1481
Journal of Cell Science 113, 1481-1490 (2000)
Printed in Great Britain © The Company of Biologists Limited 2000
JCS1224
ARVCF localizes to the nucleus and adherens junction and is mutually
exclusive with p120ctn in E-cadherin complexes
Deborah J. Mariner, Jue Wang and Albert B. Reynolds*
Department of Cell Biology, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-2175, USA
*Author for correspondence (e-mail: [email protected])
Accepted 12 February; published on WWW 21 March 2000
SUMMARY
ARVCF is a novel Armadillo repeat domain protein that is
closely related to the catenin p120ctn. Using new ARVCF
monoclonal antibodies, we have found that ARVCF
associates with E-cadherin and competes with p120 for
interaction with the E-cadherin juxtamembrane domain.
ARVCF also localized to the nucleus in some cell types,
however, and was significantly more nucleophilic than
p120. Surprisingly, despite apparently ubiquitous
expression, ARVCF was at least tenfold less abundant than
p120 in a wide variety of cell types, and was difficult to
detect by immunofluorescence unless overexpressed.
Consequently, it is not likely to be abundant enough in
adult tissues to functionally compete with p120. ARVCF
also completely lacked the ability to induce the cellbranching phenotype associated with overexpression of
p120. Expression of ARVCF/p120 chimeras confirmed
INTRODUCTION
ARVCF (Armadillo repeat gene deleted in Velo-cardio-facial
syndrome) is a candidate gene for the related developmental
abnormalities Velo-cardio-facial syndrome (VCFS) and
DiGeorge syndrome (DGS) (Sirotkin et al., 1997),
characterized by a wide spectrum of phenotypes such as
conotruncal heart defects, cleft palate and facial
dysmorphology (Shprintzen et al., 1981; Young et al., 1980).
The gene maps to a region of human chromosome 22q11
(Bonne et al., 1998; Sirotkin et al., 1997) that is hemizygous
in 80-85% of VCFS/DGS patients (Desmaze et al., 1993;
Driscoll et al., 1993, 1992; Kelly et al., 1993; Morrow et al.,
1995; Scambler et al., 1992; Wilson et al., 1992a,b). Other
genes also map to this region and the contribution of the loss
of ARVCF to these syndromes has not yet been fully
established.
ARVCF is the closest identified relative to the catenin
p120ctn (‘p120’), suggesting that they have related functions
(Sirotkin et al., 1997). Both proteins contain an amino-terminal
coiled-coil domain, as well as a central Armadillo repeat
domain (Arm domain). The Arm domains are 56% identical to
one another and consist of 10 imperfect 42 amino acid repeats.
Although the homology decreases in the amino- and carboxy-
previous results indicating that the branching activity of
p120 maps to its Armadillo repeat domain. Surprisingly,
the preferential localization of ARVCF to the nucleus
required sequences in the amino-terminal end of ARVCF,
suggesting that the sequences directing nuclear
translocation of ARVCF are distinct from the predicted
bipartite nuclear localization signal located between
repeats 6 and 7. The dual localization of ARVCF to
junctions and to nuclei suggests activities in different
cellular compartments, as is the case for several other
Armadillo repeat proteins including β-catenin, p120 and
the plakophilins.
Key words: ARVCF, p120ctn, E-cadherin, Catenin, Adherens
junction, Armadillo repeat
terminal regions flanking the Arm repeats, the intron-exon
structure of the genes is nearly identical (Keirsebilck et al.,
1998), indicating an ancient evolutionary relationship.
Alternative splicing results in the cell type-specific expression
of multiple p120 isoforms whose individual roles are unknown
(Keirsebilck et al., 1998; Mo and Reynolds, 1996). The cloned
human ARVCF cDNA most closely resembles p120 isoform
p120ctn1A (Reynolds and Daniel, 1997; Sirotkin et al., 1997).
p120 interacts with a variety of cadherins, including E-,
N-, P-, C- and VE-cadherins (Lampugnani et al., 1997;
Reynolds et al., 1996; Yap et al., 1998). Cadherins are a large
superfamily of transmembrane glycoproteins that mediate
Ca2+-dependent cell-cell adhesion and participate in multiple
aspects of development, morphogenesis and malignancy (for
reviews, Takeichi, 1991; Yap, 1998). Of the classical cadherins,
E-cadherin has been studied most extensively, in part because
its expression is frequently downregulated or turned off in
metastatic cancer (reviewed in Birchmeier and Behrens, 1994).
It is the major cell-cell adhesion molecule in most carcinomas,
and its downregulation in late-stage tumors is widely
considered to be an important factor in the transition to
malignancy. Indeed, restoration of E-cadherin expression in
such cells restores adhesiveness and reduces invasive
phenotypes both in vitro and in vivo (Frixen et al., 1991; Perl
1482 D. J. Mariner, J. Wang and A. B. Reynolds
et al., 1998; Vleminckx et al., 1991). Cadherin function is
regulated by catenins (α, β-catenins, plakoglobin/γ-catenin and
p120), proteins that bind directly or indirectly to the cadherin
cytoplasmic tail (reviewed in Nollet et al., 1999; Steinberg and
McNutt, 1999). β-catenin links E-cadherin to α-catenin, which
in turn links the complex to the actin cytoskeleton either
directly or indirectly through other proteins such as α-actinin
or vinculin (Hazan et al., 1997; Herrenknecht et al., 1991;
Knudsen et al., 1995; Nagafuchi et al., 1991; Nieset et al.,
1997). p120 does not interact with α-catenin (Daniel and
Reynolds, 1995), suggesting that it does not participate directly
in the linkage to the actin cytoskeleton.
Alterations in α- and β-catenins have been reported in
metastatic cell lines and may also contribute to the invasive
phenotype (Hirano et al., 1992; Kawanishi et al., 1995; Morton
et al., 1993; Oyama et al., 1994). β-catenin has wellcharacterized roles in both adhesion and transcription
(reviewed in Peifer, 1995). Less is known about the role of
p120 and its family members in these processes. Though
originally characterized as a prominent substrate for the Src
protein tyrosine kinase, there is recent evidence suggesting
roles for p120 in cadherin clustering (Yap et al., 1998), cell
motility (Chen et al., 1997), neuronal outgrowth (Riehl et al.,
1996), and inhibition or dismantling of the cadherin complex
(Aono et al., 1999; Ohkubo and Ozawa, 1999). In addition,
p120 binds to a transcription factor, Kaiso (Daniel and
Reynolds, 1999), and has been reported to translocate to the
nucleus under some circumstances (van Hengel et al., 1999).
The growing p120 family now includes ARVCF (Sirotkin et
al., 1997), δ-catenin/NPRAP/neurojungin (Paffenholz and
Franke, 1997; Paffenholz et al., 1999; Zhou et al., 1997) and
p0071 (Hatzfeld and Nachtsheim, 1996), and a related
subgroup of proteins including plakophilin 1 (Hatzfeld et al.,
1994; Heid et al., 1994; Schmidt et al., 1997), plakophilin 2
(Mertens et al., 1996) and plakophilin 3 (Bonne et al., 1999;
Schmidt et al., 1999). Whereas p120 and δ-catenin bind to type
I and type II cadherins (Daniel and Reynolds, 1995; Lu et al.,
1999; Reynolds et al., 1996) in adherens junctions, the
plakophilins and possibly p0071 (Hatzfeld and Nachtsheim,
1996) associate instead with desmosomal proteins (Hatzfeld et
al., 1994; Mertens et al., 1996; Schmidt et al., 1997). In
addition, most of these proteins localize to the nucleus to
varying degrees, and it has been suggested that this duality of
localization may reflect a function common to most Armadillo
repeat proteins (Fagotto et al., 1998). The emergence of p120
family members, many of which are coexpressed in various
cells, introduces a new level of complexity to the regulation of
cadherin function (see Commentary in this issue by
Anastasiadis and Reynolds, 2000). It is not clear, for example,
whether these different family members compete with one
another for binding to a particular cadherin, or what effect such
competition might have on cadherin function. With the
exception of β-catenin, the nuclear roles of these proteins are
largely unknown. ARVCF has not been characterized at the
protein level, in part because antibodies have not been available
until now.
We show here that despite the expected similarities between
ARVCF and p120, these proteins are functionally distinct in
several respects. Like p120, ARVCF colocalized and
associated with E-cadherin. ARVCF and p120, however, were
mutually exclusive in cadherin complexes, indicating that
they compete for the same binding site on E-cadherin.
Unexpectedly, analysis of multiple cell types revealed that the
expression level of ARVCF in adult tissues was at least tenfold
less than that of p120. Therefore, it is unlikely under normal
circumstances that ARVCF functions simply as a competitive
binding protein. Instead, it is likely to bring to the junction its
own activity, one that is distinct from that of p120 and does not
require high level expression. Additionally, ARVCF showed a
strong cell type-specific preference for localization to the
nucleus and completely lacked the strong branching activity
associated with overexpression of p120 in fibroblasts.
ARVCF/p120 chimeras were generated and used to map the
sequences responsible for the branching phenotype to the
carboxy terminus of p120. Despite the presence of a classic
bipartite nuclear localization signal in the central region of
ARVCF, the nuclear translocation preference of this protein
required sequences residing in the amino-terminal end of the
molecule. These data indicate dual functions for ARVCF in
adherens junctions and the nucleus, and highlight significant
differences relative to p120 in activity, abundance and
localization.
MATERIALS AND METHODS
Cell culture
Cells were cultured in DMEM (Hyclone) containing 10% fetal bovine
serum and 1% penicillin (10,000 i.u./ml)-streptomycin (10 mg/ml)
(GibcoBRL). Human ARVCF (GenBank accession number U51269)
was stably overexpressed in Madin Darby Canine Kidney II cells
(MDCK II) as described previously (Mariner et al., 1999). These cells
were maintained in the above medium supplemented with 250 µg/ml
(active units) G418 (GibcoBRL). The MDCK II parent cell line was
provided by Dr Robert Coffey (Vanderbilt University), and PANC-1
cells (human pancreatic carcinoma) were provided by Dr Steven
Leach (Vanderbilt University). Other cell lines were obtained from the
American Type Culture Collection, including MCF-7, human breast
carcinoma; BeWo, human placental carcinoma; HepG2, human liver
carcinoma; HCT 116, human colon carcinoma; 293, human
embryonic kidney; HeLa, human cervical carcinoma; Va-2, human
fibroblasts; MOLT-4, human T-cells; NIH 3T3, murine fibroblasts.
Transient transfection
Transient transfections were performed with SuperFect Transfection
Reagent (Qiagen) according to company protocol, except that DNAdendrimer complexes were allowed to form for 15 minutes before
transfection, and cells were incubated in the presence of transfection
reagent overnight. Cells were used for experiments 1-2 days posttransfection.
Human ARVCF (GenBank accession number U51269) and human
p120-1A cDNA were expressed from a CMV promoter in pcDNA3.1
plasmid (Invitrogen), while murine p120-1A was expressed from
Rc/CMV plasmid (Invitrogen).
Immunoprecipitation, western blotting and Coomassie
Blue staining
For immunoprecipitation, cells were washed once with phosphatebuffered saline (PBS) (10 mM Tris, pH 7.4, 150 mM NaCl) at room
temperature, then lysed in ice-cold lysis buffer (0.5% Nonidet P-40
(NP-40), 50 mM Tris, pH 7.4, 150 mM NaCl) or RIPA (1% NP-40,
0.1% sodium dodecyl sulfate, 0.5% deoxycholic acid, 50 mM Tris,
pH 7.4, 150 mM NaCl) containing 1 mM PMSF, 5 µg/ml leupeptin,
2 µg/ml aprotinin, 1 mM EDTA and 1 mM Na3V04 (leupeptin from
ICN; all other inhibitors from Sigma). Lysates were cleared by
centrifugation at 14000 rpm in an Eppendorf microfuge at 4°C for 5
ARVCF in the nucleus and adherens junction 1483
minutes. Immunoprecipitations were carried out as described
previously (Reynolds et al., 1994). Briefly, primary antibody
incubations were performed with 4 µg purified monoclonal antibody,
100 µl hybridoma supernatant or 2 µl polyclonal antibody (pAb) for
1 hour at 4°C. Complexes were collected by further incubation for 1
hour in the presence of Protein A-Sepharose beads (Pharmacia)
coupled to rabbit anti-mouse bridge antibody (Jackson
Immunoresearch Laboratories). Immunoprecipitates were washed 5×
with ice-cold lysis buffer (without protease or phosphatase inhibitors),
then boiled for 3 minutes in Laemmli sample buffer (Laemmli, 1970)
before separation by SDS-polyacrylamide gel electrophoresis (PAGE)
on 7% polyacrylamide gels. Antibodies used for immunoprecipitation
were ARVCF mAb 4B1 (Mariner et al., 1999), p120 mAb 15D2 (Wu
et al., 1998), E-cadherin mAb rr1, β-catenin pAb (Sigma C2206) and
hemagglutinin-antigen epitope tag mAb 12CA5.
Western blotting was carried out as described (Reynolds et al.,
1994). Proteins were detected by enhanced chemiluminescence
(Amersham ECL reagent). ARVCF was detected with an ARVCF
mouse pAb generated against the carboxy-terminal 115 amino acids
of human ARVCF diluted 1:5000. Other antibodies used for western
blotting include p120 mAb pp120 (Transduction Laboratories
#P17920), 0.1 µg/ml; E-cadherin mAb (Transduction Laboratories
#C20820), 0.1 µg/ml; β-catenin pAb (Sigma #C2206), 1:1000.
For protein staining with Coomassie Blue, 7% polyacrylamide gels
were agitated in Coomassie Blue stain (50% methanol, 10% acetic
acid, 0.2% Coomassie Brilliant Blue R) overnight. Destaining was
performed in 30% methanol, 7% acetic acid for several hours,
followed by further incubation in 10% methanol, 7% acetic acid.
Phosphatase treatment
For phosphatase treatment, ARVCF was immunoprecipitated as
described above. Immunoprecipitates were washed 3× with lysis
buffer lacking protease and phosphatase inhibitors, and twice with
TBS to remove detergent. Washed immunoprecipitates were then
incubated with 200 units λ phosphatase (New England Biolabs #753)
for 30 minutes at 30°C, in a 50 µl reaction mixture containing 50 mM
Tris-HCl, pH 7.5, 0.1 mM Na2EDTA, 5 mM EDTA, 0.01% Brij 35,
2 mM MnCl2. The reaction was terminated by removing the
supernatant and boiling the immunoprecipitate in Laemmli sample
buffer for 3 minutes.
Immunofluorescence labeling
Cells were labeled by immunofluorescence as described previously
(Reynolds et al., 1994). Briefly, cells were cultured on glass coverslips
for 24-48 hours. After two rinses in room temperature PBS, cells were
fixed and permeabilized in ice-cold methanol for 7 minutes at −20°C,
then washed twice in PBS. Coverslips were then blocked in blocking
solution (PBS containing 3% nonfat milk) for 5 minutes, then
incubated in primary antibody diluted in blocking buffer (mAb 4B1,
8D11, 12F4, 1 µg/ml) for 30 minutes at room temperature in a
humidified chamber. Following three 5 minute PBS washes,
coverslips were rinsed with blocking buffer and incubated with
secondary antibody diluted in blocking buffer. Secondary antibodies
used include Alexa488-coupled goat anti-mouse IgG (Molecular
Probes), diluted 1:1200; fluorescein isothiocyanate (FITC)-coupled
goat anti-IgG1 and tetramethyl rhodamine isothiocyanate (TRITC)coupled goat anti-IgG2a (Southern Biotechnology Associates, Inc.),
diluted 1:200. The chimera ARVCF-p120 was detected with mAb
12F4, and p120-ARVCF was detected with mAb 4B1.
Generation of bimolecular chimeric proteins
ARVCF-p120 and p120-ARVCF chimeric proteins were generated by
molecular sewing and polymerase chain reaction (PCR) amplification
with Pfu Turbo (Stratagene).
For ARVCF-p120, human ARVCF (hARVCF) cDNA,
corresponding to amino acids 1-469 of hARVCF, were joined to
cDNA corresponding to amino acids 478-962 of human p120 isoform
1A (p120-1A). First, 5′ ARVCF cDNA was amplified from
pcDNA3.1/hARVFC plasmid with the oligonucleotides (5′) CCTGAGCTGCCTGAGGTGCTGGC (3′) and (5′) GGATGAAAGATTCCACAGGGTGCCAGTGACAAGCTC (3′). Likewise, human p120-1A
3′ cDNA was amplified from pcDNA3.1/hp120-1A plasmid with the
oligonucleotides (5′) ACTGGCACCCTGTGGAATCTTTCATCCCATGACTCAATC (3′) and (5′) GCTTACATTCCTAAGGCAGCCAGC (3′). These products served as template for a subsequent
amplification reaction with the oligonucleotide primers (5′) CCTGAGCTGCCTGAGGTGCTGGC (3′) and (5′) GCTTACATTCCTAAGGCAGCCAGC (3′). Following digestion with Bsu36I restriction
enzyme (NEB), the product was subcloned between flanking 5′
hARVCF and 3′ hp120-1A cDNA sequence in pcDNA3.1.
For p120-ARVCF, human p120-1A cDNA corresponding to amino
acids 1-477 was joined to cDNA corresponding to amino acids 470962 of human ARVCF, essentially as described for ARVCF-p120. 5′
p120-1A cDNA was amplified from pcDNA3.1/hp120-1A plasmid
with the oligonucleotides (5′) GCCCTCTAGACT CGAGCGGCC (3′)
and (5′) GGATGACAGGTTCCACAGGGTTCCGGTAATAACTTCAGT (3′). 3′ human ARVCF cDNA sequence was amplified from
pcDNA3.1/hARVCF plasmid with (5′) ACCGGAACCCTGTGGAACCTGTCATCCTATGAGCCCCTG (3′) and (5′) CAACTAGAAGGCACAGTCGAGGC (3′) (complementary to pcDNA3.1 polylinker
sequence). These products provided the template for a subsequent
amplification reaction with the primers (5′) GCCCTCTAGACTCGAGCGGCC (3′) and (5′) CAACTAGAAGGCACAGTCGAGGC
(3′). The HindIII digestion product was subcloned between flanking
5′ hp120-1A and 3′ hARVCF cDNA sequence in pcDNA3.1.
The 5′ subcloning junctions and fusion regions between ARVCF
and p120 cDNAs were verified by sequencing.
RESULTS
Characterization of ARVCF expression
Monoclonal antibodies (mAbs) were generated previously
against the carboxy-terminal 115 amino acids of ARVCF, a
region with relatively low similarity to p120 (Mariner et al.,
1999). Fig. 1 shows the region of ARVCF used as antigen to
generate ARVCF mAb 4B1, and illustrates the structural
similarity between ARVCF and p120. The monoclonal
antibodies 4B1 (ARVCF) and 15D2 (p120) are highly specific
for their respective antigens (Mariner et al., 1999).
Initial efforts to localize ARVCF by immunofluorescence
were unsuccessful. Similarly, ARVCF was difficult to detect
by immunoprecipitation and western blotting under conditions
routinely used to assay p120. Subsequent experiments (Fig. 2)
revealed that ARVCF is nearly ubiquitously expressed, as has
been demonstrated previously by northern analysis (Sirotkin et
al., 1997), but is present in very low amounts at the protein
level. To obtain roughly equivalent signal intensities for
ARVCF and p120, the amount of cell lysate required for
ARVCF immunoprecipitation reactions (Fig. 2A) was typically
10- to 20-fold more than that required for p120 (Fig. 2B).
Levels were also compared in semiquantitative fashion by
immunoprecipitating ARVCF and p120 from HCT 116 cell
lysates with excess antibody, and analysis by Coomassie Blue
staining (data not shown). HCT116 cells were chosen because
they express higher levels of ARVCF than any of our other cell
lines. Immunoprecipitated p120, but not ARVCF, was readily
detectable by this method, suggesting that even in HCT116
cells, ARVCF is expressed at significantly lower levels than
p120. In general, ARVCF levels were highest in epithelial
cells (e.g. Fig. 2A, lanes 1-4), but decreased levels were also
1484 D. J. Mariner, J. Wang and A. B. Reynolds
human ARVCF
mAb Ag
1 2 3 4
5 6 * 7 8 9 10
AA 1
962
human p120ctn 1A
1 2 3 4
AA 1
5
6 * 7 8 9 10
962
Fig. 1. Structural similarity of ARVCF and p120ctn isoform 1A, and
location of ARVCF monoclonal antibody epitopes. Individual
Armadillo repeats are numbered. An asterisk indicates the position of
a putative nuclear localization signal, and the filled box depicts a
coiled-coil motif. Monoclonal antibodies were generated against a
115-amino-acid carboxy-terminal ARVCF fragment (hatched), a
region with low homology to p120.
Fig. 2. Comparison of ARVCF and p120 expression in different cell
types. ARVCF (mAb 4B1) and p120 (mAb 15D2) were
immunoprecipitated from NP-40 cell lysates of the indicated human
cell lines, and western blotted with ARVCF pAb (A) or mAb pp120
(B). Total protein was normalized before immunoprecipitation to
control for relative abundance. However, fivefold more lysate was used
for ARVCF immunoprecipitates than for the p120 immunoprecipitates.
Note that the exposure time for the ARVCF western blot was 15
minutes, while that for the p120 blot was 30 seconds.
detected in fibroblasts (e.g. lane 8) and a T-lymphocyte cell line
(lane 9). ARVCF was expressed as multiple isoforms,
suggesting extensive alternative splicing similar to that
characterized previously for p120 (Keirsebilck et al., 1998; Mo
and Reynolds, 1996).
To further examine and exclude the possibility that the
apparently low levels of ARVCF relative to p120 were due to
differences in antibody affinity, we coated ELISA plates with
recombinant fragments of p120 and ARVCF at equivalent
molar concentrations, and compared the signals generated by
our various p120 and ARVCF monoclonal antibodies (data not
shown). The ARVCF antibodies behaved similarly to wellcharacterized high-affinity p120 monoclonal antibodies,
indicating that differences in antibody affinities are unlikely to
account for the low levels of ARVCF detected above.
To circumvent problems with abundance, we utilized several
Fig. 3. Post-translational modification and isoform distribution of
ARVCF. mAb 4B1 immunoprecipitates of ARVCF from various cell
lines were split equally, incubated in the absence (lanes 1-5) or
presence (lanes 6-10) of lambda (λ) phosphatase, and western
blotted with ARVCF antibodies. Lanes contain immunoprecipitates
from untransfected MDCK cells (lanes 1,6), neo vector alone
transfected MDCK cells (lanes 2,7), MDCK cells stably transfected
with human ARVCF (lanes 3,8), human HCT116 colon cancer cells
(lanes 4,9), and human kidney 293 cells (lanes 5,10). Because
exogenous ARVCF is difficult to detect under conditions used for
p120 immunoprecipitation (lanes 1,2 and 6,7), tenfold more total
protein was present in lysates used for immunoprecipitation from
HCT116 (lanes 4,9) and 293 (lanes 5,10) than was present in MDCK
lysates (lanes 1-3, 6-8). HCT116 (lanes 4,9) and 293 (lanes 5,10)
cells contained several ARVCF isoforms, the largest of which
comigrated exactly with the ectopic human ARVCF expressed in
MDCK cells (lanes 3,8). Phosphatase treatment resulted in
sharpening and increased mobility of the bands in many cell types
(e.g. compare lane 4 with lane 9), consistent with removal of
phosphate.
stable MDCK cell lines ectopically expressing human ARVCF.
Immunoprecipitated ARVCF from these cell lines was easily
detected by SDS-PAGE and semiquantitative Coomassie Blue
staining (data not shown) at levels approximating those of
endogenous p120. The exogenous ARVCF from the MDCK
ARVCF overexpressor cell lines reacted strongly with ARVCF
monoclonal antibodies and comigrated with the largest form of
endogenous human ARVCF from the human cell lines HCT116
and 293 (Fig. 3, compare lane 3 to lanes 4 and 5, and lane 8 to
lanes 9 and 10). Upon treatment of ARVCF immunoprecipitates
with lambda phosphatase (lanes 6-10), a broad spectrum protein
phosphatase acting on phospho-serine, -threonine and -tyrosine,
both the endogenous and ectopic ARVCF bands collapsed into
sharp, tightly migrating bands (compare lanes 1-5 with 6-10),
indicating that ARVCF is extensively phosphorylated in vivo,
as is p120 (Thoreson et al., 2000).
Localization of ARVCF to adherens junctions
Only very faint junctional staining of ARVCF could be
ARVCF in the nucleus and adherens junction 1485
cell lines stably expressing vector alone (lanes
1-5) or ARVCF (lanes 6-10). Interactions in the
absence of ARVCF overexpression were not
detected due to the low levels of ARVCF (lanes
1-5). In the ARVCF overexpressing cell lines,
ectopic ARVCF, p120 and β-catenin each
coprecipitated with E-cadherin (Fig. 5B,C,D,
lane 7) and vice versa (Fig. 5A, lanes 8-10),
demonstrating association with one another.
However, ARVCF was not present in p120
immunoprecipitates (Fig. 5B, lane 9) and vice
versa (Fig. 5C, lane 8), while both proteins
coimmunoprecipitated β-catenin (Fig. 5D, lanes
8 and 9). These data suggest that ARVCF and
p120 are mutually exclusive for one another in
E-cadherin complexes, consistant with the
hypothesis that ARVCF interacts with Ecadherin directly and competes with p120 for
binding to the juxtamembrane domain.
Localization of ARVCF to the nucleus
To assess the distribution of ARVCF in other
cell types, we immunolocalized the protein after
transient transfection of ARVCF cDNA into a
variety of cell lines. Interestingly, under
conditions of transient overexpression, ARVCF
localized clearly to both cell-cell junctions and
nuclei in multiple cell types including MDCK
(data not shown). The nuclear localization was
particularly striking in the human fibroblast cell
line Va-2, where both junctional and nuclear
localization was observed. To further examine
ARVCF localization in this cell line, we
generated stable cell lines by transfection and
subcloning. ARVCF could not be detected in
Fig. 4. Overexpressed ARVCF colocalizes with p120. Untransfected control MDCK
the absence of overexpression (Fig. 6A), but
cells (A,B), or stable MDCK cell lines overexpressing ectopic ARVCF (C,D), were
localized prominently to the nucleus (Fig. 6C,
methanol-fixed and immunolabeled with ARVCF mAb 4B1 (A,C) or p120 mAb 8D11
arrows) as well as to points of cell-cell contact
(B,D). ARVCF was barely detectable in untransfected control cells by
(Fig. 6C, arrowhead) in multiple clonal Va-2
immunofluorescence microscopy, but colocalized precisely with p120 when
cell lines overexpressing ARVCF. Endogenous
overexpressed. 63× magnification.
p120, on the other hand, localized to the
adherens junctions in these cells and was not
detected by either monoclonal or polyclonal antibodies in the
apparent in nuclei (Fig. 6B,D). The intensity of the nuclear
absence of ARVCF overexpression (Fig. 4A), consistent with
ARVCF staining varied widely, with some nuclei staining
the low level of ARVCF detected in parental MDCK cells by
brightly and others, not at all. Cell density did not affect the
immunoprecipitation and western blotting. Immunofluorescent
variable levels of nuclear staining, nor was the degree of
localization in ARVCF-overexpressing MDCK cells, however,
nuclear localization strictly dosage-dependent, since low- as
revealed bright staining of ARVCF at cell contacts and precise
well as high-level expressing cells exhibited nuclear ARVCF.
colocalization with p120 (Fig. 4, compare C,D) and E-cadherin
Transiently overexpressed ARVCF typically concentrated to
(data not shown) in adherens junctions. Punctate staining at the
high levels in the nuclei of transfected Va-2 cells, though it
membranes, which is typical of desmosomal components, was
occasionally appeared to be absent from nuclei. Ectopically
not detected by ARVCF monoclonal antibodies. These data
expressed p120 (isoform 1A), however, was detectable in the
suggest that, like p120, ARVCF associates with cadherin
nuclear compartment to a lesser extent, with lower frequency
complexes.
of nuclear translocation and decreased concentration despite
high level expression. This tendency of overexpressed p120ARVCF and p120 bind E-cadherin in mutually
1A to remain at junctions and in the cytoplasm occurred even
exclusive complexes
in the absence of exon B, which contains a functional nuclear
To determine whether ARVCF associates directly with Eexclusion signal (van Hengel et al., 1999). Likewise,
cadherin complexes, we assayed for protein-protein
cotransfection of ARVCF and p120 in Va-2 cells frequently
associations by immunoprecipitation and western blotting of
showed accumulation of ARVCF but not p120 in the nucleus
various components of the cadherin complex (Fig. 5) in MDCK
of the same cell (Fig. 6, compare ARVCF in E to p120 in F),
1486 D. J. Mariner, J. Wang and A. B. Reynolds
Fig. 5. ARVCF and p120 coprecipitate with E-cadherin in mutually
exclusive complexes. Adherens junction proteins indicated across the
top of the blot were immunoprecipitated from 0.5% NP-40 detergent
cell lysates of a control neo-resistant MDCK cell line (lanes 1-5) or a
similar MDCK cell line stably overexpressing human ARVCF (lanes
6-10). The irrelevant epitope tag mAb 12CA5 (lanes 1,6) was used to
control for nonspecific interactions. Coimmunoprecipitating proteins
were detected by western blotting with an E-cadherin mAb (A),
ARVCF pAb (B), p120 mAb pp120 (C) and anti-β-catenin pAb (D).
Only 1/10 of the p120 immunoprecipitate was loaded for the p120
direct western blot (C, lanes 4,9). ARVCF was barely detectable in
untransfected cells (B, lane 3), but was easily detected after
transfection (B, lane 8). Note in the transfected cell line that ARVCF
immunoprecipitates do not contain p120 (C, lane 8), and p120
immunoprecipitates do not contain ARVCF (B, lane 9), suggesting a
mutually exclusive interaction with E-cadherin.
indicating that the nuclear localization of these proteins is
regulated by distinct mechanisms.
ARVCF lacks the branching activity of p120
Transient transfection of p120 into most fibroblast cell lines
induces an unusual dosage-dependent branching phenotype
that is particularly striking in NIH 3T3 cells (Reynolds et al.,
1996). To determine whether ARVCF also displays this
activity, human ARVCF and human p120 were transiently
expressed at high levels in NIH 3T3 cells from a plasmid
containing a CMV promoter. Whereas the branching
morphology of cells overexpressing p120 was striking (Fig.
7B), high levels of ARVCF had little or no effect on cell
Fig. 6. Overexpressed ARVCF localizes to both nuclei and cell-cell contacts in Va-2 fibroblasts. Wild-type Va-2 cells (A,B) were stably
transfected with human ARVCF (C,D) or transiently cotransfected with both ARVCF and murine p120 (E,F). Cells were fixed with methanol
and immunostained with ARVCF mAb 4B1 (A,C,E), or p120 mAbs 12F4 (B,D) and 8D11 (F). ARVCF was undetectable in Va-2 fibroblasts in
the absence of overexpression (A), but was detected in cell-cell contacts (arrowhead) and in the nucleus (arrows) upon stable ARVCF
expression (C). Endogenous p120, however, was not readily detectable in nuclei of wild-type (B) or stable ARVCF transfectants (D). In
transient cotransfections of ARVCF and p120, ARVCF was frequently nuclear (E) in cells that simultaneously excluded p120 (F). 63×
magnification.
ARVCF in the nucleus and adherens junction 1487
Fig. 7. Transient ARVCF overexpression in NIH 3T3 cells does not
induce a branching phenotype. Human ARVCF (A) or human p120
(B) was transiently overexpressed in NIH 3T3 cells from pcDNA3.1,
a plasmid containing a CMV promoter. No obvious morphological
phenotype was apparent upon high-level expression of ARVCF (A),
while a striking, dosage-dependent branching phenotype resulted
from p120 overexpression (B). Overexpressed ARVCF, but not p120,
frequently formed bright, spherical cytoplasmic aggregates (A,
arrowheads).
morphology (Fig. 7A). In several cell types, ectopic ARVCF
formed bright, spherical molecular aggregates in the
cytoplasm (Fig. 7A, arrowheads), which may be artifacts of
overexpression, but were nonetheless absent from p120
transfectants. Interestingly, high level coexpression of ARVCF
with p120 had no discernable effects on the branching
phenotype induced by p120 (data not shown). Thus, ARVCF
lacks p120’s branching activity, and was not able to act in a
dominant negative manner to suppress it.
A ARVCF-p120
1 2 3 4
5 6
7 8 9 10
AA 1
962
p120-ARVCF
1 2 3 4
AA 1
5
6
7 8 9 10
962
hp120
hARVCF
Molecular mapping of the sequences responsible for
the branching phenotype and nuclear localization
To begin to define the sequences mediating the different
phenotypic and nuclear properties of these proteins, molecular
chimeras (ARVCF-p120 and p120-ARVCF) were generated by
fusing human ARVCF with human p120 (isoform 1A) between
Arm repeats 3 and 4. The proteins are highly conserved in this
region and, in fact, are identical over a stretch of nine amino
acids in the location of the joint. Thus, we anticipated that the
overall structure of the chimeric proteins would not be changed
significantly, and indeed, both chimeric proteins retained the
ability to colocalize with E-cadherin at adherens junctions
(data not shown), a function mediated by the central Armadillo
repeat domain (Daniel and Reynolds, 1995). The p120 type 1A
isoform was selected for these experiments because it most
closely resembles the cloned human ARVCF cDNA and is
naturally abundant in fibroblasts (Mo and Reynolds, 1996;
Reynolds et al., 1994).
To clarify the region of p120 responsible for its branching
activity, NIH 3T3 cells were transiently transfected with the
ARVCF-p120 and p120-ARVCF chimeras (shown
schematically in Fig. 8A), which were then localized by
immunofluorescence (Fig. 8B). ARVCF-p120 transfectants
exhibited a branching phenotype similar, albeit slightly less
severe, to that induced by full-length p120 (Fig. 8Bi),
confirming previous data which demonstrated that the
Armadillo repeat domain of p120 mediates branching
(Reynolds et al., 1996). Additionally, the ARVCF-p120
transfected cells lacked the cytoplasmic speckle-like
aggregates typically detected in ARVCF transfected cells,
indicating that the carboxy-terminal end of ARVCF was
responsible for the aggregation of ARVCF into cytoplasmic
aggregates. Conversely, cells expressing the p120-ARVCF
chimera (Fig. 8Bii) did not exhibit the branching phenotype
and displayed well-defined aggregates (arrowheads).
To map the region responsible for the nucleophilic properties
of ARVCF, the chimeras were transiently transfected into Va2 fibroblasts (Fig. 8C). ARVCF-p120 localized prominently to
the nuclei of most transfected cells (Fig. 8Ci), though it was
not as prominantly concentrated in the nucleus as full-length
Fig. 8. Molecular mapping of branching and nuclear
localization activities. (A) Structure of ARVCF/p120 chimeric
proteins. ARVCF sequences are depicted in gray, and p120
sequences in white. ARVCF and p120 human cDNAs were
joined at the junction between Armadillo repeats 3 and 4 (as
indicated), generating ARVCF-p120 and p120-ARVCF. The
asterisk indicates the position of a predicted nuclear
localization signal. The black box designates a coiled-coil
motif. (B) Branching activity of the chimeric proteins in NIH
3T3 cells. Transient transfection and immunofluorescence
detection of ARVCF-p120 and p120-ARVCF in NIH 3T3 cells
revealed branching activity in cells expressing ARVCF-p120
(Bi), but not p120-ARVCF (Bii), and cytoplasmic aggregates
in cells expressing p120-ARVCF (Bii, arrowheads) but not
ARVCF-p120 (Bi). 40× magnification. (C) Localization of
chimeric proteins in Va-2 cells. Transient transfection and
immunofluorescence detection of ARVCF-p120 (Ci) and
p120-ARVCF (Cii) in Va-2 fibroblasts reveal that nuclear
localization segregates with the amino-terminal end of
ARVCF. Arrowheads indicate nuclei. 63× magnification.
1488 D. J. Mariner, J. Wang and A. B. Reynolds
ARVCF. Conversely, p120-ARVCF was absent from the
nucleus of the majority of transfected cells (Fig. 8Cii), much
like full-length p120-1A. These data suggest that, in
fibroblasts, the amino-terminal region of ARVCF is primarily
responsible for its localization with respect to the nucleus,
despite the presence of a classical bipartite nuclear localization
signal located in the carboxy-terminal region between
Armadillo repeats 6 and 7.
DISCUSSION
The recent identification of novel proteins with high homology
to p120 raises the possibility of competition and/or redundancy
among members of the growing p120 family. Moreover, as
more of these proteins are definitively demonstrated to localize
to the nucleus, a paradigm is emerging that suggests a general
role for p120 family proteins in junctional – nuclear signaling,
perhaps relaying important information regarding the status of
cell-cell contacts. Here, we find that yet another p120 family
member, ARVCF, interacts with E-cadherin in a manner that is
mutually exlusive with p120’s direct interaction with the Ecadherin juxtamembrane domain. In addition, ARVCF is
strikingly nucleophilic in particular cell types that, for the most
part, exclude p120 or at least prohibit its accumulation to high
levels in the nucleus. Interestingly, ARVCF completely lacked
the branching activity associated with p120. Thus, sequence
differences appear to eliminate an interaction or activity that in
p120 leads to the dramatic induction of highly branched
cellular processes. Therefore, while several similarities
between p120 and ARVCF are evident, the data suggest that
these proteins are unlikely to have significant functional
redundancy.
In support of this conclusion is the finding that ARVCF is
expressed at very low levels in most cells. To generate an
ARVCF signal on western blots that was comparable to that
for p120, it was necessary to immunoprecipitate ARVCF from
at least tenfold more cell lysate than required for p120. In fact,
there was not enough ARVCF in any of the untransfected cell
lines examined to suggest either an important role as a stuctural
protein in junctions, or that displacement of p120 by ARVCF
could be quantitatively significant. Rather, we propose a
specialized role for ARVCF in modulating cadherin function,
for which high-level expression is not necessary. However, it
is also possible that ARVCF is expressed at high levels under
certain circumstances, perhaps during development, which
could increase its presence in the cadherin complex relative to
other p120 family members. For example, δ-catenin/NPRAP/
neurojungin, a close relative of p120 and ARVCF, is expressed
at highest levels during brain development and is decreased in
adult neural tissues (Lu et al., 1999; Paffenholz and Franke,
1997). The possibility of competition among p120 family
members for cadherin binding is an important concept, the
consequences of which remain poorly understood.
Analysis of ARVCF expression by western blotting revealed
multiple bands in all cell types examined. Alternative splicing
of p120 results in the use of as many as four different start
codons and the alternative use of three exons in the carboxyterminal half of the protein (Mo and Reynolds, 1996; van
Hengel et al., 1999). Given the nearly identical intron-exon
structure of these proteins, it is likely that the multiple isoforms
of ARVCF are similarly generated. In addition, like p120,
ARVCF isoforms generally did not migrate on electrophoretic
gels as sharply focussed bands, a situation readily rectified
by treatment with phosphatase. Thus, ARVCF appears to
be extensively modified by phosphorylation, especially in
epithelial cells. We have shown previously that p120
phosphorylation is dependent on its recruitment to the
membrane by E-cadherin (Thoreson et al., 2000). By analogy
to p120, the diffuse ARVCF bands likely reflect its presence at
membranes.
Overexpression of ARVCF and p120 in a variety of cell lines
revealed a clear propensity of ARVCF to localize to the nucleus
in certain cell types, and ARVCF was considerably more
efficient than p120 (isoform 1A) in this process. Though the
nuclear accumulation of ARVCF was particularly striking in
human Va-2 fibroblasts, ARVCF was less intensely nuclear and
often excluded from the nucleus in NIH 3T3 cells, indicating
that nuclear localization is mediated by cell type-specific
events that are not necessarily fibroblast-specific. In addition,
in clonal populations of Va-2 cells, ARVCF was cell junctionspecific in some cells and mostly nuclear in others. This result
was independent of cell density, raising the possibility that
ARVCF localization is affected by the cell cycle, as has been
reported previously for the Drosophila Armadillo repeat
protein Pendulin (Kussel and Frasch, 1995). In addition,
transiently overexpressed ARVCF, but not p120, tended to
form aggregates in the cytoplasm. This phenomenon was
exacerbated by high level expression and was dependent on
sequences downstream of Arm repeat 3.
Additional characteristics further distinguish ARVCF from
p120. ARVCF completely lacked the strong branching activity
induced in fibroblasts by high-level p120 expression. This
effect is not induced by other Armadillo repeat proteins (e.g.
β-catenin) and requires an intact Armadillo repeat domain
(Reynolds et al., 1996). Apparently, the 56% identity to p120
within the Arm domain is not sufficient to preserve the activity.
The simplest explanation is that p120, but not ARVCF,
associates with an activity that somehow mediates the
branching phenotype. It is also noteworthy that stable
overexpression of ARVCF in both MDCK and Va-2 cells was
easily achieved, whereas we have been unable to stably
overexpress p120 in these and most other cell lines. Thus,
constitutive expression of p120, but not ARVCF, is apparently
incompatible with most cells for reasons that are as yet
unknown but might relate to these different activities.
Surprisingly, sequences necessary for the strong nuclear
presence of ARVCF were located in its amino-terminal end.
All p120 family members contain conserved stretches of basic
amino acids located between repeats 6 and 7, which resemble
prototypical nuclear localization signals, or in the case of
ARVCF, a classic bipartite nuclear localization signal. The
motif is the obvious candidate for the sequence that regulates
the ability of these proteins to translocate to nuclei. Bipartite
nuclear targeting motifs are found in more than 50% of nuclear
proteins and less than 5% of non-nuclear proteins (Dingwall
and Laskey, 1991). Nonetheless, our data strongly suggest that
strong nuclear localization of ARVCF is dependent on
sequences amino-terminal to repeat 4. The data are consistent
with reports that the cognate motif in δ-catenin and
plakophilins is not required for nuclear translocation
(Klymkowsky, 1999; Paffenholz and Franke, 1997). Moreover,
ARVCF in the nucleus and adherens junction 1489
in preliminary experiments, we find that deletion of the basic
motif in p120 has no effect on its ability to translocate to the
nucleus, even under conditions where nuclear translocation of
p120 is efficient (not shown). Therefore, the basic motif is
likely to have a different function that has yet to be elucidated.
In summary, ARVCF and p120 associate with E-cadherin in
a mutually exclusive fashion, suggesting competition for
interaction with the juxtamembrane domain. Thus, it is
theoretically possible that high level ARVCF expression could
compete for cadherin occupancy, thereby substituting its own
functions or acting as a dominant negative inhibitor of p120
function. However, the low level expression of ARVCF relative
to p120 suggests that replacement of p120 is not
physiologically relevant, at least in most adult cell types.
Instead, ARVCF is likely to have a different and probably
additive role in cell-cell junctions that is not directly
competitive with p120. In addition, ARVCF appears to be more
nucleophilic than p120 in many cell types. Thus, ARVCF may
have increased importance in the nucleus, or shuttle between
membranes and the nucleus, thereby conveying information
related to cell-cell contact. One possibility is that docking on
E-cadherin, or other resident cadherins, may be a regulatory
mechanism restricting access of ARVCF to the nucleus. The
inability of ARVCF to induce cellular branching, and the
increased nucleophilic properties of ARVCF relative to p120,
highlight an emerging picture supporting nonredundant roles
for these proteins in cells where they are coexpressed.
We thank Frans van Roy for the human p120 cDNA, and Howard
Sirotkin and Raju Kucherlapati for the human ARVCF cDNA. This
work was supported in part by NIH grant CA55724, and by the
Vanderbilt-Ingram Cancer Center through a Cancer Center Support
Grant from the National Cancer Institute (CA69485). We also wish to
acknowledge the excellent support of Ray Mernaugh and the
Vanderbilt Molecular Recognition Unit.
REFERENCES
Aono, S., Nakagawa, S., Reynolds, A. B. and Takeichi, M. (1999). p120(ctn)
acts as an inhibitory regulator of cadherin function in colon carcinoma cells.
J. Cell Biol. 145, 551-562.
Birchmeier, W. and Behrens, J. (1994). Cadherin expression in carcinomas:
role in the formation of cell junctions and the prevention of invasiveness.
Biochim. Biophys. Acta 1198, 11-26.
Bonne, S., van Hengel, J., Nollet, F., Kools, P. and van Roy, F. (1999).
Plakophilin-3, a novel armadillo-like protein present in nuclei and
desmosomes of epithelial cells. J. Cell Sci. 112, 2265-2276.
Bonne, S., van Hengel, J. and van Roy, F. (1998). Chromosomal mapping
of human armadillo genes belonging to the p120(ctn)/plakophilin subfamily.
Genomics 51, 452-454.
Chen, H., Paradies, N. E., Fedor-Chaiken, M. and Brackenbury, R. (1997).
E-cadherin mediates adhesion and suppresses cell motility via distinct
mechanisms. J. Cell Sci. 110, 345-356.
Daniel, J. M. and Reynolds, A. B. (1995). The tyrosine kinase substrate
p120cas binds directly to E-cadherin but not to the adenomatous polyposis
coli protein or alpha-catenin. Mol. Cell. Biol. 15, 4819-4824.
Daniel, J. M. and Reynolds, A. B. (1999). The catenin p120(ctn) interacts
with Kaiso, a novel BTB/POZ domain zinc finger transcription factor. Mol.
Cell. Biol. 19, 3614-3623.
Desmaze, C., Prieur, M., Amblard, F., Aikem, M., LeDeist, F., Demczuk,
S., Zucman, J., Plougastel, B., Delattre, O., Croquette, M. F. et al. (1993).
Physical mapping by FISH of the DiGeorge critical region (DGCR):
involvement of the region in familial cases. Am. J. Hum. Genet. 53, 12391249.
Dingwall, C. and Laskey, R. A. (1991). Nuclear targeting sequences – a
consensus? Trends Biol. Sci. 16, 478-481.
Driscoll, D., Salvin, J., Sellinger, B., Budarf, M., McDonald-McGinn, D.,
Zackai, E. and Emanuel, B. (1993). Prevalence of 22q11 microdeletions
in DiGeorge and velocardiofacial syndromes: Implications for genetic
counselling and prenatal diagnosis. J. Med. Genet. 30, 813-817.
Driscoll, D., Spinner, N., Budarf, M., McDonald-McGinn, D., Zackai, E.,
Goldberg, R., Shprintzen, R., Saal, H., Zonana, J., Jones, M. et al.
(1992). Deletions and microdeletions of 22q11.2 in velo-cardio-facial
syndrome. Am. J. Med. Genet. 44, 261-268.
Fagotto, F., Gluck, U. and Gumbiner, B. (1998). Nuclear localization signalindependent and importin/karopherin-independent nuclear import of βcatenin. Curr. Biol. 8, 181-190.
Frixen, U. H., Behrens, J., Sachs, M., Eberle, G., Voss, B., Warda, A.,
Lochner, D. and Birchmeier, W. (1991). E-cadherin-mediated cell-cell
adhesion prevents invasiveness of human carcinoma cells. J. Cell Biol. 113,
173-185.
Hatzfeld, M., Kristjansson, G. I., Plessmann, U. and Weber, K. (1994).
Band 6 protein, a major constituent of desmosomes from stratified epithelia,
is a novel member of the armadillo multigene family. J. Cell Sci. 107, 22592270.
Hatzfeld, M. and Nachtsheim, C. (1996). Cloning and characterization of a
new armadillo family member, p0071, associated with the junctional plaque:
evidence for a subfamily of closely related proteins. J. Cell Sci. 109, 27672778.
Hazan, R. B., Kang, L., Roe, S., Borgen, P. I. and Rimm, D. L. (1997).
Vinculin is associated with the E-cadherin adhesion complex. J. Biol. Chem.
272, 32448-32453.
Heid, H. W., Schmidt, A., Zimbelmann, R., Schafer, S., WinterSimanowski, S., Stumpp, S., Keith, M., Figge, U., Schnolzer, M. and
Franke, W. W. (1994). Cell type specific desmosomal plaque proteins of
the plakoglobin family: plakophilin 1 (band 6 protein). Differentiation 58,
113-131.
Herrenknecht, K., Ozawa, M., Eckerskorn, C., Lottspeich, F., Lenter, M.
and Kemler, R. (1991). The uvomorulin-anchorage protein alpha catenin is
a vinculin homologue. Proc. Natl. Acad. Sci. USA 88, 9156-9160.
Hirano, S., Kimoto, N., Shimoyama, Y., Hirohashi, S. and Takeichi, M.
(1992). Identification of a neural alpha-catenin as a key regulator of cadherin
function and multicellular organization. Cell 70, 293-301.
Kawanishi, J., Kato, J., Sasaki, K., Fujii, S., Watanabe, N. and Niitsu, Y.
(1995). Loss of E-cadherin-dependent cell-cell adhesion due to mutation of
the beta-catenin gene in a human cancer cell line, HSC-39. Mol. Cell. Biol.
15, 1175-1181.
Keirsebilck, A., Bonne, S., Staes, K., van Hengel, J., Nollet, F., Reynolds,
A. and van Roy, F. (1998). Molecular cloning of the human p120ctn catenin
gene (CTNND1): expression of multiple alternatively spliced isoforms.
Genomics 50, 129-146.
Kelly, D., Goldberg, R., Wilson, D., Lindsay, E., Carey, A., Goodship, J.,
Burn, J., Cross, I., Shprintzen, R. and Scambler, P. (1993). Confirmation
that the velo-cardio-facial syndrome is associated with haplo-insufficiency
of genes at chromosome 22q11. Am. J. Med. Genet. 45, 308-312.
Klymkowsky, M. W. (1999). Plakophilin, armadillo repeats, and nuclear
localization. Microsc. Res. Tech. 45, 43-54.
Knudsen, K. A., Soler, A. P., Johnson, K. R. and Wheelock, M. J. (1995).
Interaction of alpha-actinin with the cadherin/catenin cell-cell adhesion
complex via alpha-catenin. J. Cell. Biol. 130, 67-77.
Kussel, P. and Frasch, M. (1995). Pendulin, a Drosophila protein with cell
cycle-dependent nuclear localization, is required for normal cell
proliferation. J. Cell. Biol. 129, 1491-1507.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly
of the head of the bacteriophage T4. Nature 227, 680-685.
Lampugnani, M. G., Corada, M., Andriopoulou, P., Esser, S., Risau, W.
and Dejana, E. (1997). Cell confluence regulates tyrosine phosphorylation
of adherens junction components in endothelial cells. J. Cell Sci. 110, 20652077.
Lu, Q., Paredes, M., Medina, M., Zhou, J., Cavallo, R., Peifer, M.,
Orecchio, L. and Kosik, K. S. (1999). delta-catenin, an Adhesive Junctionassociated Protein Which Promotes Cell Scattering. J. Cell Biol. 144, 519532.
Mariner, D. J., Sirotkin, H., Daniel, J. M., Lindman, B. R., Mernaugh, R.
L., Patten, A. K., Thoreson, M. A. and Reynolds, A. B. (1999). Production
and characterization of monoclonal antibodies to ARVCF. Hybridoma 18,
343-349.
Mertens, C., Kuhn, C. and Franke, W. W. (1996). Plakophilins 2a and 2b:
constitutive proteins of dual location in the karyoplasm and the desmosomal
plaque. J. Cell Biol. 135, 1009-1025.
1490 D. J. Mariner, J. Wang and A. B. Reynolds
Mo, Y. Y. and Reynolds, A. B. (1996). Identification of murine p120 isoforms
and heterogeneous expression of p120cas isoforms in human tumor cell
lines. Cancer Res. 56, 2633-2640.
Morrow, B., Goldberg, R., Carlson, C., Gupta, R. D., Sirotkin, H., Collins,
J., Dunham, I., O’Donnell, H., Scambler, P., Shprintzen, R. et al. (1995).
Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome.
Am. J. Hum. Genet. 56, 1391-1403.
Morton, R. A., Ewing, C. M., Nagafuchi, A., Tsukita, S. and Isaacs, W. B.
(1993). Reduction of E-cadherin levels and deletion of the alpha-catenin
gene in human prostate cancer cells. Cancer Res. 53, 3585-3590.
Nagafuchi, A., Takeichi, M. and Tsukita, S. (1991). The 102 kd cadherinassociated protein: similarity to vinculin and posttranscriptional regulation
of expression. Cell 65, 849-857.
Nieset, J. E., Redfield, A. R., Jin, F., Knudsen, K. A., Johnson, K. R. and
Wheelock, M. J. (1997). Characterization of the interactions of alphacatenin with alpha-actinin and beta-catenin/plakoglobin. J. Cell Sci. 110,
1013-1022.
Nollet, F., Berx, G. and Roy, F. v. (1999). The Role of the E-Cadherin/Catenin
Adhesion Complex in the Development and Progression of Cancer. Mol.
Cell Biol. Res. Commun. 2, 77-85.
Ohkubo, T. and Ozawa, M. (1999). p120(ctn) binds to the membraneproximal region of the E-cadherin cytoplasmic domain and is involved in
modulation of adhesion activity. J. Biol. Chem. 274, 21409-21415.
Oyama, T., Kanai, Y., Ochiai, A., Akimoto, S., Oda, T., Yanagihara, K.,
Nagafuchi, A., Tsukita, S., Shibamoto, S., Ito, F. et al. (1994). A truncated
beta-catenin disrupts the interaction between E-cadherin and alpha-catenin:
a cause of loss of intercellular adhesiveness in human cancer cell lines.
Cancer Res. 54, 6282-6287.
Paffenholz, R. and Franke, W. W. (1997). Identification and localization of
a neurally expressed member of the plakoglobin/armadillo multigene family.
Differentiation 61, 293-304.
Paffenholz, R., Kuhn, C., Grund, C., Stehr, S. and Franke, W. W. (1999).
The arm-repeat protein NPRAP (neurojungin) is a constituent of the plaques
of the outer limiting zone in the retina, defining a novel type of adhering
junction. Exp. Cell Res. 250, 452-464.
Peifer, M. (1995). Cell adhesion and signal transduction: the Armadillo
connection. Trends Cell Biol. 5, 224-229.
Perl, A. K., Wilgenbus, P., Dahl, U., Semb, H. and Christofori, G. (1998).
A causal role for E-cadherin in the transition from adenoma to carcinoma.
Nature 392, 190-193.
Reynolds, A. B., Daniel, J., McCrea, P. D., Wheelock, M. J., Wu, J. and
Zhang, Z. (1994). Identification of a new catenin: the tyrosine kinase
substrate p120cas associates with E-cadherin complexes. Mol. Cell Biol. 14,
8333-8342.
Reynolds, A. B. and Daniel, J. M. (1997). p120ctn: a Src-substrate turned
catenin. In Cytoskeletal-Membrane Interactions and Signal Transduction,
chapter 3 (ed. P. Cowin and M. Klymkowsky), pp. 31-48. USA: Landes
Bioscience.
Reynolds, A. B., Daniel, J. M., Mo, Y. Y., Wu, J. and Zhang, Z. (1996). The
novel catenin p120cas binds classical cadherins and induces an unusual
morphological phenotype in NIH3T3 fibroblasts. Exp. Cell Res. 225, 328337.
Riehl, R., Johnson, K., Bradley, R., Grunwald, G. B., Cornel, E.,
Lilienbaum, A. and Holt, C. E. (1996). Cadherin function is required for
axon outgrowth in retinal ganglion cells in vivo. Neuron 17, 837-848.
Scambler, P., Kelly, D., Lindsay, E., Williamson, R., Goldberg, R.,
Shprintzen, R., Wilson, D., Goodship, J., Cross, I. and Burn, J. (1992).
Velo-cardio-facial syndrome associated with chromosome 22 deletions
encompassing the DiGeorge locus. Lancet 339, 1138-1139.
Schmidt, A., Langbein, L., Pratzel, S., Rode, M., Rackwitz, H. R. and
Franke, W. W. (1999). Plakophilin 3 – a novel cell-type-specific
desmosomal plaque protein. Differentiation 64, 291-306.
Schmidt, A., Langbein, L., Rode, M., Pratzel, S., Zimbelmann, R. and
Franke, W. W. (1997). Plakophilins 1a and 1b: widespread nuclear proteins
recruited in specific epithelial cells as desmosomal plaque components. Cell
Tissue Res. 290, 481-499.
Shprintzen, R. J., Goldberg, R. B., Young, D. and Wolford, L. (1981). The
velo-cardio-facial syndrome: a clinical and genetic analysis. Pediatrics 67,
167-172.
Sirotkin, H., O’Donnell, H., DasGupta, R., Halford, S., St. Jore, B.,
Puech, A., Parimoo, S., Morrow, B., Skoultchi, A., Weissman, S. M. et
al. (1997). Identification of a new human catenin gene family member
(ARVCF) from the region deleted in velo-cardio-facial syndrome.
Genomics 41, 75-83.
Steinberg, M. S. and McNutt, P. M. (1999). Cadherins and their connections:
adhesion junctions have broader functions. Curr. Opin. Cell Biol. 11, 554560.
Takeichi, M. (1991). Cadherin cell adhesion receptors as a morphogenetic
regulator. Science 251, 1451-1455.
Thoreson, M. A., Anastasiadis, P. Z., Daniel, J. M., Ireton, R. C.,
Wheelock, M. J., Johnson, K. R., Hummingbird, D. K. and Reynolds,
A. B. (2000). Selective uncoupling of p120ctn from E-cadherin disrupts
strong adhesion. J. Cell Biol., in press.
van Hengel, J., Vanhoenacker, P., Staes, K. and van Roy, F. (1999). Nuclear
localization of the p120(ctn) armadillo-like catenin is counteracted by a
nuclear export signal and by E-cadherin expression. Proc. Natl. Acad. Sci.
USA 96, 7980-7985.
Vleminckx, K., Vakaet, L., Jr., Mareel, M., Fiers, W. and van Roy, F.
(1991). Genetic manipulation of E-cadherin expression by epithelial tumor
cells reveals an invasion suppressor role. Cell 66, 107-119.
Wilson, D., Cross, I., Goodship, J., Brown, J., Scambler, P., Bain, H.,
Taylor, J., Walsh, K., Bankier, A., Burn, J. et al. (1992a). A prospective
cytogenetic study of 36 cases of DiGeorge syndrome. Am. J. Hum. Genet.
51, 957-963.
Wilson, D., Goodship, J., Burn, J., Cross, I. and Scambler, P. (1992b).
Deletions within chromosome 22q11 in familial congenital heart disease.
Lancet 340, 573-575.
Wu, J., Mariner, D. J., Thoreson, M. A. and Reynolds, A. B. (1998).
Production and characterization of monoclonal antibodies to the catenin
p120ctn. Hybridoma 17, 175-183.
Yap, A. S. (1998). The morphogenetic role of cadherin cell adhesion molecules
in human cancer: a thematic review. Cancer Invest. 16, 252-261.
Yap, A. S., Niessen, C. M. and Gumbiner, B. M. (1998). The juxtamembrane
region of the cadherin cytoplasmic tail supports lateral clustering, adhesive
strengthening, and interaction with p120ctn. J. Cell Biol. 141, 779-789.
Young, D., Shprintzen, R. and Goldberg, R. (1980). Cardiac malformations
in the velo-cardio-facial syndrome. Am. J. Cardiol. 46, 643-647.
Zhou, J., Liyanage, U., Medina, M., Ho, C., Simmons, A. D., Lovett, M.
and Kosiks, K. S. (1997). Presenilin 1 interaction in the brain with a novel
member of the armadillo family. NeuroRep. 8, 1489-1494.