Biologia 69/5: 635—643, 2014
Section Zoology
DOI: 10.2478/s11756-014-0355-y
Short-term retention of kleptoplasty from a green alga (Bryopsis)
in the sea slug Placida sp. YS001
Xiao Fan1a, Hongjin Qiao3a, Dong Xu1, Shaona Cao2, Xiaowen Zhang1, Shanli Mou1,
Yitao Wang2 & Naihao Ye1*
1
Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China; e-mail:
[email protected]
2
College of Animal Science and Technology, Qingdao Agricultural University, Qingdao 266071, China
3
Key Laboratory of Restoration for Marine Ecology, Shandong Marine Resource and Enviroment Research Institute, Yantai
264006, China
Abstract: The capacity of sea slugs (sacoglossans) for retaining chloroplasts from food algae provides important insights into
endosymbiotic relationships and kleptoplasty. A sea slug species was captured accidentally in the Yellow Sea and identified
as Placida sp. YS001 based on phylogenetic analyses of the COX1 and 16S gene sequence. Its life cycle was recorded
using microscope. Photosynthetic analysis by pulse amplitude modulated fluorometry during starvation revealed shortterm functional kleptoplasty. An ultrastructural comparison of the slug and alga showed that a change in the chloroplast
structure and the phagosome might correspond to short-term endosymbiosis. The horizontally transferred genes, psbO and
lectin, were not cloned in the adults or eggs. This study demonstrates the morphological adaptation that occurs during
short-term endosymbiotic relationships and provides fresh insights.
Key words: short-term endosymbiosis; Placida sp.; kleptoplasty; Bryopsis hypnoides; morphological adaptation
Introduction
Kleptoplasty, a process by which a typically heterotrophic organism acquires and retains chloroplasts
from a photosynthetic organism (Rumpho et al. 2011),
is often confused with another definition endosymbiosis,
a relationship that one symbiotic partner (the endosymbiont) living intracellularly within the second symbiotic
partner (the host) (Nowack & Melkonian 2010). Both
have important role in evolutionary history and they
challenge the common perception that only plants are
capable of performing photosynthesis (Rumpho et al.
2011). An excellent example is solar-powered sea slugs,
which acquire intact chloroplasts from food algae and
incorporate them into their tissues. The algal symbionts
capture the sun’s rays and convert them into biological energy via photoautotrophic CO2 fixation, which
provides energy and carbohydrates for sea slugs. In exchange, the sea slugs supply a nutrient-rich environment for the algal symbiont. This algae–animal symbiotic relationship between sea slugs and the filaments
of multinucleate algae is finally known as kleptoplasty
(Rumpho et al. 2000, 2011).
However, photosynthetic sacoglossans vary in their
ability to retain plastids and maintain their function.
The ability last for varying lengths of time and has
been categorized into six levels based on the carbon fixation rates of different sacoglossans: level 1 is the direct
digestion of chloroplasts; level 2 is nonfunctional kleptoplasty for <2 h; level 3 is nonfunctional kleptoplasty
for >24 h (animals are pigmented but the chloroplasts
are digested rapidly); level 4 is short-term functional
kleptoplasty for <24 h; level 5 is medium-term functional kleptoplasty for <1 week; and level 6 is long-term
functional kleptoplasty for >1 week (Clark et al. 1990;
Evertsen et al. 2007). Evertsen et al. (2007) further refined these categories to eight levels using pulse amplitude modulated fluorometry (PAM) and determined
the presence of photosynthesis in the slugs during starvation.
Recently, intensive research has been reported on
the endosymbiotic mechanisms of the long-term endosymbiont species, Elysia chlorotica, including horizontal gene transfer and morphological adaptations
that support the long-term maintenance of chloroplast
function. Three algal nuclear genes, i.e., fcp, Lhcv-1,
and Lhcv-2, were discovered by polymerase chain reaction (PCR) using protein purification and sequencing
(Pierce et al. 2007). Later, psbO (Rumpho et al. 2008)
and prk (Rumpho et al. 2009) were also identified in
a
The authors contributed equally to this work
* Corresponding author
c 2014 Institute of Zoology, Slovak Academy of Sciences
Unauthenticated
Download Date | 6/17/17 7:46 AM
X. Fan et al.
636
E. chlorotica cDNA and genomic DNA. Schwartz et al.
(2010) discovered six additional algal nuclear genes in
E. chlorotica cDNA and genomic DNA, which encoded
enzymes in the chlorophyll synthesis pathway, as well
as additional light-harvesting and metabolic enzymes.
A comprehensive transcriptome analysis of E. chlorotica found that a variety of functional algal genes (ca. 52
genes) had been transferred into the slug genome, which
were translated actively in the host cell to support the
function of chloroplasts but the length of the identified
gene fragments is less than 90 base pairs. (Pierce et
al. 2012). However, other reports got different pionts,
Rumpho et al. (2011) and Wägele et al. (2011) showed
by transcriptomic analyses that none of the long term
retention forms showed any signs of transferred genes.
Besides these remarkable horizontal gene transfers
(HGTs), morphological adaptations were also detected
in E. chlorotica and its chloroplast donor Vaucheria
litorea. The chromophyte V. litorea has a siphonaceous
morphology and succulent filaments with few distinct
cross walls, while a large central vacuole is surrounded
by a thin layer of multinucleate cytoplasm that contains numerous chloroplasts. This makes it easy for sea
slugs to suck out large amounts of chloroplasts by puncturing the thin cell wall using their specially adapted
radular tooth (Jensen et al. 1993; Rumpho et al. 2000).
The V. litorea plastids are surrounded by four membranes in vivo, which have a more robust structure
and function than plant plastids after isolation (Lilley
et al. 1975; Kaiser et al. 1981; Seftor & Jensen 1986;
Rumpho et al. 2001), and this probably contributes to
their survival in the digestive tract during the uptake
phase of symbiosis (Rumpho et al. 2001). In addition
to the robustness of chloroplasts, Curtis et al. (2010)
reported that the different digestive capacities of the
phagosomes, which take up chloroplasts in the cells lining the tubules of the digestive diverticulum, had an
important role in the species-specific capacity for maintaining chloroplasts (Curtis et al. 2010).
However, sea slugs with short-term kleptoplasty
have not been studied as thoroughly as the long-term
species. It would be useful to elucidate whether HGT
also occurs in the short-term sea slug kleptoplasty and
how the morphology of these species is adapted. A type
of sacoglossan (genus Placida) was captured accidently
in the Yellow Sea of China (35◦ 35 N, 119◦ 30 E) that
survived for 10–14 days with starvation. The adaptive
mechanism of its endosymbiotic relationships was investigated. Morphological adaptation and HGT were studied to understand the short-term symbiosis between
this sacoglossan and its chloroplast donor Bryopsis hypnoides.
Material and methods
Sea slug collection and culture
Sacoglossans were sampled during October 2011 at Zhanqiao (120◦ 31 N, 36◦ 06 E), Qingdao, located in the Yellow
Sea (off the coast of Shandong Province). Samples were collected by hand during receding tides at depths of 0.5–1 m
below sea level, on the rocky sea bed where Placida sp.
YS001 is found frequently. The animals were always found
attached to green algae (Bryopsis hypnoides) (Tian et al.
2005), so the alga was also collected. We state clearly that
the location is an open tourist attraction and no specific
permissions were required, and the field studies did not involve endangered or protected species. Collected specimens
were transported from the sampling sites in large containers
filled with autoclaved water, which were aerated with aquarium pumps. Upon their arrival in the laboratory, the animals were separated from their host algae and maintained in
12:12 h (L:D) cycles at 15 ◦C with 15 µmol photons m−2 s−1
provided by cool-white fluorescent lights, before experimental manipulations were performed. The algae samples were
washed several times with sterile seawater, sterilized with
1% sodium hypochlorite for 2 min, and then rinsed with
autoclaved seawater. Some fresh algae were inactivated by
boiling for 1 min in boiled seawater as part of the food resource for experiment sets.
Feeding experiments and PAM measurement
Nine animals were split among three groups (A: unfed; B:
active algae feeding; C: inactive algae feeding) and used in
the feeding experiments. No food was provided to the sea
slugs in group A (provid no chloroplast), whereas fresh algae (provid complete living chloroplasts) and boiled algae
(provid inactive chloroplast but can be used as organic nutrients) were given to groups B and C respectively, and were
kept enough for the groups all the time. The feeding experiments were maintained at 15 ◦C with natural salinity and
light conditions (indirect sunlight) for several days. Photographic images of Placida sp. YS001 were recorded using a
digital camera (Canon A6501 IS).
The photosynthetic capacity was determined using the
pulse–amplitude modulated method with a Dual-PAM-100
(Walz, Effeltrich, Germany) connected to a PC running the
WinControl program. All the animals in three groups were
measured at a setting time of the day. A saturated light
pulse was applied to generate maximum fluorescence (Fm )
in the dark-adapted samples. The Fm yield of the illumi
, while Ft was the realnated samples was denoted as Fm
time fluorescence yield. The effective PSII quantum yield
was calculated as follows:
− Ft )/Fm
Y (II) = (Fm
(1)
Light microscopy
The early stage of the life cycle of Placida sp. YS001 was
investigated using a Nikon Eclipse 80i microscope (Japan),
while a Nikon CCD DS-file digital camera was used to capture images using the NIS-Elements BR 3.1 program.
Transmission electron microscopy (TEM)
Samples were prepared for TEM according to the methods
of Liu (Liu & Lin 2001). This consisted of the following
steps: collecting the algal cells; fixing with 1% (v/v) glutaraldehyde and postfixing with 1% (v/v) osmium tetroxide, both in sterilized seawater; dehydration using a series of acetone solutions; suspension in a mixture of epoxy
resin (Epon812) and acetone; embedding in 100% Epon812;
polymerization and sectioning using a LeicaUC6 ultramicrotome; mounting on 200-mesh copper grids and post-staining
with uranyl acetate. Finally, the sections were examined
by TEM (HITACHI H-7650) at an accelerating voltage of
80 kV.
Unauthenticated
Download Date | 6/17/17 7:46 AM
Endosymbiotic relationships of sea slugs and green algae
Table 1. The primers of COX1 and 16S genes based on the mitochondrial genome of relative species, E. chlorotica (NC-010567).
Gene
Primer pairs
16S
F: AAACCTGCCCAGTGCGTAT
R: GCCCACCAAATTCCTAGTCC
F: TTAGGGACATCTGGTGCA
R: TGGAAATCTGGAGGAAGG
F: CTGAGCGGAAAGATGACTG
R: GCAACTGGACGGTGGTG
F: ACGAAGGGTTGTGACGG
R: GCCTTCGCATTGGTTCGTC
COX1
Psbo
Lectin
RNA extraction and reverse transcription
The eggs and starved animals were frozen in liquid nitrogen and then ground into a fine powder using a mortar
and pestle. The integrity of the total RNA was verified by
running samples on 1.0% formaldehyde denaturing agarose
gels. The total RNA was subsequently extracted using Trizol
Reagent according to the user’s manual, after which it was
dissolved in diethylpyrocarbonate-treated water. The cDNA
used for PCR was synthesized using M-MLV reverse transcriptase and oligo d(T)18 (Promega Biotech Co., Madison,
WI, USA; Kong et al. 2009; Carzoli et al. 2009).
Cloning and sequencing of the COX1, 16S, psbO and lectin
genes
Two pairs of specific primers were designed using the conserved sequences of the COX1 and 16S genes in the mitochondrial genome of other sea slugs (E. chlorotica, NC010567) to clone the COX1 and 16S genes in Placida sp.
YS001. The other two pairs of Bryopsis hypnoides primers
of nucleotide gene psbO and lectin were designed to evaluate
the HGT between the alga and animal Placida sp. YS001
(Table 1). PCR was conducted using the cDNA template
described above. The reaction mixture contained 14.95 µL
pure water, 2 µl 10× PCR buffer (Mg2+ plus), 0.4 µl dNTP
(10 mM L−1 ), 0.75 µl (10 µM L−1 ) of each primer, and
0.15 µl rTaq DNA Polymerase (TakaRa Biotech Co., Dalian,
China) per 20 µl reaction volume. Amplification was conducted using the following conditions: initial denaturation
at 94 ◦C for 5 min, followed by 35 cycles of 94 ◦C for 1 min,
56 ◦C for 30 s, and 72 ◦C for 1 min, with a final extension
at 72 ◦C for 10 min. The PCR products were then resolved
by electrophoresis on 1% agarose gel, after which the fragment of interest was excised, purified using an agarose gel
DNA fragment recovery kit (Tiangen Biotech Co. China),
cloned into PMD-18 T vector (TaKaRa Biotech Co., Dalian,
China), and sequenced (Luo et al. 2009).
Phylogenetic analyses
The sequences of 16S and COX1 were combined separately
and automatically aligned using ClustalW (Thompson et
al. 1994), as implemented in BioEdit 7.0.9.0 (Hall et al.
1999), after which ambiguously aligned regions were removed by Gblocks (Castresana et al. 2000). Two methods: Maximum likelihood (ML) and Bayesian inference (BI)
were used to reconstruct phylogenetic relationships of sea
slugs. GTR+I+G model was selected as the most appropriate model by MODELTEST (Posada & Crandall 1998). The
ML tree was constructed with PHYML 3.0 and 1000 bootstraps were used to estimate the node reliability (Guindon
& Gascuel 2003). The Bayes tree was performed with the
concatenated dataset inferred by Bayesian inference (BI)
637
using MrBayes version v.3.1.2 (Huelsenbeck & Ronquist
2001; Ronquist & Huelsenbeck 2003) for 1000,000 generations with random starting tree, and four Marko chains
(with default heating values) sampled every 100 generations.
The first 500,000 generations were discarded as burn-in for
the multigene analyses.
Results
Phylogenetic position
After comparing the morphological features with the
other slugs figured in similar studies (Rumpho et al.
2000, 2009, 2011; Curtis et al. 2010), we found the
most three related genera that may fit the species in
our study: Elysia, Placida, Thuridia. However, morphological identity can not meet the requirement of
classification accuracy just according figure information but not living animals. Nucleotide sequence collected from NCBI solved the problem in general studies. Based on the phylogeny of COX1 and 16S sequences, the unknown sea slug was closely affiliated
with organisms in the clade Limapontioidea belonged
to Sacoglossa (Fig. 1). All of the COX1 and 16S sequences from the three most morphological similar genera (Elysia, Placida, Thuridia) of sea slug were included
in this group. The closest match to the unknown sea
slug was P. dendritica, which shared 87% identity with
the COX1 and 16S sequence and it was supported by a
Bayesian posterior probability of 100%. Thus, the unknown sea slug was identified as Placida sp. YS001.
Life cycle
Placida sp. YS001 were frequently observed grazing on
the filaments of B. hypnoides in aquaria containing seawater (Fig. 2), overhead lighting, and maintained at 10–
15 ◦C. The animals produced non-pigmented eggs in a
mucus mass, which was deposited on the aquaria walls.
The eggs developed into blastomeres (Figs 2C, D), larvae (Fig. 2E), veliger larvae (Fig. 2F), and mature larval stages (Fig. 2G), which were all recorded and that
constituted the most part of life cycle.
Appearance and photosynthetic response during starvation
At the beginning of the feeding experiment, the slugs
from three groups did not differ in their physical condition (Fig. 3). From the third day of the experiment, it
was obvious that the slugs receiving no food or boiled
B. hypnoides became yellow in color and smaller in size,
compared with the slug fed with live B. hypnoides. This
difference was more apparent over time. At day 16, the
slugs that received no food or boiled B. hypnoides died,
whereas the slugs fed with live B. hypnoides were still
alive and green. The changes during Y (II) showed the
same trend in terms of the color and size with the three
feeding treatments (Fig. 4). The Y (II) of the slugs fed
without live B. hypnoides dropped to almost 0 from the
day 2 until the end of the experiment.
Unauthenticated
Download Date | 6/17/17 7:46 AM
638
X. Fan et al.
Fig. 1. Phylogenetic tree inferred from COX1 and 16S gene sequences showing the phylogenetic position of the unknown sea slug. The
tree topology was derived using ML (Maximum likelihood) and BI (Bayesian inference) analysis. Bootstrap values are shown at the
nodes (right, ML; left, BI) if the node was supported by bootstrap values of >50%. The branch lengths correspond to evolutionary
distances.
Fig. 2. The main parts of life cycle stages of the kleptoplastic Placida sp. YS001. A: Mature Placida sp. YS001 and aposymbiotic eggs
with filaments of Bryopsis hypnoides in the background. Egg ribbons varied from 3 to 30 cm in length. Scale 20 mm. B: Fertilized
ovum 1 h after laying eggs. Scale 100 µm. C: Second cleavage 20 h after laying eggs. Scale 30 µm. D: Blastomere 36 h after laying
eggs. Scale 50 µm. E: Larvae 60 h after laying eggs. Scale 50 µm. F: Veliger larvae 8–10 days after laying eggs. Scale 100 µm. G:
Mature larval stage 10 days after laying eggs. Scale 100 µm. H: Dorsal view of a young Placida sp. YS001 30 days after laying eggs.
Scale 2 mm.
Unauthenticated
Download Date | 6/17/17 7:46 AM
Endosymbiotic relationships of sea slugs and green algae
639
Fig. 3. The change in the appearance of Placida sp. YS001 after receiving no food (A), boiled algae (B), and live Bryopsis hypnoides
(C).
Fig. 4. The response of Y (II) of Placida sp. YS001 when fed without (square) or with boiled (circle) and live Bryopsis hypnoides
(triangle) during 14 days cultivation.
Ultrastructure of chloroplasts in B. hypnoides and
Placida sp. YS001
Symbiont chloroplasts were maintained intracellularly
in a specific cell layer that lined the digestive tract of
Placida sp. YS001 (Fig. 5G). The sequestered chloroplasts were rounder than the plastids observed in the
algal cell. An intact chloroplast envelope was evident,
which was surrounded by a loose, wavy outer membrane (o) outside the chloroplast envelope (e) (Figs
5D, E, H). By contrast, the algal cell was smooth and
tightly outlined the chloroplast (Curtis et al. 2010),
while no chloroplast endoplasmic reticulum was associated with the symbionts. Large pyrenoids (p) and
unstacked chloroplast trilamellar thylakoids (th) were
evident in both the sea slug and algal plastids. Lipid
droplets were readily observed in the chloroplast thy-
lakoids of Placida sp. YS001 but never present in the
chloroplasts from the algae. The lipids in the symbionts
were larger in size and lighter in color than the plastoglobuli in the plastids of the algae.
Discussion
Conception and phylogenetic analysis
There has once been some disagreement on whether
an association between an organism and an isolated
organelle such as a chloroplast constitutes symbiosis,
since the symbiont (chloroplast) is not a free-living organism. Rumpho et al. (2000) has discussed a lot about
the conceptions and they conclude that the intracellular association of algal chloroplasts with molluscan cells
can be considered a unique symbiotic association. So in
Unauthenticated
Download Date | 6/17/17 7:46 AM
640
X. Fan et al.
Fig. 5. Ultrastructure of chloroplasts in Bryopsis hypnoides and sequestered chloroplasts lining the digestive tubules of adult Placida sp.
YS001. A: TEM of a chloroplast from B. hypnoides. The chloroplast is spherical and 6–8 µm in diameter. Thylakoids (th) are arranged
in bands around the starch granules (s), which surround a central pyrenoid body (y). Scale 2 µm. B: TEM of longitudinal section of
B. hypnoides. The algae wall (aw) and degraded chloroplasts (dc) are filled with starch granules (s), while some degraded chloroplasts
(dc) have lost the pyrenoid body (y) and the thylakoid (th) structure is disrupted. Scale 5 µm. C: TEM of degraded chloroplasts (dc)
filled with starch granules (s) surrounding a central pyrenoid body (y) in Placida sp. YS001. The thylakoid (th) structure has been
disrupted. Scale 2 µm. D: TEM of sequestered degraded chloroplasts (dc) from B. hypnoides in a digestive diverticulum (d) of Placida
sp. YS001 after being starved for 2 days. The thylakoids have either disappeared or the lamellae are no longer arranged in longitudinal
bands. The plastid is surrounded by a membrane (o) outside the chloroplast envelope (e), which contains plastoglobuli (p). Scale
0.5 µm. E: TEM of degraded chloroplasts from Placida sp. YS001 after being starved for 2 days. The chloroplast (dc) is surrounded by
a membrane (o) outside the chloroplast envelope (e). The digestive tubule cell membrane (cm) is also visible surrounding the external
chloroplast (dc). Lipid bodies (li) are present between the bands of thylakoids (th). Scale 0.5 µm. F: TEM of digestive tubules from
adult Placida sp. YS001 after being starved for 2 days. Chloroplasts (dc) are sequestered in cells that line the lumen of the digestive
diverticulum (d). The tubule is surrounded by hemolymph (h). Mitochondria (m) are present in the cytoplasm of the cell between the
chloroplasts. The most novel observation is that a phagocytic vesicle is present. Scale 2 µm. G: TEM of a longitudinal section of the
terminal end of a digestive tubule from Placida sp. YS001 after being starved for 2 days. Degraded chloroplasts (dc) are lining the
digestive diverticulum (d). The tubule is surrounded by hemolymph (h) and degraded at the end, while the effusion of starch granules
(s) is visible. Scale 5 µm. H: TEM of the longitudinal section of a digestive tubule from Placida sp. YS001 fed with active algae, B.
hypnoides. Chloroplasts (c) are sequestered in cells lining the lumen of the digestive diverticulum (d). Nuclei (n) are present. Scale
5 µm.
the later time symbiosis is a very general term that also
describes the acquisition of chloroplasts by the eukaryotes. However, we prefer to classified the phenomenon
in this study to the category of kleptoplasty.
As a suborder of Sacoglossa, the Plakobranchacea without a shell have been reported to evolve
monophyletically from the common ancestor of the
Sacoglossa, which includes nonfunctional and functional kleptoplastic species (Clark et al. 1978, 1990;
Maeda et al. 2010; Klochkova et al. 2012). Plakobranchacea is divided into Plakobranchoidea and Limapontioidea. As a member of the Limapontioidea, Placida
sp. YS001 was a sister to Placida dendritica (Alder J. &
A. Hancock, 1843) in the phylogenetic tree, which lacks
functional kleptoplasty and phagocytosis and rapidly
disintegrates the chloroplast using digestive glandu-
lar cells (McLean 1976; Evertsen & Johnsen 2009).
However, another Placida species, Placida kingstoni
Thompson, 1977, is known to retain functional kleptoplasty (Clark et al. 1990). Händeler et al. (2009) reported that species of the Plakobranchoidea have shortor long-term kleptoplasty. If P. kingstoni is considered,
the hypothesis of Händeler et al. (2009) is incorrect.
However, the capability for kleptoplasty varies considerably even in the same genus. For example, most
Elysia species exhibit functional kleptoplasty, but a few
species in this genus retain nonfunctional chloroplasts
(Evertsen 2008). Costasiella cf. kuroshimae, for example, exhibits nonfunctional kleptoplasty (Händeler et
al. 2009), whereas Costasiella ocellifera (Simroth, 1895)
has the functional type (Clark et al. 1981). Therefore,
the species-specific capacity for kleptoplasty is obvious
Unauthenticated
Download Date | 6/17/17 7:46 AM
Endosymbiotic relationships of sea slugs and green algae
and it is not totally dependent on its taxonomy. A careful analysis of the photosynthesis of slugs during starvation will facilitate a better characterization of kleptoplasty.
Starvation experiments
The Y (II) of YS001 declined sharply to about 0.02 when
fed with nothing or boiled alga and they maintained
this value for 10–14 days (Fig. 4), indicating that most
of the photosynthetic processing was performed during
the initial two days after feeding. according to Evertsen
et al. (2007), slugs with functional kleptoplasty for 1–7
days belong to level 5, i.e., short-term functional kleptoplasty. However, the end of functional kleptoplasty did
not result in YS001 death and they survived for another
8–12 days. We observed that the animals relied on their
own weight consumption to maintain life during the
later stages of starvation (Fig. 3). Thus, the slugs lost
weight and become yellower day after day. Therefore,
PAM was a good method for discriminate the actual
period of functional kleptoplasty during starvation. In
addition, boiled alga could not sustain the slugs, indicating the necessity for live alga.
Morphological adaptations
Sea slugs with short-term functional kleptoplasty
should have a different ultrastructure from those with
long-term kleptoplasty. It has been reported that the
chloroplasts of long-term kleptoplastic slugs (e.g., E.
chlorotica) are directly in contact with the cytosol and
surrounded by a double chloroplast membrane, which
differs from the four membranes found in the donor V.
litorea (Graves et al. 1979; Mujer et al. 1996; Rumpho
et al. 2000). However, three membranes surrounded the
chloroplasts in Placida sp. YS001 with a loose, wavy
outer membrane outside the chloroplast envelope, i.e.,
the phagosome membrane (Fig. 5). The same structure
was observed in E. clarki (Curtis et al. 2006), which has
long-term functional kleptoplasty for 3–4 months (Curtis et al. 2005). It seems that the presence or absence of
the third membrane did not determine the persistence
of functional kleptoplasty, after comparing Placida sp.
YS001, E. clarki, and E. chlorotica. Curtis et al. (2010)
reported that species-level differences in the phagosome
digestive capability determined the persistence of kleptoplastic associations. Placida sp. YS001 apparently digested the chloroplast more rapidly than other longterm slugs, as indicated by the wavy shape of the phagosome membrane and the reduced size of chloroplasts.
The source of the phagosome membrane still needs to
be confirmed. The characteristics of chloroplasts from
B. hypnoides demonstrated the existence of a third
membrane around chloroplasts. It is unclear whether
the third membrane is removed during digestion and
replaced with the slug’s own membrane or if it is retained but unable to be merged under the stress of the
osmotic pressure in the slug cell.
In addition, the chloroplasts sequestered by Placida sp. YS001 had a more rounded shape than their oval
counterparts in the alga, which was consistent with pre-
641
vious reports (Trench et al. 1973; Mondy & Pierce 2003;
Curtis et al. 2006, 2010). The condensed thylakoids and
the replacement of lipid droplets with starch granules
and pyrenoid bodies, also indicated a change in the
chloroplasts. This change obviously reduced the photosynthetic activity of the chloroplasts, but it might be
more appropriate for the slug to obtain nutrition from
the chloroplast.
However, B. hypnoides also exhibits unique physical and biochemical properties that may have a role in
the establishment of the sacoglossan symbiosis (Jensen
1982; Mondy & Pierce 2003; Händeler et al. 2009).
B. hypnoides is a single multinucleate cell with few distinct cross walls, a large vacuole at the center, and a
thin layer of multinucleate cytoplasm that contains numerous chloroplasts. This makes it easy for sea slugs
to suck out large amounts of chloroplasts. The merging
characteristic of the chloroplasts from B. hypnoides also
provides protection against digestion in the slug gut.
HGT
Unlike E. chlorotica kleptoplasts, we failed to clone the
psbO and lectin genes of B. hypnoides in the adults and
eggs of Placida sp. YS001, but we cannot exclude the
existence of other horizontally transferred genes. High
throughput transcriptome data from Placida sp. YS001
would be needed to give a full analysis of all potential
HGT genes, as other study (Wägele et al. 2011). However, a recent review by Rumpho et al. (2011) indicated
the reduced importance of HGT for maintaining photosynthesis in the sequestered chloroplast, because of
the low expression of horizontally transferred genes in
the sea slug transcriptome. Thus, the unusual plastid
stability plus HGT (Green et al. 2005) may contribute
more to long-term functional kleptoplasty.
Conclusion
Phylogenetic analyses based on COX1 and 16S rDNA
genes classified our sea slug samples as Placida sp.
YS001 and they were sisters to Placida dendritica. The
overall life cycle of Placida sp. YS001 was recorded.
PAM analysis suggested short-term functional kleptoplasty, which lasted for only two days. Finally, the ultrastructure of the chloroplast revealed their rapid digestion by phagosomes and there were differences in the
structures of the chloroplasts from the slug and those
from the alga, which might support short-term functional kleptoplasty.
Acknowledgements
This work was supported by Shandong Science and Technology plan project (2011GHY11528), the Hi-Tech Research
and Development Program (863) of China (2012AA052103),
the Specialized Fund for the Basic Research Operating
expenses Program (20603022012004, 2010-ts-03), National
Natural Science Foundation of China (41176153), Natural
Science Foundation of Shandong Province (2009ZRA02075),
Qingdao Municipal Science and Technology plan project
Unauthenticated
Download Date | 6/17/17 7:46 AM
642
(11-3-1-5-hy), National Marine Public Welfare Research
Project (200805069, 201205025), Taishan Scholars Station of Aquatic Animal Nutrition and Feed (HYK201004),
and the National Science & Technology Pillar Program,
(2008BAD95B11, 2010BAC68B03).
References
Carzoli F.G., Michelotti V., Fambrini M., Salvini M. & Pugliesi
C. 2009. Molecular cloning and organ-specific expression of
two gibberellin 20-oxidase genes of Helianthus annuus. Plant.
Mol. Biol. Rep. 27: 144–152. DOI: 10.1007/s11105-008-0066-z
Castresana J. 2000. Selection of conserved blocks from multiple
alignments for their use in phylogenetic analysis. Mol. Biol.
Evol. 17: 540–552.
Clark K.B. & Busacca M. 1978. Feeding specificity and chloroplast retention in four tropical Ascoglossa, with a discussion
of the extent of chloroplast symbiosis and the evolution of the
order. J. Moll. Stud. 44: 272–282.
Clark K.B., Jensen K.R. & Stirts H.M. 1990. Survey for
functional kleptoplasty among West Atlantic Ascoglossa
(=Sacoglossa) (Mollusca, Opisthobranchia). Veliger 33: 339–
345.
Clark K.B., Jensen K.R., Stirts H.M. & Fermin C. 1981. Chloroplast symbiosis in a non-elysiid mollusk, Costasiella-lilianae
Marcus (Hermaeidae: Ascoglossa (=Sacoglossa): effects of
temperature, light intensity, and starvation on carbon fixation rate. Biol. Bull. 160: 43–54.
Curtis N.E., Massey S.E. & Pierce S.K. 2006 The symbiotic chloroplasts in the sacoglossan Elysia clarki are from
several algal species. Invertebr. Biol. 125: 336–345. DOI:
10.1111/j.1744-7410.2006.00065.x
Curtis N.E., Massey S.E., Schwartz J.A., Maugel T.K. &
Pierce S.K. 2005. The intracellular, functional chloroplasts
in adult sea slugs (Elysia crispate) come from several algal species, and are also different from those in juvenile
slugs. Microsc. Microanal. 11 (Suppl. 2): 1194. DOI:
10.1017/S1431927605505774
Curtis N.E., Schwartz J.A. & Pierce S.K. 2010. Ultrastructure of
sequestered chloroplasts in sacoglossan gastropods with differing abilities for plastid uptake and maintenance. Invertebr.
Biol. 129: 297–308. DOI: 10.1111/j.1744-7410.2010.00206.x
Nowack E.C.M. & Melkonian M. 2010. Endosymbiotic associations within protists. Phil. Trans. R. Soc. B. 365: 699–712.
DOI: 10.1098/rstb.2009.0188
Evertsen J. 2008. Solar powered phycozoans: herbivore sacoglossans with photosynthetic chloroplasts. Ph.D. Thesis, Norwegian University of Science and Technology, Trondheim.
Evertsen J., Burghardt I., Johnsen G. & Wägele H. 2007. Retention of functional chloroplasts in some sacoglossans from the
Indo-Pacific and Mediterranean. Mar. Biol. 151: 2159–2166.
DOI: 10.1007/s00227-007-0648-6
Evertsen J. & Johnsen G. 2009. In vivo and in vitro differences in
chloroplast functionality in the two north Atlantic sacoglossans (Gastropoda, Opisthobranchia) Placida dendritica and
Elysia viridis. Mar. Biol. 156: 847–859. DOI: 10.1007/s00227009-1128-y
Graves D.A., Gibson M.A. & Bleakney J.S. 1979. The digestive
diverticula of Alderia modesta and Elysia chlorotica. Veliger
21: 415-422.
Green B.J., Fox T.C. & Rumpho M.E. 2005. Stability of isolated
chromophytic algal chloroplasts that participate in a unique
mollusc/kleptoplast association. Symbiosis 40: 31–40.
Guindon S. & Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.
Syst. Biol. 52: 696–704. DOI: 10.1080/10635150390235520
Hall T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.
Nucleic. Acids. Symp. Ser. 41: 95–98.
Händeler K., Grzymbowski Y.P., Krug P.J. & Wägele H. 2009.
Functional chloroplasts in metazoan cells – a unique evolutionary strategy in animal life. Front. Zool. 6: 1–18. DOI:
10.1186/1742-9994-6-28.
X. Fan et al.
Huelsenbeck J.P. & Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. DOI:
10.1093/bioinformatics/17.8.754
Jensen K.R. 1982. Chemoreception as a factor in food location of
Elysia cauze Marcus (Opisthobranchia, Ascoglossa). Mar. Behav. Physiol. 8: 205–218. DOI: 10.1080/10236248209387018
Jensen K.R. 1993. Morphological adaptations and plasticity of
radular teeth of the Sacoglossa (5 Ascoglossa) (Mollusca:
Opisthobranchia) in relation to their food plants. Biol. J.
Linn. Soc. 48: 135–155.
Kaiser W.M., Stepper W. & Urbach W. 1981. Photosynthesis of
isolated chloroplasts and protoplasts under osmotic stress.
Planta 151: 375–380.
Klochkova T.A., Han J.W., Kim J.H., Kim K.Y. & Kim
G.H. 2012. Feeding specificity and photosynthetic activity
of Korean sacoglossan mollusks. Algae 25: 217–227. DOI:
10.4490/algae.2010.25.4.217
Kong F.N., Jiang S.M., Meng X.B., Song C.L., Shi J.F., Jin D.M.,
Jiang S.L. & Wang B. 2009. Cloning and characterization of
the DHDPS gene encoding the lysine biosynthetic enzyme dihydrodipoc olinate synthase from Zizania latifolia (Griiseb).
Plant. Mol. Biol. Rep. 27: 199–208.
Lilley R.M.C., Fitzgerald M.P., Rienits K.G. & Walker D.A.
1975. Criteria of intactness and the photosynthetic activity
of spinach chloroplast preparations. New Phytol. 75: 1–10.
Liu C.P. & Lin L.P. 2001. Ultrastructural study and lipid formation of Isochrysis sp. CCMP1324. Bot. Bull. Acad. Sin. 42:
207–214.
Luo T., Deng W.Y., Zeng J. & Zhang F.L. 2009. Cloning and
characterization of a stearoy-lacyl carrier protein desaturase
gene from Cinnamomum longepaniculatum. Plant. Mol. Biol.
Rep. 27: 13–19.
Maeda T., Kajita T., Maruyama T. & Hirano Y. 2010. Molecular
phylogeny of the sacoglossa, with a discussion of gain and loss
of kleptoplasty in the evolution of the group. Biol. Bull. 219:
17–26. PMID: 20813986
McLean N. 1976 Phagocytosis of chloroplasts in Placida dendritica (Gastropoda: Sacoglossa). J. Exp. Zool. 197: 321–329.
Mondy W.L. & Pierce S.K. 2003. Apoptotic-like morphology is
associated with annual synchronized death in kleptoplastic
sea slugs (Elysia chlorotica). J. Invertebr. Biol. 122: 126–137.
Mujer C.V., Andrews D.L., Manhart J.R., Pierce S.K. & Rumpho
M.E. 1996. Chloroplast genes are expressed during intracellular symbiotic association of Vaucheria litorea plastids with
the sea slug Elysia chlorotica. Proc. Natl. Acad. Sci. USA 93:
12333–12338.
Pierce S.K., Curtis N.E., Hanten J.J., Boerner S.L. & Schwartz
J.A. 2007. Transfer, integration and expression of functional
nuclear genes between multicellular species. Symbiosis 43:
57–64.
Pierce S.K., Fang X.D., Schwartz J.A., Jiang X. & Zhao W.
2012. Transcriptomic evidence for the expression of horizontally transferred algal nuclear genes in the photosynthetic sea
slug, Elysia chlorotica. Mol. Biol. Evol. 29: 1545–1556. DOI:
10.1093/molbev/msr316
Posada D. & Crandall K.A. 1998. MODELTEST: testing the
model of DNA substitution. Bioinformatics 14: 817–818.
Ronquist F. & Huelsenbeck J.P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:
1572–1574. DOI: 10.1093/bioinformatics/btg180
Rumpho M.E., Pelletreau K.N., Moustafa A. & Bhattacharya D.
2011. The making of a photosynthetic animal. J. Exp. Biol.
214: 303–311. DOI: 10.1242/jeb.046540
Rumpho M.E., Pochareddy S., Worful J.M., Summer E.J., Bhattacharya D., Pelletreau K.N., Tyler M.S., Lee J., Manhart J.R. & Soule K.M. 2009. Molecular characterization of
the Calvin cycle enzyme phosphoribulokinase in the stramenopile alga Vaucheria litorea and the plastid hosting
mollusc Elysia chlorotica. Mol. Plant. 2: 1384–1396. DOI:
10.1093/mp/ssp085
Rumpho M.E., Summer E.J., Green B.J., Fox T.C. & Manhart
J.R. 2001. Mollusc/algal chloroplast symbiosis: how can isolated chloroplasts continue to function for months in the cytosol of a sea slug in the absence of an algal nucleus? Zoology
104: 303–312. PMID: 16351845
Unauthenticated
Download Date | 6/17/17 7:46 AM
Endosymbiotic relationships of sea slugs and green algae
Rumpho M.E., Summer E.J. & Manhart J.R. 2000. Solarpowered
sea slugs. Mollusc/algal chloroplast symbiosis. Plant Physiol.
123: 29–38.
Rumpho M.E., Worful J.M., Lee J., Kannan K., Tyler M.S., Bhattacharya D., Moustafa A. & Manhart J.R. 2008. Horizontal
gene transfer of the algae nuclear gene psbO to the photosynthetic sea slug Elysia chlorotica. Proc. Natl. Acad. Sci. USA
105: 17867–17871. DOI: 10.1073/pnas.0804968105
Schwartz J.A., Curtis N.E. & Pierce S.K. 2010. Using algal
transcriptome sequences to identify transferred genes in the
sea slug, Elysia chlorotica. Evol. Biol. 37: 29–37. DOI:
10.1007/s11692-010-9079-2
Seftor R.E. & Jensen R.G. 1986. Causes for the disappearance
of photosynthetic CO2 fixation with isolated spinach chloroplasts. Plant. Physiol. 81: 81–85.
Thompson J.D., Higgins D.G. & Gibson T.J. 1994. Clustal-Wimproving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res. 22:
4673–4680.
643
Tian C., Wang G., YE N.H. & Zhang B.Y. 2005. Cloning and
sequence analysis of the partial sequence of the rbcL from
Bryopsis hypnoides. Acta Oceanol. Sin. 5: 150–161.
Trench R.K., Boyle E.J. & Smith D.C. 1973. Association between
chloroplasts of Codium fragile and the mollusc Elysia viridis.
II. Chloroplast ultrastructure and photosynthetic carbon fixation in Elysia viridis. Proc. Roy. Soc. Lon. B. Biol. 184:
63–81.
Wägele H., Deusch O., Händeler K., Martin R., Schmitt V.,
Christa G., Pinzger B., Gould S.B., Dagan T., KlussmannKolb A. & Martin W. 2011. Transcriptomic evidence that
longevity of acquired plastids in the photosynthetic slugs
Elysia timida and Plakobrachus ocellatusdoes not entail lateral transfer of algal nuclear genes. Mol. Biol. Evol. 28: 699–
706. DOI: 10.1093/molbev/msq239
Received September 6, 2013
Accepted December 15, 2013
Unauthenticated
Download Date | 6/17/17 7:46 AM