Am J Physiol Lung Cell Mol Physiol 290: L777–L789, 2006.
First published November 18, 2005; doi:10.1152/ajplung.00293.2005.
Iroquois genes influence proximo-distal morphogenesis during rat
lung development
Minke van Tuyl,1,2 Jason Liu,1 Freek Groenman,1,2 Ross Ridsdale,1
Robin N. N. Han,1 Vikram Venkatesh,1 Dick Tibboel,4 and Martin Post1,2,3
1
Lung Biology Program, Hospital for Sick Children Research Institute, Toronto; Departments of
Pediatrics and 3Physiology, University of Toronto, Toronto, Canada; and 4Department of Pediatric Surgery,
Sophia Children’s Hospital, Erasmus University Medical Centre Rotterdam, Rotterdam, The Netherlands
2
Submitted 6 July 2005; accepted in final form 9 November 2005
establishes a large
diffusible interface with the circulation to facilitate respiratory
gas exchange at birth. To form such a large surface area, the
developing lung undergoes epithelial airway branching and
differentiation while the pulmonary mesenchyme provides the
vascular, smooth muscle, and cartilage tissue. Although the
exact molecular signals guiding lung development are unknown, several morphogenetic factors have been implicated
(56, 60). One of them, Sonic hedgehog (Shh), a vertebrate
homolog of Drosophila hedgehog (Hh), is expressed in the
lung epithelium (57). The Gli1–3 genes, the vertebrate counterparts of Cubitus interruptus (Ci), which is the principal effector
of Hh signaling in Drosophila, are expressed in distinct but
overlapping domains in the lung mesenchyme, with highest
expression in distal tips (57). Null mutant mice for Shh and the
Gli genes all exhibit a mild or severe lung phenotype, from
minor lobar defects and lung hypoplasia to lung agenesis (23,
35, 40, 43, 45). Downstream targets for Gli proteins remain to
be elucidated. In Drosophila, Ci may regulate the activity of
the Iroquois complex of homeobox genes (20). The Iroquois
complex (Iro-C) contains three highly related homeobox
genes: araucan, caupolican, and mirror, which are members of
an evolutionary conserved family of homeodomain containing
transcription factors.
In the fruit fly, araucan and caupolican are positive controllers of the proneural genes achaete and scute and vein-forming
genes (20). During wing formation, araucan and caupolican
are positively controlled by Ci and Decapentaplegic (Dpp)
(22). The Iro-C homeoproteins are essential for dorso-ventral
patterning of the Drosophila eye, head, and follicle (12, 13, 29,
36). In Xenopus, the amphibian homologs of Iroquois, Xiro1
and Xiro2, control the expression of proneural genes, and
similar to araucan and caupolican, Xiro1 and Xiro2 are positively controlled by Ci (21). More recently, Gómez-Skarmeta
et al. (19) showed that in Xenopus neural development, Xiro1
represses bone morphogenetic protein (BMP) 4 and that the
expression of Xiro requires Wnt signaling. BMP4, a member of
the transforming growth factor-␤ (TGF-␤) superfamily of proteins and the vertebrate counterpart of Drosophila Dpp, plays
a major role in lung morphogenesis. Both overexpression and
inhibition of BMP4 signaling result in abnormal lung branching in mice (4, 52, 61).
Six vertebrate homologs of the Iroquois genes, Irx1– 6, have
been identified. The six members are organized in two cognate
clusters of three genes each, Irx1, Irx2, Irx4 and Irx3, Irx5,
Irx6, respectively (47). In most tissues, the pattern of expression of the clustered genes, especially of Irx1 and Irx2 and of
Irx3 and Irx5, respectively, closely resemble each other (25).
The Irx genes show temporal and spatial restricted expression
patterns during murine neural and cardiac development (7, 8,
10, 16, 17, 41). In the chicken, Irx4 regulates chamber-specific
gene expression (1).
Based on the aforementioned reports, we investigated
whether the Irx genes are part of either the Shh/Gli and/or
BMP4 signaling pathway that controls lung branching morphogenesis. Because Irx6 is very weakly expressed and in a
Address for reprint requests and other correspondence: M. Post, Program in
Lung Biology, Hospital for Sick Children Research Inst., 555 Univ. Ave.,
Toronto, Ontario M5G 1X8, Canada (e-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Iroquois homeobox genes; differentiation; sonic hedgehog; fibroblast
growth factor; bone morphogenic protein 4
DURING DEVELOPMENT, THE MAMMALIAN LUNG
http://www.ajplung.org
1040-0605/06 $8.00 Copyright © 2006 the American Physiological Society
L777
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Van Tuyl, Minke, Jason Liu, Freek Groenman, Ross Ridsdale, Robin N. N. Han, Vikram Venkatesh, Dick Tibboel, and
Martin Post. Iroquois genes influence proximo-distal morphogenesis during rat lung development. Am J Physiol Lung Cell Mol
Physiol 290: L777–L789, 2006. First published November 18, 2005;
doi:10.1152/ajplung.00293.2005.—Lung development is a highly regulated process directed by mesenchymal-epithelial interactions, which
coordinate the temporal and spatial expression of multiple regulatory
factors required for proper lung formation. The Iroquois homeobox
(Irx) genes have been implicated in the patterning and specification of
several Drosophila and vertebrate organs, including the heart. Herein,
we investigated whether the Irx genes play a role in lung morphogenesis. We found that Irx1–3 and Irx5 expression was confined to the
branching lung epithelium, whereas Irx4 was not expressed in the
developing lung. Antisense knockdown of all pulmonary Irx genes
together dramatically decreased distal branching morphogenesis and
increased distention of the proximal tubules in vitro, which was
accompanied by a reduction in surfactant protein C-positive epithelial
cells and an increase in ␤-tubulin IV and Clara cell secretory protein
positive epithelial structures. Transmission electron microscopy confirmed the proximal phenotype of the epithelial structures. Furthermore, antisense Irx knockdown resulted in loss of lung mesenchyme
and abnormal smooth muscle cell formation. Expression of fibroblast
growth factors (FGF) 1, 7, and 10, FGF receptor 2, bone morphogenetic protein 4, and Sonic hedgehog (Shh) were not altered in lung
explants treated with antisense Irx oligonucleotides. All four Irx genes
were expressed in Shh- and Gli2-deficient murine lungs. Collectively,
these results suggest that Irx genes are involved in the regulation of
proximo-distal morphogenesis of the developing lung but are likely
not linked to the FGF, BMP, or Shh signaling pathways.
L778
IRX GENES AND LUNG DEVELOPMENT
very restrictive pattern (41) we focused on Irx1–5. We found
that Irx1, Irx2, Irx3, and Irx5, but not Irx4, are specifically
expressed in developing lung epithelium during the period of
active airway branching. Inhibition of Irx signaling in vitro
resulted in grossly abnormal lungs with decreased branching
and epithelial proximalization of the lung. Addition of BMP4
did not recover the observed lung phenotype, suggesting that
BMP4 is not a downstream target of Irx in the developing lung.
Furthermore, we observed that Irx inhibition had no effect on
Shh expression and that the Irx genes were normally expressed
in Shh⫺/⫺ and Gli2⫺/⫺ mutant lungs, suggesting that they do
not function up- or downstream in the Shh/Gli signaling
pathway.
Animals. All rat and mouse protocols were in accordance with
Canadian Counsel of Animal Care guidelines and were approved by
the Animal Care and Use Committee of the Hospital for Sick Children
(Toronto, ON, Canada). Female and male Wistar rats were obtained
from Charles River (St. Constant, Quebec, Canada) and were bred in
our animal facilities. Rats were killed at embryonic days (E) 13.5–
20.5 of gestation (term ⫽ 22 days). Shh, Gli2, and Gli3 heterozygous
(Shh⫹/⫺, Gli2⫹/⫺, Gli3⫹/⫺) mice were obtained from Dr. C. C. Hui
(Hospital for Sick Children). The Shh, Gli2, and Gli3 genotypes were
established by PCR analysis of genomic DNA (15).
Fig. 1. Irx1 (A–C) and Irx3 (D–F) expression in the developing rat lung. In situ hybridization (ISH) using antisense digoxigenin (DIG)-labeled probes showed
that Irx1 and Irx3 mRNA were expressed at high levels in early gestational rat lung epithelium [A and D and B and E, at embryonic day (E) 13.5 and E16.5,
respectively], whereas their expression decreased at later stages (C and F, at E18.5 for Irx1 and Irx3, respectively). No staining was observed in mesenchymal
or endothelial tissue or when sense probes (G–I for sense Irx1; sense Irx2, -3, and -5 not shown) were used. Dark purple color is positive ISH staining. Bar: 100
␮m.
AJP-Lung Cell Mol Physiol • VOL
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
MATERIALS AND METHODS
Lung organ culture. Rat embryos were obtained from timedpregnant rats at E13.5 (morning of plug is designated as E0.5). Lungs
were dissected under sterile conditions and placed on floating 8-␮m
Whatman Nuclepore polycarbonate membranes (Integra Environmental Burlington, ON, Canada). Explants were cultured in Dulbecco’s
modified Eagle medium (DMEM; GIBCO-BRL, Grand Island, NY)
with 10% (vol/vol) fetal bovine serum and maintained in 20% O2/5%
CO2 at 37°C. Medium and oligodeoxynucleotides (ODNs) were
changed every other day. Antisense, sense, and scrambled Irx ODNs
were added to a final concentration of 20 ␮M. Recombinant human
BMP4 (R&D Systems, Minneapolis, MN) was used in a concentration
of 200 ng/ml. All explant experiments were carried out in triplicate
and were repeated at least three times.
Antisense Irx oligonucleotide inhibition. A phosphorothioate oligonucleotide, 5⬘-ATGTCCTTCCCCCAGC⬘-3, targeted against the
translation initiation site of rat and murine Irx3 has an overlap of 81%
with the translation initiation sites of both murine Irx2 and Irx5 and a
95% overlap with the translation initiation site of murine Irx1 used to
target rat Irx1, Irx2, Irx3, and Irx5 gene expression. Sense oligonucleotide (5⬘-GCTGGGGGAAGGACAT-3⬘) and scrambled sequence
oligonucleotide (5⬘-CCGATGGCAGTGGAGA-3⬘) were used as controls.
Probes. The Irx1, Irx2, Irx3, and Irx5 cDNAs were a gift from Dr.
V. M. Christoffels (Academic Medical Centre, Amsterdam, The
Netherlands) (16). The Irx4 cDNA was obtained from Dr. B. G.
Bruneau (Hospital for Sick Children). Plasmid containing mouse
Mash-1 cDNA was obtained from Dr. S. E. Egan (Hospital for Sick
IRX GENES AND LUNG DEVELOPMENT
were stopped at the same time to make comparison over different
stages of development possible. After color development, sections
were washed in distilled water, dehydrated in a graded series of
ethanol and xylene, and mounted with coverslips using Permount
(Fisher Scientific, Unionville, ON, Canada). Pictures were taken with
a Leica digital imaging system.
Immunohistochemistry. Lung explants were fixed overnight in 4%
PFA in PBS, dehydrated, and embedded in paraplast. Immunohistochemistry was essentially conducted as described by Hsu and coworkers (26). Sections (7 ␮m) were deparaffinized and rehydrated in a
graded series of ethanol. Antigen retrieval was achieved with heating
in sodium citrate, pH 6.0. Endogenous peroxidase activity was
quenched with 0.15% (vol/vol) hydrogen peroxide in methanol. Nonspecific binding sites were blocked with 5% (vol/vol) normal goat
serum (NGS) and 1% (wt/vol) bovine serum albumin followed by
overnight incubation at 4°C with a mouse monoclonal anti-thyroid
transcription factor (TTF)-1 (Neomarkers, Fremont, CA) (1:50),
mouse monoclonal anti-hepatocyte nuclear factor family (HNF)-3␤
(Developmental Studies Hybridoma Bank, University of Iowa) (1:
50), mouse monoclonal anti-Shh (Developmental Studies Hybridoma
Bank) (1: 50), mouse monoclonal anti-␣-smooth muscle actin (␣-sma)
antibody (Neomarkers, Fremont, CA) (1:1,000), mouse monoclonal
anti-␤-tubulin IV (Biogenix, San Ramon, CA) (1:100), or mouse
monoclonal anti-vimentin (Sigma, St. Louis, MO) (1:600) antibody,
all diluted in blocking solution (5% NGS and 1% BSA in PBS).
Sections were subsequently incubated with biotinylated secondary
antibodies, and color detection was performed according to instructions in the Vectastain ABC and DAB kit (Vector Laboratories,
Burlingame, CA). Sections were lightly counterstained with Carazzi
hematoxylin and mounted in Permount (Fisher Scientific). Digital
images were taken using a Leica imaging system.
Terminal transferase dUTP nick-end labeling assay. Lung explants
cultured for 3 days with antisense ODNs targeted against Irx1–5 were
fixed in 4% PFA in PBS and then embedded in paraplast. Sections (5
␮m) were dewaxed with xylene, rehydrated in a graded series of
ethanol, and treated with proteinase K (20 ␮g/ml) for 15 min at 37°C.
After washing in PBS, the terminal transferase dUTP nick-end labeling (TUNEL) assay was conducted according to manufacturer’s
instructions [In Situ Cell Death Detection (fluorescein) kit, Roche].
Sections were mounted with mounting medium containing 4⬘,6-
Fig. 2. Irx2 (A–C) and Irx5 (D–F) expression in the developing rat lung. ISH using antisense DIG-labeled probes showed that Irx2 and Irx5 mRNA were
expressed at high levels in the early gestational rat lung epithelium (A and D and B and E, at E13.5 and E16.5, respectively) while their expression decreased
at later stages (C and F, at E18.5 for Irx2 and Irx5, respectively). No staining was observed in mesenchymal or endothelial tissue or when sense probes were
used. Dark purple color is positive ISH staining. Bar: 100 ␮m.
AJP-Lung Cell Mol Physiol • VOL
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Children). Murine surfactant protein (SP)-C and Clara cell secretory
protein (CCSP) cDNA fragments were cloned by RT-PCR. Sense and
antisense riboprobes for Irx1 (1050 bp), Irx2 (1800 bp), Irx3 (1000
bp), Irx4 (1050 bp), Irx5 (950 bp), Mash-1 (2.8 kb), surfactant protein
C (SP-C; 330 bp), and Clara cell secretory protein (CCSP, 315 bp)
were digoxigenin (DIG) labeled according to a protocol provided by
the manufacturer (Roche, Montreal, PQ, Canada).
RNA extraction and RT-PCR. Total RNA was isolated by using
RNeasy total RNA kit (Qiagen, Chatham, CA), and RT-PCR was
performed as described previously (59). Primer sequences (from 5⬘ to
3⬘), size of amplification products, number of cycles, and annealing
temperature were: fibroblast growth factor (FGF) 1 GCCATAGTGAGTCCGAGGACC and ACCGAGAGGTTCAACCTGCC, 387
bp, 35 cycles, 55°C (42); FGF7 CTTCCCTTTGACAGGAATCCCCTT and ATCCTGCCAACTCTGCTCTACAGA, 509 bp, 35 cycles, 60°C (48); FGF10 AAGCTCTTGGTCAGGACATGGTGT and
TCCATTCAATGCCACATACATTTG, 458 bp, 25 cycles, 55°C
(33); FGF receptor (FGFR) 2 AAGGTTTACAGCGATGCCCA and
ACCACCATGCAGGCGATTAA, 345 bp, 35 cycles, 47°C (18); and
BMP4 TCCATCACGAAGAACATC and TAGTCGTGTGATGAGGTG, 220 bp, 35 cycles, 56°C (52).
In situ hybridization. Isolated lungs and cultured lung explants
were fixed in 4% (vol/vol) paraformaldehyde (PFA) in PBS at 4°C for
4 –18 h, dehydrated in ethanol, and embedded in paraplast. Sections of
12 ␮m were cut and mounted on Superfrost slides (Fisher Scientific,
Unionville, ON, Canada). The lungs were then assayed for nonradioactive RNA in situ hybridization according to Moorman et al. (39). In
brief, after being dewaxed and rehydrated, tissue sections were permeabilized with proteinase K (20 ␮g/ml), postfixed in 4% PFA and
0.2% glutaraldehyde, and prehybridized for 1 h at 70°C. The sections
were hybridized overnight at 70°C with DIG-labeled riboprobes for
Irx1–5, SP-C, or CCSP (1 ␮g/ml). The next day, sections were
washed in 50% formamide in 2⫻ SSC, pH 4.5, at 65°C followed by
PBS-T (PBS containing 0.1% Tween 20). Subsequently, the sections
were incubated with anti-DIG alkaline phosphatase diluted 1:1,000 in
blocking solution (Roche) at 4°C. The next day, sections were washed
in PBS-T followed by washes in 100 mM NaCl, 100 mM Tris, pH 9.5,
50 mM MgCl2 and then incubated with 5-bromo-4-chloro-3-indolyl
phosphate/nitro blue tetrazolium chromogen. (Roche) at room temperature until a purple color appeared (4 –5 h). All slides for one probe
L779
L780
IRX GENES AND LUNG DEVELOPMENT
(wt/vol) osmium tetroxide for 1 h followed by another three rinses
with PBS. The samples were then dehydrated through an ascending
alcohol series ending in propylene oxide. Propylene oxide was then
exchanged with an increasing concentration of Epon (Marivac, St.
Laurent, Qc, Canada) until the samples were fully infiltrated with
100% Epon. Samples were placed in molds, and the Epon was
polymerized at 70°C overnight. Ultrathin sections of the resulting
blocks were cut with a diamond knife on a Reichert Ultracut microtome and placed onto 400-mesh copper grids. All samples were
stained 10 min in 3% (wt/vol) uranyl acetate in double-distilled water
5 min in 1% (wt/vol) lead citrate followed by a double wash with
distilled water to remove excess stain. Samples were examined on a
Philips 430 electron microscope.
RESULTS
Irx expression in the developing rat lung. In situ hybridization analysis revealed that all Irx genes, except for Irx4, display
a similar developmental expression pattern during rat lung
development (Figs. 1 and 2). Irx4 was not expressed in developing lung (results not shown). Irx1 (Fig. 1, A–C), Irx3 (Fig. 1,
D–F), Irx2 (Fig. 2, A–C), and Irx5 (Fig. 2, D–F) were highly
expressed during the pseudoglandular stage of lung develop-
Fig. 3. Effect of Irx inhibition on lung branching morphogenesis in vitro. Sense (A, D–F) or antisense (AS, G–I) oligodeoxynucleotides (ODNs) targeted against
the overlapping translation sequence of Irx1–5 were added to the culture in a concentration of 20 ␮M. Antisense Irx ODN-treated lung explants (G–I) showed
a dramatic decrease in branching morphogenesis compared with control (A–C) and sense (D–F) Irx ODN-treated explants. Arrows: dilatated proximal airway
structures. Bar: 250 ␮m (A, D, G); 300 ␮m (B, E, H); 360 ␮m (C, F, I).
AJP-Lung Cell Mol Physiol • VOL
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
diamidine-2-phenylindole dihydrochloride. Digital images were taken
using a Leica imaging system.
Bromodeoxyuridine labeling of explants. Lung explants cultured
for 3– 6 days with antisense ODNs targeted against Irx1–5 were
incubated for 6 h with 1 ␮M bromodeoxyuridine (BrdU). Explants
were then fixed in Carnoy’s fixative and embedded in paraplast, and
5-␮m sections were cut and mounted on ␣-aminopropyltriethoxysilane-coated slides. Tissue sections were dewaxed in xylene and
rehydrated in a graded series of ethanol. The sections were incubated
for 20 min in 2 M HCl, transferred to PBS, and incubated for 1 h in
5% (vol/vol) NGS and 1% (wt/vol) BSA in PBS. The excess of
blocking solution was carefully removed, and tissue sections were
incubated overnight at 4°C with 1:20 mouse monoclonal anti-BrdU
antibody (Roche). The tissue sections were washed three times in PBS
and incubated for 1 h with a 1:100 dilution of biotinylated secondary
sheep anti-mouse IgG followed by a 1-h incubation with 1:150 diluted
fluorescein isothiocyanate streptavidin complex. The tissues were
washed again in PBS and mounted with DAKO fluorescent mounting
solution. No immunofluorescence was observed when primary antibody was omitted. Digital images were taken using a Leica imaging
system.
Transmission electron microscopy. Lung explants were minced and
fixed for 1 h in 4% (wt/vol) PFA and 1% (wt/vol) glutaraldehyde in
PBS. Tissues were then rinsed three times in PBS and exposed to 1%
IRX GENES AND LUNG DEVELOPMENT
AJP-Lung Cell Mol Physiol • VOL
Fig. 4. Effect of antisense Irx ODN on expression of Irx1–3 and Irx5. ISH with
DIG-labeled antisense probes for Irx1 (A and B), Irx3 (C and D), Irx2 (E and
F), and Irx5 (G and H) genes in sense (control: A, C, E, G) and antisense Irx
ODN-treated lung explants (B, D, F, H) after 3 days in culture. All 4 Irx genes,
which were highly expressed in the epithelial cells of the sense Irx ODNtreated (control) explants [Irx1 (A), Irx3 (C), Irx2 (E), or Irx5 (G)], were hardly
detected in the antisense Irx ODN-treated lung explants [Irx1 (B), Irx3 (D),
Irx2 (F), or Irx5 (H)]. Dark purple color is positive ISH staining. Bar: 100 ␮m.
performed to assess apoptosis in the lung explants. Mesenchymal apoptosis was dramatically increased in antisense Irx
ODN-treated lung explants after 3 days in culture (Fig. 5, Bd
and C) compared with sense explants (Fig. 5, Bb and C).
Mesenchymal cell markers in antisense Irx-treated lung
explants. To examine whether airway muscularization was
affected by the antisense Irx knockdown, we performed immunohistochemistry for ␣-sma. In lung explants treated with
sense (control) Irx ODNs for 6 days, ␣-sma-immunopositive
reactivity staining was detected in a thin layer around the
proximal bronchioles and larger blood vessels (Fig. 6, A and
B). In the antisense Irx ODN-treated lung explants, the layer of
␣-sma-positive cells was disorganized. The ␣-sma-positive cell
layer was regularly interrupted and failed to form a smooth
layer supporting proximal bronchioles and larger blood vessels
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
ment (E13–E18), a period of active branching morphogenesis.
During that developmental stage, expression of Irx1, Irx2, Irx3,
and Irx5 was confined to branching lung endoderm, with no
expression in mesenchymal or endothelial lung tissue. In addition, Irx expression appears to be equal throughout the
epithelium and is not restricted to branch points. The Irx
expression declines during the late pseudoglandular/early canalicular stage of development (E18 –E19) and becomes more
restricted to the distal epithelium. Irx mRNA is undetectable at
later stages (E20 –E22), when the distal air-exchange units are
developing (not shown). No signal was detected when sense
riboprobes were used (Fig. 1, G–I). These expression data are
indicative of a role for the Irx genes in early rat lung development, especially during the formation of the bronchial tree.
Antisense inhibition of Irx expression reduces lung branching in vitro. To investigate the role of the Irx genes during early
lung development, E13.5 rat lung explants were cultured in the
presence of a universal antisense ODN targeted against Irx1, 2,
3, and 5 (Fig. 3). E13.5 rat lungs consist of two epithelial buds,
which over time in culture undergo progressive branching (Fig.
3, A–C). Treatment of explant cultures with missense Irx ODN
(not shown) did not affect lung explant growth or branching
morphogenesis compared with control (Fig. 3, A–C) or sense
Irx ODN-treated lung explants (Fig. 3, D–F). A dramatic
inhibition of lung growth and branching morphogenesis was
observed when the universal antisense ODN against Irx was
used (Fig. 3, G–I). After 1 and 2 days in culture, lung explants
treated with antisense Irx ODN displayed a normal number of
main bronchi and lobes, but subsequent peripheral branching
was reduced (Fig. 3G). After 4 days in culture, peripheral
branching morphogenesis was even further abrogated in the
antisense ODN-treated lungs. The reduced peripheral branching was associated with a distension/dilatation of proximal
airway tubules (arrow, Fig. 3H). This phenotype persisted at
least up till 7 days in culture (arrow, Fig. 3I).
To examine the effectiveness of the universal antisense Irx
ODN, we assessed Irx1, 2, 3, and 5 mRNA expression by
nonradioactive in situ hybridization in rat lung explants cultured with sense (control) or antisense ODNs targeted against
Irx. After 3 days in culture, Irx1, 2, 3, and 5 were expressed in
the epithelial cells lining the airway tubules of the sense-treated
explants (Fig. 4, A, E, C, and G, respectively). After 6 days in
culture, the expression of all four Irx genes declined (not
shown) similar to what was observed in the in vivo situation
(Figs. 1 and 2). Treatment of lung explants with universal
antisense Irx ODNs abolished the epithelial mRNA expression
of Irx1, 2, 3, and 5 after 3 (Fig. 4, B, F, D, and H, respectively)
and 6 days (not shown) in culture. Even prolonged detection
times for the in situ hybridization did not reveal any significant
level of Irx1, 2, 3, 5 transcripts in the antisense ODN-treated
explants.
Proliferation and apoptosis in antisense Irx-treated lung
explants. BrdU incorporation into DNA was used to investigate
the proliferation in sense (control) and antisense Irx ODNtreated lung explants. Proliferation in epithelial and mesenchymal cells was similar in sense and antisense Irx ODN-treated
lung explants after 3 days in culture (not shown). After 6 days
in culture, a dramatic decrease in the number of proliferating
mesenchymal cells was noted in the antisense Irx ODN-treated
lung explants (Fig. 5, A f and h and C) compared with sense
explants (Fig. 5, A b and d and C). TUNEL assay was
L781
L782
IRX GENES AND LUNG DEVELOPMENT
(Fig. 6E). Additionally, it appeared that antisense Irx ODN
treatment resulted in a loss of mesenchymal mass compared
with the sense ODN-treated lung explants (compare Fig. 6, A
and D). Because vimentin is normally expressed throughout
the proximal and distal mesenchymal compartment of the lung,
we carried out vimentin immunoanalysis. In sense Irx ODNtreated lung explants, abundant positive staining for vimentin
was observed throughout the mesenchymal compartment of the
lung explants after 6 days in culture (Fig. 6C). In the explants
treated with the universal antisense Irx ODN, the mesenchymal
compartment had indeed dramatically decreased in volume but
exhibited positive staining for vimentin (Fig. 6F).
Epithelial cell markers in antisense Irx-treated lung explants. Because all four Irx genes were knocked down in
epithelial cells after treatment with the universal antisense Irx
ODN, we investigated epithelial cell differentiation by nonradioactive in situ hybridization. SP-C, a marker for distal
respiratory epithelium (62), was expressed in distal epithelial
cells of lung explants treated for 3– 6 days with sense (control)
AJP-Lung Cell Mol Physiol • VOL
Irx ODNs (Fig. 7A). In the antisense Irx ODN-treated lung
explants, however, SP-C mRNA was barely detectable in
epithelial cells after a 3-day culture (not shown), and only a
few mRNA positive clusters were found after culturing for 6
days (Fig. 7B). CCSP and ␤-tubulin IV, markers for proximal
nonciliated and ciliated epithelial cells (30, 55, 58, 67), respectively, were expressed after 6 days in culture in sense Irx
ODN-treated explants, and their expression was restricted to
the proximal airways (Figs. 7C and 8, A–C). In the antisense
Irx ODN-treated lung explants, almost all epithelial lining cells
were ␤-tubulin IV and CCSP positive (Figs. 7D and 8, D–F).
The proximal phenotype of the epithelial structures in the
antisense-treated explants was corroborated by transmission
electron microscopy (Fig. 8, J–L vs. Fig. 8, G–I). Because the
expression of both SP-C (63) and CCSP (5, 6) is regulated by
TTF-1 and HNF-3␤, we then assessed the expression of both
transcription factors in sense and antisense Irx ODN-treated
lung explants. Positive immunoreactivity for TTF-1 (Fig. 7, E
and F) and HNF-3␤ (Fig. 7, G and H) was detected in epithelial
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Fig. 5. Effect of Irx inhibition on proliferation and apoptosis. A: explants treated with sense (control) or antisense Irx ODN for 6 days (a– h; c, d, g, and h are
enlargements of boxed sections in a and e) were pulsed with bromodeoxyuridine (BrdU) for 6 h, and subsequent BrdU incorporation was visualized by anti-BrdU
immunofluorescence (b, d, f, and h). Cell nuclei were visualized with 4⬘,6-diamidine-2-phenylindole dihydrochloride (DAPI; a, c, e, and g). The number of
BrdU-immunopositive mesenchymal cells decreased dramatically after 6 days in antisense Irx-ODN-treated lung explants (f and h) compared with sense control
ODN-treated explants (b and d). B: terminal transferase dUTP nick-end labeling (TUNEL) analysis of sense (control) and antisense Irx ODN-treated lung explants
after 3 days in culture. Cell nuclei were visualized with DAPI (a and c). Few TUNEL-positive cells were seen throughout the epithelium of sense Irx ODN-treated
(control) explants (b). Large numbers of TUNEL-positive cells were found in the mesenchyme (⫻) of antisense Irx ODN-treated lung explants (d). C: percentage
of BrdU-positive (after 6 of days culture) and TUNEL-positive cells (after 3 days of culture) (black bar, sense-treated explants; grey bar, antisense-treated
explants; means ⫾ SE cells, n ⱖ 1,000 cells). EPI, epithelium; MES, mesenchyme. BrdU cells were counted at bar: 100 ␮m (A: a, b, e, and f), 40 ␮m (A: c,
d, g, and h), 100 ␮m (B: a– d).
IRX GENES AND LUNG DEVELOPMENT
L783
cells of both sense and antisense Irx ODN-treated lung explants. No obvious major differences were notable. Thus the
lack of SP-C expression in antisense Irx ODN-treated lung
explants is likely not due to a reduction in TTF-1 or HNF-3␤
expression.
FGF expression in antisense Irx-treated lung explants. The
extended family of FGFs plays a critical role in the development of many organs, including the lung. FGF1, FGF2, FGF7,
FGF9, FGF10, and FGF18 are all expressed in the developing
lung, but only FGF10 has been shown to be critically necessary
for the initiation of lung development (51). FGF1, FGF7, and
FGF10, which are produced by the pulmonary mesenchyme,
bind to and activate the FGF receptor FGFR2IIIb, which is
present on pulmonary epithelial cells (51). Using semiquantitative RT-PCR, we investigated whether the Irx knockdown in
culture affected the FGF/FGFR2 signaling pathway. No obvious differences in expression of FGF1, FGF7, FGF10, or
FGFR2 were observed between control, sense, and antisense
Irx ODN-treated lung explants after 3 or 6 days in culture (Fig.
9A). Although spatial effects cannot be excluded, this finding
makes it unlikely that reduced branching morphogenesis in the
antisense Irx ODN-treated lung explants is the result of a
deficiency in of FGF1, 7, and 10 or their receptor, FGFR2.
BMP4 expression in antisense Irx ODN-treated lung explants. The reduction in SP-C expression and concurrent increased CCSP expression in the antisense Irx ODN-treated
lung explants is very similar to the lung phenotype described
for mice overexpressing either Xnoggin, a BMP4 antagonist, or
a dominant-negative BMP4 receptor in distal epithelial cells
(61). Both mice displayed a severe reduction in distal epithelial
cells and a concurrent increase in proximal cells. Given that
reduced BMP4 signaling results in a proximalization phenotype of the lung, we added recombinant BMP4 to the medium
AJP-Lung Cell Mol Physiol • VOL
of sense (control) and antisense Irx ODN-treated lung explant
cultures. Recombinant BMP4 (200 ng/ml) did, however, not
restore distal branching morphogenesis in antisense Irx ODNtreated lung explants after 3 (Fig. 9B, a– d) or 6 (Fig. 9B, e– h)
days in culture. To analyze whether BMP4 expression was
affected by Irx knockdown in the lung explants, we performed
semiquantitative RT-PCR. No obvious differences in the relative expression of BMP4 mRNA were detected between control, sense, and antisense Irx ODN-treated lung explants after 3
or 6 days in culture (Fig. 9C). These results suggest that the
antisense Irx ODN-induced defect in branching and proximaldistal differentiation is not a consequence of BMP4 deficiency.
Irx gene expression in Shh and Gli2 mutant lungs. Various
reports have implicated the Shh/Gli pathway in lung development (3, 23, 35, 40, 45). Because the Drosophila homolog of
Gli1–3, Ci, has been shown to positively control araucan and
caupolican, the Drosophila counterparts of vertebrate Irx
genes (20), we investigated the expression of Irx1, 2, 3, and 5
in lungs of Shh and Gli2 mutant mice. In situ hybridization
analysis showed that Irx1 and Irx2 (Fig. 10I, B and E) and Irx3
and Irx5 (not shown) were normally expressed in distal bronchioles of E13.5 and E14.5 Gli2⫺/⫺ lungs compared with
wild-type lungs (Fig. 10I, A and D). Shh⫺/⫺ lungs were
severely hypoplastic, but Irx1 and 2 mRNA (Fig. 10I, C and F)
and Irx3 and 5 mRNA (not shown) expression in these lungs
was comparable to that of littermate wild-type lungs (Fig. 10I,
A and D). We also investigated the expression of Shh in the
antisense Irx ODN-treated lungs. Immunohistochemically, Shh
was expressed in the epithelium of the distal end buds of the
control (Fig. 10II, A and B) as well the antisense Irx ODNtreated lung explants (Fig. 10II, C). These results indicate that
at least in the developing lung the Irx genes are not upstream
or downstream from the Shh/Gli2 signaling pathway.
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Fig. 6. Effect of Irx inhibition on smooth muscle cell formation. Immunostaining was performed for ␣-smooth muscle actin (␣-sma; A, B, D, and E) and vimentin
(C and F) in sense (control; A–C) and antisense Irx ODN-treated (D–F) E13.5 rat lung explants after 6 days in culture. B and E are higher magnifications of
A and D, respectively. In sense (control) Irx ODN-treated explants vimentin immunoreactivity was present in mesenchymal cells surrounding epithelial tubules
(C), while ␣-sma identified the smooth muscle cell layer at the base of developing airways (A and B). In antisense Irx ODN-treated lung explants, vimentin (F)
and ␣-sma (D and E) were expressed in a decreased and disorganized manner. Brown color is positive immunostaining. Bar: 250 ␮m (A, D); 40 ␮m (B, E); 100
␮m (C, F).
L784
IRX GENES AND LUNG DEVELOPMENT
DISCUSSION
Herein, we demonstrate that Irx homeobox genes play a role
in proximo-distal morphogenesis of the lung in vitro. Evidence
is provided that the Irx genes are not components of wellknown signaling pathways critical for lung development such
as the Shh, BMP4, and FGF signaling pathways. We speculate
that Irx genes are additional transcriptional components of the
complex genetic network directing lung morphogenesis.
AJP-Lung Cell Mol Physiol • VOL
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Fig. 7. Effect of Irx inhibition on epithelial cell differentiation. ISH was
performed with DIG-labeled antisense probes for surfactant protein (SP)-C (A
and B) and Clara cell secretory protein (CCSP, C and D) in sense (control; A,
C, E, and G) and antisense Irx ODN-treated (B, D, F, and H) E13.5 rat lung
explants after 6 days in culture. In the control (sense Irx ODN-treated)
explants, SP-C mRNA was expressed in distal pulmonary epithelium (A). In
the antisense Irx ODN-treated lung explants however, SP-C mRNA expression
was dramatically decreased (B), and expression was only observed in some
remaining distal epithelial cells. In the control (sense Irx ODN-treated)
explants, CCSP was expressed in proximal epithelial cells (C). In the antisense
Irx ODN-treated explants, CCSP was expressed in almost the entire explant
(D). Dark purple color is positive ISH staining. Immunostaining for thyroid
transcription factor (TTF)-1 (G and H) and hepatocyte nuclear factor
(HNF)-3␤ (E and F) revealed an epithelium-specific expression in sense
(control: E and G) and antisense Irx ODN-treated (F and H) lung explants. No
difference was observed between sense (control) and antisense Irx ODNtreated lung explants for either TTF-1 or HNF-3␤ protein. Brown staining is
positive staining. Bar: 250 ␮m (A–D); 100 ␮m (E–H).
In the present study we found that Irx1, Irx2, Irx3, and Irx5
are specifically expressed in developing rat lung epithelium
during the period of active airway branching. Houweling et al.
(25) showed similar expression patterns for Irx1–5 in the
developing murine lung. In the E10.5 murine lung, Irx1 and
Irx2 were expressed at high levels in the mesoderm adjacent to
the endoderm of the laryngo-tracheal groove, while Irx3 and
Irx5 expression was restricted to the endoderm of the groove
and foregut (25). From E10.5 onward (until E13.5) Irx1–3 and
Irx5 expression was confined to the epithelial layer of the
murine lung buds and bronchi (25). Similar murine pulmonary
expression patterns for Irx1, Irx2, and Irx5 have been reported
by others (2, 7, 34). In the E11.5 murine lung, Irx2 expression
localized to the distal tips of the developing bronchi, while Irx2
expression decreased at 13.5 and was no longer visible at E14.5
(2). A comparable expression pattern was found for Irx1, with
the difference that Irx1 was still prominently expressed
throughout the lung epithelium at E13.5 but disappeared in the
developing murine lung at the beginning of the alveolar phase
(2). In the present study, we showed that Irx1–3 and Irx5 are
expressed throughout the pulmonary rat lung epithelium up to
E18.5, which is the pseudoglandular phase of rat lung development and equals the E13.5–16.5 mouse lung. Similar to the
mouse lung, the intensity of expression for all four Irx genes
decreased dramatically with advancing gestational age. In
contrast to the reported mouse findings, we did not observe any
specific spatial expression pattern for any of the Irx genes,
although the expression became more restricted to distal epithelial cells with advancing gestation. This may be due to the
different in situ hybridization techniques employed. Becker et
al. (2) used whole mount in situ hybridization to investigate Irx
gene expression, whereas we performed in situ hybridization
on tissue sections.
On the basis of the expression patterns, we hypothesized that
the Irx genes are involved in early lung branching morphogenesis. Because of the overlapping expression patterns of the four
Irx genes, we decided to silence all four pulmonary expressed
Irx genes using an in vitro antisense ODN approach. Moreover,
silencing of individual Irx genes in vivo has yet not resulted in
any major lung phenotype (34), suggesting that the loss of an
Irx gene may be compensated by others. The use of antisense
ODNs targeted against a common translation sequence of all
four Irx genes resulted in a complete loss of Irx1–3 and Irx5
expression in E13.5 rat lung explants, which was accompanied
by a dramatic decrease in epithelial branching morphogenesis.
After 6 days in culture, control E13.5 lung explants displayed
a complex branching network with some larger airways in the
middle of the explant and more finer and complex branching in
the periphery of the explant. Antisense Irx ODN treatment
resulted in distension of the proximal airway tubules, whereas
hardly any distal epithelial structures were detected. These
results suggest that Irx genes are not required for bronchial
branching, although they may regulate airway size, but are
involved in the formation of the smaller distal airways.
In the present study, antisense Irx ODN-treated explants
exhibited a reduced and disorganized airway smooth muscle
cell differentiation. Furthermore, antisense Irx knockdown increased apoptosis in the mesenchymal compartment of the lung
explants, whereas proliferation decreased. This overall loss in
mesenchymal cells and disorganized muscularization of the
airways suggest that Irx genes may have a role in the formation
L785
IRX GENES AND LUNG DEVELOPMENT
of visceral smooth muscle cells, which arise from the mesenchymal cells during lung development (64, 65).
In situ hybridization revealed an epithelial proximalization
in antisense Irx ODN-treated explants compared with control
lung explants. CCSP and ␤-tubulin IV were abundantly expressed in the epithelial cells lining the large, ballooning
airways of the antisense Irx ODN-treated lung explants, while
in control lung explants CCSP and ␤-tubulin IV were only
expressed in few larger airways in the center of the lung
explants. In contrast, SP-C was highly expressed in the distal
airways of control lung explants but was barely detectable in
antisense Irx ODN-treated lung explants. Expression of both
SP-C (63) and CCSP (5, 6) is regulated by Nkx2.1 (or TTF-1)
and Foxa2 (or HNF-3␤). TTF-1 is expressed in pulmonary
epithelium from the start of normal lung development (31, 32).
Mice deficient for TTF-1 die at birth with severely hypoplastic
AJP-Lung Cell Mol Physiol • VOL
lungs, no thyroid gland, and brain abnormalities (31). Additional analysis of the rudimentary TTF-1⫺/⫺ lungs revealed
cyst-like structures lined with columnar epithelial cells and an
overall proximalized phenotype (38, 66), which resembles the
phenotype of the Irx-deficient lung explants of the present
study. However, immunohistochemical analysis revealed a
normal expression pattern for TTF-1 in antisense Irx ODNtreated lung explants. Also, HNF-3␤ was normally expressed
in both sense (control) and antisense Irx ODN-treated lung
explants. Thus Irx proteins appear not to signal via these
transcription factors. Whether Irx proteins directly influence
SP-C transcription remains to be established. Another possibility is that the loss in SP-C expression is tertiary to the effects
of Irx inhibition on the mesenchyme.
Proximalization of the lung has been described as a consequence of inhibition of BMP4 signaling by Weaver et al. (61).
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Fig. 8. Immunohistochemical staining for ␤-tubulin VI and transmission electron microscopy of
explants treated with sense (control) or antisense
Irx ODNs. In 6-day antisense-treated explants the
ciliated cell marker ␤-tubulin VI was expressed in
almost all epithelial structures of the explant (D–F;
n ⫽ 3 separate explants), whereas its expression
was confined to the proximal epithelial cells in
sense control explants (A–C; n ⫽ 3 separate explants). Transmission electron microscopy revealed greater numbers of ciliated proximal airway
cells in 6-day antisense-treated explants (J–L)
compared with sense control explants (G–I). Lamellar body containing cells were present in the
sense control explants (see inset in I), but not in
antisense-treated explants. Bar: 250 ␮m (A–F),
100 ␮m (G and J), 2 ␮m (H, I, K, and L).
L786
IRX GENES AND LUNG DEVELOPMENT
Interestingly, the Drosophila Irx orthologs, araucan and
caupolican, are positively controlled by Dpp, the fly homolog
of vertebrate BMP4. In Xenopus it has been shown that Xiro1,
one of the Xenopus Irx orthologs, and BMP4 control each other
(19). Furthermore, Xiro1 and Xiro2 are controlled by Noggin,
a BMP4 antagonist (21). Given that inhibition of BMP4 signaling results in proximalization of the lung (61) and the
interaction between Irx and BMP4 orthologs in invertebrates
(21), we performed semiquantitative RT-PCR for BMP4 but
did not find a difference in BMP4 mRNA expression between
sense (control) and antisense Irx ODN-treated lung explants.
Also, addition of recombinant BMP4 to antisense Irx ODNtreated lung cultures did not restore distal branching morphogenesis. These data suggest that the Irx genes are not upstream
of BMP4. However, the experiments do not rule out the
possibility that BMP4 is upstream from the Irx genes.
FGFs are very important for lung development. Without
FGF10, no lung will develop below the trachea (37, 39) and in
vitro, FGF10 induces outgrowth of two primary lung buds by
chemoattraction (44). FGF7-deficient mice have no lung abnormalities (24); however, in vitro studies reveal a role for
FGF7 in widespread epithelial proliferation and SP-C expression (48, 53). The importance of FGFR2IIIb was shown when
a soluble dominant-negative FGFR2IIIb was expressed
throughout the entire developing embryo and resulted in lung
bud initiation, but no branching morphogenesis (14). Similarly,
AJP-Lung Cell Mol Physiol • VOL
when a soluble dominant-negative FGFR2IIIb was overexpressed in distal epithelial cells, a trachea and two unbranched
bronchi developed, without any further lung formation (46).
Marker analysis of the latter lung rudiments revealed CCSP
expression in remaining air sacs and no SP-C expression,
similar to what we found in antisense Irx ODN-treated lung
explants. Shannon et al. (50) showed that uncommitted E13.5
rat tracheal epithelium expressed SP-C mRNA when cultured
in specified medium with FGF1 and FGF7. However, when
cultured without FGF1 and FGF7 the tracheal epithelium was
negative for SP-C, but positive for CCSP, suggesting that FGF
signaling is important for epithelial cell differentiation and
maintenance. In the present study, loss of Irx signaling in the
explants did not affect the expression of FGF1, FGF7, or
FGF10 and their receptor FGFR2, implying that the Irx genes
are likely not a component of the FGF signaling pathway.
However, it is possible that Irx genes control the formation or
degradation of extracellular matrix molecules such as proteoglycans, which regulate the bioavailability of FGFs to their
receptors.
The Shh signaling pathway plays an important role in the
development of multiple organs (27). In the lung, Shh is
required for proper branching morphogenesis and endoderm
patterning (35, 45). Shh signaling is mediated via Gli1–3, the
vertebrate counterparts of Ci in Drosophila (57). In the fly, the
Iro-C genes araucan and caupolican, are positively controlled
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Fig. 9. Effect of Irx inhibition on bone morphogenetic protein (BMP) 4 and FGF1, FGF7, and FGF10 expression. A: semiquantitative RT-PCR showed
comparable levels of mRNA expression for FGF1, FGF7, FGF10, and FGF receptor (FGFR) 2 in control (C), sense, and antisense Irx ODN-treated lung explants.
B: to determine whether Irx genes were upstream of BMP4, rat lung explants were incubated for 3 (a– d) and 6 (e– h) days with 200 ng/ml recombinant BMP
(rBMP) 4. rBMP4-treatment of control lung explants (b and f) did not result in obvious differences in epithelial branching compared with untreated control
explants (a and e). Both antisense Irx ODN-treated lung explants (c and g) and antisense Irx ODN-treated lung explants cultured with rBMP4 (d and h) showed
a dramatic decrease in distal airway branching with a concomitant increase in the size of proximal airways. rBMP4 did not restore distal branching morphogenesis
in antisense Irx ODN-treated lung explants after 3 (a– d) or 6 (e– h) days in culture. C: semiquantitative RT-PCR revealed no differences in BMP4 mRNA
expression between control, sense, and antisense Irx-ODN-treated lung explants. RNA integrity and recovery were demonstrated by ␤-actin RT-PCR. Bar: 250
␮m.
IRX GENES AND LUNG DEVELOPMENT
L787
by Ci (22). Furthermore, Becker et al. (2) showed that Gli1–3
and Irx1 and Irx2 genes are coexpressed in the developing lung
in adjacent tissues. Suggestions have been made of Shh/Gli and
Mash-1 being upstream and downstream factors, respectively,
in the Irx regulation cascade (2, 8). The hypoplastic phenotype
seen in both antisense Irx ODN-treated rat lungs and Shh/Gli2deficient murine lungs supports an interaction between both
signaling cascades. However, all four Irx genes (Irx1–3, 5)
were normally expressed in the different E13.5/14.5 Shh and
Gli2 mutant lungs (comparable to E15.5/16.5 in rats). Moreover, Shh expression was not altered by antisense Irx ODN
treatment. Thus it is unlikely that the Irx genes are upstream or
downstream in the Shh signaling cascade in the developing
lung. In contrast to Drosophila, in which araucan has been
shown to regulate the gene activity of the achaete-scute complex (AS-C) (20), we also found that Irx ablation did not affect
the expression of the mammalian homolog of AS-C, Mash-1,
implying that Mash-1 is not downstream of Irx signaling (not
AJP-Lung Cell Mol Physiol • VOL
shown). Therefore, we speculate that the Irx genes function in
another signaling pathway.
A phenotype resembling the antisense Irx ODN-treated
lungs, was seen in retinoic acid (RA)-treated mouse lung
explants (11). In Xenopus, RA increases Xiro expression in the
neural plate, but it decreases Xiro expression outside this plate
(21). If we extrapolate these findings to the present study, it
would mean that RA downregulates the Irx genes, which in
turn leads to outgrowth of proximal and inhibition of distal
lung structures. Wnt7b null lungs also resemble the antisense
Irx-treated lungs (54). Downregulation of Wnt7b leads to lung
hypoplasia, which is mainly due to a thinned layer of mesenchyme surrounding the distal airways (54). Furthermore, vascular smooth muscle layers have holes, and FGF10 expression
is not altered in Wnt7b-deficient lungs (54). These phenotypic
similarities as well as the mutual expression of Wnt7b97 and
Irx1– 4 in airway epithelium suggest an potential interaction
between Wnt and Irx. The existence of such interaction is
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
Fig. 10. Irx expression in murine Gli2⫺/⫺ and Sonic hedgehog knockout (Shh⫺/⫺) lungs and Shh expression in antisense Irx-ODN-treated lung explants. I: ISH
using antisense DIG-labeled probes showed that in E13.5–14.5 murine lungs, Irx1 and Irx2 mRNA were expressed in epithelial cells lining the lung tubules (A
and D, respectively). Despite the hypoplastic appearance of Gli2⫺/⫺ (B and E) and Shh⫺/⫺ (C and F) lungs, the pattern and level of expression of Irx1 and Irx2
mRNA were similar compared with control lungs (A and D, respectively). Dark purple color is positive ISH staining. II: immunostaining for Shh in control (A),
sense Irx-ODN treated (B), and antisense Irx-ODN-treated (C) rat lung explants after 6 days culture. Bar: 250 ␮m.
L788
IRX GENES AND LUNG DEVELOPMENT
supported by recent reports showing that the expression of
Xiro1 (19), Iro1 and 7 (28), and Irx3 (9) is dependent on Wnt
signaling. Further investigations will be required to explore the
putative RA-Irx and Wnt-Irx interaction during lung development.
In summary, we found that Irx1, 2, 3, and 5 are expressed in
the early branching lung epithelium. Antisense knockdown
experiments in vitro revealed that these Irx genes together play
an important role in proximo-distal epithelial differentiation
and branching morphogenesis of the lung. The importance of
each individual Irx remains to be investigated, but overall Irx
signaling appeared not to be linked to Shh, FGF, and BMP
signaling cascades known to be critical for lung development.
ACKNOWLEDGMENTS
GRANTS
This work was supported by the Canadian Institutes of Health Research (M.
Post) and the Sophia Foundation for Medical Research, The Netherlands
(SSWO #342, M. van Tuyl; and SSWO #460, F. Groenman).
REFERENCES
1. Bao ZZ, Bruneau BG, Seidman JG, Seidman CE, and Cepko CL.
Regulation of chamber-specific gene expression in the developing heart by
Irx4. Science 283: 1161–1164, 1999.
2. Becker MB, Zulch A, Bosse A, and Gruss P. Irx1 and Irx2 expression
in early lung development. Mech Dev 106: 155–158, 2001.
3. Bellusci S, Furuta Y, Rush MG, Henderson R, Winnier G, and Hogan
BL. Involvement of Sonic hedgehog (Shh) in mouse embryonic lung
growth and morphogenesis. Development 124: 53– 63, 1997.
4. Bellusci S, Henderson R, Winnier G, Oikawa T, and Hogan BL.
Evidence from normal expression and targeted misexpression that bone
morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung
morphogenesis. Development 122: 1693–1702, 1996.
5. Bingle CD, Hackett BP, Moxley M, Longmore W, and Gitlin JD. Role
of hepatocyte nuclear factor-3 alpha and hepatocyte nuclear factor- 3 beta
in Clara cell secretory protein gene expression in the bronchiolar epithelium. Biochem J 308: 197–202, 1995.
6. Bohinski RJ, Di Lauro R, and Whitsett JA. The lung-specific surfactant
protein B gene promoter is a target for thyroid transcription factor 1 and
hepatocyte nuclear factor 3, indicating common factors for organ-specific
gene expression along the foregut axis. Mol Cell Biol 14: 5671–5681,
1994.
7. Bosse A, Stoykova A, Nieselt-Struwe K, Chowdhury K, Copeland NG,
Jenkins NA, and Gruss P. Identification of a novel mouse Iroquois
homeobox gene, Irx5, and chromosomal localisation of all members of the
mouse Iroquois gene family. Dev Dyn 218: 160 –174, 2000.
8. Bosse A, Zulch A, Becker MB, Torres M, Gomez-Skarmeta JL,
Modolell J, and Gruss P. Identification of the vertebrate Iroquois homeobox gene family with overlapping expression during early development of the nervous system. Mech Dev 69: 169 –181, 1997.
9. Braun MM, Etheridge A, Bernard A, Robertson CP, and Roelink H.
Wnt signaling is required at distinct stages of development for the
induction of the posterior forebrain. Development 130: 5579 –5587, 2003.
10. Bruneau BG, Bao ZZ, Tanaka M, Schott JJ, Izumo S, Cepko CL,
Seidman JG, and Seidman CE. Cardiac expression of the ventriclespecific homeobox gene Irx4 is modulated by Nkx2–5 and dHand. Dev
Biol 217: 266 –277, 2000.
11. Cardoso WV, Williams MC, Mitsialis SA, Joyce-Brady M, Rishi AK,
and Brody JS. Retinoic acid induces changes in the pattern of airway
branching and alters epithelial cell differentiation in the developing lung in
vitro. Am J Respir Cell Mol Biol 12: 464 – 476, 1995.
12. Cavodeassi F, Diez Del Corral R, Campuzano S, and Dominguez M.
Compartments and organising boundaries in the Drosophila eye: the role
of the homeodomain Iroquois proteins. Development 126: 4933– 4942,
1999.
AJP-Lung Cell Mol Physiol • VOL
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
We thank A. Griffin for animal handling and care and I. Tseu and M.
Kuliszewski for technical assistance.
Martin Post is the holder of a Canadian Research Chair (tier 1) in
Respiration.
13. Cavodeassi F, Modolell J, and Campuzano S. The Iroquois homeobox
genes function as dorsal selectors in the Drosophila head. Development
127: 1921–1929, 2000.
14. Celli G, LaRochelle WJ, Mackem S, Sharp R, and Merlino G. Soluble
dominant-negative receptor uncovers essential roles for fibroblast growth
factors in multi-organ induction and patterning. EMBO J 17: 1642–1655,
1998.
15. Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H,
and Beachy PA. Cyclopia and defective axial patterning in mice lacking
Sonic hedgehog gene function. Nature 383: 407– 413, 1996.
16. Christoffels VM, Keijser AG, Houweling AC, Clout DE, and Moorman AF. Patterning the embryonic heart: identification of five mouse
Iroquois homeobox genes in the developing heart. Dev Biol 224: 263–274,
2000.
17. Cohen DR, Cheng CW, Cheng SH, and Hui CC. Expression of two
novel mouse Iroquois homeobox genes during neurogenesis. Mech Dev
91: 317–321, 2000.
18. De Moerlooze L, Spencer-Dene B, Revest J, Hajihosseini M, Rosewell
I, and Dickson C. An important role for the IIIb isoform of fibroblast
growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling
during mouse organogenesis. Development 127: 483– 492, 2000.
19. Gómez-Skarmeta J, de la Calle-Mustienes E, and Modolell J. The
Wnt-activated Xiro1 gene encodes a repressor that is essential for neural
development and downregulates Bmp4. Development 128: 551–560, 2001.
20. Gomez-Skarmeta JL, Diez del Corral R, de la Calle-Mustienes E,
Ferre-Marco D, and Modolell J. Araucan and caupolican, two members
of the novel Iroquois complex, encode homeoproteins that control proneural and vein-forming genes. Cell 85: 95–105, 1996.
21. Gomez-Skarmeta JL, Glavic A, de la Calle-Mustienes E, Modolell J,
and Mayor R. Xiro, a Xenopus homolog of the Drosophila Iroquois
complex genes, controls development at the neural plate. EMBO J 17:
181–190, 1998.
22. Gómez-Skarmeta JL and Modolell J. Araucan and caupolican provide a
link between compartment subdivisions and patterning of sensory organs
and veins in the Drosophila wing. Genes Dev 10: 2935–2945, 1996.
23. Grindley JC, Bellusci S, Perkins D, and Hogan BL. Evidence for the
involvement of the Gli gene family in embryonic mouse lung development. Dev Biol 188: 337–348, 1997.
24. Guo L, Degenstein L, and Fuchs E. Keratinocyte growth factor is
required for hair development but not for wound healing. Genes Dev 10:
165–175, 1996.
25. Houweling AC, Dildrop R, Peters T, Mummenhoff J, Moorman AF,
Ruther U, and Christoffels VM. Gene and cluster-specific expression of
the Iroquois family members during mouse development. Mech Dev 107:
169 –174, 2001.
26. Hsu SM, Raine L, and Fanger H. Use of avidin-biotin-peroxidase
complex (ABC) in immunoperoxidase techniques: a comparison between
ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem
29: 577–580, 1981.
27. Ingham PW and McMahon AP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev 15: 3059 –3087, 2001.
28. Itoh M, Kudoh T, Dedekian M, Kim CH, and Chitnis AB. A role for
iro1 and iro7 in the establishment of an anteroposterior compartment of the
ectoderm adjacent to the midbrain-hindbrain boundary. Development 129:
2317–2327, 2002.
29. Jordan KC, Clegg NJ, Blasi JA, Morimoto AM, Sen J, Stein D,
McNeill H, Deng WM, Tworoger M, and Ruohola-Baker H. The
homeobox gene mirror links EGF signalling to embryonic dorso-ventral
axis formation through notch activation. Nat Genet 24: 429 – 433, 2000.
30. Khoor A, Gray ME, Singh G, and Stahlman MT. Ontogeny of Clara
cell-specific protein and its mRNA: their association with neuroepithelial
bodies in human fetal lung and in bronchopulmonary dysplasia. J Histochem Cytochem 44: 1429 –1438, 1996.
31. Kimura S, Hara Y, Pineau T, Fernandez-Salguero P, Fox CH, Ward
JM, and Gonzalez FJ. The T/ebp null mouse: thyroid-specific enhancerbinding protein is essential for the organogenesis of the thyroid, lung,
ventral forebrain, and pituitary. Genes Dev 10: 60 – 69, 1996.
32. Lazzaro D, Price M, de Felice M, and Di Lauro R. The transcription
factor TTF-1 is expressed at the onset of thyroid and lung morphogenesis
and in restricted regions of the foetal brain. Development 113: 1093–1104,
1991.
33. Lebeche D, Malpel S, and Cardoso WV. Fibroblast growth factor
interactions in the developing lung. Mech Dev 86: 125–136, 1999.
IRX GENES AND LUNG DEVELOPMENT
AJP-Lung Cell Mol Physiol • VOL
51. Shannon JM and Hyatt BA. Epithelial-mesenchymal interactions in the
developing lung. Annu Rev Physiol 66: 625– 645, 2004.
52. Shi W, Zhao J, Anderson KD, and Warburton D. Gremlin negatively
modulates BMP-4 induction of embryonic mouse lung branching morphogenesis. Am J Physiol Lung Cell Mol Physiol 280: L1030 –L1039, 2001.
53. Shiratori M, Oshika E, Ung LP, Singh G, Shinozuka H, Warburton D,
Michalopoulos G, and Katyal SL. Keratinocyte growth factor and
embryonic rat lung morphogenesis. Am J Respir Cell Mol Biol 15:
328 –338, 1996.
54. Shu W, Jiang YQ, Lu MM, and Morrisey EE. Wnt7b regulates
mesenchymal proliferation and vascular development in the lung. Development 129: 4831– 4842, 2002.
55. Tichelaar JW, Wert SE, Costa RH, Kimura S, and Whitsett JA.
HNF-3/forkhead homologue-4 (HFH-4) is expressed in ciliated epithelial
cells in the developing mouse lung. J Histochem Cytochem 47: 823– 832,
1998.
56. Van Tuyl M and Post M. Molecular mechanisms of lung development
and lung branching morphogenesis. In: Fetal and Neonatal Physiology
(3rd ed.), edited by Polin RA, Fox WW, and Abman SH. Philadelphia, PA:
Saunders, Harcourt Health Sciences, 2003, vol. 1, p. 812– 821.
57. Van Tuyl M and Post M. From fruitflies to mammals: mechanisms of
signalling via the Sonic hedgehog pathway in lung development. Respir
Res 1: 30 –35, 2000.
58. Van Tuyl M, Groenman F, Kuliszewski M, Ridsdale R, Wang J,
Tibboel D, and Post M. Overexpression of lunatic fringe does not affect
epithelial cell differentiation in the developing mouse lung. Am J Physiol
Lung Cell Mol Physiol 288: L672–L682, 2005.
59. Wang J, Souza P, Kuliszewski M, Tanswell AK, and Post M. Expression of surfactant proteins in embryonic rat lung. Am J Respir Cell Mol
Biol 10: 222–229, 1994.
60. Warburton D, Schwarz M, Tefft D, Flores-Delgado G, Anderson KD,
and Cardoso WV. The molecular basis of lung morphogenesis. Mech Dev
92: 55– 81, 2000.
61. Weaver M, Yingling JM, Dunn NR, Bellusci S, and Hogan BL. Bmp
signaling regulates proximal-distal differentiation of endoderm in mouse
lung development. Development 126: 4005– 4015, 1999.
62. Wert SE, Glasser SW, Korfhagen TR, and Whitsett JA. Transcriptional elements from the human SP-C gene direct expression in the
primordial respiratory epithelium of transgenic mice. Dev Biol 156:
426 – 443, 1993.
63. Whitsett JA and Glasser SW. Regulation of surfactant protein gene
transcription. Biochim Biophys Acta 1408: 303–311, 1998.
64. Yang Y, Palmer KC, Relan N, Diglio C, and Schuger L. Role of
laminin polymerization at the epithelial mesenchymal interface in bronchial myogenesis. Development 125: 2621–2629, 1998.
65. Yang Y, Relan NK, Przywara DA, and Schuger L. Embryonic mesenchymal cells share the potential for smooth muscle differentiation: myogenesis is controlled by the cell’s shape. Development 126: 3027–3033,
1999.
66. Yuan B, Li C, Kimura S, Engelhardt RT, Smith BR, and Minoo P.
Inhibition of distal lung morphogenesis in Nkx2.1(-/-) embryos. Dev Dyn
217: 180 –190, 2000.
67. Zhou L, Lim L, Costa RH, and Whitsett JA. Thyroid transcription
factor-1, hepatocyte nuclear factor-3beta, surfactant protein B, C, and
Clara cell secretory protein in developing mouse lung. J Histochem
Cytochem 44: 1183–1193, 1996.
290 • APRIL 2006 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.33.3 on June 16, 2017
34. Lebel M, Agarwal P, Cheng CW, Kabir MG, Chan TY, Thanabalasingham V, Zhang X, Cohen DR, Husain M, Cheng SH, Bruneau BG,
and Hui CC. The Iroquois homeobox gene Irx2 is not essential for normal
development of the heart and midbrain-hindbrain boundary in mice. Mol
Cell Biol 23: 8216 – 8225, 2003.
35. Litingtung Y, Lei L, Westphal H, and Chiang C. Sonic hedgehog is
essential to foregut development. Nat Genet 20: 58 – 61, 1998.
36. McNeill H, Yang CH, Brodsky M, Ungos J, and Simon MA. Mirror
encodes a novel PBX-class homeoprotein that functions in the definition of
the dorsal-ventral border in the Drosophila eye. Genes Dev 11: 1073–
1082, 1997.
37. Min H, Danilenko DM, Scully SA, Bolon B, Ring BD, Tarpley JE,
DeRose M, and Simonet WS. Fgf-10 is required for both limb and lung
development and exhibits striking functional similarity to Drosophila
branchless. Genes Dev 12: 3156 –3161, 1998.
38. Minoo P, Su G, Drum H, Bringas P, and Kimura S. Defects in
tracheoesophageal and lung morphogenesis in Nkx2.1 mouse embryos.
Dev Biol 209: 60 –71, 1999.
39. Moorman AF, Houweling AC, de Boer PA, and Christoffels VM.
Sensitive nonradioactive detection of mRNA in tissue sections: novel
application of the whole-mount in situ hybridization protocol. J Histochem
Cytochem 49: 1– 8, 2001.
40. Motoyama J, Liu J, Mo R, Ding Q, Post M, and Hui CC. Essential
function of Gli2 and Gli3 in the formation of lung, trachea and oesophagus. Nat Genet 20: 54 –57, 1998.
41. Mummenhoff J, Houweling AC, Peters T, Christoffels VM, and
Ruther U. Expression of Irx6 during mouse morphogenesis. Mech Dev
103: 193–195, 2001.
42. Ozawa K, Uruno T, Miyakawa K, Seo M, and Imamura T. Expression
of the fibroblast growth factor family and their receptor family genes
during mouse brain development. Brain Res Mol Brain Res 41: 279 –288,
1996.
43. Park HL, Bai C, Platt KA, Matise MP, Beeghly A, Hui CC, Nakashima M, and Joyner AL. Mouse Gli1 mutants are viable but have
defects in SHH signaling in combination with a Gli2 mutation. Development 127: 1593–1605, 2000.
44. Park WY, Miranda B, Lebeche D, Hashimoto G, and Cardoso WV.
FGF-10 is a chemotactic factor for distal epithelial buds during lung
development. Dev Biol 201: 125–134, 1998.
45. Pepicelli CV, Lewis PM, and McMahon AP. Sonic hedgehog regulates
branching morphogenesis in the mammalian lung. Curr Biol 8: 1083–
1086, 1998.
46. Peters K, Werner S, Liao X, Wert S, Whitsett J, and Williams L.
Targeted expression of a dominant negative FGF receptor blocks branching morphogenesis and epithelial differentiation of the mouse lung. EMBO
J 13: 3296 –3301, 1994.
47. Peters T, Dildrop R, Ausmeier K, and Ruther U. Organization of mouse
Iroquois homeobox genes in two clusters suggests a conserved regulation
and function in vertebrate development. Genome Res 10: 1453–1462,
2000.
48. Post M, Souza P, Liu J, Tseu I, Wang J, Kuliszewski M, and Tanswell
AK. Keratinocyte growth factor and its receptor are involved in regulating
early lung branching. Development 122: 3107–3115, 1996.
49. Sekine K, Ohuchi H, Fujiwara M, Yamasaki M, Yoshizawa T, Sato T,
Yagishita N, Matsui D, Koga Y, Itoh N, and Kato S. Fgf10 is essential
for limb and lung formation. Nat Genet 21: 138 –141, 1999.
50. Shannon JM, Gebb SA, and Nielsen LD. Induction of alveolar type II
cell differentiation in embryonic tracheal epithelium in mesenchyme-free
culture. Development 126: 1675–1688, 1999.
L789