S56
Bulletin of the NYU Hospital for Joint Diseases 2011;69(Suppl 1):S56-61
Abnormal Vascular Endothelial Growth Factor
Expression in Mesenchymal Stem Cells from both
Osteonecrotic and Osteoarthritic Hips
Fackson Mwale, Ph.D., Hongtian Wang, Ph.D., Aaron J. Johnson, M.D., Michael A. Mont, M.D.,
and John Antoniou, M.D., Ph.D..
Abstract
In osteonecrosis (ON) of the hip, interruption of
angiogenesis is a pathological process that may lead to
impairment of the nutrient supply, cell death, and the
collapse of bone. However, the process of angiogenesis
in ON is not well understood. The purpose of this study
was to investigate the expression of vascular endothelial
growth factor (VEGF) in human mesenchymal stem
cells (MSCs) in vitro. Cultured MSCs obtained from the
hips of normal, ON, and osteoarthritic (OA) patients all
expressed VEGF-A. Furthermore, MSCs from normal
stem cells also expressed VEGF-B, but its expression
had a tendency to increase in those stem cells from ON
and OA patients, while VEGF-C was absent in all of the
stem cells. However, VEGF-D expression consistently
decreased in MSCs from ON patients, but increased in
stem cells from OA donors over that of control cells. In
addition, placental growth factor (PGF), which has a
similar function as VEGF, was expressed in MSCs, and
the levels were similar in MSCs from normal, ON, and
OA donors. The results suggest that ON and OA are
associated with aberrant VEGF-D expression.
Fackson Mwale, Ph.D., Hongtian Wang, Ph.D., and John Antoniou, M.D., Ph.D., are from the Lady Davis Institute for Medical
Research and Department of Surgery, SMBD-Jewish General
Hospital, McGill University, Montreal (QC), Canada. Aaron J.
Johnson, M.D., and Michael A. Mont, M.D., are from Rubin Institute for Advanced Orthopedics, Center for Joint Preservation and
Reconstruction, Sinai Hospital of Baltimore, Baltimore, Maryland.
Correspondence: Fackson Mwale, Ph.D., Lady Davis Institute for
Medical Research and Department of Surgery, SMBD-Jewish General Hospital, 3755 Côte Ste-Catherine Road, Montreal, Quebec
H3T 1E2, Canada; [email protected].
O
steonecrosis (ON), also known as avascular necrosis, bone infarction, ischemic necrosis, subchondral osteonecrosis, and aseptic necrosis, occurs
when there is cellular death of bone due to the interruption
of the blood supply. Without a blood supply, eventually,
there will be collapse of the architectural bony structure.
If it involves the bones of a joint, such as the hip, knee, or
shoulder, ON often leads to articular cartilage damage and
destruction of the articular surfaces. This event will lead
to joint pain and loss of function and is frequently severe
enough to require arthroplasty surgery.
Underneath the collapsing bone in ON of the hip, there is
typically an attempt at a reparative response. Unfortunately,
except under conditions of extremely small lesions, the
reparative response fails, as osteoclastic resorption leads
to subchondral collapse. Beneath the collapsing segment,
there is often a hypervascular area, with the resultant effect
similar to a hypertrophic nonunion found in altered fracture
healing. At present, it is not known how to definitively repair the ischemic bone, but one potential treatment method
would be to differentiate mesenchymal stem cells (MSCs)
from adjacent living bone tissue into osteoblasts, and then
embed them within a biomatrix to stimulate angiogenesis.
This would test the hypothesis that under the appropriate
stimulus, these cells, together with the remaining inorganic
mineral volume, could produce a matrix that mimics that
of native bone. Hopefully, the repaired tissue would have
properties resembling those found in healthy and fully
functional bone.
MSCs have been shown to undergo enhanced bone
formation in a mouse model of a segmental bone defect
in terms of expressing osteogenic and angiogenic factors,
such as BMP2+VEGF.1 This model mimics the cellular
condensation requirements for embryonic mesenchymal
osteoblastogenesis and provides the biochemical environmental factors conducive to bone formation.
Mwale F, Wang H, Johnson AJ, Mont MA, Antoniou J. Abnormal vascular endothelial growth factor expression in mesenchymal stem cells from both
osteonecrotic and osteoarthritic hips. Bull NYU Hosp Jt Dis. 2011;69(Suppl 1):S56-61.
Bulletin of the NYU Hospital for Joint Diseases 2011;69(Suppl 1):S56-61
Geiger and colleagues have shown that if the blood
supply is compromised in fracture healing,24 application
of osteogenic factors alone cannot induce successful bone
healing. Angiogenesis is essential for restoring blood flow to
the fracture site. Treatment with vascular endothelial growth
factor (VEGF) superfamily members, VEGFA, VEGFB,
VEGFC, VEGFD, or placental growth factor (PGF) are
key requirements for angiogenesis.2 Human MSCs have
been found to express VEGF, suggesting that implantation
of human MSCs is a practical means for a source of VEGF
production.3 Autologous MSCs have appropriate differentiation properties, easy accessibility, and proliferative capacity.
Because of the potential similarity to the altered healing
response found in fracture nonunions that have been successfully treated with autologous MSCs, they could potentially
complement ON treatment by secreting angiogenic factors
and undergoing osteoblast differentiation. The purpose of
this study was to investigate the expression of the angiogenic
VEGF superfamily members in MSCs from normal, ON,
and osteoarthritis (OA) patients.
Materials and Methods
Source and Preparation of Stem Cells
The three sources of stem cells used in the study were: 1.
normal human MSCs obtained from Lonza Group, Ltd.
(Basel, Switzerland); 2. MSCs from OA patients obtained
from 15 milliliter aspirates drawn from the intramedullary
canal of donors undergoing total hip arthroplasty for OA,
using a protocol approved by the research ethics committee
(REC) of the Jewish General Hospital; and 3. MSCs from
ON patients, obtained in a similar manner, from donors undergoing hip arthroplasty, using the same protocol approved
by the institutional review board (IRB) of Sinai Hospital of
Baltimore.
Bone marrow aspirates were processed as previously
described.4-7 Briefly, each aspirate was diluted 1:1 with
Dulbecco’s Modified Eagle Medium (DMEM) reagent
(Invitrogen™, Burlington, Ontario, Canada) and layered
over 1:1 with Ficoll (Ficoll-Paque Plus; GE Healthcare BioSciences, Baie-d’Urfé, Quebec City). After centrifugation
at 900 x g for 30 minutes, the mononuclear cell layer was
removed from the interface, washed with DMEM, and resuspended in DMEM supplemented with 10% fetal bovine
serum (Hyclone, Logan, Utah), 100 units/ml penicillin,
100 µg/ml streptomycin, and 2 mM L-glutamine. The cells
were plated in 20 milliliters of media in a 176-cm2 culture
dish and incubated at 37° Celsius (C) in a 5% CO2 humidified atmosphere. After 72 hours, nonadherent cells were
discarded, and the adherent ones were thoroughly washed
twice with DMEM. Thereafter, the cells were expanded, as
previously described.5
Cell Culture
Approximately, one million of third or fourth passage
OA and ON donor MSCs were cultured on commercial
S57
polystyrene tissue culture dishes (Sarstedt, Inc.,
Montreal, Quebec, Canada) in DMEM-high glucose
with 10% FBS. The media was changed every 2 days for
up to 7 days, after which cells were harvested for gene
expression studies.
Total RNA Isolation
Total RNA was extracted from MSCs by a modification
of the method of Chomcynski and Sacchi,8 using TRIzol®
reagent (Invitrogen™). After centrifugation for 15 minutes
at 12,000 x g at 4° C, the aqueous phase was precipitated
in one volume of isopropanol, incubated for 20 minutes at
room temperature, and centrifuged again for 15 minutes at
12,000 x g at 4° C. The resulting RNA pellet was air-dried,
re-suspended in 40 μl of diethylpyrocarbonate-treated water,
and 5 µl was assayed for RNA concentration and purity by
measuring A260/A280.
Reverse Transcription (RT) and LightCycler®
Real-Time Polymerase Chain Reaction (PCR)
Salt-free primers for target genes VEGFA, VEGFB, VEGFC, VEGFD and PGF, as well as for housekeeping gene
GAPDH, were generated by Invitrogen™. The sequences
of the primers are shown in Table 1. For LightCycler® reaction, every 20 μL reaction solution consists of a master
mix of the following reaction components: 8 μL Rnase free
distilled water, 10 μL SYBR Green mixture (Qiagen), 0.5
μL forward primer (0.25 μM), 0.5 μL reverse primer (0.25
μM), and 1 μL cDNA.
The real time PCR condition included one cycle of
denaturation (95°C for 15 minutes), 45 cycles of amplification and quantification (95° C for 15 seconds, 58° C
for 15 seconds, and 72° C for 15 seconds, with a single
fluorescence measurement), melting curve (65° to 95° C,
with a heating rate of 0.1° C per second and a continuous
fluorescence measurement), and finally a cooling step to
40° C. After real-time PCR, the samples were collected by
centrifugation, and the gene size was analyzed on 2.0%
agarose gel. The primer sequences used for PCR shown in
Table 1 were chosen because they are specific for human
RNA, and they amplify a single product. GAPDH primers
have been described in one of our earlier articles.9
Calculation of Relative Units of Gene
Transcription
The crossing points (CPs) were determined by LightCycler®
software, version 3.3 (Roche Diagnostics, Basel, Switzerland) and were measured at constant fluorescence level.
Every sample was run in duplicate. The relative units of
real-time PCR were determined by the following equation:
Relative units = 2 DCP target / 2DCP reference
Regarding statistical analysis, all experiments were
performed in triplicates, and statistical differences between
the treated and the controls were analyzed by Statview
S58
Bulletin of the NYU Hospital for Joint Diseases 2011;69(Suppl 1):S56-61
Figure 1 Photomicrograph of normal (CTL), osteonecrosis (ON), and osteoarthritic (OA) cells cultured in DMEM/high glucose with
10% FBS for 7 days.
(SAS Institute, Inc., Cary, North Carolina). Results were
considered statistically significant at p < 0.05. All results
were the average of three samples ± standard deviation.
Results
After culturing the cells for 24 hours, MSCs from normal, ON, and OA donors had the typical appearance of
stem cells, with no overt differences between the groups
(Fig.1). Normal donors showed strong VEGF-A message (Fig. 2, lane 1). VEGF-A message from ON and
OA MSCs were also prominent, although they had a
tendency to decrease (Fig. 2, lanes 2 and 3). In view of
these results, in which VEGF-A, being the most important member of the VEGF proteins, appeared in all of the
stem cells and with the understanding that VEGF-A can
stimulate vasculogenesis and angiogenesis, we decided to
analyze VEGF B, C, and D, as well as PGF, a growth factor with similar functions as VEGF. MSCs from normal
stem cells also expressed VEGF-B; however, in contrast
to VEGF-A, its expression had a tendency to increase in
stem cells from ON and OA patients (Fig.3).
Since VEGF-C was previously reported to be active in
angiogenesis, lymphangiogenesis, endothelial cell growth,
survival, and permeability of blood vessels, it appeared possible that MSCs express VEGF-C. However, VEGF-C was
not detected in any of the stem cells (data not shown). The
expression of VEGF-D was markedly reduced in normal
stem cells (Fig. 4, lane 1). Its expression was strongly downregulated in MSCs from ON but strongly up-regulated in
stem cells from OA donors (Fig. 4, lanes 2 and 3). PGF was
expressed in MSCs, and the levels were similar in MSCS
from normal, ON, and OA donors (Fig. 5).
Discussion
MSCs have the ability to recruit and participate in angiogenesis and de novo arteriogenesis, and VEGF plays a central
role in the observed host-derived angiogenic response. Previously, it was proposed that ex vivo expanded autologous
MSCs may serve as cell therapy to promote therapeutic
angiogenesis.10 In this and our previous studies,4,6,7,9,11,12 we
used RT-PCR analyses of MSCs, which permitted expression analyses of the interrelationships of the VEGF family
members VEGF-A, VEGF-B, VEGF-C, and VEGF-D, as
well as PDF genes, that have usually been studied individu-
Table 1 Primers for Human VEGFA, B, C, D, PGF and GAPDH
PCR Product
Size
Gene
Sequence
VEGFA
Forward:
Reverse:
gggcagaatcatcacgaagt
tggtgatgttggactcctca
(100-119)
(221-310)
211
VEGFB
Forward:
Reverse:
cccttgactgtggagctcat
cactggctgtgttcttccag
(163-172)
(346-365)
203
VEGFC
Forward:
Reverse:
cacttgctgggcttcttctc
tgctcctccagatctttgct
(4-23)
(157-176)
173
VEGFD
Forward:
Reverse:
tgtaagtgcttgccaacagc
gtggattttcctcctgcaaa
(565-574)
(708-727)
163
PGF
Forward:
Reverse:
gttcagcccatcctgtgtct
aacgtgctgagagaacgtca
(216-235)
(359-378)
163
GAPDH
Forward:
Reverse:
tgaaggtcggagtcaacggat
ttctcagccttgacggtgcca
(11-31)
(171-191)
181
PCR, polymerase chain reaction; VEGF, vascular endothelial growth factor; PGF, placental growth factor; GAPDH,
glycerol-3-phosphate dehydrogenase.
Bulletin of the NYU Hospital for Joint Diseases 2011;69(Suppl 1):S56-61
S59
Figure 2 Vascular endothelial growth factor A (VEGFA) gene
expression of normal (CTL), osteonecrosis (ON), and osteoarthritic
(OA) cells cultured for 7 days in in the presence of DMEM/high
glucose with 10% FBS. All values have been normalized to GAPDH
gene expression.
Figure 3 Vascular endothelial growth factor B (VEGFB) gene
expression of normal (CTL), osteonecrosis (ON), and osteoarthritic
(AO) cells cultured for 7 days in in the presence of DMEM/high
glucose with 10% FBS. All values have been normalized to GAPDH
gene expression.
Figure 4 Vascular endothelial growth factor D (VEGFD) gene
expression of normal (CTL), osteonecrosis (ON), and osteoarthritic
(AO) cells cultured for 7 days in in the presence of DMEM/high
glucose with 10% FBS. All values have been normalized to GAPDH
gene expression.
Figure 5 Placental growth factor (PGF) gene expression of normal
(CTL), osteonecrosis (ON), and osteoarthritic (AO) cells cultured
for 7 days in in the presence of DMEM/high glucose with 10%
FBS. All values have been normalized to GAPDH gene expression.
ally concerning their participation in stem cell-mediated
angiogenesis in ON and OA donor cells.
We observed that MSCs from normal, ON, and OA patients were characterized by a distinct signature profile of
VEGF gene expression. Thus, MSCs from control patients
are characterized by the expression of VEGF-A, VEGF-B,
PGF, VEGF-D, and the absence of VEGF-C. This suggests
that angiogenesis involving MSCs does not require VEGFC. There is also an absence of or low level of expression
of type X collagen, better known as a protein expressed by
terminally hypertrophic chondrocytes.7,12,13
MSCs from ON patients were characterized by the expression of VEGF-A, VEGF-B, PGF, and decreased expression
of VEGF-D for reasons that are unclear. The decreased
expression of VEGF-D suggests that angiogenesis in MSCs
may not require VEFG-D.
MSCs from OA patients were characterized by a reduced
expression of VEGF-A and increased expressions of VEGFB and VEGF-D. The increased expression of VEGF-B and
VEGF-D in these MSCS raises questions as to whether this
S60
Bulletin of the NYU Hospital for Joint Diseases 2011;69(Suppl 1):S56-61
is related to type X collagen expression. In these cells, it is
noteworthy that aggrecan and type X collagen are constitutively expressed.5-7,12,13 Previously, we have shown that the
onset of hypertrophy in the growth plate was accompanied
by the strongest but transient expression of VEGF as well
as aggrecan.14
Various studies have proposed using various VEGF
factors to complement osteogenic factors for the treatment
of ON in animal models.15-23 A recent report described the
potential use of genetically engineered bone marrow stem
cells carrying genes for VEGF and bone morphogenetic
protein-6 (BMP-6) (to induce osteogenesis) for the treatment
of pre-collapse ON.16 Another report described the downregulation of VEGF proteins and gene expression in rabbits
with steroid-induced ON.17 In another report, the expression
of VEGF was assessed in six specimens from late stage ON
of the femoral head.18 These investigators found that osteoblasts from the reactive interface exhibited increased VEGF
expression, which the investigators postulated might be a
secondary phenomenon in an attempt to stimulate ingrowth
of a reparative blood supply. They also found that osteoblasts
derived from OA femoral heads exhibited down-regulation of
VEGF after 24 hours of co-incubation with glucocorticoids.
Other studies have assessesed the role of VEGF proteins in
various animal models and clinical studies of ON.19-23
5.
6.
7.
8.
9.
10.
11.
Conclusion
Our data further define the complex changes and interrelationships in the VEGF family gene expression in stem cells
from ON and OA donors that may occur in the course of
vascular invasion and cell death. This investigation draws
attention to these VEGF molecules and their relationships
to the physiological and pathological events that are part of
angiogenesis.
Disclosure Statement
None of the authors have a financial or proprietary interest
in the subject matter or materials discussed, including, but
not limited to, employment, consultancies, stock ownership,
honoraria, and paid expert testimony.
12.
13.
14.
References
1. Kumar S, Wan C, Ramaswamy G, et al. Mesenchymal stem
cells expressing osteogenic and angiogenic factors synergistically enhance bone formation in a mouse model of segmental
bone defect. Mol Ther. 2010 May;18(5):1026-34; Epub 2010
Jan 12.
2. Mayer H, Bertram H, Lindenmaier W, et al. Vascular endothelial growth factor (VEGF-A) expression in human
mesenchymal stem cells: autocrine and paracrine role on
osteoblastic and endothelial differentiation. J Cell Biochem.
2005 Jul 1;95(4):827-39.
3. Kagiwada H, Yashiki T, Ohshima A, et al. Human mesenchymal stem cells as a stable source of VEGF-producing cells. J
Tissue Eng Regen Med. 2008 Jun;2(4):184-9.
4. Mwale F, Girard-Lauriault PL, Wang HT, et al. Suppression
15.
16.
17.
18.
of genes related to hypertrophy and osteogenesis in committed human mesenchymal stem cells cultured on novel
nitrogen-rich plasma polymer coatings. Tissue Eng. 2006
Sep;12(9):2639-47.
Mwale F, Stachura D, Roughley P, Antoniou J. Limitations of
using aggrecan and type X collagen as markers of chondrogenesis in mesenchymal stem cell differentiation. J Orthop
Res. 2006 Aug;24(8):1791-8.
Mwale F, Wang HT, Nelea V, et al. The effect of glow discharge
plasma surface modification of polymers on the osteogenic
differentiation of committed human mesenchymal stem cells.
Biomaterials. 2006 Apr;27(10):2258-64; Epub 2005 Nov 28.
Mwale F, Yao G, Ouellet JA, et al. Effect of parathyroid
hormone on type X and type II collagen expression in mesenchymal stem cells from osteoarthritic patients. Tissue Eng
Part A. 2010 Nov;16(11):3449-55; Epub 2010 Aug 18.
Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem. 1987;162:156-9.
Nelea V, Luo L, Demers CN, et al. Selective inhibition of
type X collagen expression in human mesenchymal stem
cell differentiation on polymer substrates surface-modified
by glow discharge plasma. J Biomed Mater Res A. 2005 Oct
1;75(1):216-23.
Al-Khaldi A, Eliopoulos N, Martineau D, et al. Postnatal
bone marrow stromal cells elicit a potent VEGF-dependent
neoangiogenic response in vivo. Gene Ther. 2003;10:621-9.
Mwale F, Stachura D, Roughley P, Antoniou J. Limitations of
using aggrecan and type X collagen as markers of chondrogenesis in mesenchymal stem cell differentiation. J Orthop
Res. 2006;24:1791-8.
Petit A, Wang HT, Girard-Lauriault PL, et al. Novel insights
into the mechanism of decreased expression of type X collagen in human mesenchymal stem cells from patients with
osteoarthritis cultured on nitrogen-rich plasma polymers:
implication of cyclooxygenase-1. J Biomed Mater Res A.
2010 Sep 1;94(3):744-50.
Mwale F, Girard-Lauriault PL, Wang HT, et al. Suppression
of genes related to hypertrophy and osteogenesis in committed human mesenchymal stem cells cultured on novel
nitrogen-rich plasma polymer coatings. Tissue Eng. 2006
Sep;12(9):2639-47.
Tchetina E, Mwale F, Poole AR. Distinct phases of coordinated
early and late gene expression in growth plate chondrocytes
in relationship to cell proliferation, matrix assembly, remodeling, and cell differentiation. J Bone Miner Res. 2003
May;18(5):844-51.
Mont MA, Jones LC, Seyler TM, et al. New treatment approaches for osteonecrosis of the femoral head: an overview.
Instr Course Lect. 2007;56:197-212.
Cui Q, Botchwey EA. Emerging ideas: treatment of precollapse osteonecrosis using stem cells and growth factors. Clin
Orthop Relat Res. 2010 Dec 16; Epub ahead of print.
Wang G, Zhang CQ, Sun Y, et al.. Changes in femoral head
blood supply and vascular endothelial growth factor in
rabbits with steroid-induced osteonecrosis. J Int Med Res.
2010;38:1060-9.
Varoga D, Drescher W, Pufe M, et al.. Differential expression
of vascular endothelial growth factor in glucocorticoid-related
osteonecrosis of the femoral head. Clin Orthop Relat Res.
Bulletin of the NYU Hospital for Joint Diseases 2011;69(Suppl 1):S56-61
2009;467:3273-82.
19. Suzuki O, Bishop AT, Sunagawa T, et al. VEGF-promoted
surgical angiogenesis in necrotic bone. Microsurgery.
2004;24:85-91.
20. Radke S, Battmann A, Jatzke S, et al. Expression of the
angiomatrix and angiogenic proteins CYR61, CTGF, and
VEGF in osteonecrosis of the femoral head. J Orthop Res.
2006;24:945-52.
21. Katsube K, Bishop AT, Simari RD, et al..Vascular endothelial
growth factor (VEGF) gene transfer enhances surgical revascularization of necrotic bone. J Orthop Res. 2005;23:469-74.
22. Kim TH, Hong JM, Lee JY, et al.. Promoter polymorphisms of
S61
the vascular endothelial growth factor gene is associated with
an osteonecrosis of the femoral head in the Korean population.
Osteoarthritis Cartilage. 2008 Mar;16(3):287-91; Epub 2007
Aug 16.
23. Kabata T, Matsumoto T, Yagishita S, et al. Vascular endothelial
growth factor in rabbits during development of corticosteroidinduced osteonecrosis: a controlled experiment. J Rheumatol.
2008;35:2383-90.
24. Geiger F, Lorenz H, Xu W, et al. VEGF producing bone marrow stromal cells (BMSC) enhance vascularization and resorption of a natural coral bone substitute. Bone 2007;41:516-522.