Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
RESEARCH ARTICLE
Open Access
High level transient production of recombinant
antibodies and antibody fusion proteins
in HEK293 cells
Volker Jäger1, Konrad Büssow1, Andreas Wagner1, Susanne Weber2, Michael Hust2, André Frenzel2
and Thomas Schirrmann2*
Abstract
Background: The demand of monospecific high affinity binding reagents, particularly monoclonal antibodies, has
been steadily increasing over the last years. Enhanced throughput of antibody generation has been addressed by
optimizing in vitro selection using phage display which moved the major bottleneck to the production and
purification of recombinant antibodies in an end-user friendly format. Single chain (sc)Fv antibody fragments
require additional tags for detection and are not as suitable as immunoglobulins (Ig)G in many immunoassays. In
contrast, the bivalent scFv-Fc antibody format shares many properties with IgG and has a very high application
compatibility.
Results: In this study transient expression of scFv-Fc antibodies in human embryonic kidney (HEK) 293 cells was
optimized. Production levels of 10-20 mg/L scFv-Fc antibody were achieved in adherent HEK293T cells.
Employment of HEK293-6E suspension cells expressing a truncated variant of the Epstein Barr virus (EBV) nuclear
antigen (EBNA) 1 in combination with production under serum free conditions increased the volumetric yield up to
10-fold to more than 140 mg/L scFv-Fc antibody. After vector optimization and process optimization the yield of an
scFv-Fc antibody and a cytotoxic antibody-RNase fusion protein further increased 3-4-fold to more than 450 mg/L.
Finally, an entirely new mammalian expression vector was constructed for single step in frame cloning of scFv
genes from antibody phage display libraries. Transient expression of more than 20 different scFv-Fc antibodies
resulted in volumetric yields of up to 600 mg/L and 400 mg/L in average.
Conclusion: Transient production of recombinant scFv-Fc antibodies in HEK293-6E in combination with optimized
vectors and fed batch shake flasks cultivation is efficient and robust, and integrates well into a high-throughput
recombinant antibody generation pipeline.
Keywords: Recombinant Antibodies, Single Chain Fv, scFv-Fc, ImmunoRNase, Transient Mammalian Protein
Production, Serum-free medium
Background
The increasing demand of monospecific detection reagents, particularly antibodies, for all human gene products is one of the biggest challenges to investigate the
protein function and interaction [1-3]. Recently, we have
demonstrated that phage display selection with our universal human naïve antibody gene libraries HAL4/7/8 can
* Correspondence: [email protected]
2
Department of Biotechnology, Technische Universität Braunschweig,
Institute of Biochemistry, Biotechnology and Bioinformatics, Spielmannstr 7,
Braunschweig 38106, Germany
Full list of author information is available at the end of the article
dramatically enhance the throughput of antibody generation and currently results in hundreds of new antibody
clones per annum [4]. These recombinant antibodies have
affinities in the low nanomolar range in some cases even
in the subnanomolar range without any additional engineering [3]. Miniaturization and parallelization of panning
and screening has been established in microtiter plate
scale [5] and moves the bottleneck of the antibody pipeline towards the production and purification of milligram
amounts of the individual antibodies in an application
compatible recombinant format.
© 2013 Jäger et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Single chain fragment variable (scFv) consisting only of
the variable (V) regions of immunoglobulin (Ig) light (L)
and heavy (H) chain connected by a soluble and flexible
oligopeptide can be fused to the IgG Fc moiety. The
resulting scFv-Fc format has properties of IgGs like
bivalency, tag-free detection with standard secondary antibody conjugates and Fc-mediated effector functions [6,7].
We and others have previously shown that scFv-Fc antibodies can be used in all immunoassays including ELISA
[8], immunoblot [9], antigen and antibody microarray [3],
immunohistochemistry [10], immunofluorescence [7,11],
quartz crystal microbalance immunosensors [12,13], surface plasmon resonance [8,14], and flow cytometry
[8,15,16]. Moreover, scFv-Fc antibodies have been successfully used to neutralize viral, bacterial and fungal pathogens in vitro and in vivo [17-19] which suggests potential
use in therapy.
Although production of scFv-Fc antibodies in yeast
Pichia pastoris already achieved production levels of
10–30 mg/L [20], and recent developments with glycoengineered yeasts [21] for commercial antibody production
[22] and high throughput screening [23] are promising,
mammalian cell antibody expression systems are still being
advanced regarding production yields and product quality
[24]. Today, almost all therapeutic antibodies are produced
in mammalian cells because their advanced folding, secretion and post-translational apparatus is best suited to produce antibodies indistinguishable from those produced in
the human body with least concerns for immunogenic
modifications. Industrial IgG production levels in Chinese
hamster ovary (CHO) cells reached about 5 g/L some years
ago [25] whereas today titers often exceed 12 g/L as result
of a steadily ongoing progress of mammalian cell culture
technology which is mainly due to improved high producer
cell lines, optimized serum-free production media as well
as optimized and prolonged production processes at very
high cell densities. The highest IgG titer has been reported
in the human embryonic retinal cell line Per.C6 (Crucell,
Leiden, The Netherlands) with 27 g/L in a perfusion bioreactor. Although the generation of high producer cell
lines has been dramatically improved and accelerated
[26,27], it is still too expensive, time-consuming and laborious for research applications, particularly if large numbers
of individual antibodies have to be produced.
Here, transient and semi-stable mammalian antibody
expression is much more suitable because it allows fast
and parallelized production without any need to generate producer cell lines [28]. Moreover, transient mammalian antibody production can be scaled up by
employing batch or fed-batch bioreactor processes to
more than 150 liter production volumes [29]. Therefore,
transient antibody production is suitable for small scale
production for antibody screening [30], but also capable
to generate even grams of antibodies [31-33].
Page 2 of 20
Particularly, human embryonic kidney (HEK) 293 cell
lines have been used for transient protein expression because they can be very efficiently transfected with plasmid DNA. This cell line was generated from embryonal
tissue by transformation with sheared adenovirus 5
DNA. Some derivatives were further transformed either
with the simian virus 40 (SV40) large T antigen, termed
HEK293T, or with the Epstein Barr virus (EBV) nuclear
antigen 1 (EBNA1), termed HEK293E, in order to mediate semi-stable episomal propagation of vectors
containing an origin of replication (ori) of SV40 or EBV,
respectively. Transient transfection of plasmid DNA in
HEK293 cells can be performed by calcium phosphate
transfection [34], cationic liposomes and polymers. The
cationic polymer polyethyleneimine (PEI) combines
highly efficient plasmid delivery with low cytotoxicity
and simple handling [35-37]. PEI can be used in serumcontaining as well as serum-free media [38] and is compatible with upscaling of the production volume [39-42].
The large number of protonable amino groups of PEI results in its cationic charge, which is responsible for DNA
complexation [35,36]. These protonable amino groups
also provide high pH buffering capacity which seems to
protect the DNA from degradation in endosomal compartments and to mediate an early escape of DNA/PEI
complexes from lysosomes probably by the so-called
proton sponge effect [43]. According to the proton
sponge hypothesis, the buffering capacity of PEI leads to
osmotic swelling and rupture of endosomes, resulting in
the release of the complexed DNA into the cytoplasm.
In this study, we optimized mammalian expression
vectors for single step in frame cloning of scFv fragments from our universal antibody phage display libraries HAL4/7/8 [4] into the IgG-like scFv-Fc format. In
combination with transient production using the
HEK293-6E cell line, a variant genetically modified with
a truncated version of EBNA1 which grows in suspension and chemically defined serum-free medium [44,45],
we achieved volumetric yields of more than 0.5 g/L for
recombinant antibodies as well as for an immunoRNase
fusion protein by simple shake flask cultivation. We
demonstrate that transient scFv-Fc production in
HEK293-6E is robust, versatile and highly efficient and
can overcome the bottleneck of antibody production in
a high throughput in vitro antibody selection pipeline.
Results
Construction and test of vectors for transient scFv-Fc and
immunoRNase expression in HEK293 cells
Transient expression in HEK293 cell lines was initially
tested with two previously described pCMV vectors encoding either the CD30 specific scFv-Fc-4E3 antibody or
the corresponding immunoRNase (Figure 1A), respectively [11]. We reproducibly achieved volumetric yields of
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 3 of 20
A
scFv-Fc-RNase
C
scFv
bla gene
Fc
CH2
CMV
promoter
bGH pA
CH3
Stop
ATG
Modified Kozak
pCMV-hIgG1Fc-XP
I
ATG
Modified Kozak
pMB1 ori
L
H
CH2
SV40 promoter/
origin
CH3
F1 ori
Stop
pCMV-neo--scFv-hIgG1Fc
pCMV-oriP1-scFv-hIgG1Fc
VL
NcoI
NotI
Fc
SP
I
E2
VL
bGH pA
E1
L
Optimized
stop
scFv
CMV
promoter
bla gene
E2
E1
bla gene
ATG
Kozak
VH
Optimized
hinge
neo
VH
Fc
bGH pA
CH3
pCMX2.5-hIgG1Fc-XP
E
scFv
Fc
CH2
H
pMB1 ori
D
I
Spacer
SV40 pA
neo
SP
NotI
SV40 promoter/
origin
SV40 pA
CMV
promoter
VL
NcoI
SP
E1
H
L
VH
VL
NotI
Spacer
scFv
E2
I
E2
NcoI
E1
SP
L
F1 ori
VH
CMV
promoter
bla gene
B
ATG
Modified Kozak
Spacer
H
CH2
bGH pA
CH3
Optimized
hinge
Optimized
stop
pCSE2.5-hIgG1Fc-XP
EBV origin
pMB1 ori
pMB1 ori
EBV
origin
ori P
F1 ori
scFv-Fc
SV40 origin
ori P
only in
pCMV-oriP1scFv-hIgG1Fc
Figure 1 Development of vectors for transient antibody expression in HEK293 cell lines. A) Illustration of the structure of scFv-Fc and
scFv-Fc-RNase constructs. B) The vector pCMV-hIgG1Fc-XP based on pCMV/myc/ER backbone which contains a neomycin phosphotransferase
(neo) selection marker under control of a simian virus (SV) 40 promoter (with SV40 ori) and poly A (pA) signal. The antibody gene expression
cassette consists of a modified untranslated 5’ region and ribosomal binding site (modified KOZAK sequence), mouse heavy Ig chain leader
comprising two exons (E1 and 2, light blue) interrupted by one intron (I) for stabilized expression, followed by a spacer sequence (grey) flanked
unique NcoI/NotI sites for single step in frame cloning and fusion with following constant hinge, CH2 and CH3 regions of human IgG1 Fc gene
fragment (dark blue). The gene expression cassette is driven by a CMV promoter and terminated by bovine growth hormone (bGH) poly
adenylation signal (pA). C) pCMX2.5-hIgG1Fc-XP has a modified hinge without genetic upper hinge of the IgG1 heavy chain and optimized
translation termination sequence at the 3’ of the Fc gene fragment. D) pCMV-neo- and pCMV-oriP1 test vectors containing CD30 specific
scFv-Fc or scFv-Fc-RNase were generated from the parental pCMV vectors [11] by deleting the complete neo expression cassette or replacing it
by a short EBV oriP variant. E) The expression vector pCSE2.5-hIgG1Fc-XP was newly generated and comprises all advantages for transient
expression of the previous vectors including the optimized hinge and stop sequences of pCMX2.5, no selection marker expression cassette,
minimal SV40 ori and short EBV oriP for episomal replication in SV40-large T antigen or EBNA1 positive mammalian expression cell lines.
14 mg/L for the scFv-Fc and 7 mg/L immunoRNase
(Figure 2). Transient transfection was performed with
PEI which allowed very high transfection efficiencies of
more than 70% in HEK293T cells, as previously described
[38]. Transfection with PEI resulted in higher antibody
yields than several commercial polymers- or liposomebased transfection reagents, which was attributed to PEI’s
lower cytotoxicity (data not shown). The optimal transfection conditions were previously determined with 1 μg
DNA to 8 μg PEI per mL cell culture [38]. Additional
scFv-Fc antibodies and immunoRNase proteins were also
tested in the same vector system and reached 4 to 6 mg/L
in HEK293T cells (Figure 2).
In order to facilitate cloning of single chain antibody
fragments from phage display antibody gene libraries
such as HAL4/7/8 [4] into the IgG-like scFv-Fc format,
the new vector pCMV-hIgG1Fc-XP (Figure 1B) was generated from the pCMV/myc/ER-derived vector pCMV-
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 4 of 20
Figure 2 Transient expression of different scFv-Fc and scFv-Fc-RNases in HEK293T. Different scFv-Fc antibodies and the corresponding
immunoRNase fusion proteins were cloned into the pCMV vector and transiently expressed in HEK293T cells. Volumetric yields were measured
with a human IgG/Fc capture ELISA. Mean values and standard deviations were determined by at least 3 independent experiments.
HC by modifying the 5′ untranslated region, the ribosomal binding site [46] and by introducing a Nco/NotI
compatible multiple cloning site. The original NcoI site
at the start codon was removed by transversion from
cytidine to adenine at position −2 in order to preserve
high translation initiation efficiency because it is described as second abundant nucleotide at this position in
vertebrate mRNAs [47]. The residual secretory mouse Ig
heavy chain signal peptide consisting of two exons and
one intron for stabilized expression was retained. Following, a new spacer sequence was introduced which is
flanked by the new unique NcoI/NotI cloning sites
allowing single step in frame cloning of scFv antibody
fragments from the HAL4, 7 and 8 phage display libraries in fusion with the gene fragments encoding
aminoterminal mouse Ig heavy chain signal peptide and
carboxyterminal hIgG1-Fc moiety. All vectors containing
this NcoI/NotI cloning cassette are designated with
“XP”. The pCMV-hIgG1Fc-XP vectors were further optimized at the 3′ stop translation sequences of the Fc gene
fragment (Table 1) and tested by transient expression in
adherent HEK293T cells. The sequence of the original
BamHI/XbaI cloning site and the upstream opal stop
codon was prone to mutations in the stop codon to
TTA. Therefore, we eliminated the BamHI site in direct
vicinity of the stop codon and tested the opal stop codon
Table 1 pCMV-hIgG1Fc-XP vectors with modified 3′ translation termination sequences
pCMV
5→3’
Features
-
TCTCCCTGTCCCCGGGTAAATGAGGATCCTCTAGAAGCT
opala, BamHI, XbaI
2.1
TCTCCCTGTCCCCGGGTAAATGAGTCTAGAAGCT
opal + 1 nt, XbaI
2.2
TCTCCCTGTCCCCGGGTAAATGAGTGCGTCTAGAAGCT
opal + 5 nts, XbaI
2.3
TCTCCCTGTCCCCGGGTAAATGAGTGCGACGGCCGGCTCTAGAAGCT
opal + 14 nts, XbaI
2.4
TCTCCCTGTCCCCGGGTAAATGAATCTAGAAGCT
opal + dA, XbaI
2.5
TCTCCCTGTCCCCGGGTAAATAAATCTAGAAGCT
ochre + dA, XbaI
3.2
TCTCCCTGTCCCCGGGATGAGTGCGTCTAGAAGCT
ΔK330b, opal + 5 nts, XbaI
4.2
TCTCCCTGTCCCCGGGATCCTGAGTGCGTCTAGAAGCT
K330Sb, c, BamHI, opal + 5 nts, XbaI
Abreviations: nt, desoxynucleotide(s) derived from human IgG gene sequences; dA, desoxy-adenine.
underlined … stop codon, bold letter… desoxynucleotide downstream from the stop codon also termed as “forth nucleotide of the stop codon” is important
efficient for translation termination.
a
Frequent mutations of opal (TGA) to TTA were observed which might be due to the immediately following BamHI and XbaI sites.
b
Numbering according to Uniprot: P01857.
c
Additional BamHI fusion site.
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 5 of 20
(TGA) with one, five or 14 downstream nucleotides
from the human genomic Ig sequence (pCMV2.1hIgG1Fc-XP, pCMV2.2-hIgG1Fc-XP, pCMV2.3-hIgG1FcXP) as well as with one adenine (pCMV2.4-hIgG1Fc-XP)
followed by the XbaI site (Table 1). The adenine as
fourth nucleotide is the most frequent in translation termination signals of eukaryotic genes and provides very
low read through of the ribosome [48,49]. We also tested
the ochre stop codon (TAA) followed by one adenine
(pCMV2.5-hIgG1Fc-XP). Moreover, we constructed two
vectors with an Fc gene fragment whose 3′ terminal lysine codon was either deleted (pCMV3.2-hIgG1Fc-XP)
or replaced by a BamHI site reconstituting codons for
the two amino acids glycine and serine (pCMV4.2hIgG1Fc-XP), respectively (Table 1). The translation termination sequence of the latter two vectors matched
those from vector pCMV2.2-hIgG1Fc-XP.
Transient expression of pCMV2.1-, pCMV2.2-, pCMV2.3-,
pCMV2.4-, pCMV2.5-, pCMV3.2- and pCMV4.2-hIgG1FcXP vectors in HEK293T cells resulted in a 1.5- to 3-fold
higher average scFv-Fc antibody production level than the
original pCMV-hIgG1Fc-XP vector depending from the
expressed protein (Figure 3). The vector pCMV2.1-2.5 and
pCMV4.2 achieved with little exceptions very similar expression levels of 15–35 mg/L Fc and scFv-Fc proteins when
measured 48 h after transfection. We chose pCMV2.5hIgG1Fc-XP showing the best average results for further
Fc
scFv-Fc LA13-IIE3
vector development and eliminated the genetic upper
hinge region of hIgG1 to avoid unspecific binding of
the unpaired cysteine which normally forms the
interchain disulfide bond between light and heavy
chain in IgG1 and which is not required in scFv-Fc
antibodies. The resulting new pCMX2.5-hIgG1Fc-XP
vector (Figure 1C) achieved comparable or slightly
higher production levels for scFv-Fc antibodies in
HEK293T cells than the corresponding pCMV2.5hIgG1Fc-XP vector (data not shown).
Transient expression of standard mammalian expression
vectors in HEK293-6E cells
First transient expression studies in the HEK293-6E cell
line [41] were conducted by using mammalian expression vectors pCMV-scFv-hIgG1Fc-4E3 and pCMV-scFvhIgG1Fc-RNase-4E3 encoding a CD30 specific scFv-Fc
antibody and the corresponding immunoRNase fusion
protein [11]. Optimal DNA to PEI ratio was previously
determined with 1:2 to 1:8 and an optimal plasmid DNA
concentration of 0.5 to 1 μg/mL [38]. We used standard
transfection conditions of 1 μg plasmid DNA and 2.5 μg
PEI per mL for all further experiments and achieved
volumetric yields of 30 to 40 mg/L scFv-Fc-RNase and
70 to 80 mg/L scFv-Fc, respectively, already after 3 days
of production (Figure 4A), and 60–70 mg/L scFv-FcRNase and 120 to 140 mg/L scFv-Fc, respectively, after
scFv-Fc PhOx
Average
50
Volumetric yield [mg/L]
45
*
**
**
**
**
**
**
40
35
30
25
20
15
10
5
0
pCMV2.1 pCMV2.2 pCMV2.3 pCMV2.4 pCMV2.5 pCMV3.2 pCMV4.2
pCMV
Negative
control
Vector
Figure 3 Test of different translation termination sequences for transient expression in HEK293T cells. A number of pCMV vectors were
generated containing the opal stop codon and the following one (pCMV2.1), five (pCMV2.2), or 14 nucleotides (pCMV2.5) derived from genomic
human Ig sequence or adenine as “fourth” stop codon nucleotide (pCMV2.4). Moreover, we also tested vector constructs containing an ochre
stop codon followed by an adenine (pCMV2.5) and pCMV2.2 variants where the 3' terminal lysine codon was deleted (pCMV3.2) or replaced by a
BamHI cloning site encoding the amino acids GS instead (pCMV4.2). Transient productions were done in HEK293T cells and tested by human
IgG/Fc capture ELISA 48 h after transfection. Mean production levels and standard deviations of three productions are given. Cells transfected
with the YFP reporter gene are used as negative control for the ELISA. Statical analysis was performed by comparing each vector with the vector
pCMV using a t-test. Significance is indicated (* … p < 0.05 and ** p < 0.01). ND not determined.
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Figure 4 (See legend on next page.)
Page 6 of 20
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 7 of 20
(See figure on previous page.)
Figure 4 Test of optimized antibody expression vectors in HEK293-6E cells. Three different vectors pCMV-, pCMV-oriP1- and pCMVneo- -scFv-Fc-4E3 encoding a CD30 specific scFv-Fc antibody, and another three vectors pCMV-, pCMV-oriP1- and pCMV-neo- -scFv-Fc-RNase-4E3
encoding a CD30 specific immunoRNase, respectively, were transiently transfected into HEK293-6E cells in 50 mL scale in shake flasks. Production
of each vector and each construct were performed as triplicates. A) After 48 and 72 h, volumetric yields of scFv-Fc and scFv-Fc-RNase were tested
from production supernatants by human IgG/Fc capture ELISA. B-C) After 72 h of scFv-Fc (D, triplicate samples individually purified) and
scFv-Fc-RNase (E, triplicate samples combined prior purification) were purified by protein A affinity chromatography and volumetric yields were
calculated. Percentage recovery is calculated in comparison to the volumetric yields measured from supernatants (A). D) Several production
parameters were tested like transfection efficiency (co-transfection with an GFP expressing vector), viable cell number and viability as well as E)
concentrations of glucose, L-lactate, L-glutamine and L-glutamate.
5 days of production [38]. Although the volumetric
yields in HEK293-6E cells were about 10-fold higher
than in adherent HEK293T, the 5 days product accumulation and the higher cell densities have to be taken into
account. Transfection efficiencies measured with a fluorescent reporter protein usually varied between 40-50%
[38], but we also observed transfection efficiencies of up
to 90% which seem to depend on the number of cell
passages and the general condition of the cells.
In order to verify that the transfection of cells was completed by PEI:DNA complexes after 48 hours, an additional
experiment was performed where culture supernatant was
collected 48 hours post transfection and used in combination with fresh non-transfected cells. No additionally
transfected cells were observed in these cultures as measured by flow cytometry (data not shown).
Construction and optimization of vectors for transient
expression in HEK293-6E cells
Since the pCMV or pCMX vector backbones are not compatible to the episomal replication machinery in the
HEK293-6E cells which express a truncated version of
EBNA1, vector optimization was done by generating
two variants of both vectors, pCMV-scFv-hIgG1Fc-4E3
(6391 bp) and pCMV-scFv-hIgG1Fc-RNase-4E3 (6769 bp),
encoding a CD30 specific scFv-Fc antibody and the corresponding scFv-Fc-RNase variant. First, the complete neomycin phosphotransferase (neo) selection marker expression
cassette including its SV40 promoter/ori and poly-A signal
as well as the F1 origin from the vector backbone were eliminated resulting in plasmids pCMV-neo--scFv-Fc and -scFvFc-RNase comprising only 4338 and 4715 bp (Figure 1D),
respectively. Then, a short version of the EBV oriP was introduced into these vectors resulting in the vectors pCMVoriP1-scFv-Fc and pCMV-oriP1-scFv-Fc-RNase with a size
of 5327 and 5705 bp (Figure 1D), respectively.
The HEK293-6E expression of pCMV, pCMV-neoand pCMV-oriP1 containing scFv-Fc- and scFv-FcRNase-4E3, respectively, was done in three independent
samples in 25–50 mL scale in shake flasks. After 3 day
of production the small pCMV-neo- vector missing the
selection marker already resulted in a 2.5-fold increase
of volumetric yields for scFv-Fc and scFv-Fc-RNase, respectively, compared to the parental pCMV vectors
(Figure 4A). The pCMV-oriP1 vectors containing an
EBV oriP with shortened spacer sequence between FR and
DS element even achieved 3.5 fold higher yields for both
constructs compared to the pCMV vectors (Figure 4A).
Production supernatants were harvested and purified by
protein A affinity chromatography. The scFv-Fc-RNase
protein samples were separately purified and achieved recovery rates of about 80% (Figure 4B). In contrast, supernatants of triplicate productions of each scFv-Fc antibody
expression vector were combined prior purification which
resulted in a lower recovery rate of about 50% probably
due to the lower efficacy of the 1 mL Bio-Scale Mini
UNOsphere SUPrA Cartridges (binding capacity of human
IgG1 ca. 20 mg) when applying more than 10 mg scFv-Fc
antibody (Figure 4C). Nevertheless, transient production of
scFv-Fc and scFv-Fc-RNase using the pCMV-oriP1 vector
resulted in the highest amount purified, followed by the
pCMV-neo- vector and the parental pCMV vectors. After
transfection, the concentration of viable cells increased
from 1.5×106 cells per mL to up to 4×106 cells per mL in
the following 3 days for the pCMV and pCMV-oriP1 vectors, whereas pCMV-neo- transfected cells did not exceed
2.5×106 cells per mL (Figure 4D). After 3 days of production, viability in samples was 85 to 90% (Figure 4D). Transfection efficiencies tested by co-transfection with a
fluorescent reporter plasmid were 75 to 90% (Figure 4E).
In addition, several metabolic parameters were tested in
this experiment. The initial glucose concentration of about
3 g/L was almost entirely consumed after 3 days whereas
L-lactate concentrations remained at an almost constant
level throughout the 3 days production period (Figure 4E).
L-glutamine (initially at 7.5 mM) and L-glutamate concentrations were tested after 72 h and found at about 1.5 and
2 mM, respectively (Figure 4E). This early depletion of important nutrients of the cellular energy metabolism combined with the fact that episomal plasmid replication will
enable cells for a sustained recombinant protein production suggests that the original protocol provided from BRI
has a potential for further optimization.
Optimization of scFv-Fc and immunoRNase production
in HEK293-6E cells
In the original protocol and in the initial experiments we
have seen that best yields were obtained after at least
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
5 days production. Therefore, the production after transfection with pCMV, pCMV-neo- and pCMV-oriP1 with
scFv-Fc- and scFv-Fc-RNase-4E3 was prolonged (Figure 5).
For this purpose, cultures were fed 48 h post transfection
with 0.5% trypton TN1 plus one additional volume of
fresh F17 medium. Compared to the 3 days protocol maximum yields increased more than 100% after 6 days for
most vector constructs whereas a further extension of production beyond did not result in any significant additional
improvement. Highest production levels were achieved
after 6–7 days for the vector pCMV-oriP1 with more than
450 mg/L for both scFv-Fc-4E3 (Figure 5A) and scFv-FcRNase-4E3 (Figure 5B). For comparison, scFv-Fc-4E3 and
the MUC1-specific scFv-Fc-HT186-D11 [8] expressed
by the original vector pCMV yield in about 120 mg/L
(Figure 5B).
Interestingly, YFP expressed by a pCMV-like vector in
a parallel sample, was only slightly released into the
supernatant after 6 days which can be seen as slight
27 kDa protein band in SDS-PAGE (Figure 5C). However, YFP release into the supernatant increased to 150
to more than 350 mg/L after 7 to 8 days, respectively,
which is associated with the increasing cell lysis and
release of cytoplasmic proteins.
In addition to the standard fed of one volume medium
and trypton TN1 48 h after transfection, additional supplementation with glucose alone and in combination
with the histone deacetylase inhibitor VPA were tested
(Figure 6). The fed of glucose together with VPA significantly increased the scFv-Fc-RNase production in two of
three independent samples, whereas glucose alone did
not result in any higher yield in comparison to the
standard medium TN1 supplementation (Figure 6A, B).
Interestingly, VPA treatment led to lower cell growth
with maximum cell concentration of 4×106 cells/mL
6 days after transfection, whereas the other two groups
reached 6-8×106 cells/mL (Figure 6C). From day 6 to 7
of production, the cell concentration began slightly to
decrease in all groups associated with a reduced viability
<70% except in the VPA treated group where the viability still remained >90% (Figure 6D). After 3 to 4 days of
production, the ratio of GFP co-transfected cell decreased in all groups indicating that cells stressed by
transgene expression were more prone to cell death or
lysis than non-transfected cells (Figure 6D). A more detailed look into the metabolic parameters (Figure 6E, F)
revealed that the standard medium plus TN1 fed
prevented complete glucose consumption only for 5 days
and lactate was also consumed one day later (Figure 6E).
Nevertheless, the product yield still doubled from day 5
to 8. Additional glucose supplementation delayed
complete glucose metabolization within the tested 7 days
production period without increasing the protein production (Figure 6F). In contrast to glucose, L-glutamine
Page 8 of 20
was not completely metabolized during 7 days of production in all groups. Additional VPA treatment led to
clearly lower glucose and L-glutamine consumption of
all groups.
Generation of an optimized library compatible scFv-Fc
vector for HEK293-6E expression
In order to obtain an optimal transient mammalian
expression vector that comprises all advantages of the
previous vectors, a new vector was constructed. First, a
minimal backbone of the vector pCMX2.5-hIgG1Fc-XP
was generated. Then, the entire antibody gene expression cassette of pCMX2.5-hIgG1Fc-XP comprising CMV
promoter and enhancer, the 5′untranslated region including the modified ribosomal binding site, the gene sequences for the murine immunoglobuline signal peptide
including the intron, the spacer containing library compatible multiple cloning sites and the hIgG1 Fc moiety
were introduced. In a third step, the bGH poly A signal
with reduced adjacent spacer sequences, a minimal
SV40 ori [50] and a shortened variant of the EBV oriP
were introduced. The gene expression cassettes of the
CD30 specific scFv-Fc-4E3 antibody and the scFv-FcRNase-4E3 immunoRNase were introduced in this
vector in order to obtain the plasmids pCSE-scFvhIgG1Fc-4E3 and pCSE-scFv-hIgG1Fc-RNase-4E3, respectively. Transient production in HEK293-6E was
tested by standard supplementation with one volume
medium and 0.5% TN1 hydrolysate and achieved volumetric yields of 300 to 400 mg/L of scFv-Fc-RNase and
scFv-Fc, respectively, which were similar or even slightly
higher than those obtained by the corresponding
pCMV-oriP1 test vectors transfected in parallel samples
(Figure 7A). Highest production levels were obtained
after 6 days when the viability of the cells was still >90%
(Figure 7C). Transfection rates were identical for all
these vectors (Figure 7B).
In order to obtain a universal library compatible vector
for the expression of scFv-Fc antibodies, the complete
transgene expression cassette from pCMX2.5-hIgG1FcXP was inserted into the pCSE vector backbone
resulting in the vector pCSE2.5-hIgG1Fc-XP (Figure 1E).
Test of the pCSE2.5-hIgG1Fc-XP vector platform for
expressing various scFv-Fc antibodies
More than 20 scFv gene fragments obtained by phage
display from the HAL7/8 libraries were subcloned in
frame into the Fc expression gene cassette of the vector
pCSE2.5-hIgG1Fc-XP in order to produce IgG-like scFvhIgG1Fc antibodies. Transient production using the
standard transfection and production conditions resulted
in volumetric yields of 100 to 600 mg/L scFv-Fc antibodies with an average of about 400 mg/L (Figure 8).
The production levels of hIgG1-Fc without scFv even
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Figure 5 (See legend on next page.)
Page 9 of 20
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 10 of 20
(See figure on previous page.)
Figure 5 Prolonged transient protein production in HEK293-6E cells. A) and B) The vectors pCMV-oriP1, pCMV-neo- and pCMV containing
CD30 specific scFv-Fc- and scFv-Fc-RNase-4E3 constructs, respectively, were transiently transfected into HEK293-6E cells in 25 mL scale in shake
flasks. In addition, pCMV2.2-scFv-Fc with the MUC1-specific affinity maturated scFv HT186-D11 [8] and a plasmid pCS2-venus expressing the
yellow fluorescent reporter protein (YFP, venus) were transfected in parallel attempts. Production samples were taken 3, 6, 7, and 8 days after
transfection. A) Volumetric yields of scFv-Fc and scFv-Fc-RNase were tested by gel densitometry. C) SDS-PAGE was performed with 5 μL of each
supernatant under reducing conditions. Gels were stained with coomassie (G250). Purified scFv-Fc- and scFv-Fc-RNase-4E3 were used as standards
for gel densitometry. YFP was compared to the scFv-Fc standard.
reached up to 900 mg/L. SDS-PAGE analyses of production supernatants revealed major protein bands corresponding to scFv-Fc antibodies with a molar mass of 55
to 60 kDa (Fc without scFv at 27 kDa) under reducing
conditions. There was only a small amount of additional
proteins released by the HEK293-6E (Figure 9A). Protein
A affinity purification and desalting were sufficient to
obtain all scFv-Fc antibodies in very high purify of >98%
(Figure 9B).
Storage of purified scFv-Fc antibodies for more than
6 months at 4°C in PBS without protective protein did not
reveal any significant proteolytic degradation (Figure 10).
Discussion
We previously described an efficient platform for the
in vitro generation of recombinant human antibodies by
phage display from the universal libraries HAL4/7/8
[4,51] which can address the required throughput even
for proteome projects [1,3]. However, the production of
milligram amounts of different antibodies for the enduser in an application compatible recombinant format
created a new bottleneck in the overall-process. IgG-like
bivalent scFv-Fc antibodies perform well in most immunoassays, but production of more complex antibody formats
like scFv-Fc requires eukaryotic or even mammalian
expression systems to achieve high yields of functional
protein and to reduce the efforts during downstream
processing [24].
In this study we optimized transient antibody expression in HEK293 cell lines in order to obtain high yields
in combination with simple and robust protocols for
production and downstream processing. We started with
pCMV standard vectors and transient expression in
HEK293T cells which already achieved more than
20 mg/L volumetric yields per day. However, laborious
handling of these adherent cells, limited scalability, and
daily medium exchange prevents this production system
from being suitable for production of more than a few
antibodies in parallel. In contrast, suspension cell lines
allow easier handling, higher cell densities, and better
scalability which would facilitate simultaneous production of dozens of antibodies as well as up-scaling to liter
volumes in shake flasks or bioreactors.
The HEK293-6E cell line was developed to improve transient production of recombinant proteins [41,42,44,45,52]
and used in this study. The first tests performed with the
pCMV expression vector without oriP already resulted in
volumetric yields of more than 140 mg/L scFv-Fc and
70 mg/L scFv-Fc-RNase after 5 days production which is
about 10-fold higher than the expression levels in
HEK293T. However, specific cellular production levels of
HEK293T and HEK293-6E cells were in a similar range of
5–20 pg per cell per day. Therefore, the 5–10 fold higher
production titers in HEK293-6E were mainly due to higher
cell densities in suspension culture and the product accumulation over several days. In order to optimize antibody
production in the HEK293-6E cell line, we generated test
vectors without selection marker and with a short variant
of EBV oriP, respectively. The elimination of the selection
marker already resulted in a 2 to 2.5-higher production
compared to the original pCMV vector in HEK293-6E
which is probably due to the small size of the vector, i.e. the
higher number of plasmid molecules per transfection, and
the absence of any co-expressed selection marker protein.
Co-expression of a fluorescent reporter protein resulted in
an approximately 10-20% lower antibody yield (data not
shown). The introduction of the short oriP variant into the
expression vector pCMV-neo- led to an additional increase
of antibody production levels. The increased stability of
plasmids containing the EBV oriP by episomal replication
and more efficient distribution to the daughter cells during
cell division in EBNA1+ cell lines is important for
prolonged production but it cannot entirely explain the
higher expression levels already after 72 hours which
reached more than 250 mg/L for an CD30 specific scFv-Fc
antibody and more than 100 mg/L for the corresponding
scFv-Fc-RNase fusion protein. It was implicated that
EBNA1 binding to oriP also increases the nuclear plasmid
import and enhances the activity of strong constitutive promoters like the immediate early CMV promoter [53].
Moreover, binding of EBNA1 to the family of repeats (FR)
domain of oriP activates the transcription of downstream
EBV genes as well as transgenes [54,55].
The measurement of metabolic parameters revealed
that glucose was almost entirely consumed after 3 days
of production. In this case cells start to subsequently
remetabolize L-lactate whereas lactate levels remained at
a relatively low and constant level if glucose is fed in
time. In contrast, L-glutamine was still not completely
depleted. However, this is mainly due to the fact that
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 11 of 20
Figure 6 Fed-batch optimization of transient scFv-Fc-RNase protein production in HEK293-6E cells. The vector pCMV-oriP1-scFv-Fc-RNase4E3 was transiently transfected into HEK293-6E cells in 25 mL scale in shake flasks. One volume of fresh medium and 0.5% (w/v) tryptone TN1
was fed 48 h after transfection to all groups (group A, B, C). After 3 days two groups (group B, C) were fed with glucose and one group with
additional 3.75 mM valproic acid (VPA, only group C). A) Volumetric yields of scFv-Fc-RNase protein were measured from supernatant samples
taken from day 2 to 8 after transfection. B) ScFv-Fc-RNase was purified by protein A affinity chromatography from production supernatants
harvested 8 days after transfection. The yield was calculated from total amount of purified protein and the final production volume. Protein
recovery was determined as ratio of scFv-Fc-RNase after and before purification. C) Cell number, D) viability and and transfection efficiency
(GFP co-transfection), E) Glucose and lactate as well as F) L-glutamine and glutamate were measured during the production until day 7. All
groups were performed in independent triplicate samples. Mean values as well as standard deviations are given.
our media were already supplemented with 7.5 mM of
L-glutamine instead of the 4 mM of the original protocol. According to these results, we optimized and
prolonged the fed batch shake flask cultivation by a
doubling of culture volume by supplementation of
medium, glucose and VPA in addition to our standard
fed with casein hydrolysate TN1. Production titers improved almost twice for both, scFv-Fc and scFv-FcRNase constructs, after supplementation with one volume fresh medium in combination with TN1 48 h after
transfection and a prolongation of the production to
7–8 days. Additional supplementation of glucose alone,
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Figure 7 Comparison of the optimized expression vectors for
transient production in HEK293-6E cells. Two pCMV-oriP1 and
pCSE vectors expressing the CD30 specific antibody scFv-Fc-4E3 and
the corresponding immunoRNase, respectively, as well as the
pCSE2.5-hIgG1-XP vector that expresses only the hIgG1-Fc fragment
were transiently transfected into HEK293-6E cells in 25 mL scale and
shake flasks. After 48 h one volume fresh medium and 0.5%
tryptone TN1 was added. After 5 days additional 0.5% TN1 was fed.
A) Volumetric yields were determined by gel densitometry from
supernatants. B) Transfection efficiency was measured by cotransfection with YFP reporter plasmid (1/20 of the total plasmid
DNA) using flow cytometry. C) Viability of the cells was also
measured by flow cytometry with PI staining.
performed 3 days after transfection, did result in just a
small increase of the yield suggesting that the lack of
glucose is not immediately causing detrimental effects
Page 12 of 20
on recombinant protein production as the metabolism of
the cells is able to compensate this by using other components (e.g. L-lactate and L-glutamine). However, glucose
supplementation maintained cell viability for at least one
more day at a high level, thus minimizing the burden of
contaminating, passively released intracellular proteins in
the supernatant. In contrast, the combined addition of
VPA and glucose 3 days after transfection increased the
scFv-Fc-RNase production levels about 20 to 25%. VPA is
known to induce total cellular protein expression like
other histone deacetylase inhibitors, e.g. sodium butyrate
[32]. Shake flask experiments supplemented with VPA/
glucose had the highest glucose, L-lactate and L-glutamine
concentrations remaining after 4–7 days of transient production. This appears to be comprehensible since further
cell proliferation is substantially diminished after supplementation with VPA. However, addition of VPA seems to
depend on other parameters because not all productions
achieved higher antibody yields compared to the standard
fed batches. Since VPA increases general protein expression [56,57], it may also alter cell properties, inducing
apoptosis and potentially influence product quality. Therefore, the addition of VPA was not included into the standard protocol in the further study.
In order to combine all advantages of the previous
vectors including compatibility to single step in frame
subcloning of single chain antibody fragments from
phage display libraries into the scFv-Fc antibody format,
an entirely new transient mammalian expression vector
was generated. The vector backbone was optimized for
small size, compatibility to episomal replication in SV40
large T antigen or EBNA1 expressing mammalian cell
lines, i.e. HEK293T and HEK293-6E, without any
eukaryotic selection marker and high copy E. coli plasmid ori for efficient plasmid DNA preparation. Transient
expression in HEK293-6E cells using these optimized
pCSE vectors containing the scFv-Fc and scFv-Fc-RNase
expression cassettes resulted in similar or better yields
than the corresponding pCMV-oriP1 test vectors which
achieved the highest production yields compared to all
previous vectors. Moreover, reduced plasmid propagation in E. coli observed for the pCMV-neo- and pCMVoriP1 test vectors was overcome by employment of
appropriate spacer sequences which separated the E. coli
pMB1 ori from other DNA structure elements like the
highly repetitive FR element of EBV oriP1 or the antibody gene expression cassette. Finally, an Fc expression
cassette containing a NcoI/NotI in frame cloning cassette was introduced which allows single step cloning of
scFv antibody gene fragments from phage display libraries like HAL4/7/8 into the scFv-Fc format. More than 20
different scFv antibody gene fragments were subcloned
into the vector pCSE2.5-hIgG1Fc-XP and achieved
average volumetric yields of 400 mg/L by transient
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 13 of 20
1000
Volumetric yield [mg/L]
900
800
700
600
500
400
300
200
100
0
scFv-Fc antibodies
Figure 8 Expression of 20 different scFv-Fc antibodies from the HAL phage display antibody generation pipeline. A total of 20 different
scFv antibody gene fragment isolated by phage display from the naïve antibody gene libraries HAL7/8 were subcloned into the vector
pCSE2.5-hIgG1Fc-XP. The scFv-Fc antibodies were expressed after transient transfection in HEK293-6E cells in 25 mL scale and shake flasks. After
48 h one volume of fresh medium and 0.5% tryptone TN1 was supplemented. After 5 to 6 days supernatants were harvested and analyzed by
human IgG/Fc capture ELISA. Standard deviations were calculated from a minimum of triplicate ELISA samples.
production in HEK293-6E. Some scFv-Fc antibodies
even exceeded production levels of 600 mg/L which is
more than 4-5-fold higher than transient production
levels of camelid heavy chain and single domain antibodies Fc proteins of 20 to 136 mg/L using the vector
pTT5 in HEK293-6E cells [45]. Crude production supernatants contained more than 80% recombinant scFv-Fc
antibody which facilitated protein A affinity purification.
Almost all scFv-Fc antibodies were stable for more than
half a year storage at 4°C without any protective agent.
These scFv-Fc antibodies have been used successfully for
many different immunoassays including ELISA, immunoblot and flow cytometry.
Improved production media and fed batch supplementation as well as controlled bioreactor processes may further increase cell densities and prolong production time
which can further enhance production levels. Backliwal
and colleagues [32] combined optimized PEI-based
transfection at high cell densitities with the coexpression of cell cycle regulators p18 and p21, acidic
fibroblast growth factor, VPA supplementation, consequent maintenance at high cell densities of 4x106 cells/
mL and upscaling to 2 L and achieved production levels
of more than 1 g IgG in two weeks after transfection.
However, individual optimization is not suitable for
high-throughput production of non-characterized antibodies which requires a simple, robust and efficient
protocol as we have shown in this study.
Conclusion
Taken together, transient expression in HEK293-6E
combined with optimized expression vectors and fed
batch processes provides robust and versatile production
of up to 600 mg/L recombinant IgG-like scFv-Fc antibodies. This expression system has been proven to be
scalable from milliliter to liter volumes already in shake
flasks which can address the production bottleneck of
high throughput in vitro antibody generation pipelines.
Moreover, efficient secretory production of more complex IgG-like scFv-Fc antibodies facilitates downstream
processing and increases the compatibility to standard
immunoassays and other applications compared to small
recombinant antibody fragments. Concluding, efficient
transient production of scFv-Fc antibodies and derivative
fusion proteins in HEK293-6E provides the bridge from
high throughput in vitro antibody generation to application which reduces efforts to obtain recombinant antibodies as highly specific detection reagents to all human
proteins and protein variants in a proteome scale as well
as to accelerate processes in therapeutic antibody development pipelines.
Methods
Cell culture
The adherently growing human embryonic kidney
(HEK) cell line HEK293T/17 (HEK293T) was obtained
from American type culture collection (ATCC, LGC
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 14 of 20
Figure 9 Production supernatants and protein A purified samples of 20 different scFv-Fc antibodies. A) Crude supernatant (10 μL or 5 μL)
from 5 to 6 days production sample were analyzed by SDS-PAGE under reducing conditions and coomassie (R250) staining. B) Samples of 1 μg
scFv-Fc antibody were also analyzed after protein A affinity purification.
Standards GmbH, Wesel, Germany: ATCC-No. CRL11268) and cultured in Dulbecco’s modified Eagle’s
medium (DMEM, high glucose (4.5 g/L) with 2 mM Lglutamine) supplemented with 8% (v/v) heat inactivated
fetal calf serum (FCS) and 1% (v/v) of a 10.000 U/mL
penicillin and 10 mg/mL streptomycin stock solution
(all products from PAA, Pasching, Austria) at 37°C, 5%
CO2 and 95% humidity.
The HEK293-6E cell line was licensed from National
Research Council (NRC), Biotechnological Research Institute (BRI), Montreal, Canada [41]. Cells were cultured
according to the supplier’s description in chemically
defined F17 medium (Invitrogen, Life Technologies,
Darmstadt, Germany) supplemented with 1 g/L pluronic
F68 (Applichem, Darmstadt, Germany), 4 mM L-glutamine
(PAA) and 25 mg/L G418 (PAA). HEK293-6E cells were
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 15 of 20
Figure 10 Stability of the scFv-Fc antibodies produced in HEK293-6E. A total of 1 μg of 24 different protein A purified scFv-Fc antibodies
(scFv PhOx-Yol [15], HuM195 [16] and HT186-D11 [8] are not from the HAL antibody gene libraries) were analyzed after 6 months of storage in
PBS without any protective protein or protease inhibitor. The concentration of the scFv-Fc was calculated immediately after protein A purification.
cultivated in 125 mL to 1 L polycarbonate shake flasks
(Corning, Amsterdam, The Netherlands) in a Minitron™
CO2 orbital shaker with 25 mm orbital (Infors,
Bottmingen, Switzerland) at 37°C, 5% CO2 atmosphere
and 110 rounds per minute (rpm) without exceeding
2×106 cells/mL during maintenance. Small cultures were
performed in 24 to 6 well multiwell plates using a linear
shaker (Incutec K15-500) placed in a CO2 incubator with
humidified atmosphere at 150 rpm.
Construction of pCMV and pCMX plasmid vectors
The vector pCMV/myc/ER (Invitrogen) was used to construct the CD30 specific scFv-hIgG1Fc antibody and
immunoRNase scFv-Fc-RNase as described previously
[11]. The pCMV-HC (kindly provided by Dr. Thomas
Jostock, now at Novartis) was originally generated by replacing the myc-tag and ER retention signal in pCMV/
myc/ER by the Fc gene fragment encoding hinge, CH2
and CH3 domains of human IgG1 using NotI and XbaI
cloning sites. The plasmid pCMV-HC was further modified to move the NcoI restriction site downstream to the
end of the leader encoding the secretory signal peptide.
Therefore, the KOZAK sequence [46] had to be modified
from GCCACCATGG to GCCAACATGG without leaving the minimal consensus sequence ANNATGG. At the
same time we further included the cloning sites PstI,
PspOMI, BglII and NotI embedded into a short spacer sequence encoding nine amino acids of IGHV4 [58] and the
five amino acid linker RSAAA. The leader sequence and
new multiple cloning site was amplified from pCMV-HC
with the desoxyoligonucleotides TS_pCMVFc_Leader_f1
and TS_pCMVFc_NheI_r1 (Table 2) and than subcloned
into the PmlI and NheI of the same vector. The resulting
plasmid pCMV-hIgG1Fc-XP was used for cloning the scFv
gene fragments PhOxYol [15] and IIB6 [8] into the NcoI/
NotI cloning site (pCMV-scFv-hIgG1Fc-PhOxYol and IIB6). The corresponding immunoRNases were generated
by cloning the gene fragment encoding a partial sequence
the hIgG1-Fc fused with the RNase 1 from pCMV-scFv
-hIgG1Fc-RNase-4E3 into these two vectors (pCMV-scFvhIgG1Fc-RNase-PhOxYol and -IIB6). The vector pCMVhIgG1Fc-XP was further optimized at the 5′ sequence of
the Fc gene by replacing its SacII-XbaI fragment with
PCR amplificates using the desoxyoligonucleotide forward primer TS_hIgG1CH2_SacII_f and the reverse
primers TS_pCMV2.1_r, TS_pCMV2.2_r, TS_pCMV2.3_r,
TS_pCMV2.4_r, TS_pCMV2.5_r, TS_pCMV3.2_r, and
TS_pCMV4.2_r (Table 2). The resulting variants had different stop codons (and downstream nucleotides sequences), deletion of the 5′-terminal lysine codon
(ΔK330), or the introduction of a BamHI fusion site replacing the carboxyterminal lysine by a serine codon
(K330S) and were referred to as pCMVx.y-hIgG1Fc-XP
(with x and y according to Table 2).
The pCMV vector family was further modified to eliminate the codons for the genetic upper hinge region (encoding the amino acids PKSC) which functionally belong
to the CH1 including the cysteine involved in forming
the interchain disulfide bond with the light chain in the
Fab fragments. The modified Fc gene fragment was amplified from vector pCMV2.5-hIgG1Fc-XP with the
primers MHdCpCMV-NotI_f and MHCH2-SacII_r and
cloned into the NotI and SacII sites the same vector replacing the original Fc. The resulting vector was designated as pCMX2.5-hIgG1Fc-XP, respectively.
Construction of test expression vectors compatible
to expression in HEK293-6E cells
In order to optimize plasmids for the transient production in HEK293-6E cells two new test vector variants
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 16 of 20
Table 2 Oligonucleotide primers used in this study
Primer
TS_pCMVFc_Leader_f1
5’→3’
CTGGCACGTGGAAATTAATTAAACGCCGCCAACATGGGATGGAGCTGT
REN
PmlI
TS_pCMVFc_NheI_r1
AGATGCTAGCGGCCGCAGATCTGGGCCCGGATTCCTGCAGCTGGACCTGTGCCATGGAGTGCGCGCCTGTGGAGAGA
NheI, NcoI
TS_hIgG1CH2_SacII_f
ACGGCGTGGAGGTGCATAATGCCAAGAC
TS_pCMV2.1_r
AGCTTCTAGACTCATTTACCCGGGGACAGGGAGA
XbaI
TS_pCMV2.2_r
AGCTTCTAGACGCACTCATTTACCCGGGGACAGGGAGA
XbaI
TS_pCMV2.3_r
AGCTTCTAGAGCCGGCCGTCGCACTCATTTACCCGGGGACAGGGAGA
XbaI
TS_pCMV2.4_r
AGCTTCTAGATTCATTTACCCGGGGACAGGGAGA
XbaI
TS_pCMV2.5_r
AGCTTCTAGATTTATTTACCCGGGGACAGGGAGA
XbaI
TS_pCMV3.2_r
AGCTTCTAGACGCACTCATCCCGGGGACAGGGAGA
XbaI
TS_pCMV4.2_r
AGCTTCTAGACGCACTCAGGATCCCGGGGACAGGGAGA
XbaI
MHdCpCMV-NotI_f
GATCTGCGGCCGCTAGCGACAAAACTCACACATGCC
NotI
MHCH2-SacII_r
CTCCTCCCGCGGCTTTGTCTTGG
SacII
TS_oriP_PmeI-PvuII_f
GACTCAGCTGTTTAAACGAACTAAACCTGACTACG
PvuII, PmeI
TS_oriP_FR_BsmBI/PciI_r
CACTCGTCTCACATGTATTCTCATGTTTGACAGC
BsmBI/PciI
TS_pUCori_MfeI_f
CAGTCAATTGGGATATCGCAGGAAAGAGCATGTGAGC
MfeI, EcoRV
TS_5’CMV_MfeI_r
CTGTCAATTGTGAATTCGATACCGATCTC
MfeI, EcoRI
TS_oriPspacer_Pci_r
CAACACATGTCAACATTAGCCCACCGTGC
PciI
TS_oriPspacer_Pml_f:
AGATCACGTGTAGGTGGGCGGGCCAAGA
PmlI
a
underlined: ribosomal binding site (modified KOZAK sequence).
Abbreviations: REN restriction endonuclease cloning site.
were generated expressing the antibody scFv-Fc-4E3 or
its immunoRNase variant scFv-Fc-RNase-4E3 [11; 4E3 is
referred to the CD30 specific scFv], respectively. The
first vector variants were obtained by deleting the
complete neomycin phosphotransferase (npt) selection
marker cassette (including SV40 promoter/ori and Poly
A signal) from the vectors pCMV-scFv-Fc-4E3 or
pCMV-scFv-RNase-4E3 [11; originally termed pCMVαCD30scFv-Fc and pCMV-αCD30scFv-RNase] using
PvuII and blunted PciI resulting in the plasmids
pCMVneo--scFv-hIgG1Fc-4E3 and pCMVneo--scFvhIgG1Fc-RNase-4E3.
The second type of vectors were generated by introducing the short oriP amplified from the vector
pTT5SH8Q2 (NRC, BRI) using the desoxyoligonucleotide primers TS_oriP_PmeI-PvuII_f and TS_
oriP_FR_BsmBI/PciI_r (Table 2) using the PciI and PvuII
cloning sites. The resulting vectors were referred to as
pCMVoriP1-scFv-hIgG1Fc-4E3 and pCMVoriP1-scFvhIgG1Fc-RNase-4E3.
Construction of pCSE expression vectors compatible with
our scFv antibody gene libraries
A minimal vector backbone consisting of beta lactamase
gene (resistance to ampicillin) and the E. coli pUC ori
was amplified from pCMX2.5-hIgG1Fc-XP using the
desoxyoligonucleotide primers TS_pUCori_MfeI_f and
TS_5′CMV_MfeI_r (Table 2). The PciI site was flanking
the pUC ori was deleted. The PCR fragment was
digested with MfeI and dephosphorylated. The complete
EBV oriP was obtained from pCEP4 (Invitrogen) by restriction with MfeI und cloned into the amplified minimal vector backbone. The resulting vectors were
referred to as pMfeI-oriP(+) or pMfeI-oriP(−) depending
of the oriP1 orientation. The spacer fragment between
dyad symmetry (DS) and family of repeats (FR) element
of oriP was modified in order to remove the restriction
sites Bsu36I, EcoRV, SpeI, MluI, NcoI, PspOMI and SpeI
to minimize its size. The spacer fragment was amplified
from pMfeI oriP(+) using the desoxyoligonucleotides
TS_oriPspacer_Pci_r and TS_oriPspacer_Pml_f (Table 2)
and digested with PciI (NcoI compatible overhang) und
PmlI (blunt end). After cloning into the Bsu36I (blunted
with Quick blunt Kit from NEB) and NcoI sites of
pMfeI-ori(+) Bsu36I, PmlI, PciI and NcoI were removed
and the resulting vector was referred to as pMfeI-oriP2(+).
Moreover, a DNA sequence comprising bovine growth
hormone (BGH) poly A signal (GenBank:AF117350.1:
75..282 bp), a 72 bp minimal SV40 ori/enhancer sequence
(identical to human herpes viruses 1 and 5; GenBank:
FJ593289.1: 134104..134196) comprising three critical
elements 17-bp AT tract, central 23-bp perfect inverted
repeat with four GAGGC boxes (P4/P3 and P2/P1), and
10-bp early palindrome EP [50,59] and appropriate spacer
sequences as well as various restriction cloning sites was
generated by gene sysnthesis (Mr. Gene, Regensburg,
Germany) and cloned into the EcoRI and HpaI cloning
sites of pMfeI-oriP2(+) resulting in the new vector
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
pSV40oriP2(+). Finally, the CMV enhancer/promoter and
complete gene expression cassettes of pCMX2.5-hIgG1FcXP, pCMV-scFv-Fc-4E3 or pCMV-scFv-RNase-4E3, respectively, were cloned into pSV40oriP2(+) using EcoRI
and XbaI resulting in the vectors pCSE2.5-hIgG1Fc-XP,
pCSE-scFv-hIgG1Fc-4E3 and pCSE-scFv-hIgG1Fc-RNase4E3, respectively.
Single step cloning of scFv gene fragments from HAL7/8
into pCSE2.5-hIgG1Fc-XP
In order to test the single step in frame cloning of scFv
antibody gene fragments, more than 20 scFv gene fragments obtained by phage display to different antigens
from the antibody gene libraries HAL 7/8 [4] were
cloned into the NcoI/NotI cloning site of pCSE2.5hIgG1Fc-XP to obtain scFv-hIgG1Fc antibody constructs.
High quality plasmid preparations for transfection were
done using the NucleoBond Xtra Midi Kit according to
the manufacturer’s description (Machery Nagel, Düren,
Germany).
Page 17 of 20
(without G418) into 125 to 1000 mL polycarbonate Erlenmeyer flasks with ventilation membrane caps (Corning,
Amsterdam, The Netherlands) and incubated at 37°C and
110 rpm in a orbital shaker. For small scale productions
1 mL/well in a 12 well plate was incubated at 150 rpm in a
linear shaker. A total of 1 μg high quality plasmid-DNA
and 2.5 μg PEI per mL culture volume was prepared in
1/10 volume of fresh serum free culture medium as described above if not otherwise indicated. To quantify the
transfection efficiency 1/20 of total DNA of the reporter
plasmids pEF-FS-EGFP or pCS2-venus encoding the enhanced green fluorescence protein (EGFP) or the yellow
fluorescence protein (YFP) variant venus [60], respectively,
were added. After adding the DNA/PEI complexes, the
cells were further cultured for 48 h. Then a final concentration of 0.5% (w/v) of tryptone N1 (TN1, Organotechnie
S.A.S., La Courneuve, France) was added as described
elsewere (Pham et al. 2005) together with one additional
volume fresh culture medium.
Protein A purification
Transient transfection and production in HEK293T cells
Transient production in adherent HEK293T was done as
previously described [38]. Briefly, HEK293T cells were
seeded into 10 cm plates using 12.5 mL culture medium
(Sarstedt, Nürnbrecht, Germany) to reach 70-80%
confluency after day culture. To improve cell adherence
during transfection and production, plates were prepared
with sterile poly-L-lysine (Sigma-Aldrich, Munich,
Germany; 0.01% (w/v), 75–150 kDa, cell-culture grade) for
15 minutes followed by to three washing steps with sterile
phosphate buffered saline (PBS; 137 mM NaCl, 2.6 mM
KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4). Transfection
was performed with 10 μg polyethyleneimide (PEI,
Polysciences, Warrington, PA). A total of 10 μg high quality plasmid-DNA (Machery Nagel, Düren, Germany) and
80 μg/mL PEI were separately diluted in 600 μL DMEM.
DNA and PEI solution were mixed and incubated for 15–
30 min at room temperature (RT). DNA/PEI complexes
were distributed over the cells and incubated for 24 h.
Next day, medium was completely replaced by DMEM
supplemented with 4% (v/v) IgG stripped FCS (PAA) and
penicillin/streptomycin to minimize co-purification of bovine IgG by protein A/G affinity chromatography. The
medium was usually harvested and exchanged everyday
for up to two weeks. Production medium was harvested
and exchanged every day for up to 1–2 weeks.
Transient transfection and production in suspension
HEK293-6E cells
Transient production in suspension HEK293-6E cells
was performed as previously described [38]. Briefly, two
days before transfection 5× 105 cells/mL HEK293-6E
were seeded in 25 to 150 mL serum free culture medium
All scFv-hIgG1Fc antibodies and scFv-hIgG1Fc-RNase
constructs were purified by protein A affinity purification using 1 mL Bio-Scale Mini UNOsphere SUPrA Cartridges and the semiautomated Profinia 2.0 system
(Biorad, Munich, Germany) according the standard
manufacturer’s protocol.
Flow cytometry
Transfection efficiency was measured either using a
Guava EasyCyte mini flow cytometer (Guava Technologies,
Hayward, CA, USA) or a FC500 flow cytometer (Beckman
Coulter, Krefeld, Germany) usually 48 h after transfection.
Transfected cells were detected by the co-expression of
either GFP (pTTo/GFPq, NRC, BRI; 5% of total plasmid
DNA) or YFP in the fluorescence light (FL) 1. Dead cells
were stained with 2 μg/mL propidium iodide (PI, Sigma).
Sodium dodecyl sulfate (SDS) polyacrylamide gel
electrophoresis (PAGE)
SDS-PAGE was performed with a Mini-PROTEAN system (BioRad). Protein standards and samples were prepared under reducing conditions with Laemmli sample
buffer for 5 minutes at 95°C or under non reducing conditions (Laemmli sample buffer without reducing agent)
for 10 min at 65°C. Gels with up to 35 lanes were
performed with a PerfectBlue Twin ExW S system
(PEQlab, Erlangen, Germany). Coomassie staining was
performed as described [14].
Quantification of scFv-Fc antibodies by IgG/Fc capture
ELISA and gel densitometry
The antibodies in the production supernatants were
quantified by IgG/Fc capture ELISA as described [61].
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Briefly, a total of 100 μL/well goat-anti-human immunoglobulin (polyvalent) capture antibody (Sigma, Cat.-No.
I1761; 200 ng/mL) was diluted in PBS and coated in
96-well Maxisorp™ microtiter plates (Nunc, Thermo Fisher
Scientific) for 1 h at 37°C. After blocking with 20% (v/v)
FCS for 1 h at 37°C, the wells were washed three times
with PBST (PBS with 0.05% [v/v] tween-20, Sigma) using
a Columbus ELISA washer (TECAN, Crailsheim,
Germany). A total of 100 μL/well of several sample dilutions
and a half dilution series of the human IgG protein standard
(N protein SL, Dade Behring) were prepared in PBS
containing 1% (v/v) FCS and incubated for 1 h at 37°C.
After washing, a total of 100 μL/well of 20 ng/mL goat-antihuman-IgG (Fc-specific) antibody horseradish peroxidase
(HRP) conjugate (Sigma, Cat.-No. A0170) was incubated
for 1 h at 37°C. After washing the color reaction was
initiated with 100 μL/well 3,3′,5,5′-tetramethylbenzidine
(TMB) substrate solution (20 volumes TMB solution A
consisting of 30 mM potassium citrate, 0.5 mM citric acid,
pH4.1 mixed with 0.5 volumes of TMB solution B consisting
of 10 mM TMB in 10% [v/v] Aceton, 89% [v/v] ethanol,
0.3% [v/v] H2O2) and stopped by addition of 100 μL/well of
0.5 M H2SO4. The absorbance was measured at 450 nm
against a reference wavelength of 620 nm (A450-A620) using
the Sunrise ELISA reader (TECAN). Additionally, recombinant proteins produced in HEK293-6E cells under
serum free culture conditions were quantified by
SDS-PAGE after coomassie staining. Samples were prepared
under reducing conditions and compared to purified standard proteins using the software image J
(http://rsb.info.nih.gov/ij/disclaimer.html).
Quantitative measurements of metabolic cell culture
parameters
Glucose and L-lactate were quantified with a membranebased enzymatic analyzer (YSI Model 2700 Select, Yellow Spring Instruments, Yellow Spring OH). The same
instrument was also used to measure L-glutamine in
combination with L-glutamic acid.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
VJ and KB participated in the design of this study, supervised the production
in HEK293-6E and the analysis of metabolic parameters, and drafted this part
of the manuscript. AW performed productions in HEK293-6E cells and
analyzed the metabolic parameters. SW carried out the comparative
production of the more than 20 different scFv-Fc antibody clones in
HEK293-6E cells and analyzed the data. MH provided the monoclonal
recombinant human scFv antibodies and revised the manuscript. AF
participated in the design of the new expression vectors and revised the
manuscript. TS designed, coordinated and supervised this study, constructed
most of the vectors, performed some productions, drafted and revised the
manuscript. All authors read and approved the final manuscript.
Acknowledgments
We gratefully thank Stefan Dübel (Technische Universität Braunschweig,
Germany) for critical discussion and reading the manuscript. Moreover, we
Page 18 of 20
thank our technicians Franziska Resch, Saskia Helmsig and Nadine Konisch,
and our former student Stefanie Claudia Pohl for performing some of the
experiments. We acknowledge the financial support by EU FP6 supported
coordination action funded activities “proteome binders” (contract 026008)
and the EU FP7 collaborative projects “Affinity Proteome” (contract 222635)
and “Affinomics” (contract 241481).
Author details
1
Department of Molecular Structural Biology, Helmholtz-Zentrum für
Infektionsforschung GmbH, Inhoffenstraße 7, Braunschweig 38124, Germany.
2
Department of Biotechnology, Technische Universität Braunschweig,
Institute of Biochemistry, Biotechnology and Bioinformatics, Spielmannstr 7,
Braunschweig 38106, Germany.
Received: 4 December 2012 Accepted: 24 May 2013
Published: 26 June 2013
References
1. Taussig MJ, Stoevesandt O, Borrebaeck CAK, Bradbury AR, Cahill D,
Cambillau C, de Daruvar A, Dübel S, Eichler J, Frank R, Gibson TJ, Gloriam D,
Gold L, Herberg FW, Hermjakob H, Hoheisel JD, Joos TO, Kallioniemi O,
Koegl M, Koegll M, Konthur Z, Korn B, Kremmer E, Krobitsch S, Landegren U,
van der Maarel S, McCafferty J, Muyldermans S, Nygren P-A, Palcy S,
Plückthun A, Polic B, Przybylski M, Saviranta P, Sawyer A, Sherman DJ, Skerra
A, Templin M, Ueffing M, Uhlén M: ProteomeBinders: planning a European
resource of affinity reagents for analysis of the human proteome. Nat
Methods 2007, 4:13–17.
2. Dübel S, Stoevesandt O, Taussig MJ, Hust M: Generating recombinant
antibodies to the complete human proteome. Trends Biotechnol 2010,
28:333–339.
3. Colwill K, Gräslund S: A roadmap to generate renewable protein binders
to the human proteome. Nat Methods 2011, 8:551–558.
4. Hust M, Meyer T, Voedisch B, Rülker T, Thie H, El-Ghezal A, Kirsch MI, Schütte
M, Helmsing S, Meier D, Schirrmann T, Dübel S: A human scFv antibody
generation pipeline for proteome research. J Biotechnol 2011,
152:159–170.
5. Hust M, Steinwand M, Al-Halabi L, Helmsing S, Schirrmann T, Dübel S:
Improved microtitre plate production of single chain Fv fragments in
Escherichia coli. N Biotechnol 2009, 25:424–428.
6. Shu L, Qi CF, Schlom J, Kashmiri SV: Secretion of a single-gene-encoded
immunoglobulin from myeloma cells. PNAS 1993, 90:7995–7999.
7. Moutel S, El Marjou A, Vielemeyer O, Nizak C, Benaroch P, Dübel S, Perez F:
A multi-Fc-species system for recombinant antibody production. BMC
Biotechnol 2009, 9:14.
8. Thie H, Toleikis L, Li J, von Wasielewski R, Bastert G, Schirrmann T, Esteves IT,
Behrens CK, Fournes B, Fournier N, de Romeuf C, Hust M, Dübel S: Rise and
fall of an anti-MUC1 specific antibody. PLoS One 2011, 6:e15921.
9. Kirsch MI, Hülseweh B, Nacke C, Rülker T, Schirrmann T, Marschall H-J, Hust
M, Dübel S: Development of human antibody fragments using antibody
phage display for the detection and diagnosis of Venezuelan equine
encephalitis virus (VEEV). BMC Biotechnol 2008, 8:66.
10. Girgis MD, Olafsen T, Kenanova V, McCabe KE, Wu AM, Tomlinson JS:
Targeting CEA in pancreas cancer xenografts with a Mutated scFv-Fc
antibody fragment. EJNMMI Res 2011, 1:24.
11. Menzel C, Schirrmann T, Konthur Z, Jostock T, Dübel S: Human antibody
RNase fusion protein targeting CD30+ lymphomas. Blood 2008,
111:3830–3837.
12. Shen Z, Stryker GA, Mernaugh RL, Yu L, Yan H, Zeng X: Single-chain
fragment variable antibody piezoimmunosensors. Anal Chem 2005,
77:797–805.
13. Al-Halabi L, Balck A, Michalzik M, Fröde D, Büttgenbach S, Hust M,
Schirrmann T, Dubel S: Recombinant antibody fragments allow repeated
measurements of C-reactive protein with a quartz crystal microbalance
immunosensor. MAbs 2013, 5:0–1.
14. Pohl SC, Schwarz S, Frenzel A, Schirrmann T: A cassette vector system for
the rapid cloning and production of bispecific tetravalent antibodies.
Antibodies 2012, 1:19–38.
15. Schirrmann T, Pecher G: Human natural killer cell line modified with a
chimeric immunoglobulin T-cell receptor gene leads to tumor growth
inhibition in vivo. Cancer Gene Ther 2002, 9:390–398.
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
16. Schirrmann T, Pecher G: Specific targeting of CD33(+) leukemia cells by a
natural killer cell line modified with a chimeric receptor. Leuk Res 2005,
29:301–306.
17. Capodicasa C, Chiani P, Bromuro C, De Bernardis F, Catellani M, Palma AS,
Liu Y, Feizi T, Cassone A, Benvenuto E, Torosantucci A: Plant production of
anti-β-glucan antibodies for immunotherapy of fungal infections in
humans. Plant Biotechnol J 2011, 9:776–787.
18. Rülker T, Voß L, Thullier P, O’ Brien LM, Pelat T, Langermann C, Schirrmann T,
Dübel S, Marschall H-J, Hust M, Hülseweh B: Isolation and characterisation
of a human-like antibody fragment (scFv) that inactivates VEEV In Vitro
and In Vivo. PLoS One 2012, 7:e37242.
19. West AP Jr, Galimidi RP, Gnanapragasam PNP, Bjorkman PJ: Single-chain Fvbased anti-HIV proteins: potential and limitations. J Virol 2012,
86:195–202.
20. Liu J, Wei D, Qian F, Zhou Y, Wang J, Ma Y, Han Z: pPIC9-Fc: a vector
system for the production of single-chain Fv-Fc fusions in Pichia pastoris
as detection reagents in vitro. J Biochem 2003, 134:911–917.
21. Zhang N, Liu L, Dumitru CD, Cummings NRH, Cukan M, Jiang Y, Li Y, Li F,
Mitchell T, Mallem MR, Ou Y, Patel RN, Vo K, Wang H, Burnina I, Choi B-K,
Huber HE, Stadheim TA, Zha D: Glycoengineered Pichia produced antiHER2 is comparable to trastuzumab in preclinical study. MAbs 2011,
3:289–298.
22. Ye J, Ly J, Watts K, Hsu A, Walker A, McLaughlin K, Berdichevsky M, Prinz B,
Sean Kersey D, d’ Anjou M, Pollard D, Potgieter T: Optimization of a
glycoengineered Pichia pastoris cultivation process for commercial
antibody production. Biotechnol Prog 2011, 27:1744–1750.
23. Jiang Y, Li F, Button M, Cukan M, Moore R, Sharkey N, Li H: A highthroughput purification of monoclonal antibodies from glycoengineered
Pichia pastoris. Protein Expr Purif 2010, 74:9–15.
24. Schirrmann T, Al-Halabi L, Dübel S, Hust M: Production systems for
recombinant antibodies. Front Biosci 2008, 13:4576–4594.
25. Wurm FM: Production of recombinant protein therapeutics in cultivated
mammalian cells. Nat Biotechnol 2004, 22:1393–1398.
26. Jostock T: Expression of antibody in mammalian cells. In Antibody
Expression and Production. Edited by Al-Rubeai M. Heidelberg: Springer;
2011:1–24 [Cell Engineering, vol. 7].
27. Wilke S, Groebe L, Maffenbeier V, Jäger V, Gossen M, Josewski J, Duda A,
Polle L, Owens RJ, Wirth D, Heinz DW, van den Heuvel J, Büssow K:
Streamlining homogeneous glycoprotein production for biophysical and
structural applications by targeted cell line development. PLoS One 2011,
6:e27829.
28. Geisse S, Fux C: Recombinant protein production by transient gene
transfer into mammalian cells. Meth. Enzymol. 2009, 463:223–238.
29. Baldi L, Hacker DL, Adam M, Wurm FM: Recombinant protein production
by large-scale transient gene expression in mammalian cells: state of the
art and future perspectives. Biotechnol Lett 2007, 29:677–684.
30. Jostock T, Vanhove M, Brepoels E, Van Gool R, Daukandt M, Wehnert A,
Van Hegelsom R, Dransfield D, Sexton D, Devlin M, Ley A,
Hoogenboom H, Müllberg J: Rapid generation of functional human
IgG antibodies derived from Fab-on-phage display libraries.
J Immunol Methods 2004, 289:65–80.
31. Geisse S, Henke M: Large-scale transient transfection of mammalian cells:
a newly emerging attractive option for recombinant protein production.
J Struct Funct Genomics 2005, 6:165–170.
32. Backliwal G, Hildinger M, Chenuet S, Wulhfard S, De Jesus M, Wurm FM:
Rational vector design and multi-pathway modulation of HEK 293E cells
yield recombinant antibody titers exceeding 1 g/l by transient
transfection under serum-free conditions. Nucleic Acids Res 2008, 36:e96.
33. Tuvesson O, Uhe C, Rozkov A, Lüllau E: Development of a generic
transient transfection process at 100 L scale. Cytotechnology 2008,
56:123–136.
34. Meissner P, Pick H, Kulangara A, Chatellard P, Friedrich K, Wurm FM:
Transient gene expression: recombinant protein production with
suspension-adapted HEK293-EBNA cells. Biotechnol Bioeng 2001,
75:197–203.
35. Boussif O, Lezoualc’h F, Zanta MA, Mergny MD, Scherman D, Demeneix B,
Behr JP: A versatile vector for gene and oligonucleotide transfer into
cells in culture and in vivo: polyethylenimine. PNAS 1995, 92:7297–7301.
36. Boussif O, Zanta MA, Behr JP: Optimized galenics improve in vitro gene
transfer with cationic molecules up to 1000-fold. Gene Ther 1996,
3:1074–1080.
Page 19 of 20
37. Thomas M, Klibanov AM: Enhancing polyethylenimine’s delivery of
plasmid DNA into mammalian cells. PNAS 2002, 99:14640–14645.
38. Schirrmann T, Büssow K: Transient production of scFv-Fc fusion proteins
in mammalian cells. In Antibody Engineering. Edited by Kontermann R,
Dübel S. Berlin, Heidelberg: Springer Berlin Heidelberg; 2010:387–398.
39. Schlaeger EJ, Christensen K: Transient gene expression in mammalian
cells grown in serum-free suspension culture. Cytotechnology 1999,
30:71–83.
40. Wurm F, Bernard A: Large-scale transient expression in mammalian cells
for recombinant protein production. Curr Opin Biotechnol 1999,
10:156–159.
41. Durocher Y, Perret S, Kamen A: High-level and high-throughput
recombinant protein production by transient transfection of suspensiongrowing human 293-EBNA1 cells. Nucleic Acids Res 2002, 30:E9.
42. Swiech K, Kamen A, Ansorge S, Durocher Y, Picanço-Castro V, RussoCarbolante EM, Neto MS, Covas DT: Transient transfection of serum-free
suspension HEK 293 cell culture for efficient production of human rFVIII.
BMC Biotechnol 2011, 11:114.
43. Godbey WT, Wu KK, Mikos AG: Tracking the intracellular path of poly
(ethylenimine)/DNA complexes for gene delivery. PNAS 1999,
96:5177–5181.
44. Loignon M, Perret S, Kelly J, Boulais D, Cass B, Bisson L, Afkhamizarreh F,
Durocher Y: Stable high volumetric production of glycosylated human
recombinant IFNalpha2b in HEK293 cells. BMC Biotechnol 2008, 8:65.
45. Zhang J, Liu X, Bell A, To R, Baral TN, Azizi A, Li J, Cass B, Durocher Y:
Transient expression and purification of chimeric heavy chain
antibodies. Protein Expr Purif 2009, 65:77–82.
46. Kozak M: At least six nucleotides preceding the AUG initiator codon
enhance translation in mammalian cells. J Mol Biol 1987, 196:947–950.
47. Kozak M: An analysis of 5′-noncoding sequences from 699 vertebrate
messenger RNAs. Nucleic Acids Res 1987, 15:8125–8148.
48. Brown CM, Stockwell PA, Trotman CN, Tate WP: Sequence analysis
suggests that tetra-nucleotides signal the termination of protein
synthesis in eukaryotes. Nucleic Acids Res 1990, 18:6339–6345.
49. McCaughan KK, Brown CM, Dalphin ME, Berry MJ, Tate WP: Translational
termination efficiency in mammals is influenced by the base following
the stop codon. Proc Natl Acad Sci USA 1995, 92:5431–5435.
50. Deb S, DeLucia AL, Baur CP, Koff A, Tegtmeyer P: Domain structure of the
simian virus 40 core origin of replication. Mol Cell Biol 1986, 6:1663–1670.
51. Frenzel A, Fröde D, Meyer T, Schirrmann T, Hust M: Generating
recombinant antibodies for research, diagnostics and therapy using
phage display. Current Biotech 2012, 1:33–41.
52. Pham PL, Kamen A, Durocher Y: Large-scale transfection of mammalian
cells for the fast production of recombinant protein. Mol Biotechnol 2006,
34:225–237.
53. Längle-Rouault F, Patzel V, Benavente A, Taillez M, Silvestre N, Bompard A,
Sczakiel G, Jacobs E, Rittner K: Up to 100-fold increase of apparent gene
expression in the presence of Epstein-Barr virus oriP sequences and
EBNA1: implications of the nuclear import of plasmids. J Virol 1998,
72:6181–6185.
54. Li J-H, Chia M, Shi W, Ngo D, Strathdee CA, Huang D, Klamut H, Liu F-F:
Tumor-targeted gene therapy for nasopharyngeal carcinoma. Cancer Res
2002, 62:171–178.
55. Zuo Y, Wu J, Xu Z, Yang S, Yan H, Tan L, Meng X, Ying X, Liu R, Kang T,
Huang W: Minicircle-oriP-IFNγ: a novel targeted gene therapeutic system
for EBV positive human nasopharyngeal carcinoma. PLoS One 2011,
6:e19407.
56. Backliwal G, Hildinger M, Kuettel I, Delegrange F, Hacker DL, Wurm FM:
Valproic acid: a viable alternative to sodium butyrate for enhancing
protein expression in mammalian cell cultures. Biotechnol Bioeng 2008,
101:182–189.
57. Wulhfard S, Baldi L, Hacker DL, Wurm F: Valproic acid enhances
recombinant mRNA and protein levels in transiently transfected Chinese
hamster ovary cells. J Biotechnol 2010, 148:128–132.
58. Lefranc M-P, Giudicelli V, Ginestoux C, Jabado-Michaloud J, Folch G,
Bellahcene F, Wu Y, Gemrot E, Brochet X, Lane J, Regnier L, Ehrenmann F,
Lefranc G, Duroux P: IMGT(R), the international ImMunoGeneTics
information system(R). Nucleic Acids Res 2009, 37:D1006–D1012.
59. Meinke G, Phelan P, Moine S, Bochkareva E, Bochkarev A, Bullock PA, Bohm
A: The crystal structure of the SV40 T-antigen origin binding domain in
complex with DNA. PLoS Biol 2007, 5:e23.
Jäger et al. BMC Biotechnology 2013, 13:52
http://www.biomedcentral.com/1472-6750/13/52
Page 20 of 20
60. Nagai T, Ibata K, Park ES, Kubota M, Mikoshiba K, Miyawaki A: A variant of
yellow fluorescent protein with fast and efficient maturation for
cell-biological applications. Nat Biotechnol 2002, 20:87–90.
61. Rülker T, Meier D, Schirrmann T: Quantification of human IgG and related
Fc fusion proteins by a human IgG/Fc capture ELISA. In Antibody
Engineering. Edited by Kontermann R, Dübel S. Berlin, Heidelberg: Springer
Berlin Heidelberg; 2010:743–748.
doi:10.1186/1472-6750-13-52
Cite this article as: Jäger et al.: High level transient production of
recombinant antibodies and antibody fusion proteins in HEK293 cells.
BMC Biotechnology 2013 13:52.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit