Does epigenetic regulation mediate response to cold adaptation in cellular systems? Does the H3K4me3 system help cells respond to changes in temperature? Salvör Rafnsdóttir Baccalaureus Scientiarum Thesis in Medicine University of Iceland Faculty of Medicine School of Health Sciences This is a BSc Thesis. All rights reserved. © Salvör Rafnsdóttir August 10th 2016 Supervisor: Hans Tómas Björnsson MD. Ph.D. Abstract Does epigenetic regulation mediate response to cold adaptation in cellular systems? 1
2
2,3
Salvör Rafnsdóttir , Li Zhang , Hans Tómas Björnsson . 1
2
Faculty of Medicine University of Iceland, McKusick-­Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Department of Pediatrics, Johns Hopkins University School of Medicine. 3
Introduction: Cells have adaptive responses to tolerate changing environments. It is likely that some of these responses involve epigenetic regulation of adaptive gene expression changes. By understanding these responses one may be able to better understand the mechanistic basis of therapeutic hypothermia. Here we explore whether the H3K4me3 system (a Trithorax ortholog), previously implicated in environmental responses in plants, mediates a similar response in humans. Furthermore we investigated whether known cold-­responsive genes (CIRP and SP1), show cell type specific responses to cold stimuli. Finally, we developed an unbiased strategy to map the factors that play a role in the (epigenetic) upregulation of genes known to upregulate in response to cold stress. Materials and methods: Here we employed two reporter alleles that measure global activity of the H4Ac and H3K4me3 machineries to test the hypothesis that global changes in H3K4me3 act as a switch to help human cells respond to cold stress. Furthermore, we developed several novel fluorescence based indicator constructs for two genes known to be upregulated with cold temperature stimuli (SP1 and CIRP), to rapidly and robustly explore responses to cold stress in multiple cell types. Finally, one of these constructs (SP1-­Short indicator) was stably integrated into HEK293 genome after preliminary studies and will be used in an unbiased forward mutagenesis screen to identify upstream regulators of SP1. Results: We have developed an initial tool-­kit for the exploration of cold stimulated adaptive responses in human cells. Furthermore, through our use of fluorescence indicators we demonstrate variation in expression of SP1 among different cancer cell lines when exposed to cold temperature stimuli. Discussion and Conclusion: We hypothesize that these changes could either be influenced by cell type of origin or the genetic complement of the individual lines. We are in the process of using a non-­
biased forward mutational screen that has the potential of uncovering novel regulators of cold adaptation. A better understanding of cold adaption may yield insight into the therapeutic benefit of hypothermia, a poorly understood therapeutic strategy that is widely used in clinical medicine. This opens up the possibility to develop a pharmacological strategy to capture some of the positive effects of hypothermia without the need to anesthestize the patient. 1 Acknowledgements
I would like to thank Li Zhang, the senior laboratory manager in the Bjornsson lab at the Johns Hopkins Medical Institute, for her endless patience and guidance through the entire project. Also I would like to thank Genay Pilarowski and Giovanni Carosso, graduate students in the Bjornsson lab, and Jill Fahrner, a junior faculty member, for all their help. I am more than grateful to Hans Björnsson for giving me this opportunity and for all the help he provided. Also I would like to thank him for inspiring me to be productive, hard-­working, precise and first and foremost a scientist. I could not have asked for better instructors than Li Zhang and Hans Bjornsson for my B.Sc. research. I would like to thank the Dietz lab and the Valle lab at the Johns Hopkins Medical Institute for sharing some cell lines. Also, I would like to thank the Dietz lab for the access to their FACS machine. I am grateful that my parents, Hildur Kristjánsdóttir and Rafn Benediktsson, and Kristján Godsk Rögnvaldsson reviewed my writings and lecture and always were up for a Skype call whenever needed. I am extremely grateful that my parents encouraged my to do what I want and then helped me so it could be doable. I would like to thank all of my grandparents and aunt and uncle, Selma Kristjánsdóttir and Róbert Gíslason, for their help and kindness. I would like to thank Kristján, my sister, Þórdís Rafnsdóttir and my friend Rakel Másdóttir for visiting me and bringing me small pieces of Iceland with them. Össur Rafnsson, my brother, gets thanks for sending me an art piece representing Iceland so I could show my friends. I would especially like to thank Emily Dlugi, Kaytlyn Burke and Kristín María Guðmundsdóttir for making the time outside the lab wonderful and showing me the best of Baltimore. Emily Dlugi gets special thanks for reading over my thesis and correcting the grammar. 2 Table of contents
List of figures ..................................................................................................................................... 4 List of tables ...................................................................................................................................... 4 List of abbreviations .......................................................................................................................... 5 1 Introduction ................................................................................................................................ 8 1.1 Epigenetics and the environment ............................................................................... 10 1.1.1 Epigenetics and nutrition ........................................................................................ 10 1.1.2 Epigenetics and temperature ................................................................................. 11 1.2 Cold stimulus and gen expression. ............................................................................ 13 1.2.1 CIRP, a Cold-­inducible RNA-­binding protein. ........................................................ 13 1.2.2 Other gene responses to changing temperatures .................................................. 14 1.2.3 Hypothermia as an effective therapeutic strategy in clinical medicine ................... 14 2 Goals of Research ................................................................................................................... 15 3 Materials and methods ............................................................................................................ 15 4 3.1 List of equipment and kits: .......................................................................................... 15 3.2 List of solutions: ........................................................................................................... 17 3.3 Maintenance of cell culture: ......................................................................................... 19 3.4 Epigenetic reporter systems: ...................................................................................... 20 3.5 Western blotting: .......................................................................................................... 21 3.6 Temperature expression indicators: ........................................................................... 21 3.7 Collection and analysis of data: .................................................................................. 22 3.8 GeCKO genome scale CRISPR knock out screening: .............................................. 23 Results ..................................................................................................................................... 24 4.1 Does global activity of Trithorax ortholog in humans (H3K4me3 activity) increase with cold stimulus? Does the activity of Trithorax orthologs increase more than other systems (H4 acetylation)? ............................................................................................................................ 24 4.2 Can we develop approaches that would facilitate the study of cold stimulus in cellular systems? ........................................................................................................................... 26 4.3 Do genes known to be upregulated with cold stimuli show maximal response at temperature used for therapeutic strategies? ............................................................................. 28 4.4 Is the cellular cold response observed in all cellular systems or does it depend on the tissue of origin? ....................................................................................................................... 29 5 Discussion ............................................................................................................................... 32 5.1 Future steps .................................................................................................................. 35 References ...................................................................................................................................... 36 3 Appendix ......................................................................................................................................... 42 List of figures
Figure 1: Structure of stable temperature expression indicators. ......................................................... 22 Figure 2: Response of epigenetic indicators to individual temperature stimuli. .................................... 25 Figure 3: Percentage GFP positive cells at set temperature divided by percentage GFP positive cells at 37°C for acetyl-­ and methyl indicator. .......................................................................................... 25 Figure 4: Western blot on HEK293 WT cells after temperature exposure for 24 hours. ...................... 26 Figure 5: Response of epigenetic indicators to individual temperature stimuli. .................................... 27 Figure 6: Line chart of normalized MF value for all temperature indicators under different temperature stimuli. .......................................................................................................................................... 28 Figure 7: Fluorescence of transiently transfected SP1 Short indicator to different cell lines at different temperature stimuli. ..................................................................................................................... 31 Figure 8: Line chart of normalized MF value for all cell lines transiently transfected with SP1 Short indicator under different temperature stimuli. .............................................................................. 32 List of tables
Table 1: Equipment and kits used in our research. .............................................................................. 17 Table 2: Solutions used in our research. .............................................................................................. 19 Table 3 List over cell lines and their features. ...................................................................................... 20 4 List of abbreviations
°C: Degrees Celsius. A: Alanine. ATP: Adenosine triphosphate. bp: base pairs. BSA: Bovine Serum Albumin. ChIP-­Seq.: Chromatin Immunoprecipitation followed by next generation Sequencing. CIRBP: Cold-­inducible RNA-­binding protein (synonym CIRP and hnRNP A18). CIRP: Cold-­inducible RNA-­binding protein (synonym CIRBP and hnRNP A18). CRISPR-­Cas9: clustered regularly interspaced short palindrome repeats-­associated nuclease. CRISPR associated 9. C-­terminal: Carboxyl terminal of a protein. DI: Deionized Water. DMEM: Dulbecco's Modified Eagle's Medium. DNA: Deoxyribonucleotide acid. DNMT: DNA Methyltransferase. DPBS: Dulbecco’s Phoshate Buffered Saline. E: Glutamic acid or glutamate. EDTA: Ethylenediaminetetraacetic acid. EMEM: Eagle’s minimal essential medium. FACS: Fluorescent-­activated cell sorting. FBS: Fetal Bovine Serum. FLC: Flowering Locus C. FRI: Frigida. GFP: Green Fluorescent Protein. GRCF: Genetic Resources Core Facility. H1: Histone H1. H2A: Histone H2A. H2B: Histone H2B. H3: Histone 3. H3K9me1: Monomethylation of lysine in position number 9 of Histone 3. H3K27me3: Trimethylation of lysine in position number 27 of Histone 3. H3K36me2: Dimethylation of lysine in position number 32 of Histone 3. H3K36me3: Trimethylation of lysine in position number 32 of Histone 3. H3Y41: H3 tyrosine 41. H4: Histone H4. H4Ac: Histone 4 acetylation. HAT: Histone acetyltransferase. 5 HDAC: Histone Deacetylase. HDACi: Histone Deacetylase inhibitor. hnRNP A18: Heterogeneous Ribonucleoprotein A18 (synonym CIRBP and CIRP). HSP: Heat Shock Protein. HSP70: Heat Shock Protein 70. IMDM: Iscove's Modified Dulbecco's Medium. IRES: Internal Ribosomal Entry site. K: lysine. kD: kilo Dalton. KMD2A: Lysine Demethylase 2a. -­3
m: milli, 10 . MCRE: Mild Cold Responsive Element. ms: milli seconds. -­9
n: nano, 10 . N-­terminal: Amino terminal of a protein. NEB: New England Biolabs. N.S.: Non-­Significant. PBS: Phosphate buffered saline. PHD-­finger: Plant homeodomain finger. PWS: Prader Willi Syndrome. RBM3: RNA Binding motif protein 3. RNA: Ribonucleotide Acid. RNA-­binding domain:ribonucleotide acid-­binding domain. RPMI-­1640: Roswell Park Memorial Institute medium – 1640. SAM: S-­Adenosyl methionine. sgRNA: small guide Ribonucleotide Acid. siRNA: small interfering Ribonucleotide Acid. SOC: Super optimal broth with catabolite repression. SP1: Specificity protein 1. TBS: Tris Buffered-­Saline. TBS-­T: Tris Buffered-­Saline – Tween. TERC: Telomerase RNA Component. TERT: Telomerase reverse transcriptase. UV: Ultra Violet. V: Volt. 6 VIN3: Vernalization Insensitive 3. -­6
µ: micro, 10 . µF: micro Farad. 5mC: 5-­Methylcytosine. .csv: Comma Separated Value. .fcs: Flow Cytometry Standard. 7 1 Introduction
Each cell in our body contains heritable information which dictates its behavior. This information is mainly contained in the sequence of DNA (deoxyribonucleic acid)[1]. The basic unit of the DNA sequence itself is the nucleotide which is made out of a nitrogenous base, deoxyribose and a phosphate group. The deoxyribose and phosphate make the backbone of the double stranded DNA helix. Two chains of nucleotides are then linked together with hydrogen bonds between individual nitrogen bases. Four different nitrogenous bases exist: guanine and adenine (purines), and cytosine and thymine (pyrimidines). Together the order of these bases contains the information needed to orchestrate the cellular processes. The composition of the entire DNA complement of each organism is termed the genome. The genome contains variations which is thought to account for much of the variation seen between species and individuals. The information contained in the genome is transmitted between generations and this allows for identical behavior or functions of the next generation. Genetics is the study of this genetic variation[2]. Epigenetics is the study of changes to the DNA or associated proteins that is inherited through mitosis or meiosis but not encoded in the DNA sequence itself[3]. Epigenetic modification offers one mechanism which the cell can use to modify how it utilizes the available genetic information. It is important for the cell to contain such mechanisms to be able to respond to rapidly changing environment, as changes of the encoded DNA genome can take generations to come to light. Epigenetic modifications are often divided in three major subgroups that include DNA-­methylation, histone-­modification and RNA-­associated silencing[3]. RNA-­associated silencing has to date not been observed in mammals but is known to occur in other organisms such as the plant, Arabidopsis thaliana[3]. Although each of these epigenetic systems has independent functions they all play a role in establishing gene expression patterns. Epigenetic factors in association with the transcriptional machinery help determine whether a gene is transcribed[2, 3]. The best understood epigenetic modification is 5-­methylcytosine (5mC), which is methylation of carbon number 5, of the nitrogenous base cytosine[3]. Only some cytosines can be methylated and in mammals the main target is the CpG dinucleotide[4]. In general, the CpG dinucleotide is underrepresented in the genome. However, one exception involves CpG islands which are regions of DNA that have the highest average GC content (C+G≥ 55%). CpG islands are located in the promoter regions of about 40% of genes[3]. CpG DNA methylation of promoter sequences has been associated with gene silencing, while gene body (exons and introns) methylation is associated with active gene expression. The promoter regions often remain methylation free[4, 5]. DNA methylation is maintained by DNMT1, the maintenance DNA methyltransferase which recognizes hemi-­methylated DNA and thereby offers a mechanistic basis of how this mark is inherited through DNA replication[4, 6]. Among other things, DNA methylation plays a role in silencing integrated viral genomes, genes and transposable elements that are located throughout the human genome[3]. Transposable elements are DNA sequences that have the ability to mobilize from one part of the genome to another. Therefore, the genome has acquired defense mechanisms such as DNA methylation[3]. Another interesting fact about 5mC is that it is an endogenous mutagen. The basis of this is thought to relate to predisposition of 5mC to deaminate to thymine (a DNA base) with deamination. However, usually cytosine deaminates 8 to uracil (a RNA base), and is easily identified and repaired by the BER (base excision repair) pathway[3, 7]. DNA is carefully packaged in the nucleus and without this packaging the DNA strand would not be able to fit into the nucleus. The most basic unit of this packaging is the nucleosome, which is made from a histone octamer core and DNA that is wrapped around this histone core[8, 9]. H1 proteins sit on the outside of each nucleosome and help keep the chromatin complex in its place[10]. The octamer is made out of two copies of four proteins that include H2A, H2B, H3 and H4[10]. In addition, there are known alternative genetic variants of the histone proteins called H2Az and H3.3 which can replace H2A and H3, respectively[11]. The N-­terminal tail of any given histone protrudes from the octamer core and can be covalently modified by various enzymes. Most of the modification sites are located on the histone’s N-­terminal but some core site exists e.g. H3Y41, which can be phosphorylated[12]. The packaging is an ongoing and dynamic process and the cells have mechanisms to either tightly package or unwind the DNA sequence based on needs[2, 12]. Sequence–specific DNA binding proteins (transcription factors) bind to their DNA binding sites and draw the chromatin remodelers and modification complexes to the particular sites of interest[12]. To facilitate transcription of relevant genes, the histone tails undergo covalent modification. Which in some cases such as histone acetylation, changes the charge of the histone and thereby loosens up the association with the negatively charged DNA[12]. In addition, to histone acetylation other modification have been discribed including phosphorylation, methylation of lysine, methylation of arginine and ubiquitylation of conserved amino acids on the N-­terminal (amino-­
terminal) of the histone tails[12]. In general, the acetylation mark on histone tails is associated with open chromatin and hypo-­acetylated with closed chromatin[12]. Histone acetytransferases (HATs) use Acetyl-­CoA as the donor molecule for transferring acetyl groups to the lysine residue and histone deacetylases (HDACs) remove these acetyl groups. Histone phosphorylation takes place on serine, threonine and tyrosine. The addition of phosphoryl groups is controlled by kinases and the removal by phosphatases. All of histone kinase’s add phosphate from an adenosine triphoshate (ATP) to the hydroxyl group of the targeted amino acid. Histone methylation takes place at lysine and arginine[12]. Histone modification on lysine can be mono-­, di-­ or tri-­ methylated and arginine can be mono-­, symmetrically-­ or asymmetrically di-­methylated[12]. Histone methylation is observed in either open or closed chromatin depending on the position of the methylated lysine in the protein. For instance, histone 3, lysine 9, mono-­methylation (H3K9me1) is a well-­known closed chromatin mark, often observed in the inactive X-­chromosome of females and around centromeres of chromosomes[12]. In contrast, histone 3, lysine 4 tri-­methylation (H3K4me3) is an example of open chromatin mark[12]. Histone lysine (K) methyltransferases (KMT) are specific proteins that often have target specificity for a single target such asH3K4me[12]. KMTs use S-­Adenosyl methionine (SAM) as the donor molecule to transfer a methyl group to a specific target[12]. Arginine Methyltransferases (PRMTs) methylate arginine by transferring a methyl group from a SAM to the specific target[12]. Both lysine and arginine methylation can be removed with histone demethylases (KDM’s)[12]. 9 1.1 Epigenetics and the environment 1.1.1 Epigenetics and nutrition The environment, such as nutrient availability and temperature is known to impact cells. Epigenetic inheritance has been studied in plants, animals and prokaryotes[13, 14]. A well-­established example of vy
interaction between the environment and epigenetics involves the Agouti viable yellow mouse (A ). vy
The A occurred naturally through the insertion of a transposable element upstream of the agouti gene that normally expresses the agouti protein in a tissue specific manner[15]. The integration of this transposable element leads to increased expression of the agouti protein in a non-­tissue specific manner as the promoter of the transposon drives expression of the Agouti gene irrespective of cell vy
type[15]. This genetic alteration leads to many phenotypes observed in the A mice compared to wildtype littermates including a predisposition to diabetes, tumor formation and importantly a change in vy
the fur color of the mice from dark fur to yellow[15]. Interestingly, any given litter of an A female demonstrates a range of fur colors ranging from agouti (completely yellow) to pseudoagouti (completely brown), and intermediates, a mixture of yellow and brown fur[15]. This fur variation within individual animals is explained by the fact that in some cells the transposable element has been methylated and expression of the Agouti gene has reverted to the normal cellular expression, pseudoagouti fur. However, in other cells the transposable element remains unmethylated, leading to expression of the Agouti gene in all tissues leading to the full agouti phenotype[15]. In essence, these mice are epigenetically mosaic for the activity of the inserted transposon promoter. This epigenetic layer of phenotypic variability has been shown to be inherited transgenerationally as pups of the agouti mice are mostly agouti or mottled[15]. On the other hand, pseudoagouti mouse tend to have offspring with all types of fur[15]. In humans, incomplete erasure of epigenetic modifications in the germline has also been described in Prader Willi Syndrome (PWS). PWS is a caused by a loss of function of imprinted genes in the region 15q11-­q13[16]. Although most of the patients have genetic alterations of the paternal locus, some of these patients are only found to harbor an isolated epimutation but no other genetic disruption of the allele. In a large cohort of PWS patients caused by epimutation, investigators found that the epimutation always originated on the paternal grandmother’s chromosome[16]. The authors concluded that the epigenetic defect was inherited by the offspring from the father due to failed erasure of that particular site during spermatogenesis[16]. vy The inherited epigenetic variability in the A mouse has been shown to be influenced by diet[17]. Putting pregnant Agouti dams placed on dietary rich in availability of methyl-­donors (folic acid, vitamin B12, choline, and betaine) you can alter the epigenetic state of the agouti locus towards methylation and thereby increases the frequency of pseudoagouti pups[17]. It is interesting that epidemiology studies in various human populations have suggested that environmental factors such as nutrient availability can have health influences on generations to come including the risk of diabetes, glucose intolerance and cardiovascular mortality in offspring. However, currently the mechanistic basis of these correlations is poorly understood[18-­22]. 10 1.1.2 Epigenetics and temperature Just as nutrition is an environmental stimulus, so is temperature. A well-­known example of an epigenetically based response to changing temperature is the process of vernalization in plants[23]. Vernalization, the process of plant flowering after a winter, plays a central role in the lifecycle of plants. It is a good example of how temperature can change cellular behaviors through epigenetic modification[23]. There are two types of antagonistic epigenetic factors that help mediate the process of vernalization, the Polycomb and the Trithorax families of epigenetic factors. The Polycomb factors generate epigenetic silencing at target loci through the trimethylation of histone 3 on lysine 27 (H3K27me3) and trimethylation of histone 3 on lysine 9 (H3K9me3). On the other hand, the Trithorax factors add epigenetic modifications that facilitate gene expression such as di-­ and trimethylation of histone 3 on the amino acid lysine in position 36 (H3K36me2-­3) and di-­ and trimethylation of histone 3 on the amino acid lysine 4 (H3K4me2-­3). This phenomenon has been extensively researched in the plant Arabidopsis thaliana[23, 24]. Aradiposis thaliana is an annual plant that flowers during spring. During fall any offspring that grew from the seed from the previous spring usually grow and vernalize the following spring, but how does the plant know when to flower? Two loci called the Flowering Locus C (FLC) and Frigida (FRI) locus were found to play a pivotal role in the regulation of vernalization. FLC encodes a MADS box transcription factor that represses a pathway that is stimulated by light and leads to flowering after an extensive photoperiod. Activation of FRI and thereby the Trithorax systems leads to the addition of H3K4me3 to FLC[25]. FRI works as an enhancer of FLC expression[25]. During autumn prior to vernalization there is addition of H3K4me3/2 at the FLC gene locus. This phenomenon ensures that the plant only grows, but does not flower that fall. In support of this, investigators have found that rapid flowering during autumn is associated with reduced FLC expression, decreased H3K4me3 and increased H3K27me3 of FLC. During winter when the outdoor temperature raches 10°C or below, the Polycomb mediated epigenetic silencing of FLC dominates. This change is mediated by the Vernalization Insensitive 3 (VIN3), a zinc finger chromatin remodeler[23, 24, 26]. VIN3 recruits members of the Polycomb family to the FLC locus which leads to the placement of closed chromatin modifications[26]. This process appears to be controlled by a positive feedback loop: the greater the positive feedback, the greater the epigenetic silencing[26]. The strength of the epigenetic silencing has been linked to how lengthy the exposure to cold is[26]. Furthermore, the vernalization process only responds to continuous cold periods not short bursts of cold[26]. Finally, the epigenetic shift occurs stochastically in any given cell of the plant leading to a gradual shift in epigenetic expression in the whole plant. A gradual shift in all cells is thought to buffer the cold stimulus noise, minimizing the effect of any single day temperature extremes[26]. When spring arrives H3K27me3 gets accompanied by H3K9me3, which prolongs the repression of FLC[23]. This is often referred to as the epigenetic memory of Aradiposis thaliana. The memory of cold exposure in association with a longer photoperiod therefore leads to the flowering of the plant. The FLC locus is then again neutralized for the next generation[23-­
28]. Other plants have similar epigenetic regulation that leads to vernalization after winter e.g. Triticum aestivum (wheat) and Lilium longiflorum (Easter lily)[29, 30]. A similar temperature dependent effect has been observed on the Trithorax epigenetic regulatory system in molluscs. In the oyster species, Crassostrea gigas histone methylation (H3K4me, H3K9me 11 and H3K27me) of a critical genetic site during the larvae developmental phase is correlated with its environmental temperature[31]. Researchers have found that methylation levels at this locus are correlated with temperature at three different temperatures (18°C, 25°C and 32°C). Development at 18°C was associated with hypo-­methylation six hours after fertilization and hyper-­methylation at twenty-­
four hours after fertilization. In contrast, development at 32°C was associated with extreme hyper-­
methylation of this locus. Larvae that underwent development at the highest and lowest temperatures also showed developmental abnormalities[31]. The larvae that underwent development at 32°C also showed a higher mortality rate and higher rate of various abnormal phenotypes[31]. Furthermore, the larvae that developed at 18°C demonstrated slower growth. It therefore appears that the optimal temperature for well-­being of this species is 25°C, which is its typical temperature of development. These observations suggest that temperature and epigenetics interact and and that the balance between Trithorax and Polycomb factors may be critical in the developing organism[31]. Temperature is not only thought to affect life expectancy of molluscs. There are some clues that environmental temperature has an impact on life expectancy and the well-­being of humans as well[32-­
35]. Epidemiological studies have shown that extreme outdoor temperatures affects mortality rates[32-­
35]. The temperature effect on mortality seems to be correlated with latitude. The general rule is that for higher latitude degrees (closer to either pole) people appear to be more sensitive to the extremely hot temperatures. In contrast people closer to the equator appear more sensitive to the cold[32-­34]. Seasonal differences and different cold stimuli of the seasons have effects on the human body, though the mechanistic basis behind this is not fully understood[36]. Humans have many physiological mechanisms that allow them to adapt to the heat, including sweat production, lowered heart rate, and lowered core temperature[37]. On the other hand, people have surprisingly few physiological adaptations in responses to cold weather, the obvious one being the lack of fur, which is a shared feature of all other mammals that have adapted to a cold climate[37]. The human species evolved for the greatest amount of time in the tropics and can therefore be considered to be a tropical animal[37]. One mechanism for responding to a cold climate comes from voluntary movement, working or shivering, which generates heat through muscle activity. Other strategies involve minimizing one’s total exposed surface by cuddling into a ball to minimize heat loss. There are even studies that suggest that ethnic background can affect cold tolerance and this hints at specific genetic differences that may predict the extent of such a response. As an example, epidemiologic studies on frost-­bites in the Korean War showed that people of African-­American heritage had a greater incidence rate and more severe frost bite than other races even after controlling for other factors[37]. The Inuit’s of Greenland and the American-­Indians seem to be the least sensitive to cold exposure[37]. People from these populations appear to have a superior ability to regulate vasodilation in response to cold or other unknown cellular responses that help them tolerate cold temperatures. For instance, people of Inuit descent are better able to regulate their blood flow to the limbs at critical times to limit the extent of necrosis after cold exposure. Researchers have suggested that part of the reason for this population’s higher tolerance of cold climates, could be because their ancestors had to trek through extremely cold climates (or environments) to reach their current place of settlement[37]. Relatively little is known about what happens at the cellular level other than the fac tthat Inuit’s and Caucasians living near the artic have 12 some genetic variation in their mitochondria that favors higher heat production at the cost of lower efficiency (ie. respiration to ATP production)[38]. However, to date other potential cellular responses are currently unknown. 1.2 Cold stimulus and gen expression. All cells have an internal homeostasis system which compensates for changes in its environment. The predominant hypothesis for how cells respond to cold is thought to involve slowing of their metabolic rate and a generalized decrease in gene expression of the cell[39]. Given this fact it is curious that some genes are upregulated in response to cold temperature stimuli e.g. Cold Inducible RNA-­binding protein (CIRP) and RNA-­binding motif 3 (RBM3)[40, 41]. Thus, the regulation of these genes may hint at cellular adaptive responses which may also mediate some of the therapeutic response to cold (see section 1.2.1 and 1.2.2)[42]. 1.2.1 CIRP, a Cold-­inducible RNA-­binding protein. CIRP is one of several known genes which is upregulated in response to a cold stimulus[41]. This gene is located on chromosome 19p13.3[41]. Its protein product CIRP is an 18-­kD protein which consist of an N-­terminal RNA-­binding domain (ribonucleotide acid-­binding domain) and a C-­terminal (Carboxyl-­
terminal) with a Glycine-­rich domain[41]. The Glycine-­rich domain is a well recognized RNA-­binding motif that binds to mRNA[41, 43]. The CIRP mRNA contains a IRES-­like (Internal Entry Ribosomal site) site that allows for more efficient transcription at lower temperatures[41, 44]. CIRP has two different splice forms, produced under different environmental temperatures which have different promoters that overlap to some extent[44]. Different transcription factors control each promoter[44]. CIRP has one core promoter that is located from -­264 nucleotides upstream of the transcription start site (TSS) to +1 distal to the TSS[44]. Upon cold exposure the longer promoter is activated, but this promoter extends upstream to the core promoter. Thus, activation results in a different CIRP variant[44]. The shorter splice form seems to be mainly produced at 37°C, whereas the longer one is produced under mild hypothermic conditions, e.g. 32°C. CIRP transcription increases at 32°C, due to transcriptional regulation events[44]. Other known elements that control transcription rate of CIRP include the zinc finger, specificity protein 1 (SP1). SP1 is located on chromosome 12q13.13[45]. SP1 binds to the Mild Cold Responsive Element (MCRE). The MCRE is stationed in the flanking 5’ region of a mouse CIRP[13]. MCRE is an enhancer that mediates upregulation of gene expression of CIRP 3-­7 fold at 32°C. The effect of SP1, induction of CIRP gene expression, happens both at 37°C and at 32°C[13]. CIRP is thought to help protect cells against harmful stress and environmental factors such as hypoxia, UV-­light radiation and hypothermia[46, 47]. The protein product of CIRP is thought to downregulate pro-­apoptotic proteins when the cell undergoes stress response and thereby aid in survival of the cell[48]. Upregulation of CIRP has also been linked to increased survival of cancer cells and recurrence and invasiveness of tumours[49]. CIRP seems to be necessary to maintain telomerase activity through regulation of its component Telomerase Reverse Transcriptase (TERT) and Telomerase RNA Component (TERC) proteins. CIRP’s effect on TERT and TERC has been shown to 13 be necessary at both 32°C and 37°C[50]. CIRP also affects the circadian rhythm in humans by regulating gene expression of several circadian genes[51]. CIRP is thought to help mediate the lowered body temperature that occurs during sleep[52]. CIRP is also known to have function in germ cells of the testis[53]. The expression of CIRP in these cells is decreased when cells are exposed to higher temperature and also has a role in cold-­induced repression of cell growth[54]. CIRP has also been shown to influence sex differentiation in vertebrates, through its effects on the bi-­potential gonad in the snapping turtle (Chelydra serpentine). Female turtles develop if eggs are laid at higher environmental temperature but males at lower temperatures[55]. 1.2.2 Other gene responses to changing temperatures RBM3 is another gene that is also known to be upregulated in cold environments[56]. RBM3 is located on Xp11.23. CIRP and RBM3 are both members of a glycine rich RNA-­binding family. Like CIRP, RBM3 influences transcriptional level of certain mRNAs[57]. RBM3 is also is thought to play a part in many of above mentioned roles of CIRP, including roles in spermatogenesis where temperature is crucial and in regulating the circadian rhythm in humans[51, 54]. At the rewarming phase after a cold shock, genes encoding heat shock proteins (HSPs) are upregulated due to the rising internal temperature[58]. Inhibition of histone deacetylases triggers induction of HSP70[59]. Harmful effects of rewarming have been linked to Heat Shock Factor (HSF) and HSP[58]. Studies of animals have shown that rapid rewarming is harmful and can cause hyperthermia in brain cells[60]. Together, these studies suggest that temperature regulation may be mediated through the balance (either at gene specific or globally) of epigenetic states. 1.2.3 Hypothermia as an effective therapeutic strategy in clinical medicine Hypothermia as a therapeutic strategy has been used since antiquity in clinical medicine. For example, hypothermia is commonly used in treatment at home of moderate burn injury, as it reduces blood flow to the injured site[61]. Therefore, many practice hypothermia as a therapeutic strategy without appreciating the exact nature of their actions. In recent years, physicians and health care staff have been using hypothermia as a therapeutic strategy for more drastic life threatening conditions[60, 62-­64]. This has been called targeted temperature management. For instance, in the case of anoxic events part of the therapeutic strategy often involves drastic-­hypothermia, lowering the internal body temperature down to the range between 32-­35°C[62, 65]. Hypothermia has been shown to play a role in protecting against neurological damage[60, 63, 64]. Patients that suffer from conditions such as cardiac arrest, perinatal asphyxia and traumatic brain injury often undergo internal hypothermia as part of their therapeutic strategy[60, 64, 66, 67]. Clinical trials where hypothermia is used as a therapeutic strategy for other conditions such as acute myocardial infarction seem promising[67]. Animal studies also indicate benefit of hypothermia for other diseases such as ischemic stroke[64]. Hypothermia is used during some types of surgeries, e.g. heart surgeries and transplantation. Hypothermia of patients during aortic surgeries is thought to protect these patients from neurological damage to the brain[60]. Hypothermia has a positive influence on the success of most types of transplantation e.g. kidney transplant. Hypothermia of cadaveric kidney-­donor improves transplantation outcomes, as it reduces 14 the rate of delayed kidney graft functioning[62]. Hypothermia is not only used for extreme-­traumatic events in medicine but also used in less dramatic ways such as for storing patient-­samples[68, 69]. However, despite hypothermia being widely used in clinical medicine, the mechanism of this therapeutic effect is poorly understood. 2 Goals of Research
The aim of this research is to explore factors which might mediate the observed therapeutic effect of targeted temperature managament (hypothermia) and to examine whether human cells have an epigenetically based mechanism which respond to alterations in temperature. We aim to lay the groundwork towards a mechanistic understanding of cold responses in cellular systems. We will do this by answering the following questions: 1. Does global activity of a Trithorax ortholog in humans (H3K4me3 activity) increase with cold stimulus? Does the activity of Trithorax orthologs increase more than other systems (H4 acetylation)? 2. Can we develop approaches that would facilitate the study of cold stimulus in cellular systems? 3. Do genes known to be upregulated with cold stimuli show maximal response at temperature used for therapeutic strategies? 4. Is the cellular cold response observed in all cellular systems or does it depend on the tissue of origin? We will also: 5. Attemp to develop approaches that would allow the identification of factors that help upregulate the known cold responsive genes. 6. Attemp to develop approaches that would lead to a better understanding of mechanistics of cold stimuli in cellular systems. 3 Materials and methods
3.1 List of equipment and kits: List of Equipment Equipment/Kit: Manufacturer: Eppendorf Eppendorf® T25 flask Falcon® T75 flask Falcon® 6 well plate Greiner Bio-­One 12 well plate Greiner Bio-­One 96 well plate Falcon® 15 Glass pipettes 5, 10, 25 mL Sarstedt® Pipet aid Drummond, Falcon® 50 mL conical tubes Falcon® Gloves SKINTX Pyrex® solid glass beads Sigma-­Aldrich® 0.22 µm Cellulose Acetate Sterilizing Low Binding filter. Corning -­80°C freezer Thermo Scientific -­20°C freezer Various 4°C fridge Various Cell culture incubator (x3) Heraeus, Forma Scientific, Binder Paper (dust free) Kimwipes KIMTECT
Nanodrop 2000 Thermo Scientific Avanti™ J-­25I centrifuge Beckman Optima L-­90K Ultracentrifuge Beckman Coulter® SW 32 Ti Rotor Package, Swinging Bucket Beckman Coulter® Tube, Thickwall, Polycarbonate, 32 mL, 25 x 89 mm SCIENCE
Beckman Coulter® Microcentrifuge 5424 for Eppendorf tubes Eppendorf® Microcentrifuge refrigerated Z-­233 MK-­2 Hermle® Microcentrifuge Beckman Coulter® Microcentrifuge (used for cell culture) Sorvall® Legend T Eppendorf Thermomixer Eppendorf® Rocker II (model 260350) Boekel Scientific Stirrer / Hot plate Corning Fisher Stirrer / Hot plate Fisher Scientific Microwave Kenmore elite Cell culture hood, Sterile CARD® II, Advance° The Baker Company Micropressor controlled 280 series water bath Thermo Scientific® Incubator bacterial shaker New Brunswick Scientific co., INC RPT filter Sterile Tips: 10, 20, 200, 1000 µL USA scientific Bio-­Rad gene pulser Xcell™ Bio-­Rad laboratories Mitsubishi P83 printer Mitsubishi 16 Bio-­Rad universal hood III 5 mL Polystyrene Round-­Bottom Tube 12-­75 mm style Bio-­Rad laboratories Falcon BD FACS™ Universal loader BD Biosciences Nikon Eclipse TE2000-­U Nikon BZ-­X710-­All-­in-­One Fluorescence microscope KEYENCE Ruled Hemocytometer Electron Microscopy Sciences Counter Control Company (Taiwan) Nikon eclipse TS 100 Nikon Instruments Olympus CK40 OPELCO, OPtical ELements COrporation MicroAmp® optical 384-­well Reaction plate with barcode Applied Biosystems® by Life technologies MicroAmp™ Optical Adhesive film Applied Biosystems® by Life technologies PCR tubes, 0.2 mL Thermo stip Thermo Scientific PureLink™ Hi Pure Plasmid Filter MidiPrep Kit Invitrogen™ by Life Technologies PureLink™ Hi Pure Plasmid Filter MaxiPrep Kit Invitrogen™ by Life Technologies GeneJet Plasmid Miniprep Kit Thermo Scientific MinElute® Gel extraction Kit (50) QIAGEN Zero Blunt Topo® PCR Cloning Kit Invitrogen Pierce™ BCA Assay Kit Thermo Fisher Scientific Trans-­Blot® Turbo™ Transfer System Bio-­Rad laboratories PVDF membrane Thermo Scientific Table 1: Equipment and kits used in our research. Here you can see a list of equipment and kits were used in the experiment and their manufacturer. 3.2 List of solutions: List of Solutions Solution: Manufacturer: TBS Quality Biological 99% ethyl alcohol Pharmco-­AAPER 0.5% Trypsin-­EDTA Gibco® by life technologies PBS Quality Biological™ DPBS Corning Cellgro™ DMEM Corning Cellgro™ IMIM Quality Biological™ 17 EMEM Quality Biological™ RPMI-­1640 Corning Cellgro™ Opti-­MEM Gibco® by Life-­Technologies Glutamine Corning Cellgro™ Pen Strep Gibco® by Life-­Technologies FBS Corning Trypsin-­EDTA Gibco® by Life-­Technologies Tween 20 (Polysorbate 20) Amresco® Odyssey® blocking buffer LI-­COR Biosciences Trypan Blue Solution Mediatech Inc. NuPage® MES Running Buffer (20x) Novex® by Life Technologies Nuclease free water Promega Bovine Serum Albumin Fraction V (BSA) Roche Diagnostics GmbH SAHA Cellike Chemicals Chloroquinine Sigma-­Aldrich® AR42 Cellike Chemicals α-­Carboxybenzylpenicillin disodium salt(cat. no Sigma (cat. no C1389) C1389) G418 Corning Cellgro™ Puromycin Sigma-­Aldrich® Blastocidin Life Technologies T4 DNA ligase NEB T4 DNA ligase buffer 10x NEB Histone H3 Mouse mAb. Cell Signaling Tri-­Methyl-­Histone H3 (k4) Rabbit Ab Cell Signaling Donkey anti-­Mouse antibody LI-­COR® Donkey anti-­Rabbit antibody LI-­COR® Precision Plus Protein™ Kaleidoscope™ Bio-­Rad laboratories Prestained Protein Standard Cutsmart 10 buffer NEB Phusion Master Mix with GC Buffer Thermo Scientific NEBNExt® High Fidelity 2xPCR Master Mix NEB NcoI NEB XbaI NEB BglII NEB KpnI NEB NheI NEB 18 XhoI NEB PshaI NEB SalI NEB SOC medium Invitrogen Lipofectamine 2000 Invitrogen Polybrene Sigma-­Aldrich® Sucrose Sigma-­Aldrich® EtBr Sigma-­Aldrich® EDTA Quality Biological Glacial Acidic Acid J.T. Baker Table 2: Solutions used in our research. Here you can see a list of solutions that were used in experiments and their manufacturer. 3.3 Maintenance of cell culture: All cell lines were maintained in a incubator at 37°C and 5% CO2 unless otherwise stated. HEK293, HCT116-­ and HeLa cells were cultured in DMEM with 10%FBS, 1% glutamine and 1% Pen Strep. Jurkat cells were cultured in RPMI 1640 with 10%FBS, 1% glutamine and 1% Pen Strep. K562 cells were cultured in IMDM with 10%FBS, 1% glutamine and 1% Pen Strep. SK-­N-­SH cells were cultured in EMEM with 10%FBS, 1% glutamine and 1% Pen Strep (see appendix part 1). Cell line Linage Tissue Type of Cancer Karyotype Origin Colorectal Near-­diploid, 45 chr. Human Male Carcinoma Chr. Y missing Type HCT116 Ectoderm Colon [70, 71] HEK293 Mesoderm [72-­74] HeLa Ectoderm Kidney Embryonic kidney Hypotriploid, 64 chr., Human Aborted (neuron-­
cell like) Adenovirus 5 DNA 22. Cervix Cervical Hypertriploid/anaploid, Human Female Carcinoma 50 chr. 3* chr. 1, 7, 10, [75] containing 3* X chr. 4* chr. 17 and Fetus (Female) 12, 14, 15, 17 and 18. 1* chr. 2,3,6. Chr. 13 missing Jurkat [76] Mesoderm Blood Acute T cell Pseudodiploid 46 chr. leukemia Del. chr. 2 (p21p23) Del. chr. 18 (p11.2) 19 Huma Male Child K562 [77] Mesoderm Blood Chronic Triploid, 69 chr. Human Female Myelogenous Leukemia SK-­N-­SH Ectoderm Brain Neuroblastoma [78, 79] Hyperdiploid, 47 chr. Human Female 3* chr. 7. 1* chr. 9 and Child 22 Table 3: List over cell lines and their features. Here you can see the various cell types used for the experiments, their tissue of origin, and there chromosome complement. 3.4 Epigenetic reporter systems: Bjornsson et al. previously made two epigenetic reporter systems[80]. One system serves as an indicator for the activity of Trithorax system, which places the H3K4me3. The other serves as a similar indicator for Histone 4 Acetylation (H4Ac) . Both indicators have been stably transfected into HEK293 WT cell lines. For instance, when H3K4me3 activity of the cells increases this leads to more recognition of the tail by the TAFIII bromodomain which only recognizes the H3K4me3 modified tail. This then causes the two halves of a separated GFP (Green Fluorescence Protein) to come together thereby restoring fluorescence, which can be quantified using various instruments[80]. The same principle works for the acetyl indicator that has a different histone tail (H4) and a different recognition domain (TAF-­PHD finger) which only recognices the H4Ac modified tail[80]. The cells containing inserted indicators were inoculated in several 12 well plates, one for each set temperature. When cells attached to the plate, they were exposed for 24 hours to one of the individual temperature;; 26°C, 29°C, 32°C, 37°C or 40°C. All experiments were done in triplicate or more. Furthermore, we included cells exposed to HDACi (AR42 and/or SAHA) as positive controls at each temperature (2-­3 wells for each HDACi). After the incubation we measured the percentage of cells that showed fluorescence above positive control cells with a BD FACS™ Universal loader. The FACS data were then analyzed with the software FlowJo and then Microsoft Excel and R-­studio for further analysis (see appendix part 2). 20 3.5 Western blotting: We performed Western blotting on HEK293 WT cells exposed to various temperatures. Briefly, cells were grown in a T75 flask. When cells achieved 70-­90% confluence we transferred one flask to one of the individual temperature;; 26°C, 29°C, 32°C, 37°C or 40°C. The cells were incubated for 24 hours. We then harvested cells and performed nuclear protein extraction[81]. We either went directly to the extraction or froze the cells and stored at -­80°C. We used 25 mg of protein from each set temperature for an individual Western blot. Protein was transferred from gel to a PVDF membrane (Thermo Fisher Scientific) using a Trans-­Blot® Turbo™ Transfer System (Bio-­Rad laboratories). We used antibodies against H3K4me3 (rabbit, 9727L, Cell Signaling) in the ratio 1:1000 and H3 (mouse, 96C10, Cell Signaling) in the ratio 1:2000 as a control. We used a LI-­COR Biosciences instrument to image the membrane. ImageJ and Microsoft Excel were used for quantitative analysis (see appendix part 3). 3.6 Temperature expression indicators: We designed and created three different expression indicators that we expected to respond to temperature stimuli. These included a CIRP indicator, a SP1 Long indicator and a SP1 Short indicator. They were all based on the same basic plasmid backbone, PGL4.10 plasmid (Promega, #9PIE665). To create our indicators, we excised the luciferase sequence that is usually found in this plasmid and replaced it with a sequence encoding GFP. In front of the GFP sequence we placed a promoter sequence from either CIRP (451 base pairs), SP1 short (261 base pairs) or SP1 Long (1618 base pairs) promoter. The CIRP promoter we used was of mouse origin but the SP1 promoters were of human origin. CIRP promoter sequence is highly conserved between mouse and human[41, 45]. We made two versions of each indicator that were with and without a neomycin cassette (Figure 1). Indicators containing the neomycin cassette were used to make stable cell lines and without the neomycin casett for transient transfection. The length of stable CIRP indicator plasmid was 5890 base pairs, the length for the stable SP1 Short plasmid was 5722 base pairs and the length of the stable SP1 Long plasmid indicator was 7079 base pairs. In stable cell lines we presume that the indicator has been integrated into the HEK293 WT cells genome. We used G418 to select for the stable cell line. After preliminary studies of all indicators on HEK293 cells with transient transfection we decided to use the SP1 Short indicator given it’s superior response to temperature changes. The SP1 Short indicator without the neomycin cassette was used for transiently transfect into various cell lines: HCT116, HeLa, HEK293, Jurkat, K562 and SK-­N-­SH (Table 1). We used Lipofectamine 2000 (Invitrogen) to transiently transfect HCT116, HeLa, HEK293 and SK-­N-­SH. We used electroporation, Bio-­Rad gene pulser Xcell™ (Bio-­rad laboratories), to transiently transfect Jurkat and K562 cell lines. We exposed the cells for either 8 or 32 hours at 37°C. Subsequently we transferred the cells to one of the following individual temperatures;; 26°C, 29°C, 32°C, 37°C or 40°C for 16 hours before FACS analysis and further analysis (see section 3.7). It has been previously demonstrated that upregulation of CIRP happens after 12 hours at 32°C and we assumed it was the same for SP1 since SP1 is known to controls CIRP expression[13, 41] (see appendix part 4). 21 Figure 1: Structure of stable temperature expression indicators. A) A depiction of the stable CIRP plasmid indicator which contains the CIRP promoter followed by GFP encoding sequence, that causes fluorescence, and a neomycin casette. B) A depiction of the stable SP1 Short plasmid indicator indicator which contains the SP1 Short promoter followed by GFP encoding sequence, that causes fluorescence, and a neomycin casette. C) A depiction of the stable SP1 Long indicator indicator which contains the SP1 Long promoter followed by GFP encoding sequence, that causes fluorescence, and a neomycin casette. D) GFP fluorescence at 4x amplification of CIRP plasmid indicator as seen under BZ-­X710-­All-­in-­One Fluorescence microscope (KEYENCE) . E) GFP fluorescence at 4x amplification of SP1 Short indicator as seen under BZ-­X710-­All-­in-­One Fluorescence microscope (KEYENCE). F) GFP fluorescence at 4x amplification of SP1 Long indicator as seen under BZ-­X710-­All-­in-­One Fluorescence microscope (KEYENCE). 3.7 Collection and analysis of data: We used a FACS instrument called BD FACS™ Universal loader (BD Biosciences) and a software that comes with the machine for measuring fluorescence. For the stably integrated epigenetic indicators we used percentage of GFP positive cells. For the temperature dependent indicators we used Mean Fluorescence (MF) of cells using the rationale that this would adjusts for the transient transfection rate, which is a obvious confounder[82]. For each cell line we used the same untransfected cell line as a control, therefore we used untransfected cells incubated at 37°C for 42 hours prior to analysis as a gate for single cells in both FACS and FlowJo analysis. We used FlowJo 10.1r5. software to further analyze the data from the FACS assay, exported from FACS as .fcs files. Then we transported the data from FlowJo to Microsoft Excel. From there, the data was adjusted in Excel by subtracting the mean value of MF from the untransfected cells at each temperature from each value of MF (we had triplicates of wells for transient transfected cells at each temperature). We did this for all of the cell lines that were 22 transiently transfected with temperature indicators. By adjusting the numbers in this way we were attempting to correct for the machine’s MF background. The Excel data were then imported as a comma separated value (.csv) file to R-­studio. In R-­studio we made boxplots, jitter plots and performed a Tukeys HSD test. The boxplots used are traditional boxplots. To make the jitter plots we used the ggplot2 package in R-­studio. The jitter plots have a mean bar for each group. Where each dot stands for a well of cells exposed at set temperature and MF value measured with BD FACS™ Universal loader. The P values were calculated with Tukeys HSD test to disprove the null hypothesis that there was no significant difference between means of compared groups. Stacked line charts and line charts were made in Microsoft Excel. All line charts are comparison plots that were made from mean (adjusted) average for what was measured (either percentage GFP positive or MF) at each temperature divided by the mean (adjusted) average for 37°C. Mean adjusted average was calculated by substracting the mean background fluorescence for the same untransfected cell line by taking the mean of each transiently transfected cell line at the same temperature. This was done in all cell lines transiently transfected with temperature indicators. Mean average was calculated from the mean of all values at each temperature, this was done for methyl-­ and acetyl indicators. This allowed us to see the differences in percentages between different temperatures. The temperature used for normalization (37°C) was always 1. An outcome over 1 indicated increased fluorescence, whereas an outcome under 1 indicated decreased fluorescence. For analyzing the western blot we used a LI-­COR Biosciences instrument to image the membrane. Then the ImageJ software was used to quantify each protein band in the image. Then Microsoft Excel was used for quantitative analysis and calculations of ratios. We used Sanger Sequencing through the GRCF to verify the sequence product, yield after each PCR step in the making of temperature indicators. We used FinchTV to analyze the Sanger Sequence and BLAST (NCBI) to align the sequence to the human genome. Then we could identify the genome sequence and detect if any mutations had yielded after each PCR. 3.8 GeCKO genome scale CRISPR knock out screening: We ordered the GeCKO Genome Scale CRISPR Knock out lentiCRISPRv2 vector from the Addgene repository (Addgene, plasmid #52961). We then amplified the lentivirus as has been previously described[83, 84]. We next grew the lentivirus, isolated it with an ultracentrifuge and calculated lentiviral copy number with a quantitative PCR and analyzed in excel as Kutner et al. described[85]. From there 6
we got our lentiviral concentration, 25.65*10 virus/mL. We hypothesized that if we could create a cell line that has a highly responsive stably integrated indicator ( we used SP1 Short indicator and HEK293 cells after preliminary studies) and with combining the use of GeCKO on that cell line, then we could perform a forward mutagenesis screen that would yield a list of genes that play a role in upregulating SP1. The Gecko lentivirus mixture contains a library of LentiCRISPRv2 that have different guide RNA´s (sgRNA) that direct the vector to one of 19,050 genes. The lentiCRISPR2v contains a Cas9 protein that makes nicks in the sequence and the vector gets integrated there. Then non homologus end joining (NHEJ) system tries to repair the nick and then 23 the vector gets locked in the sequence. With transducting the cells with the rate of 0.8 virus/cell, supposedly only yields in one knock-­out in each cells genome, we plan to use HEK293 SP1 short integrated cell line. We transduced the virus in 0.5 mL of medium containing 8µg/mL polybrene for 20 hours as Kutner et al. described[85]. The lentiCRISPRv2 has a puromycin-­resistance sequence. We start selecting cells that have integrated the vector the day after transduction using 1 µg/mL puromycin and select for a week. We then expose the cells to 32°C for 16 hours. We then plan to use a cell sorter to select cells that either demonstrate low fluorescence, high fluorescence or no fluorescence compared to control. The untransducted HEK293 stably integrated SP1 Short indicator cell line acts as a control. By sequencing the guide RNA´s in those cells we find out where in the genome they were inserted, in what gene knock out was performed. We expect overrepresentation of genes that participate in the gene regulation of SP1 either positively or negatively, respectively. Therefore, upon next generation sequencing of the mixtures of sgRNA tags, one would expect multiple hits of the critical factors[83, 84]. This work is currently underway. 4 Results
4.1 Does global activity of Trithorax ortholog in humans (H3K4me3 activity) increase with cold stimulus? Does the activity of Trithorax orthologs increase more than other systems (H4 acetylation)? When we exposed the epigenetic indicators to individual temperatures we observed different patterns for the methyl-­ and acetyl indicator (figure 3). For the acetyl indicator we only observed a significant change at the very coldest temperatures (figure 2A) but not at the warmer temperatures (figure 2B). In contrast, the methyl indicator demonstrated significant (P˂0.001) changes in compared mean of MF at all individual temperatures (figure 2C and 2D). The percentage of cells that showed fluorescence above control line for cells carrying the methyl indicator was inversely correlated with cold temperature exposure (figure 2C and 2D). For the methyl indicator we observed an increase in mean of MF at 40°C compared to 37°C (figure 2D). We also observed a bigger absolute change in fluorescence ratio for the methyl indicator compared to the acetyl indicator with colder temperature stimuli than 37°C (figure 3). 24 Figure 2: Response of epigenetic indicators to individual temperature stimuli. A depiction of boxplots for acetyl and methyl indicators at different temperatures. A) Acetyl indicator at the lower temperature batch shows significant differences between individual temperature. N=8. B) Acetyl indicator at the higher temperature batch. N=8. C) Methyl indicator at lower temperature batch shows significant differences between compared means. N=9. D) Methyl indicator at higher temperature batch shows significant differences between compared means. N=9. Normalized GFP (ratio)
6
5
4
3
2
1
0
24,5℃
26℃
27,5℃
29℃
Methyl
32℃
37℃
40℃
Acetyl
Figure 3: Percentage GFP positive cells at set temperature divided by percentage GFP positive cells at 37°C for acetyl-­ and methyl indicator. A depiction of a stacked line chart of normalized GFP fluorescence for both acetyl and methyl indicators. Fluorescence of indicator at set temperature normalized to fluorescence at 37°C for the same indicator (ratio). The acetyl indicator shows increase in percentage GFP positive cells with exposure to colder temperature stimuli. The methyl indicator shows increase in percentage GFP positive cells with 25 temperature stimuli lower than 37°C. Also the methyl indicator shows increase in GFP positive cells at 40°C compared to 37°C. The lowest point in GFP positive cells is at 37°C for the methyl indicator but at 40°C for the acetyl indicator. For calculation methods see section 3.7. To validate these findings with an independent method we performed a western blot using a primary antibody against H3K4me3 at different temperatures. Interestingly, this method showed trend toward increased H3K4me3 with colder temperature stimuli, after quantitative analysis although the changes were subtle. (Figure 4). C)
Normalized intensity (ratio)
1,4
1,2
1
0,8
0,6
0,4
0,2
0
26℃
29℃
32℃
37℃
40℃
Figure 4: Western blot on HEK293 WT cells after temperature exposure for 24 hours. A) A depiction of H3 immunostaining in a western blot which was used as a control. B) A depiction of H3K4me3 immunostaining in a western blot. C) Line chart of quantification of each H3K4me3/H3 ratio at set temperature normalized to H3K4me3/H3 ratio at 37°C. For calculation methods see section 3.7. 4.2 Can we develop approaches that would facilitate the study of cold stimulus in cellular systems? We made three types of temperature dependent expression indicators. In the fluorescent microscope we could observe green fluorescence. (Figure 1D, 1F and 1C) Each one of these demonstrated significantly (CIRP P<0.05, SP1 Long P<0.01, SP1 Short P<0.001) increased expression 26 when exposed to hypothermic stimuli when mean of MF was compared between 32°C and 37°C (figure 5 and 6). Figure 5: Response of epigenetic indicators to individual temperature stimuli. A depiction of jitter plots for different temperature indicators. A) CIRP indicator at lower temperature batch. N=3. B) CIPR indicator at higher temperature batch shows significant differences in compared means. N=3. C) SP1 Long indicator at lower temperature batch. N=3. D) SP1 Long indicator at higher temperature batch shows significant differences in compared means of 32°C compared with 37°C and 32°C compared with 40°C. N=3. E) SP1 Short indicator at lower temperatures batch. N=3. F) SP1 Short indicator at higher temperature batch shows significant differences in compared means of 32°C compared with 37°C and 32°C compared with 40°C. N=3. 27 1,60
1,40
Normalized MF value (ratio)
1,20
1,00
0,80
0,60
0,40
0,20
0,00
26℃
29℃
32℃
CIRP
SP1 Long
37℃
40℃
SP1 Short
Figure 6: Line chart of normalized MF value for all temperature indicators under different temperature stimuli. A depiction of a stacked line chart of adjusted MF value at set temperature normalized to adjusted MF value at 37℃ for all temperature indicators (ratio). They all show the same pattern with increased expression at 32°C compared to 37°C and 40°C. Then there is decreased expression at 29°C compared to 32°C and increased again at 26°C compared to 29°C. For methods of calculation see section 3.7. We next plotted the results in one graph for all indicators where each temperature group was plotted as a ratio compared to the 37°C group for each indicator (figure 6). This revealed that SP1 short demonstrated the biggest ratio increase from 37°C and CIRP showed the least dramatic difference. Based on these data we performed further experiments using SP1 Short indicator. 4.3 Do genes known to be upregulated with cold stimuli show maximal response at temperature used for therapeutic strategies? Therapeutic cold temperature used in medicine today ranges between internal temperature of 32°C and 35°C[62, 65]. We observed the greatest increase in fluorescence of all of our temperature indicators at 32°C (figure 6). The increase between means of MF value for 32°C and 37°C were significant for all three indicators (P ˂ 0.05 for CIRP, P˂0.01 for SP1 Long, P˂0.001 for SP1 Short) (figure 5). Therefore, it does appear that all three indicators show maximal activity at the exact temperature that is most frequently used in clinical medicine. 28 4.4 Is the cellular cold response observed in all cellular systems or does it depend on the tissue of origin? Our results suggest that different types of cells do not demonstrate identical responses to cold temperature stimuli. For instance for HEK293 cells, originally derived from human embryonic kidney but thought to have properties of neuronal cells, we observed the most drastic ratio increase of all cell lines, a 42% increase in MF ratio at 32°C compared to 37°C (figure 8)[72]. SK-­N-­SH, a neuroblastoma cell line, showed a 36% increase in MF ratio at 32°C compared to 37°C (figure 8)[79]. The HEK293 (figure 5D) and the SK-­N-­SH (figure 7J) were the only cell lines to show a significant (SK-­N-­SH P<0.001, HEK293 P<0.001) different MF upon comparing results from 32°C to 37°C. Other cell lines such as HCT116, a colon cancer cell line, and HeLa, a cervical cancer line, showed a more subtle increases and no signifant changes in fluorescence with exposure to lower temperature (figure 7B and 7D)[71, 75]. Jurkat cells, acute T-­cell leukemia cells, showed non-­significant changes in exposure to all individual temperatures (figure 7E and 7F)[76]. K562, a chronic myeloid leukemia cell line, showed a sharp non-­significant increase at 32°C compared to 37°C (figure 7H)[77]. HEK293 and K562 showed an upside down V-­pattern in MF ratio (figure 8). HeLa and HCT116 showed a broad parabola in MF ratio, an increase when exposed to middle range temperature stimuli and a decrease of fluorescence with highest and lowest temperature stimuli (figure 8). SK-­N-­SH cells showed a unique pattern in MF ratio that was a slope, that had higher value when exposed to colder temperature stimuli from 32-­40°C, but after 32°C there is minimal change of MF ratio (figure 8). Jurkat cells showed a unique pattern in MF ratio (figure 8). 29 30 Figure 7: Fluorescence of transiently transfected SP1 Short indicator to different cell lines at different temperature stimuli. A depiction of jitter plots for different cell lines transiently transfected with SP1 Short indicator. A) There is a significant change between compared means for 26°C vs. 29°C for HCT116 cells. N=3. B) There is a significant change between compared means for 32°C vs. 40°C and 37°C vs. 40°C for HCT116 cells. N=3.C) There is a non-­significant change in means between all compared temperatures for HeLa cells. N=3. D) There is a significant change between means at 32°C vs. 40°C and 37°C vs. 40°C for HeLa cells. N=3. E) There is a non-­significant change between any temperature for Jurkat cells. N=3. F) There is a non-­significant change between any temperature for Jurkat cells. N=3. G) There is a non-­
significant change between any temperature for K562 cells. N=3. H) There is a significant change between 32°C vs. 40°C and 37°C vs. 40°C for K562 cells. N=3. I) There is a significant change in means between 26°C vs. 37°C and 29°C vs. 37°C for SK-­N-­SH cells. N=3. J) There is a significant change between all compared means, 32°C vs. 40°C, 37°C vs. 40°C, 32°C vs. 37°C for SK-­N-­SH cells. N=3. 31 1,8
Normalized MF value (ratio)
1,6
1,4
1,2
1
0,8
0,6
0,4
0,2
0
26℃
Jurkat
29℃
HeLa
32℃
HCT116
SK-­‐N-­‐SH
37℃
K562
40℃
HEK293
Figure 8: Line chart of normalized MF value for all cell lines transiently transfected with SP1 Short indicator under different temperature stimuli. A depiction of adjusted MF value at set temperature normalized to adjusted MF value at 37℃ (ratio) for all cell lines transiently transfected with SP1 Short indicator. Jurkat cells show a pattern with increased MF value with higher temperature. HeLa cells show a parabola pattern with a peak at 32°C (HeLa cells, 26°C and 29°C on x-­axis were 24°C and 27.5°C). HCT116 cells show a parabola pattern with a peak at 29°C. SK-­N-­SH cells show an increase in MF value until 32°C then it shows a plateau when exposed to colder temperature stimuli. K562 cells show a upside down v-­shape pattern with a sharp increase at 32°C. HEK293 cells show a sharp increase at 32°C, then lower value at 29°C and again an increase at 26°C. For methods of calculation see section 3.7. 5 Discussion The research indicates that there is a trend towards increased H3K4me3 with hypothermic stimuli (figure 2,3 and 4). We observed increased fluorescence as a marker of increased CIRP and SP1 expression with cold stimuli (figure 5 and 6). Our indicators are a novel way to observe increased SP1 and CIRP expression, with single cell resolution. The differential temperature response was most prominent for our SP1 short indicator (figure 6). Given these findings, this indicator was used for further studies. Next, we wanted to elucidate whether cell type specific factors impact the cellular response. We saw hithero undescribed distinct patterns in different human cell lines when exposed to different temperature stimuli. It is key to elucidate this prior to performing a forward mutagenesis screen as the success of such a screen will be judged by the strength of the change in the fluorescence signal. We established that the optimal cell type for a mutagenesis screen are the HEK293 cells at 32°C of all the cell lines investigated (figure 8). Therefore, we made a HEK293 cell line with stably integrated SP1 Short indicator. 32 The acetyl and methyl indicators were used to investigate if epigenetic systems showed any response to temperature stimuli. The significant increase for all mean comparisons in H3K4me3 observed when the methyl indicator was exposed to cold temperature (figure 2 and 3) could be an overestimate of the real response as we did not see the same clear increase when the western blot was done (figure 4A and 4B). Alternatively, this could merely indicate that the indicator is more sensitive than the western blot. The subtle response could relate to the fact that H3K4me3 may be occurring at specific sites or it could be that there is a change in which genes are marked but not a global induction of H3K4me3. With the temperature indicators we were trying to build a tool-­kit that could help us investigate the mechanishm of therapeutic effects of low temperature in humans. There were significant differences in the mean of MF value between compared groups at the temperature that is known to have the most therapeutic effect in human medicine for all indicators (figure 5)[62, 65]. This increased fluoroscence, which indicates increased expression of SP1 and CIRP genes at 32°C compared to 37°C is consistent with prior studies[13, 41]. This indicates that the CIRP -­ SP1 pathway could play a role in the positive effects of hypothermia or perhaps other genes that are also upregulated at exactly same temperature. However, this is a testable hypothesis. We could either overexpress or delete CIRP (or other relevant factors) in mice and see whether they have different outcomes after e.g. perinatal asphyxia. However, to systematically evaluate this it would be important to know all the factors that are involved. By transiently transfecting the SP1 Short indicator to different cell lines then we were able to answer two different question, whether there was a distinct pattern observed between different human cell lines and which cell line was the most suitable for further investigation. When cancer-­cell lines were transiently transfected with the indicator, we observed notably different patterns of fluorescence after exposure to varying temperatures. We have hypothesized that the different patterns observed in individual cell types could either relate to the different genetic complements of these cells (Table 3) or because they orginate from different tissues. Interestingly we observed biggest MF ratio increase in the HEK293 and SK-­N-­SH cells at 32°C (figure 8). Furthermore, HEK293 and SK-­N-­SH were the only cell lines that had significant difference in mean of MF value when value at 32°C was compared with value at 37°C (figure 5 and 7). HEK293 has well established neuronal-­like features and SK-­N-­SH is a neuroblastoma cell line [74, 79]. Hypothermia as a therapeutic strategy appears to have robust effects on minimizing neurological damage[60, 63, 64]. However, at a temperature below 32°C we observed different patterns for these two cell lines in MF ratio (figure 8). Jurkat cells, did not show any significant response in fluorescence with different temperature exposure (figure 7E and 7F). The Jurkat cell line is of lymphocyte origin, cells that travel throughout the body and are exposed to differential temperatures [86, 87]. Interestingly, for another cell line of lymphocyte origin, K562, we observed significant change in mean of MF value between some temperatures (figure 7G and 7H). The lymphocytes’ differing responses to temperature stimulus could indicate that the difference seen between cell lines is because of different genomic complements rather than the tissue of origin. Possible confounders of our work include: 1) We did not see the same percentage of positive transiently transfected cells at different temperatures. Also, even though we plaicined identical amounts 33 of cells in each well, the wells located at higher temperatures had more cells in them. This is most likely due to increased cell proliferation at higher temperature[88]. This could theoretically dilute out the signal in the higher temperatures. For future studies we will consider co-­transfection with an unmodified RFP as a control for transfection efficiency. 2) Bleaching of signal due to exposure to room temperature while processing samples. During analyses the cells were covered in aluminum foil and kept on ice. We think that this is unlikely to have an effect on the FACS assay, whereas the GFP protein is stable for long time and process time is 0.5-­2 hours[89]. This confounder is hard to remedy. However, in the future we will only perform studies on small batches to minimize this effect. 3) We only had 3 incubators so we had to split each experiment up to two batches. Consequently, we had to freeze down the cells which were exposed to 26°C, 29°C, and 37°C-­1 and store at -­80°C before histone isolation prior to western blotting. The optimal way would have been to expose the cells on the same time to all of the different temperatures. To minimize the bias caused by this then we always had at 37°C control. During analyses and calculation of ratios then each temperature was always calculated as a ratio compared to the 37°C sample in its cohort. In the future we will try to get access to more incubators. 4) We saw some increase in the acetyl indicator fluorescence with lower temperature stimuli. The fluorescence percentage positive cells were under 1% at all temperatures. The increase that we saw for the acetyl indicator is most likely due to either cell proliferation, self-­ fluorescence of the indicator, or background fluorescence. For the acetyl-­ and methyl indicators we had a positive control (cells exposed to HDACi) but no negative controls (untransfected HEK293 cells). We could then use the negative control to adjust for the background fluorescence;; this is something we will do in future experiments. 5) In one slot then the incubator was set to 26°C and 29°C, but the internal thermometer showed 24°C (supposed to be 26°C) and 27.5°C (supposed to be 29°C) after 16 hours incubation time, in beginning the temperatures were right. This was observed in the colder temperature batch for transiently transfected SP1 Short indicator to HeLa cells (figure 7C, 7D and 8) and acetyl indicator cells (figure 2A, 2B and 3). We could have adressed this with repeating the experiment, but there was not enough time. 6) We got the HCT116, HeLa and Jurkat from other labs. When receiving a cell line from other investigators you can not be absolutely sure which cell line you are receiving[90]. However, for future work, we can have cell types verified by the Hopkins cellular repository. 7) Limited time that the student had to complete the project. The strength of this study is that we made three novel fluoroscence indicators that allow rapid evaluation of gene expression of SP1 and CIRP with single cell resolution. Having these indicators either integrated or transiently transfected in various cell line is a new way to measure the gene expression of genes known to be upregulated with cold stimuli[13, 41]. When GeCKO and SP1 short indicator are applied together in a cell line, then we have a new effective approach to see which genes are important in human cell reaction to cold temperature stimuli, little is known about this pathway and much is to gain. 34 5.1 Future steps There are a few outstanding questions that still need to be answered. Does the Trithorax system through the H3K4me3 regulate the known SP1 -­ CIRP hypothermia pathway? Which other genes contribute in the SP1 -­ CIRP hypothermia pathway[13]? Were the differences we observed in different cell lines transfected with SP1 Short indicator due to their different tissue of origin or to the fact that many of these cells have missing or amplified genetic sequences? For the epigenetic system part then we plan to perform ChIP Seq. (Chromatin Immunoprecipitation Sequencing) followed by next generation sequencing to know where in the genome factors of interest are placed. We would use an antibody that recognizes H3K4me3 to elucidate the specific sites where H3K4me3 modifications significantly changes in response to cold stimuli[91]. To be able to answer the outstanding questions we need to do a forward mutagenesis screen. We hypothesize that our temperature indicators coupled with GeCKO mutagenesis assay opens up the ability to identify many of important factors in the SP1 – CIRP pathway. This would be an unbiased way of getting to the factors needed to upregulate SP1. We hope that this approach will lead us to which of the 19,050 targeted genes are relevant to the SP1 -­ CIRP hypothermia pathway (human have around 20.000 encoding genes[92]). This is a high throughput assay and we should at least get some of the most relevant genes. Then we would validate the list of relevant genes with ChIP-­Seq. and siRNA assay for each gene. ChIP-­Seq. gives a snapshot of whether a protein is interacting with a particular genomic sequence at a given time time. We would use an antibody specific for protein of interest and then use high-­throughput sequencing[91]. On the other hand, siRNA pair to the mRNA of protein of interest and causes it to degrade and results in no translation of the protein[93]. We could then do the siRNA assay to our stable HEK293 SP1 Short indicator cell and see if fluorescence changes in the same we as seen with the Gecko approach. This forward based mutagenesis assay is underway. This forward mutagenesis screen opens up the possibility to develop a pharmacological strategy to capture some of the positive effects of hypothermia without the need to anesthetize. Better understanding of the pathway could explain why not everyone shows a favorable outcome after hypothermc therapy and also could lead to reduced side effects e.g. hypokalemia and shivering[65, 94]. With knowledge of the basic mechanism then we first have the opportunity to practice the benefits of hypothermic therapeutics as the Hippocratic oath suggests;; Primum non nocere. 35 References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. Watson, J.D. and F.H. Crick, The structure of DNA. Cold Spring Harb Symp Quant Biol, 1953. 18: p. 123-­31. Alberts B, J.A., Lewis J, et al., Molecular Biology of the Cell, The Structure and Function of DNA. . 4th edition. ed. 2002. , New York: Garland Science. Egger, G., et al., Epigenetics in human disease and prospects for epigenetic therapy. Nature, 2004. 429(6990): p. 457-­463. Jin, B., Y. Li, and K.D. Robertson, DNA Methylation: Superior or Subordinate in the Epigenetic Hierarchy? Genes Cancer, 2011. 2(6): p. 607-­17. Yang, X., et al., Gene Body Methylation can alter Gene Expression and is a Therapeutic Target in Cancer. Cancer cell, 2014. 26(4): p. 577-­590. van der Wijst, M.G., et al., Local chromatin microenvironment determines DNMT activity: from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase. Epigenetics, 2015. 10(8): p. 671-­6. Bellacosa, A. and A.C. Drohat, Role of base excision repair in maintaining the genetic and epigenetic integrity of CpG sites. DNA Repair (Amst), 2015. 32: p. 33-­42. Luger, K., et al., Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 1997. 389(6648): p. 251-­60. Davey, C.A., et al., Solvent mediated interactions in the structure of the nucleosome core particle at 1.9 a resolution. J Mol Biol, 2002. 319(5): p. 1097-­
113. Mariño-­Ramírez, L., et al., Histone structure and nucleosome stability. Expert Rev Proteomics, 2005. 2(5): p. 719-­29. Jin, C. and G. Felsenfeld, Nucleosome stability mediated by histone variants H3.3 and H2A.Z. Genes Dev, 2007. 21(12): p. 1519-­29. Bannister, A.J. and T. Kouzarides, Regulation of chromatin by histone modifications. Cell Res, 2011. 21(3): p. 381-­395. Sumitomo, Y., et al., Identification of a novel enhancer that binds Sp1 and contributes to induction of cold-­inducible RNA-­binding protein (cirp) expression in mammalian cells. BMC Biotechnol, 2012. 12: p. 72. Waterland, R.A. and C. Garza, Potential mechanisms of metabolic imprinting that lead to chronic disease. American Journal of Clinical Nutrition, 1999. 69(2): p. 179-­197. Morgan, H.D., et al., Epigenetic inheritance at the agouti locus in the mouse. Nat Genet, 1999. 23(3): p. 314-­8. Buiting, K., et al., Epimutations in Prader-­Willi and Angelman syndromes: a molecular study of 136 patients with an imprinting defect. Am J Hum Genet, 2003. 72(3): p. 571-­7. Waterland, R.A. and R.L. Jirtle, Transposable elements: targets for early nutritional effects on epigenetic gene regulation. Mol Cell Biol, 2003. 23(15): p. 5293-­300. Bygren, L.O., et al., Change in paternal grandmothers' early food supply influenced cardiovascular mortality of the female grandchildren. BMC Genet, 2014. 15: p. 12. Schaefer, S. and J.H. Nadeau, THE GENETICS OF EPIGENETIC INHERITANCE: MODES, MOLECULES, AND MECHANISMS. Q Rev Biol, 2015. 90(4): p. 381-­415. 36 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. Painter, R.C., et al., Transgenerational effects of prenatal exposure to the Dutch famine on neonatal adiposity and health in later life. Bjog, 2008. 115(10): p. 1243-­9. Veenendaal, M.V., et al., Prenatal famine exposure, health in later life and promoter methylation of four candidate genes. J Dev Orig Health Dis, 2012. 3(6): p. 450-­7. Huypens, P., et al., Epigenetic germline inheritance of diet-­induced obesity and insulin resistance. Nat Genet, 2016. advance online publication. Kim, D.H., et al., Vernalization: winter and the timing of flowering in plants. Annu Rev Cell Dev Biol, 2009. 25: p. 277-­99. Angel, A., et al., A Polycomb-­based switch underlying quantitative epigenetic memory. Nature, 2011. 476(7358): p. 105-­8. Tamada, Y., et al., ARABIDOPSIS TRITHORAX-­RELATED7 is required for methylation of lysine 4 of histone H3 and for transcriptional activation of FLOWERING LOCUS C. Plant Cell, 2009. 21(10): p. 3257-­69. Satake, A. and Y. Iwasa, A stochastic model of chromatin modification: cell population coding of winter memory in plants. J Theor Biol, 2012. 302: p. 6-­17. Xu, L., et al., Di-­ and tri-­ but not monomethylation on histone H3 lysine 36 marks active transcription of genes involved in flowering time regulation and other processes in Arabidopsis thaliana. Mol Cell Biol, 2008. 28(4): p. 1348-­60. Johanson, U., et al., Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science, 2000. 290(5490): p. 344-­7. Diallo, A.O., et al., Expression of vernalization responsive genes in wheat is associated with histone H3 trimethylation. Mol Genet Genomics, 2012. 287(7): p. 575-­90. Villacorta-­Martin, C., et al., Whole transcriptome profiling of the vernalization process in Lilium longiflorum (cultivar White Heaven) bulbs. BMC Genomics, 2015. 16: p. 550. Fellous, A., P. Favrel, and G. Riviere, Temperature influences histone methylation and mRNA expression of the Jmj-­C histone-­demethylase orthologues during the early development of the oyster Crassostrea gigas. Mar Genomics, 2015. 19: p. 23-­30. McMichael, A.J., et al., International study of temperature, heat and urban mortality: the 'ISOTHURM' project. International Journal of Epidemiology, 2008. 37(5): p. 1121-­1131. Curriero, F.C., et al., Temperature and mortality in 11 cities of the eastern United States. Am J Epidemiol, 2002. 155(1): p. 80-­7. Huynen, M., et al., The impact of heat waves and cold spells on mortality rates in the Dutch population. Environmental Health Perspectives, 2001. 109(5): p. 463-­470. O'Neill, M.S., A. Zanobetti, and J. Schwartz, Modifiers of the temperature and mortality association in seven US cities. Am J Epidemiol, 2003. 157(12): p. 1074-­82. van Ooijen, A.M., et al., Seasonal changes in metabolic and temperature responses to cold air in humans. Physiol Behav, 2004. 82(2-­3): p. 545-­53. G.A. Harrison, J.M.T., D.R. Pilbeam, P.T. Baker, Human Biology -­ An Introduction to Human Evolution, Variation, Growth and Adaptability. Vol. 3rd Edition. 1988, Great Britain: Oxford Science Publications. 568. 37 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. Gnaiger, E., et al., Mitochondrial coupling and capacity of oxidative phosphorylation in skeletal muscle of Inuit and Caucasians in the arctic winter. Scand J Med Sci Sports, 2015. 25 Suppl 4: p. 126-­34. Heldmaier, G. and T. Ruf, Body temperature and metabolic rate during natural hypothermia in endotherms. Journal of Comparative Physiology B, 1992. 162(8): p. 696-­706. Danno, S., et al., Increased transcript level of RBM3, a member of the glycine-­
rich RNA-­binding protein family, in human cells in response to cold stress. Biochemical and Biophysical Research Communications, 1997. 236(3): p. 804-­
807. Nishiyama, H., et al., Cloning and characterization of human CIRP (cold-­
inducible RNA-­binding protein) cDNA and chromosomal assignment of the gene. Gene, 1997. 204(1-­2): p. 115-­120. Fujita, J., Cold shock response in mammalian cells. J Mol Microbiol Biotechnol, 1999. 1(2): p. 243-­55. Zhu, X., C. Buhrer, and S. Wellmann, Cold-­inducible proteins CIRP and RBM3, a unique couple with activities far beyond the cold. Cell Mol Life Sci, 2016. Al-­Fageeh, M.B. and C.M. Smales, Alternative promoters regulate cold inducible RNA-­binding (CIRP) gene expression and enhance transgene expression in mammalian cells. Mol Biotechnol, 2013. 54(2): p. 238-­49. Nicolas, M., et al., Cloning and characterization of the 5'-­flanking region of the human transcription factor Sp1 gene. J Biol Chem, 2001. 276(25): p. 22126-­32. Yang, C. and F. Carrier, The UV-­inducible RNA-­binding protein A18 (A18 hnRNP) plays a protective role in the genotoxic stress response. J Biol Chem, 2001. 276(50): p. 47277-­84. Wellmann, S., et al., Oxygen-­regulated expression of the RNA-­binding proteins RBM3 and CIRP by a HIF-­1-­independent mechanism. J Cell Sci, 2004. 117(Pt 9): p. 1785-­94. Lee, H.N., S.M. Ahn, and H.H. Jang, Cold-­inducible RNA-­binding protein, CIRP, inhibits DNA damage-­induced apoptosis by regulating p53. Biochem Biophys Res Commun, 2015. 464(3): p. 916-­21. Wang, M., et al., Expression of cold-­inducible RNA-­binding protein (CIRP) in pituitary adenoma and its relationships with tumor recurrence. Med Sci Monit, 2015. 21: p. 1256-­60. Zhang, Y., et al., Cold-­inducible RNA-­binding protein CIRP/hnRNP A18 regulates telomerase activity in a temperature-­dependent manner. Nucleic Acids Res, 2016. 44(2): p. 761-­75. Liu, Y., et al., Cold-­induced RNA-­binding proteins regulate circadian gene expression by controlling alternative polyadenylation. Sci Rep, 2013. 3. Gerber, A., et al., The systemic control of circadian gene expression. Diabetes Obes Metab, 2015. 17 Suppl 1: p. 23-­32. Nishiyama, H., et al., Decreased expression of cold-­inducible RNA-­binding protein (CIRP) in male germ cells at elevated temperature. American Journal of Pathology, 1998. 152(1): p. 289-­296. Danno, S., et al., Decreased expression of mouse Rbm3, a cold-­shock protein, in Sertoli cells of cryptorchid testis. American Journal of Pathology, 2000. 156(5): p. 1685-­1692. Schroeder, A.L., et al., A Novel Candidate Gene for Temperature-­Dependent Sex Determination in the Common Snapping Turtle. Genetics, 2016. 203(1): p. 557-­71. 38 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. Chappell, S.A., G.C. Owens, and V.P. Mauro, A 5 ' leader of Rbm3, a cold stress-­induced mRNA, mediates internal initiation of translation with increased efficiency under conditions of mild hypothermia. Journal of Biological Chemistry, 2001. 276(40): p. 36917-­36922. Derry, J.M., J.A. Kerns, and U. Francke, RBM3, a novel human gene in Xp11.23 with a putative RNA-­binding domain. Hum Mol Genet, 1995. 4(12): p. 2307-­11. Liu, A.Y., et al., Transient cold shock induces the heat shock response upon recovery at 37 degrees C in human cells. J Biol Chem, 1994. 269(20): p. 14768-­
75. Park, J.A., et al., Differentiation and upregulation of heat shock protein 70 induced by a subset of histone deacetylase inhibitors in mouse and human embryonic stem cells. BMB Rep, 2011. 44(3): p. 176-­81. Dietrichs, E.S. and E. Dietrichs, Neuroprotective effects of hypothermia. Tidsskr Nor Laegeforen, 2015. 135(18): p. 1646-­51. Gregson, W., et al., Influence of cold water immersion on limb and cutaneous blood flow at rest. Am J Sports Med, 2011. 39(6): p. 1316-­23. Niemann, C.U., et al., Therapeutic Hypothermia in Deceased Organ Donors and Kidney-­Graft Function. N Engl J Med, 2015. 373(5): p. 405-­14. Peterson, K., S. Carson, and N. Carney, Hypothermia treatment for traumatic brain injury: a systematic review and meta-­analysis. J Neurotrauma, 2008. 25(1): p. 62-­71. Polderman, K.H., Induced hypothermia and fever control for prevention and treatment of neurological injuries. Lancet, 2008. 371(9628): p. 1955-­69. Group, T.H.a.C.A.S., Mild Therapeutic Hypothermia to Improve the Neurologic Outcome after Cardiac Arrest. New England Journal of Medicine, 2002. 346(8): p. 549-­556. Polderman, K.H. and I. Herold, Therapeutic hypothermia and controlled normothermia in the intensive care unit: Practical considerations, side effects, and cooling methods. Critical Care Medicine, 2009. 37(3): p. 1101-­1120. Polderman, K.H., et al., Ultrarapid Induction of Hypothermia Using Continuous Automated Peritoneal Lavage With Ice-­Cold Fluids: Final Results of the Cooling for Cardiac Arrest or Acute ST-­Elevation Myocardial Infarction Trial. Crit Care Med, 2015. 43(10): p. 2191-­201. Ikeda, K., et al., Evaluation of the short-­term stability of specimens for clinical laboratory testing. Biopreserv Biobank, 2015. 13(2): p. 135-­43. Elliott, P. and T.C. Peakman, The UK Biobank sample handling and storage protocol for the collection, processing and archiving of human blood and urine. Int J Epidemiol, 2008. 37(2): p. 234-­44. Crowley-­Weber, C.L., et al., Development and molecular characterization of HCT-­116 cell lines resistant to the tumor promoter and multiple stress-­inducer, deoxycholate. Carcinogenesis, 2002. 23(12): p. 2063-­80. Roschke, A.V., et al., Stable karyotypes in epithelial cancer cell lines despite high rates of ongoing structural and numerical chromosomal instability. Neoplasia, 2002. 4(1): p. 19-­31. Thomas, P. and T.G. Smart, HEK293 cell line: A vehicle for the expression of recombinant proteins. Journal of Pharmacological and Toxicological Methods, 2005. 51(3): p. 187-­200. Stepanenko, A.A. and V.V. Dmitrenko, HEK293 in cell biology and cancer research: phenotype, karyotype, tumorigenicity, and stress-­induced genome-­
phenotype evolution. Gene, 2015. 569(2): p. 182-­90. 39 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. Shaw, G., et al., Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells. Faseb j, 2002. 16(8): p. 869-­71. ENCODE Project, HeLa (ATCC® CCL-­ 2™). ENCODE Project, Jurkat, Clone E6-­ 1 (ATCC® TIB-­ 152™) ENCODE Project, K562 (ATCC CCL-­243). ENCODE Project, SK-­ N-­ SH (ATCC® HTB-­ 11™) Seeger, R.C., et al., Morphology, growth, chromosomal pattern and fibrinolytic activity of two new human neuroblastoma cell lines. Cancer Res, 1977. 37(5): p. 1364-­71. Bjornsson, H.T., et al., Histone deacetylase inhibition rescues structural and functional brain deficits in a mouse model of Kabuki syndrome. Sci Transl Med, 2014. 6(256): p. 256ra135. Shechter, D., et al., Extraction, purification and analysis of histones. Nat Protoc, 2007. 2(6): p. 1445-­57. Best, A. Understanding MFI in the context of FACS data. 2013, 19 March [cited 2016 17 July];; Available from: http://technical.sanguinebio.com/understanding-­
mfi-­in-­the-­context-­of-­facs-­data/. Sanjana, N.E., O. Shalem, and F. Zhang, Improved vectors and genome-­wide libraries for CRISPR screening. Nat Methods, 2014. 11(8): p. 783-­4. Shalem, O., et al., Genome-­scale CRISPR-­Cas9 knockout screening in human cells. Science, 2014. 343(6166): p. 84-­7. Kutner, R.H., X.Y. Zhang, and J. Reiser, Production, concentration and titration of pseudotyped HIV-­1-­based lentiviral vectors. Nat Protoc, 2009. 4(4): p. 495-­
505. Alberts B, J.A., Lewis J, et al., Molecular Biology of the Cell. 4th ed. 2002, New York: Garland Science. Kenney, W.L., Encyclopedia of Occupational Health and Safety. 4th ed.: International Labor Office. Chapter 42 -­ Heat and Cold. Watanabe, I. and S. Okada, Effects of temperature on growth rate of cultured mammalian cells (L5178Y). J Cell Biol, 1967. 32(2): p. 309-­23. Corish, P. and C. Tyler-­Smith, Attenuation of green fluorescent protein half-­life in mammalian cells. Protein Eng, 1999. 12(12): p. 1035-­40. Gartler, S.M., Apparent Hela cell contamination of human heteroploid cell lines. Nature, 1968. 217(5130): p. 750-­1. Blecher-­Gonen, R., et al., High-­throughput chromatin immunoprecipitation for genome-­wide mapping of in vivo protein-­DNA interactions and epigenomic states. Nat Protoc, 2013. 8(3): p. 539-­54. Pertea, M. and S.L. Salzberg, Between a chicken and a grape: estimating the number of human genes. Genome Biol, 2010. 11(5): p. 206. Carthew, R.W. and E.J. Sontheimer, Origins and Mechanisms of miRNAs and siRNAs. Cell, 2009. 136(4): p. 642-­55. Nielsen , N., et al., Targeted Temperature Management at 33°C versus 36°C after Cardiac Arrest. New England Journal of Medicine, 2013. 369(23): p. 2197-­
2206. Li, X., et al., Deletions of the Aequorea victoria green fluorescent protein define the minimal domain required for fluorescence. J Biol Chem, 1997. 272(45): p. 28545-­9. Cullen, B.R. and M.H. Malim, Secreted placental alkaline phosphatase as a eukaryotic reporter gene. Methods Enzymol, 1992. 216: p. 362-­8. 40 97. 98. Elizabeth D. Chao, K.S. Jurkat Transfection Protocol Using the Electroporation Method. 1999, August 30 [cited 2016 28th June ];; Available from: http://cmgm.stanford.edu/hhmi/crablab/crablab/protocols/jurkat/. Delgado-­Canedo, A., et al., Optimization of an electroporation protocol using the K562 cell line as a model: role of cell cycle phase and cytoplasmic DNAses. Cytotechnology, 2006. 51(3): p. 141-­8. 41 Appendix
1. Recipes for cell culture media: 1.1 Recipe for cell culture media used for HCT116, HeLa and HEK293 cell lines: 1. 500 mL of DMEM (Corning Cellgro™). 2. 50 mL of Fetal bovine serum (Corning). 3. 5 mL of 200mM L-­glutamine (Corning Cellgro™). 4. Mix together and filter through 0.22 µm Cellulose Acetate Sterilizing low binding filter (Corning). 5. Add 5 mL of Penicillin Streptomycin (Pen Strep, Gibco® by Life-­Technologies) to the filtered media 6. Stored at 4°C. 1.2 Recipe for cell culture media, used for Jurkat cell line: 1. 500 mL of RPMI 1640, 1x with L-­glutamine media (Corning Cellgro™). 2. 50 mL of FBS (Corning). 3. 5 mL of 200 mM L-­glutamine (Corning Cellgro™). 4. Solution is mixed and filtered through 0.22 µm Cellulose Acetate Sterilizing low binding filter (Corning). 5. Add 5 mL of Penicillin Streptomycin (Pen Strep, Gibco® by Life-­Technologies) to the filtered media. 6. Stored at 4°C. 1.3 Recipe for cell culture media, used for K562 cell line: 1. 500 mL of IMDM media (Quality Biological™). 2. 50 mL of FBS (Corning). 3. Solution is mixed and filtered through 0.22 µm Cellulose Acetate Sterilizing low binding filter (Corning). 4. Add 5 mL of Penicillin Streptomycin (Pen Strep, Gibco® by Life-­Technologies) to the filtered media. 5. Stored at 4°C. 1.4 Recipe for cell culture media, used for SK-­N-­SH cell line: 6. 500 mL of EMEM media (Quality Biological™). 7. 50 mL of FBS (Corning). 8. Mix together and filter through 0.22 µm Cellulose Acetate Sterilizing low binding filter (Corning). 9. Add 5 mL of Penicillin Streptomycin (Pen Strep, Gibco® by Life-­Technologies) to the filtered media. 10. Store at 4°C. 1.5 Recipe for cell culture media without antibiotics, used for transient transfection: 1. 500 mL of DMEM (Corning Cellgro™). 2. 50 mL of Fetal bovine serum (Corning). 42 3. 5 mL of 200mM L-­glutamine (Corning Cellgro™). 4. Mix together and filter through 0.22 µm Cellulose Acetate Sterilizing low binding filter (Corning). 5. Stored at 4°C. 43 2. Protocol for epigenetic reporter plasmids: 1. See Bjornsson et al. Sci Transl Med. 2014 regarding how the epigenetic indicator constructs were created and their properties. Stable cell lines were previously created. 2. Each stably transfected cell line was grown in T75 flasks, 12 mL media containing 5 µL blastocidin (stock concentration 5mg/mL). Final concentration for blastocidin was 0.0021 mg/mL. 6
3. 0.3 x10 cells were inoculated to each well. Cells were placed in all of 12 wells in a 12 well plate. Cells were left for 16-­24 hours at 37°C to allow the cells re-­attach to the bottom. Then the 12 well plates were transferred to one of the individual temperature;; 26°C, 29°C, 32°C, 37°C or 40°C for 24 hours prior to analysis with FACS. 4. 12 hours prior to analysis 3 wells in each 12 well plate were treated with HDACi (positive control). a. Methyl indicator: 3 wells were treated with 10µM AR42, positive controls. b. Acetyl indicator: 2 wells were treated with 10µM AR42 and other 2 with 10µM SAHA, positive controls. 5. When incubation time was finished, we added trypsin to the cells after preheating the trypsin at 37°C, 0.05% Trypsin-­ EDTA (Gibco® by Life-­Technologies). Leave trypsin on for 5 minutes at room temperature. 6. Inactivate the trypsin by either diluting the trypsin in 0.5-­1 mL of FACS buffer (differs after how many cells are present in each well) or by adding media (if you add media then spin down cells (1500 rpm for 5 minutes), aspirate media off and then add FACS buffer). Recipe for FACS buffer see appendix section 4.4. 7. Move the cells and the liquid to a 5 mL Polystyrene Round-­Bottom Tube 12x75 mm style (Falcon). 8. The BD FACS™ Universal loader was used for analysing the fluorescence. 9. Gate for single cells was set up by using the HEK293 WT cells that were untransfected. 10. Exported .fcs files from the BD FACS™ Universal loader Verse software were then analysed with the software FlowJo 10.1r5. 11. The data from FlowJo was exported as an Excel sheet and further analysis was performed in R-­
Studio (boxplots) and Excel (line chart). 44 3. Protocol for western blot: Protein isolation of HEK293 WT proteins was performed from cells grown in a T75 flask with approximately 70-­80% confluent cells. 1. HEK293 WT cells were cultured at 37°C, 5% CO2 until at 70-­90% confluence. Next the T75 flasks were moved to one of the individual temperature;; 26°C, 29°C, 32°C, 37°C or 40°C, and incubated 24 hours prior to harvesting. 2. Trypsin was added and preheated to 37°C, 0.05% Trypsin-­ EDTA (Gibco® by Life-­Technologies). Trypsin was left on for 5 minutes at room temperature. Trypsin was inactivated by adding 5-­10 mL media. 3. We followed the nuclear extraction protocol described by Shecter et al[81]. a. Cells that were incubated at 26°C, 29°C and first slot of 37°C (37°C-­1) were frozen and stored at -­80°C. b. Protein from cells were incubated at 32°C, second slot of 37°C (37°C-­2) and 40°C were extracted immediately. 4. Protein concentration was measured with Pierce™ BCA Assay Kit (Thermo Fisher Scientific). 5. We used NuPAGE 4-­12% gel Bis-­Tris 1 mm gel with MES running buffer. Place the gel in the Novex gel running box. 6. We made running buffer from 50 mL NuPAGE MES (20x) running buffer with 950 mL of DI water. We filled up the Novel gel running box with 1x MES buffer. We ensured that there was no leaking and that the buffer covered the white divider between the gels. If the buffer doesn’t cover the gel the running of the gel will not work. 7. We mixed together 3 volumes sample + 1 volume 4x sample buffer with β-­ME. Exactly 25 mg per well of nuclear protein were put in each well. Each temperature had its own well. Loading mixture was denatured for 10 minutes at 70°C. Then we loaded each sampple to one well. 8. We loaded a protein ladder Marker Precision Plus Protein™ Kaleidoscope™ Prestained Protein Standards (Bio-­Rad) into one well. 9. We filled the unused wells with loading buffer. 10. We ran the gel at 200 V for about 35 minutes. 11. Cut out the PVDF membrane and prepare it in in methanol for 2 minutes on a shaker. 12. Cut out the Mini Transplot Filter paper to the same size as the membrane. 13. Wet the filter paper in 1x transfer buffer. 14. Cut the gel to the same size as the membrane. 15. We used the Trans-­Blot® Turbo™ Transfer System (Bio-­Rad) for the transferring of the proteins from the gel to the membarane. 16. We placed the filter paper at the bottom, then the membrane, then the gel and on top the other sheet of filter paper. We used a roller and rolled horizontally to remove all bubbles and ensure the sandwich is flat. This was done every time a new layer was added. 17. We ran the transfer on pre-­set settings: turbo – mini gel 45 18. After transfer we used forceps to move the membrane to a closed box with Odyssey® blocking buffer (LI-­COR Bioscientific), 1:1 buffer in PBS. We left the membrane in the buffer for 1 hour on rocker at room temperature. 19. Prepare primary antibody in 10 mL Odyssey blocking buffer. Added both to the same 10 mL. a. H3 (mouse, 96C10, Cell Signaling), 1:2000, 5 μL antibody into 10 mL Odyssey® blocking buffer (LI-­COR Biosciences). b. H3K4me3 (rabbit, 9727L, Cell Signaling), 1:1000, 10 μL antibody into 10 mL Odyssey® blocking buffer (LI-­COR Biosciences) 20. We poured out the blocking buffer from the membrane and added the prepared Odyssey-­antibody mixture. Leave at 4°C overnight. 21. Remove primary antibody and wash 5x5 minutes in TBS-­T on rocker (100 ml 10x TBS, 1 mL Tween-­20 and 900 ml DI water). 22. Prepare secondary antibody in 10 mL Odyssey blocking buffer. a. Donkey anti-­mouse (red, #C50812-­01, LI-­COR®), 1:10,000, 1 μL antibody into 10 mL Odyssey® blocking buffer (LI-­COR Biosciences). b. Donkey anti-­rabbit (green, #C50821-­03, LI-­COR®), 1:10,000, 1 μL antibody into 10 mL Odyssey® blocking buffer (LI-­COR Biosciences). 23. Pour the TBS-­T and add the Odyssey-­antibody mixture. Rock for an hour at 4°C for an hour. 24. 4x5 minutes TBS-­T washes and then 1x5 minute TBS wash on rocker. 25. Read and take pictures on LI-­COR Biosciences machine. Data was analysed with ImageJ and Microsoft Excel. 46 4. Protocol for the making of temperature expression indicators: 4.1 Recipe for bacterial media: 1. 1 L distilled water 2. Add 20g of LB Broth Base (Lennox L Broth Base from Invitrogen). 3. Mix the solution until homogenous. 4. Solution was autoclaved at 121°C for 15 minutes. 5. We added 1000 μL of 1000 ng/μL stock concentration ampicillin/carbenicillin (1000x) (made from α-­Carboxybenzylpenicillin disodium salt (Sigma (cat. no C1389)) to the solution. 6. Stored at 4°C. 4.2 Recipe for bacterial culture petri dishes: 1. 1 L of distilled water. 2. Add 15 g of Bacto™ Agar (Becton, Dickinson and Company). 3. Add 20g of LB Broth Base (Lennox L Broth Base from Invitrogen). 4. Mix the solution until homogenous. 5. Solution was autoclaved at 121°C for 15 minutes. 6. Add 1000 μL of 1000 ng/μL stock concentration ampicillin/carbenicillin (1000x) (made from α-­
Carboxybenzylpenicillin disodium salt (Sigma (cat. no C1389)) to the mixture. 2
7. Pour 20 mL of mixture to 10 cm petri dishes. 8. Let it sit overnight, until firm. 9. Stored at 4°C in plastic bag or aluminium foil, so it does not dry out. 4.3 Recipe for 2% agarose gel, 100 mL: 1. 100 mL of 1x TAE (see section 4.14). 2. Add 2g of Agarose I (Sigma-­ Aldrich®) to the TAE. 3. Heat the mixture in microwave until homogenous. 4. Cool down to room temperature and then add 5 µL EtBr (Sigma-­Aldrich®) to the mixture. 5. Pour into form, add comb to create wells and leave to set. 4.4 Recipe for FACS buffer: 1. 2 mM EDTA (Quality Biological) 2. 500 mL 1x DPBS (Corning Cellgro). 3. 0,5% BSA (Roche Diagnostics GmbH). 4. Stored at 4°C. 4.5 Basic PCR amplification settings: Standard PCR mix: Each tube should contain: 1 µL 100-­200 ng/µL template. 1 µL of 10 µM F strand primer. 1 µL of 10 µM R strand primer. 10 µL of NEBNext® High Fidelity 2xPCR Master Mix. 7 µL of 0.220 µM filtered and autoclaved water to reach desired 20 µL per PCR tube. 47 Step Temperature in °C Time of step 1 Initial denaturation 98°C 1 min 2* Denaturation 98°C 10 sec 3* Annealing -­ 30 sec 4* Extension 72°C 30 sec 5 Final Extension 72°C 5 min. 6 Hold 10°C ∞ Table 1: Settings for pROSA26-­dest in GeneAmp PCR System 9700 from PE Applied Biosystems. *Steps 2-­4 are repeated for 30 cycles. Annealing temperature differs after what you are amplifying. 4.6 Basic GFP-­Plasmid. Making, growing and purification. We used the PGL4.10 plasmid (Promega, #9PIE665), 4242 base pairs long, that contains Luciferase and has Ampicillin resistance). We multiplied the plasmid in Max – efficiency competent DH5 E. coli bacteria after the following steps: 1. Defrost bacteria on ice. Plasmid should be kept on ice. Cool down Eppendorf tubes on ice before using. 2. 240 ng of plasmid and 25 µL of Max – efficiency competent DH5, E. Coli (Invitrogen) are mixed gently together in an Eppendorf tube. 3. Bacterial cells are left on ice for 30 minutes (cold shock). 4. Bacterial cells are left in a warm heat bath, 42°C, for 45 seconds (heat shock). 5. Cells are exposed to ice for 2 minutes(cold shock). 6. Mixed 225 µL of SOC medium (Invitrogen) with 25 µL of bacterial and plasmid solution (from 5). Let it grow on a 300 rpm shaker at 37°C for 1 hour. 7. Take 50 µL of the solution and but it on a petri dish that contains agar with concentration of 1000x ampicillin. Distribute the 50 µL over the agar with Pyrex® solid glass beads (Sigma-­Aldrich®). Grow overnight at 37°C. 8. Pick a single colony of those who grew on the agar disk with a tip. Put the tip into a 14 mL Polypropylene Round-­Bottom Tube (Falcon). Grow the bacteria in 3 mL for 3 hours. 9. Transferred the media to a bigger 100 mL media and left to grow on a 200 rpm shaker at 37°C overnight. 10. Isolate the plasmid from the medium containing overnight growth bacteria with Mediprep kit, Purelink High Pure Plasmid Kit (Invitrogen by Life Technologies). 11. Digested purified plasmid with NcoI (NEB) and XbaI (NEB) to excised the luciferase from the plasmid. 48 a. Mix together in a PCR tube 5 µL purified plasmid, 3 µL of CutSmart 10x buffer (NEB), 1 µL of NcoI (NEB), 1 µL of XbaI (NEB) and 20 µL of 0.220 µM filtered and autoclaved water. Desired end volume should be 30 µL. Put enzymes in last. b. Leave the mixture at 37°C for 1-­2 hours. 12. Run digested plasmid on 2% agarose for 1-­2 hours on 100-­200 V in 1xTAE (recipe see appendix section 4.14). 13. Purify the DNA from the gel with MinElute, Gel Extraction Kit (Qiagen). 14. Amplify the GFP protein (PT7XbG2-­AcGFP1DNA) using an annealing temperature of 65,9°C in a PCR machine. Solution is mixed together. Primers: (Integrated DNA Technologies)[95]. a. Sequence for R: 3’cggcggagTCTAGAATTACTTGTACAGCTCGTCC’5 b. Sequence for F: 5’taagccaccATGGTGAGCAAGGGCGAGGAGC3’ 15. Digest the GFP protein. Mix together 20 µL purified plasmid, 3 µL of CutSmart 10x buffer (NEB), 1 µL of NcoI (NEB), 1 µL of XbaI (NEB) and 5 µL of 0.220 µM filtered and autoclaved water. Put enzymes in last, leave at 37°C for 1-­2 hours. 16. Ligation of GFP and the PGL4.10 plasmids without luciferase. Thaw out ligation buffer (NEB) at room temperature. T4 DNA ligase (NEB) should be on ice at all times. Leave the solution overnight in a PCR tube at 14°C. a. 1:1 molar ratio of GFP: PGL4.10 plasmids without luciferase. Put 1 mol GFP, 1 mol PGL4.10 plasmid without luciferase, 2 µL T4 DNA ligase buffer 10x (NEB), 1 µL T4 DNA ligase (NEB), 3.8 µL of 0.220 µM filtered and autoclaved water to reach desired 10 µL per PCR tube. b. 3:1 molar ratio of GFP: PGL4-­10 plasmid without luciferase. Put 3 mol GFP, 1 mol PGL4.10 plasmid without luciferase, 2 µL T4 DNA ligase buffer 10x (NEB), 1 µL T4 DNA ligase (NEB), 1.5 µL of 0.220 µM filtered and autoclaved water to reach desired 10 µL per PCR tube. 17. Transfect 50 µL Max – efficiency competent DH5 E. Coli (Invitrogen) with 5 µL ligated plasmid at each concentration from the day before. 18. Follow steps 3, 4 for each tube (forgot 5, did not seem to affect). 19. For each tube mix 250 µL of SOC medium (Invitrogen) with 55 µL of solution (from 18). Let it grow on a 200 rpm shaker at 37°C for 1 hour. 20. Spin down at 3000 rpm for 5 minutes. Discard 200 µL of the supernatant. Dissolve the cells in the remaining 100 µL. For each tube. Take the remaining 100 µL and spread on the Ampicillin agar plate with Pyrex® solid glass beads (Sigma-­Aldrich®). Let it grow overnight at 37°C. 21. Pick 10 different colonies from the agar plate that was left to grow overnight at 37°C. Place each colony into a 14 mL Polypropylene Round-­Bottom Tube from Falcon that contains 3 mL of bacterial medium with 1000x Ampicillin. Each Falcon tube and a control should also be left to grow on a 220 rpm shaker at 37°C overnight. 49 22. Make mini-­prep from the bacterial culture grown overnight with the GeneJet Plasmid Miniprep Kit (Thermo Scientific). a. Changes: spin at 13.000 rpm. In wash steps, spin for 45 sec. 23. Use the Nanodrop 2000 (Thermo Scientific) to measure the concentration of the plasmid. 24. Sanger sequence the product to be sure that your end product does not have any mutations in it. Use the primers for PCR for the Sanger Sequencing, (via GRCF at Johns Hopkins Medical Institute). 4.7 Temperature independent expression indicators. Making, growing and purification We made the CIRP promoter using the sequences from Al-­Fageeh et al. Mol Biotechnol, 2013 reported. The CIRP indicator is of mouse origin [44] Primers: (Integrated DNA Technologies). a. Mouse CIRP Promoter primer F: 5’ tcgataggtaccTGGCTTCACAAATGCGCCTCAGT3’ b. Mouse CIRP-­Promoter primer R: 3’cctaaggcagatctGCGAGGGGGAGCGCAAGAGT5’ We designed the SP1 human primers the same way as Nicolas et al. reported[45]. We decided to use 2 version of the SP1 promoter, short and long. The shorter one is from -­20 to -­281, the longer one is from -­20 to -­1612[45]. Primers were ordered from Integrated DNA Technologies. a. Human SP1 Promoter primer F: 5’tcaagtcaggctagcGGCACCTAACACGGTAGGCAG3’ b. Human SP1 Promoter primer F: 5’tcaagtcaggctagcGCAACTTAGTCTCACACGCCTTGG3’ c. Human SP1 Promoter primer R: 3’cagtgctgcctcgagGCTCAAGGGGGTCCTGTCCGG5’ 1. Make PCR mix for each promoter. a. For CIRP promoter: One tube for each annealing gradient (54.7°C, 55.8°C, 57.3°C, 59.0°C, 60.4°C, 61,5°C, 62,3°C), total 7. Each tube should contain: 1 µL 100-­200 ng/µL mouse or human template. 1 µL of 10 µM F strand primer. 1 µL of 10 µM R strand primer. 10 µL of Phusion Master Mix with GC Buffer (Thermo Scientific). 0.6 µL of 3% DMSO. 6.4 µL of 0.220 µM filtered and autoclaved water to reach desired 20 µL per PCR tube. The PCR settings were as shown in table 1 in section 4.5 in Appendix part 4. b. For SP1 Long and SP1 Short promoter: PCR two tubes for each promoter at 65°C, annealing temperature. Each tube should contain: 1 µL 100-­200 ng/µL human template. 1 µL of 10 µM F strand primer. 1 µL of 10 µM R strand primer. 12,5 µL of NEBNext® High Fidelity 2xPCR Master Mix (NEB). 9.5 µL of 0.220 µM filtered and autoclaved water to reach desired 25 µL per PCR tube. The PCR settings were as shown in table 1 in section 4.5 in Appendix part 4. 2. Run the PCR products on 2% agarose gel for 1-­2 hours at 100-­200V in 1xTAE (recipe see appendix section 4.14). 3. Purify the DNA from gel with MinElute® Gel Extraction Kit (Qiagen) for SP1 Long and SP1 Short promoters. Purify DNA from gel with Zero Blunt Topo® PCR Cloning Kit (Invitrogen) for CIRP. 4. Digest the promotors. The same way as described in section 4.6 step 11. Change digestion enzymes: a. CIRP: use KpnI (NEB) and BglII (NEB). b. SP1 Long and SP1 Short: use NheI (NEB) and XhoI (NEB). 50 5. Ligase the GFP + PGL4.10 construct and each of the promoters together. Using 1:1 Molar ratio and 3:1 Molar ratio see how in section 4.6 step 16. 6. Follow for each ligated construct steps 17-­23 in section 4.6. appendix part 4. 4.8 Transient transfection of temperature independent expression indicator to HEK293 WT cells. 1. 6
0.3 x10 HEK293 WT cells were inoculated to each well. We used 12 well plates. 1 mL of cell-­
media to each well. Let the cells then recover for 16-­24 hours before transient transfection. 2. The cells need to be at 70-­90% coverage for the transfection. 3. Change cell-­media, remove media and replace with 1 mL of fresh cell-­medi, without antibiotics. Cell media should be at 37°C. 4. Transient transfect 3 wells for each plasmid for each temperature. Leave 3 wells untransfected at each temperature as controls. Use the form of plasmids that does not contain the neomycin part (appendix, parts 4.6 and 4.7). 5. Mix together 50 µL of Opti-­MEM (Gibco® by Life-­Technologies) and 1 µg of DNA for each well. Media should be at room temperature. 6. Dilute Lipofectamine 2000 (Invitrogen) in 50 µL Opti-­MEM media (Gibco® by Life-­
Technologies) in 1:3 DNA:lipofectamine ratio for each well. 7. Incubate mixtures from step 4 and 5, for 5 minutes at room temperature. 8. Mix together 50 µL of mixture from step 4 and 50 µL of mixture from step 5 together, for each well. Mix gently with turning Eppendorf tube up and down. 9. Incubate mixture from step 7 for 30 minutes at room temperature. 10. Add the mixture from 8 gently to each well in the dish and gently mix with shaking the disc back and forth. 11. Incubate at 37°C for 32 hours. Then move each 12 well plate to a desired temperature, 26°C, 29°C, 32°C, 37°C or 40°C for 16 hours before analysis. 12. When incubation time is finished then trypsinize cells with preheated to 37°C, 0.05% Trypsin-­ EDTA (Gibco® by Life-­Technologies). Leave trypsin on for 5 minutes at room temperature. 13. Stop the trypsinization with putting 0.5-­1 mL of FACS buffer (differs after how many cells are present in each well). 14. Move the cells and the liquid to a 5 mL Polystyrene Round-­Bottom Tube 12x75 mm style (Falcon). 15. Collect fluorescent data with BD FACS™ Universal loader. Set up gating of the fluorescence after control, HEK293 WT cells at 37°C for 48 hours without any transfection. 4.9 Transient transfection of SP1 Short temperature independent expression indicator to HCT116, HeLa and SK-­N-­SH cell lines. 1. 6
0.3 x10 cells were inoculated to each well. Cells were placed in 6 out of 12 wells in a 12 well plate. 3 wells in a 12 well plate were transfected and 3 wells acted as a control (without transient transfection). 51 2. The transient transfection process for these cell lines was the same as mention above for HEK 293 WT cells, section 3.6, parts 2-­10 (but only done for SP1 Short indicator). 3. The incubation time and temperatures were the same for these cell lines as mentioned above for HEK293 WT, see section 3.6, part 10 4. The harvest procedure before the BD FACS™ Universal loader was the same for these cell lines as for HEK 293 WT, section 4.8 steps 12-­14 appendix part 4. 5. The gating for the BD FACS™ Universal loader machine was set up after a control for each individual cell line. 4.10 Transient transfection of SP1 Short temperature independent expression indicator to Jurkat cell line: 1. The protocol by The Crabtree Laboratory prepared by Chao et al. was used as a guideline[96, 97]. 6
2. 0.3 x 10 cells per well were placed in 3 wells in a 12 well plate. These cells serve as a control. Total volume of media per well is 1 mL of RPMI media (we did triplicates for each temperature). 6
3. 5 x10 cells are needed per transfection. One transfection per temperature, divided to 3 wells in a 12 well plate. 6
4. Spin 5 x10 cells down at 1000 rpm for 5 minutes. 5. Aspirate media from cells. 6. Re-­suspend cells in 1µg of DNA, Sp1 Short specific gene plasmid reporter, and RPMI media to the total volume of 155 µL. 7. Transfer the 155 µL of cells and media to a 0.2 cm gap width electroporation cuvette. 8. We used the Bio-­Rad Gene Pulser Xcell™ (Bio-­rad laboratories) for the electroporation. We used the manufacturers pre-­set protocol for Jurkat cells. a. Voltage = 140 V (during experiment: 138-­139V) b. Capacitance = 1000 µF c. Resistance = ∞Ω d. Gap width = 0.2 cm cuvette e. Time course = 36.7 – 38.6 ms. 9. Add 900 µL to the cuvette and put 350 µL to one well at each temperature. 10. Incubate for 8 hours at 37°C. Then move the 12 well plate to one of the individual temperature;; 26°C, 29°C, 32°C, 37°C or 40°C, and incubate for 16 hours. 11. After 16 hours of incubation then remove media containing cells from each well and put to a 5 mL Polystyrene Round-­Bottom Tube 12x75 mm style (Falcon). 12. Spin down the cells at 1000 rpm for 5 min and aspirate media. 13. Resuspend cells in 1 mL of FACS buffer (see appendix 4.4). 14. Collect fluorescent data with BD FACS™ Universal loader. Gating is set up after control, Jurkat cells at 37 °C for 24 hours without any transfection. 52 4.11 Transient transfection of SP1 Short temperature independent expression indicator to K562 cell line: The protocols by The Crabtree Laboratory prepared by Chao et al. and Delgato-­Canedo et al. were used as a guideline[97, 98] 6
1. 0.3 x 10 cells per well were placed in 3 wells in a 12 well plate. These cells serve as a control. Total volume of media per well is 1 mL of IMDM media. 6
2. 5 x10 cells are needed per transfection. One transfection per temperature, divided to 3 wells in a 12 well plate (we did triplicates for each temperature). 6
3. Spin 5 x10 cells down at 1000 rpm for 5 minutes. 4. Aspirate media from cells. 5. Re-­suspend cells in 1µg of DNA, Sp1 Short specific temperature independent expression indicator, and plain RPMI media to the total volume of 155 µL. 6. Transfer the 155 µL of cells and media to a 0.2 cm gap width electroporation cuvette. 7. We used the Bio-­Rad Gene Pulser Xcell™ (Bio-­rad laboratories) for the electroporation. a. Voltage = 175 V (during experiment: 171-­173V) b. Capacitance = 750 µF c. Resistance = ∞Ω d. Gap width = 0.2 cm cuvette e. Time course = 21.0-­24.4ms. 8. Add 900 µL to the cuvette and put 350 µL to one well at each temperature. 9. Incubate for 8 hours at 37°C. Then move the 12 well plate to one of the individual temperature;; 26°C, 29°C, 32°C, 37°C or 40°C, and incubate for 16 hours. 10. After 16 hours of incubation then remove media containing cells from each well to a 5 mL Polystyrene Round-­Bottom Tube 12x75 mm style (Falcon). 11. Spin down the cells at 1000 rpm for 5 min and aspirate media. 12. Resuspend cells in 1 mL of FACS buffer (see appendix 4.4). 13. Collect fluorescent data with BD FACS™ Universal loader. Gating is set up after control, K562 cells at 37 °C for 24 hours without any transfection. 4.12 Stable temperature independent expression indicators. Making, growing and purification: 1. Amplify the neomycin cassette with PCR. We used the neomycin from the pROSA26-­dest plasmid (Addgene, #21189). The PCR settings and mix were made as shown in table 1 in section 4.5 and described in section 4.4 in Appendix part 4. Primers: (Integrated DNA Technologies). a. Sequence for F: 5’CATTATCGTCGACTCTACCGGGTAGGGGAGGCGCTT3’ b. Sequence for R: 3’CGCCGCCGACGATAGTCAAGCTTCTGATGGAATTAGAACTTGGC5’ 2. Digest the amplified neomycin cassette and CIRP, SP1 Long and SP1 Short plasmid. Mix 2 µL of purified plasmid 0.5 µL SalI and 0.5 µL PshAI restriction enzymes (NEB), 2 µL of CutSmart® 10x 53 buffer (NEB), 15 µL of 0.220 µM filtered and autoclaved water. Put enzymes in last, leave at 37°C for 1-­2 hours. 3. Then follow steps 16-­23 in section 4.6 appendix part 4 for each of the promoters. 4. To amplify the plasmids then we transfected Max – efficiency competent DH5 as described in section 4.6 parts 17-­21. 5. Each with the transformed bacteria was grown over day in 2-­3 mL of LB-­medium containing 1000x ampicillin. In end of the day the medium was transferred to around 80 mL of LB-­medium containing 1000x ampicillin and grown over night. 6. The day after we did Mediprep from the 80 mL of the media. We used the PureLink® HiPure Plasmid Filter Mediprep kit (Invitrogen by Life Technologies). 7. Transfect your plasmid to HEK293 WT cells. Each plasmid is transfected to a 10 cm cell-­culture 2
6
dish (60 cm ) containing 6.8 x10 cells that have been left to grow for 24 hours prior to transfection. 8. Before transfection change media and put 15 mL of media without antibiotics to each dish. 9. For each plasmid. Mix together 24µg of DNA in 1.5 mL of Opti-­MEM media (Gibco® by Life-­
Technologies) at room temperature and leave for 5 minutes at room temperature. 10. For each plasmid. Dilute 60 µL of Lipofectamine® 2000 (Invitrogen) in 1.5 mL of Opti-­MEM media (Gibco® by Life-­Technologies) at room temperature and leave for 5 minutes at room temperature. 11. Mix together mixture from step 14 and mixture from step 15 together for each plasmid. Mix gently with turning Eppendorf tube up and down. Leave at room temperature for 30 minutes. 12. Add the mixture from 17 gently to each dish and gently mix with shaking the disc back and forth. 13. Incubate for 37°C for 24 hours. After 24 hours start neomycin selection. Start with changing media, add 10 mL of fresh media with antibiotics to each dish. 14. Add the G418 to the concentrate of 800 µg/mL to the media. 15. When all cells are dead except the ones that integrated the CIRP plasmid or SP1 Long plasmid or SP1 Short plasmid we picked single cell colonies. 16. From the single colonies we measured how many integrated plasmids were in each cells genome. 17. We chose one single cell colony and grew up for each indicator. 4.13 Recipe for 1x TE: 1. 10mM Tris-­Cl. pH 7.5 2. 1mM EDTA (Quality Biological) 4.14 Recipe for 50x TAE for 1L 1. 242g Tris-­Base (VWR International) 2. 57.1 mL of glacial acidic acid (J.T. Baker) 3. 100mL 0.5M EDTA (Quality Biological) 4. DI water to 1L 54