Gene 357 (2005) 9 – 17
www.elsevier.com/locate/gene
Functional complementation of yeast ribosomal P0 protein with
Plasmodium falciparum P0
K. Arunaa, Tirtha Chakrabortya,1, Pavitra N. Raoa, Cruz Santosb,
Juan P.G. Ballestab, Shobhona Sharmaa,*
a
Department of Biological Sciences, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400 005, India
Centro de Biologia Molecular FSevero Ochoa_, Universidad Autonoma de Madrid and Consejo Superior de Investigaciones Cientificas,
Cantoblanco, 28049 Madrid, Spain
b
Received 18 August 2004; received in revised form 10 December 2004; accepted 1 April 2005
Available online 15 August 2005
Received by F.G. Alvarez-Valin
Abstract
A complex of three phosphoproteins (P0, P1 and P2) constitutes the stalk region at the GTPase center of the eukaryotic large ribosomal
subunit, amongst which the protein P0 plays the most crucial role. Earlier studies have shown the functional complementation of the
conditional P0-null mutant of Saccharomyces cerevisiae (W303dGP0) with orthologous P0 genes from fungal and mammalian organisms,
but not the protozoan parasite Leishmania infantum. In this paper we show that the PfP0 gene from the protozoan malaria parasite
Plasmodium falciparum can functionally complement the conditional P0-null W303dGP0 mutant of S. cerevisiae. Unlike the above
orthologous genes, PfP0 gene could also rescue the D67dGP0 strain, which in addition to being a conditional null for ScP0 gene, is a nullmutant for both ScP1a and h genes. However, under stress conditions such as high temperature, salt and osmolarity, PfP0 gene could not
rescue D67dGP0 strain. Ribosomes purified from W303dGP0 carrying PfP0 gene did not contain ScP1 protein, indicating a lack of binding
of ScP1 to PfP0 protein. Yeast 2-hybrid analysis further confirmed the lack of binding of ScP1 to PfP0 protein. The polymerizing activities of
ribosomes with ScP0 or PfP0 protein, in the absence of ScP1 protein, were found to be about 40 – 45% that of ribosomes with all the yeast Pproteins. In its sensitivity to the inhibitor sordarin, PfP0 was similar to the P0 protein from the fungus Aspergillus fumigatus. These results
indicate a closer functional relationship of P. falciparum P0 gene to fungal P0 genes.
D 2005 Elsevier B.V. All rights reserved.
Keywords: Malaria parasite; Acidic proteins; Sordarin; Orthologous P0; Stress conditions
1. Introduction
The neutral protein P0 and the acidic proteins P1 and P2
make up a pentameric complex P0(P1)2(P2)2, which
Abbreviations: RPP0, Ribosomal protein P0; PfP0, Plasmodium
falciparum Ribosomal protein P0; ScP0, Saccharomyces cerevisiae
Ribosomal protein P0; ScP1, Saccharomyces cerevisiae Ribosomal protein
P1.
* Corresponding author. Tel.: +91 22 22804545x2570; fax: +91 22
22804610.
E-mail address: [email protected] (S. Sharma).
1
Present address: Laboratory of Cellular and Molecular Biology,
National Institute on Aging, 5600 Nathan Shock Drive, Baltimore, MD
21224, USA.
0378-1119/$ - see front matter D 2005 Elsevier B.V. All rights reserved.
doi:10.1016/j.gene.2005.04.007
constitutes the eukaryotic stalk (Uchiumi et al., 1987), a
ribosomal protuberance of the large ribosomal subunit,
functionally equivalent to the bacterial complex L10(L7/
L12) (Liljas et al., 1986). The stalk interacts with the
elongation factor EF-2 and plays an important role in the
regulation of protein synthesis. In Saccharomyces cerevisiae, the stalk consists of two P1 proteins (ScP1 a and h)
and two P2 proteins (ScP2 a and h) in addition to ScP0
(Remacha et al., 1995). The P0 protein, but not P1 or P2
protein, is essential for ribosomal activity and cell viability
(Santos and Ballesta, 1994, 1995).
Study of the capacity of orthologous P0 proteins to
complement the endogenous protein in conditional P0-null
mutants of S. cerevisiae has been performed earlier
10
K. Aruna et al. / Gene 357 (2005) 9 – 17
(Rodriguez-Gabriel et al., 2000). Several orthologous P0
genes from fungi, cellular slime mold, insects and mammals
allowed growth under restrictive conditions of conditional
P0-null yeast strains, which carried the ScP0 gene under the
inducible GAL promoter. However, the P0 gene from the
protozoan parasite Leishmania infantum did not complement the ScP0 protein. Chimeric constructs of aminoterminal domain from the mammalian P0 protein and
carboxy-terminal domain from ScP0 could complement
the ScP0 conditional null-mutant as well as rescue certain
thermal and osmolar sensitivity (Rodriguez-Gabriel et al.,
2000).
Strain D67dGP0, in addition to being a conditional null
for ScP0, is a null-mutant for both ScP1 a and h genes
(Remacha et al., 1992). When grown in non-restrictive
conditions, such as in galactose (Remacha et al., 1992), or
complemented with ectopic ScP0 in restrictive conditions
(Santos and Ballesta, 1994), the D67dGP0 strain contains
ribosomes, which are devoid of both the acidic P1 and P2
proteins. Detailed in vitro studies in yeast have further
established that in the absence of P1 protein, P2 does not
bind to P0 protein (Zurdo et al., 2000), establishing that P1
is critical for the formation of the pentameric stalk P-protein
complex. The strain D67dGP0 grows slowly and the protein
expression pattern is different (Remacha et al., 1995).
Therefore, in addition to the structural contribution to the
stalk region of the 60S ribosomal subunit, the acidic
proteins are hypothesized to play a role in the translation
regulatory mechanism in yeast (Remacha et al., 1995).
Amongst all the orthologous P0 genes used for the
complementation analysis, only the insect P0 proteins could
complement the strain D67dGP0 (Gagou et al., 2000).
Based on these results, it has been postulated that the amino
terminal rRNA binding domain of most of the eukaryotic P0
proteins is conserved, while the carboxy-terminal located
acid protein binding domain has diverged considerably. The
carboxy-terminal regions of the insect P0 proteins, however,
appear to be structurally closer to that of ScP0 (Kouyanou et
al., 2003). In this paper we show that the protozoan human
malarial parasite PfP0 protein could replace the yeast ScP0
protein in the presence as well as absence of ScP1 proteins.
The ribosomal activity of PfP0 with or without ScP1 was
comparable but the cells were differentially stress sensitive.
The results also showed that unlike all other orthologous
RPP0 proteins tested so far, PfP0 did not bind to the ScP1
protein.
2. Materials and methods
2.1. Yeast and bacterial strains and growth media
S. cerevisiae W303dGP0 (MAT a, leu2-3, 112, ura3-1,
trp1-1, his3-11, 15, ade2-1, can1-100, RPP0::URA3-GAL1RPP0) and S. cerevisiae D67dGP0 (MAT a, leu2-3, 112,
ura3-1, trp1-1, his3-11, 15, ade2-1, can1-100, rpY1a0
LEU2, rpYP1h0TRP1, RPP00URA3-GAL1-RPP0) were
derived from S. cerevisiae W303 and D67, respectively, by
integration through homologous recombination in the RPP0
locus of a construction carrying the P0 coding region fused to
the GAL1 promoter (Santos and Ballesta, 1995). Yeasts were
grown in either YEP medium (1% yeast extract, 2% peptone)
or minimal YNB medium, supplemented with the necessary
nutritional requirements. In both cases, the carbon source was
either 2% glucose or 2% galactose as indicated. Stock
cultures of all yeast strains were maintained in galactose
medium. When required, cells were shifted to glucose
medium and allowed to grow for at least 20 generations to
reach steady state growth conditions. Escherichia coli DH5a
was used as a host for the routine maintenance and
preparation of plasmids and was grown in LB medium.
Strains were tested for growth under osmolar stress in
minimal medium containing 2% glucose and 0.3 M NaCl
or 0.8 M sorbitol.
2.2. Enzymes and reagents
Restriction endonucleases were purchased from Roche
Molecular Biochemicals, MBI Fermentas, New England
Biolabs, and Amersham Pharmacia Biotech, and were used
as recommended by the suppliers. T4 DNA ligase, calf
intestinal alkaline phosphatase, and the DNA polymerase I
Klenow fragment were from Roche Molecular Biochemicals.
DNA manipulations of E. coli and yeast were performed
using standard protocols (Sambrook et al., 1989; Adams et
al., 1997). Monoclonal antibodies against PfP0 were raised
in the laboratory (Rajeshwari et al., 2004). Polyclonal rabbit
sera against ScP0 was obtained as described previously
(Santos and Ballesta, 1994).
2.3. Cloning of PfP0 in yeast expression vector
A pBluescript vector, pBSHsP0, containing the full-length
human P0 gene (Rodriguez-Gabriel et al., 2000), cloned
between the upstream (1 kb) and downstream (0.7 kb)
flanking regions of yeast P0 gene, was digested with NdeI
and NheI enzymes to remove the human P0 gene, and to
replace with PfP0 full length gene. However, as PfP0 gene
had an NdeI site in its sequence, it had to be cloned in two
parts. The entire gene was amplified using primers containing
NdeI and NheI sites (P0Nde1:5VGCTAACTCATATGATGGCGAAATTATCCAAG3V; SRB2: 5VTCGCTAGCTCAAACATTCCAAAT3V). This fragment was restricted with
NdeI and NheI, and the 3V–400 bp of NdeI– NheI fragment
of PfP0 was cloned into PfP0pBSHsP0/NdeI/NheI. The
recombinant clone, pBSPfP0C, was then digested with
Nde1 and the 5V– 551 bp NdeI fragment of PfP0 was cloned
into this, resulting into pBSPfP0 with the entire PfP0 in
proper orientation. The PfP0 insert was then PCR amplified
from pBSPfP0 using T3 and T7 primers, digested with SalI
and SacI, and ligated into the vector pFL37 (RodriguezGabriel et al., 2000), resulting in the plasmid pFL37PfP0. The
K. Aruna et al. / Gene 357 (2005) 9 – 17
sequence of the PfP0 DNA fragment cloned in this vector was
confirmed by sequencing. For the yeast two-hybrid screening, plasmids, pEG202, pSH18-34, pJG4-5 and the yeast
strain EGY48 were obtained from Roger Brent’s lab and have
been described earlier (Gyuris et al., 1993). The entire PfP0
(316 amino acids) was amplified from E12 clone (Goswami
et al., 1996), and the entire yeast P0 (312 amino acids) was
amplified from genomic DNA using primers YP0FR1
(5VCTGAATTCATGGGAGGCATTCGTGAAAAG3V) and
YP0RX1 (5VCGGCCTCGAGTCATGTTGCACTTC3V).
These were ligated into pEG202 in frame resulting in
plasmids pEGPfP0 and pEGScP0 respectively. ScP1a gene
was amplified using (5V-CTGAATTCATGTCTACTGAATCCGC3V) and (5V CTCTCGAGCTAATCAAATAAACCGAAAC 3V) primers, and cloned in the pJG4-5 vector in
the correct reading frame. The screen was performed as
detailed elsewhere (Gyuris et al., 1993). Briefly, the yeast
strain EGY48 (MATa, his3, trp1, ura3-52, leu20pLEU2LexAop6) was pre-transformed by the lithium acetate
method, with the bait pEGPfP0/pEGScP0 and the lacZ
reporter pSH18-34, which contained 8 LexA operator-binding sites (LexAop). These transformants were tested for the
lack of growth on Leu plates. These cells were then
transformed with pJG4-5-ScP1a plasmid DNA and grown
on glucose Leu Ura His Trp plates. Colonies were
replica plated onto h-galactosidase assay plates containing
either galactose or glucose as the carbon source. Only Leu+
colonies that grew and demonstrated h-galactosidase activity
on galactose, but not dextrose, were considered positives.
Quantitative h-galactosidase measurements were carried out
with yeast liquid cultures, using the procedure described by
Clonetech. Typically, 0.1 ml of cells were harvested in 200 Al
of phosphate buffer, pH 7.0, permeabilized by liquid nitrogen
treatment, and 0.8 mg of the substrate ONPG was added to
start the reaction. The specific activity was measured as
described earlier (Miller, 1972).
11
pellet of washed ribosomes was dissolved in buffer 1 and
stored at 20 -C.
2.5. Western blotting
Proteins in gels were transferred to membranes by
electrophoresis in a semi-dry system using Novablot LKB
buffer. The membranes were treated with 5% non-fat milk
dissolved in TBS (10 mM Tris – HCl, pH 7.4, 200 mM
NaCl) for 30 min and afterward they were incubated for 1 h
with the antibody diluted in the same buffer. Subsequently,
the membranes were washed 15 min in TBS and 0.1%
Tween 20. Then, the second antibody (anti rabbit HRP
conjugated and anti mouse HRP conjugated secondary
antibodies were used), diluted in the former buffer, was
added and the membranes were incubated for 30 min.
Finally, they were washed 15 min with 0.1% Tween 20 in
TBS. Bound antibodies were located by detecting peroxidase activity.
2.6. Polyphenylalanine synthesis
The reaction was performed as described earlier (Remacha et al., 1995). Briefly 50-Al samples containing 10 pmol
of 80 S ribosomes, 5 Al of S-100, 0.5 mg/ml tRNA, 0.3 mg/
ml polyuridylic acid, 40 AM [3H]phenylalanine (120 cpm/
pmol), 0.5 mM GTP, 1 mM ATP, 2 mM phosphocreatine,
and 40 Ag/ml creatine phosphokinase in 50 mM Tris –HCl,
pH 7.6, 15 mM MgCl2, 90 mM KCl, 5 mM h-mercaptoethanol. After incubation at 30 -C for 30 min, samples were
precipitated with 10% trichloroacetic acid, boiled for 10
min, and filtered through glass fiber filters. Radioactivity
incorporated in blanks lacking ribosomes was subtracted
from all samples. In assays to test the relative activity of
ribosomes from different transformants, the same S-100
fraction from wild-type strain W303 was used.
2.4. Cell fractionation and ribosome preparation
2.7. In vivo sordarin resistance assay
Yeast cells were grown exponentially in rich YEP
medium up to A 600 = 1 and cells were collected by
centrifugation and washed with buffer 1 (100 mM Tris –
HCl, pH 7.4, 20 mM KCl, 12.5 mM MgCl2, 5 mM hmercaptoethanol). Cells in buffer 1 were supplemented with
protease inhibitors (0.5 Amol of phenylmethylsulfonyl
fluoride, 1.25 Ag of leupeptin, aprotinin, and pepstatin per
gram of cells), and broken with glass beads. The extract was
centrifuged in a Beckman SS-34 rotor (12,000 rpm, 15 min,
4 -C), yielding the supernatant 30 fractions, which was
centrifuged at 90,000 rpm for 30 min at 4 -C in a Beckman
TL100.3 rotor. The supernatant S100 fraction was stored at
80 -C and the crude ribosome pellet was resuspended in
buffer 2 (20 mM Tris –HCl, pH 7.4, 500 mM AcNH4, 100
mM MgCl2, 5 mM h-mercaptoethanol) and centrifuged
through a discontinuous sucrose gradient (20/40%) in buffer
2 at 90,000 rpm for 120 min at 4 -C in a TL100.3 rotor. The
The assay was carried out in 96-well plates with 105 cells
per well in 100 Al of rich medium supplemented with
different amount of sordarin derivative GM193663 (a gift of
Glaxo-Smith-Kline Research Center, Tres Cantos, Madrid).
Ten serial dilutions of the antibiotic were done starting with
the concentration of 5 Ag/well. After 48 h incubation at 30 -C
the A 600 was measured and the IC50 (minimal concentration
of compound that inhibits 50% of growth) was calculated.
3. Results
3.1. Complementation of the conditional P0 null phenotype
by orthologous proteins at 30- and 37 -C
Both the S. cerevisiae W303dGP0 and D67dGP0 strains
carry the essential RPP0 gene under the control of the
12
K. Aruna et al. / Gene 357 (2005) 9 – 17
for their growth on glucose under normal as well as
different stress conditions (Fig 1 and Table 1). W303dGP0
cells transformed with pFL37 containing the RPP0 gene of
each of these sources were able to grow at 30 -C on
glucose plates (Fig. 1A). Therefore, like ScP0, AfP0 and
HsP0, the PfP0 gene could rescue the null-phenotype. The
RPP0 genes from each of these sources could rescue
W303dGP0 under most of the stress conditions, but the
rescue by PfP0 at high temperature as well as high salt
concentration was weaker (Table 1).
In the case of D67dGP0 strain, only ScP0 and PfP0
genes could rescue the inability to grow in glucose
containing media, showing that unlike HsP0 and AfP0,
PfP0 gene could rescue growth even in the absence of P1
proteins (Fig. 1B). However, PfP0 gene could not rescue
growth under high temperature, salt or osmolar stress. Even
the native ScP0 protein, could not support growth at 37 -C
in the absence of ScP1 protein.
GAL1 promoter and are viable only when grown in
galactose as a carbon source. In addition, the strain
D67dGP0 is a mutant in which both the P1a/P1h have
been disrupted and the ribosomes are totally depleted from
acidic proteins (Remacha et al., 1992). These strains were
transformed with the plasmid pFL37-PfP0, which contained the entire coding sequence of the PfP0 gene from
Plasmodium falciparum under the control of the 5V
regulatory region of the yeast RPP0 gene to assure the
same level of expression. For comparison, these strains
were also transformed with the plasmids pFL37-ScP0,
pFL37-AfP0 and pFL37-HsP0 carrying the coding
sequence of the RPP0 genes from S. cerevisiae, Aspergillus fumigatus and Homo sapiens, respectively. These
transformed strains were then analyzed for their ability to
grow on glucose. Since there is a residual amount of ScP0
remaining from the growth under galactose, the cells were
grown for at least two generations before they were scored
A
B
Control
W303dGP0
Control
ScP0
D67dGP0
PfP0
AfP0
HsP0
30°°C
+NaCl
+Sorbitol
+Sorbitol
PfP0
AfP0
HsP0
37
37°C
+NaCl
ScP0
30°C
37
37°C
+NaCl
+NaCl
+Sorbitol
+Sorbitol
Fig. 1. Growth of S. cerevisiae W303dGP0 cells (A) and D67dGP0 (B) transformed with plasmid pFL37 carrying various P0 genes on minimal medium
containing different osmotic conditions (0.3 M NaCl and 0.8 M sorbitol) at 30- and 37 -C. Hs—Homo sapiens; Af—Aspergillus fumigatus; Pf—Plasmodium
falciparum; Sc—Saccharomyces cerevisiae; Control: W303dGP0 (A); D67dGP0 (B) cells.
K. Aruna et al. / Gene 357 (2005) 9 – 17
Table 1
Growth of strain W303dGP0 and D67dGP0 with different RPP0 genes
Strain
Minimal medium
+0.3 M NaCl
+0.8 M Sorbitol
30 -C
37 -C
30 -C
37 -C
30 -C
37 -C
++++
++
++
+++
++
+
–
–
+++
+
+
++
–
–
–
–
++++
+
+++
+++
++
–
–
–
+++
+
++
+++
–
–
–
–
++++
++
+++
+++
++
–
–
–
+++
+
+
++
–
–
–
–
3.2. Growth curve and expression of PfP0 protein in yeast
strains
Figs. 2A and B show the growth profile for W303dGP0
strain containing various P0 genes from different sources
at 30- and 37 -C, respectively. All orthologous genes
conferred slower growth rates, and the doubling times for
cells containing ScP0, PfP0, AfP0 and HsP0 genes at 30
-C were 95, 140, 133 and 170 min, respectively (Fig.
3C). The doubling times for cells containing ScP0, AfP0
10
Log A600
30ºC
1
ScP0
AfP0
0.1
PfP0
HsP0
0.01
0
3
6
9
12
15
18
21
24
27
Time(hrs.)
Log A600
B
S
W
P
S
W
S
P
S
P
RPP0 Growth on His glucose minimal medium
W303dGP0 ScP0
PfP0
HsP0
AfP0
D67dGP0 ScP0
PfP0
HsP0
AfP0
A
P
13
10
37ºC
1
ScP0
AfP0
0.1
PfP0
HsP0
0.01
0
3
6
9
12
15
18
21
24
27
Time(hrs.)
C
W303dGP0 Doubling time(mins.)
Temperature
ScP0
PfP0
HsP0
AfP0
30º C
95
140
170
133
37º C
106
372
267
255
Fig. 2. Growth curves of S. cerevisiae W303dGP0 cells carrying various P0
genes on minimal medium at A) 30 -C and B) 37 -C. C) Table shows the
doubling times of these cells at 30 -C and 37 -C. Hs—Homo sapiens; Af—
Aspergillus fumigatus; Pf—Plasmodium falciparum; Sc—Saccharomyces
cerevisiae.
A
B
C
D
Fig. 3. Immunoblots of total protein extracts from yeast cells resolved on
10% SDS-PAGE, probed with A and C) anti-PfP0 monoclonal antibodies;
B and D) anti-ScP0 polyclonal rabbit antisera. About 100 Ag of total protein
from W303dGP0 cells (Panels A and B) and about 10 Ag of total protein
D67dGP0 cells (Panels C and D) transformed with plasmid pFL37
containing PfP0 gene: Lane P; and ScP0 gene: Lane S; were used for
the immunoblot. Lane W: 100 Ag of total protein from wild type yeast
EG303. The 34 kDa and 38 kDa ScP0 and PfP0 are shown with arrow and
arrowhead, respectively.
and HsP0 genes were similar to the values reported
earlier (Rodriguez-Gabriel et al., 2000) and comparable
to those containing PfP0 gene. However, at 37 -C the
doubling time of cells containing PfP0 gene is 370 min,
considerably higher than 255 –265 min for cells with
AfP0 and HsP0 genes (Fig. 2C). Cells with ScP0 genes
doubled at 105 min at 37 -C. The D67dGP0 strain
containing PfP0 grew very slowly with a doubling time
of > 540 min, as opposed to 180 –200 min of D67dGP0
with ScP0 (data not shown). It was also observed that
freshly after transformation, W303dGP0 cells containing
PfP0 showed long lag periods of about 4 to 6 h in liquid
cultures, and we postulate that the lag-period as well as
slower growth may be partly due to the differential
codon usage in yeast and Plasmodium (Vinkenoog et al.,
1998).
In order to assess that the complementation was due to
PfP0 protein, and not due to the reversion of ScP0 protein
production, immunoblots were probed with antibodies
specific for these P0 proteins (Fig. 3). PfP0 and ScP0
proteins are 38 and 34 kDa in size respectively, and were
exclusively detected in protein extracts from cells containing the respective RPP0 genes. No reversion was detected
in W303dGP0 strain containing PfP0 gene even after
several generations in liquid culture. However, upon
continuous culturing of D67dGP0 strain containing PfP0
gene in liquid glucose medium, reversion to shorter
doubling time concomitant with expression of ScP0 protein
was observed frequently. Clearly the rescue afforded by
PfP0 gene in the absence of ScP1 is inefficient, resulting
in a stress to produce ScP0 protein. It is a conjecture that
14
K. Aruna et al. / Gene 357 (2005) 9 – 17
W303ScP0
A
W303PfP0
B
Polymerizing activity of ribosomes
containing different P0 proteins
Ribosomes from
% of control
W303dGP0/ScP0
100
W303dGP0/PfP0
41.5
D67dGP0/ScP0
44.2
D67dGP0/PfP0
42.0
Fig. 4. A: Table showing polymerizing activity of ribosomes derived from S. cerevisiae carrying PfP0 or ScP0 proteins. B: Western blot probed with antiScP1h monoclonal antibodies. Lanes contain ribosomes extracted from W303dGP0 cells transformed with ScP0 and PfP0 genes respectively. Arrow shows the
12 kDa ScP1h protein.
the GAL1 promoter undergoes mutation(s) under such
stress and becomes leaky.
3.3. Effect of PfP0 on yeast ribosome activity, composition
and sensitivity to sordarin
The polymerizing activities of ribosomes from the
W303dGP0 and D67dGP0 strains containing PfP0 gene
were found to be comparable, around 40 – 45% of the
W303dGP0 strain with ScP0; this value is also similar to the
activity of ribosomes from control D67dGP0 expressing the
endogenous ScP0 (Fig. 4A). It has been demonstrated
earlier that P0 interacts primarily with P1 proteins (Lalioti et
al., 2002). In order to test whether P1 protein is bound to the
ribosome stalk in W303dGP0 strain containing PfP0, an
immunoblot of purified ribosomes were probed with antibody specific for ScP1h protein, and it was observed that it
did not bind to yeast ribosomes containing PfP0 protein
(Fig. 4B).
The lack of interaction between PfP0 and ScP1 proteins
was independently confirmed with yeast two-hybrid assay
using P0 as the bait fusion, and ScP1 as the trap fusion
partner. Earlier in vitro studies in yeast have established that
it is ScP1a which interacts with maximum efficiency with
ScP0 protein (Zurdo et al., 2000), and therefore ScP1a was
used as the trap fusion partner. When the cells were
ScP0
subjected to selection conditions, the cells containing the
control ScP0 protein as the bait fusion protein grew as Leu+,
establishing interaction of ScP0 with ScP1a (Fig. 5). hgalactosidase activity of cells with ScP0 and ScP1a was
measured as 417 Miller units (Miller, 1972), indicating
interaction between ScP0 and ScP1a. However, the PfP0
bait-fusion protein did not grow under these selection
conditions, demonstrating an absence of interaction with
ScP1a (Fig. 5B).
Protein P0 plays an important role in determining the cell
susceptibility to antifungal sordarin derivatives (GomezLorenzo and Garcia-Bustos, 1998; Justice et al., 1999). It
PfP0
A
B
Fig. 5. Yeast 2-hybrid interaction of P0 with ScP1 protein. Growth of yeast
reporter strain EGY48 (pSH18-34) transformed with ScP0 or PfP0 in
pEG202 vector on A) U H T Glucose medium and B) U H T
L Gal/raf medium containing ScP1a in pJG4-5 vector.
Fig. 6. Inhibition of cell growth by sordarin derivative GM193663.
Increasing concentrations of antibiotic were added to cells from S.
cerevisiae W303dGP0/ScP0 (g), W303dGP0/PfP0 (q) and W303dGP0/
AfP0 (>) growing in glucose rich medium as indicated in Section 2. 100%
corresponds to the A 600 of sample growing in the absence of drug.
K. Aruna et al. / Gene 357 (2005) 9 – 17
has been shown that expression in S. cerevisiae of P0
protein from A. fumigatus, a sordarin resistant organism,
increases the resistance of yeast to the antifungal (Santos
and Ballesta, 2002). The effect of PfP0 on susceptibility of
strain W303dGP0-PfP0 to sordarin was tested and PfP0 was
found to be comparable to AfP0 in its resistance to sordarin
(Fig. 6). The IC50 for strain W303dGP0 expressing ScP0,
PfP0 or AfP0 was found to 0.03 AM, 0.8 AM and 0.96 AM
respectively. Thus > 25-fold increase in resistance was
observed in cells containing either PfP0 or AfP0.
4. Discussion
Amongst all the orthologous genes tested for complementation earlier, the RPP0 genes from mammalian
organisms such as H. sapiens and Rattus norvegicus,
cellular slime mold D. discoideum and the fungus A.
fumigatus complemented the conditional null-phenotype
for growth on glucose, but that from protozoan parasite L.
infantum did not (Rodriguez-Gabriel et al., 2000). Homology mapping has indicated PfP0 gene to be more closely
related to yeast and mammalian genes, as compared to the
kinetoplastid protozoan Leishmania and Trypanosoma
genes (Goswami et al., 1996). The complementation results
confirm that PfP0 protein is functionally closer to yeast P0
protein, as compared to the kinetoplastid protozoan P0
protein. The results presented in this paper also show that in
the absence of stress conditions, PfP0 gene allows for
growth of cells comparable to the other orthologous RPP0
genes listed above. However, under stress conditions the
15
PfP0 gene performs comparatively poorly. Unlike these
orthologous RPP0 genes, PfP0 gene could support the
growth of yeast cells in the absence of ScP1 proteins.
One of the major differences between other P0 and PfP0
proteins lies in the absence of interactions between PfP0 and
ScP1 proteins. This would imply that the ribosomal stalks of
both W303dGP0 and D67dGP0 cells containing PfP0
protein would be devoid of both P1 and P2 proteins, since
the yeast P2 proteins bind to P0 protein only through the P1
proteins (Zurdo et al., 2000). The comparable polymerizing
activities of ribosomes from the W303dGP0 and D67dGP0
strains containing PfP0 gene are therefore not unexpected.
On the basis of extensive analysis on the interaction sites, a
putative leucine zipper site on ScP0 has been predicted to
bind the ScP1 proteins (Lalioti et al., 2002). This leucine
zipper site is entirely missing in PfP0 gene as compared to
the other orthologous P0 genes (Fig. 7). This difference may
explain the lack of binding of ScP1 proteins with PfP0. Like
the PfP0 gene, the P0 genes from the insects Ceratitis
capitata and Bombyx mori have been reported to complement D67dGP0 strain. However, the putative leucine zipper
is present in all the insect P0 proteins, and insect P0 proteins
do bind to the acidic proteins (Gagou et al., 2000; Kouyanou
et al., 2003). The genome database for P. falciparum
predicts putative single genes for orthologous PfP1 and
PfP2 acidic proteins. PfP2 gene has been cloned and the
gene expression has been reported (Fidock et al., 1998).
However, no information exists regarding the properties of
these P. falciparum acidic P-proteins.
P1/P2 proteins distinctly play a role in the ribosomal
efficiency in yeast, since a drop of about 50 –60% of
Fig. 7. The clustal box shade alignment of P0 of different organisms BmP0: Bombyx mori P0, HsP0: Homo sapiens P0, ScP0: Saccharomyces cerevisiae P0,
AfP0: Aspergillus fumigatus, PfP0: Plasmodium falciparum P0. The putative leucine zipper region is marked, with * showing the leucine residues in ScP0. The
amino acids implicated in sordarin resistance at positions 117, 122 and 124 in ScP0 are marked with +.
16
K. Aruna et al. / Gene 357 (2005) 9 – 17
polymerizing activity is observed in the absence of P1
protein. The presence of ScP1 proteins also appears to be
vital under several stress conditions. Although P-proteins
play a structural role in the composition of the yeast 60S
ribosomal subunit, heterogeneity of ribosomal composition
has been observed. Ribosomes from stationary phase are
deficient in P1/P2 proteins, as compared to ribosomes from
exponential phase of growth (Saenz-Robles et al., 1990).
The pattern of protein expression in the absence of P1 and
P2 proteins is distinct from that in the presence of these
acidic proteins (Remacha et al., 1995). It was documented
that the distinct pattern of expression was not due to
translation error or termination suppression, but was
postulated to be due to differential translation modulation,
or/and due to extra-ribosomal properties of these acidic
proteins (Remacha et al., 1995). Recently the ribosomal
protein L13a was shown to bind to the 3V-UTR of
ceruloplasmin, a protein involved in the inflammatory
response of human monocytes, and inhibit its translation
(Mazumder et al., 2003). A regulatory role of ribosomes,
through differential binding of selective mRNAs to ribosomes, has been postulated to play an important part in
translational control (Ballesta and Remacha, 1996; Mauro
and Edelman, 2002). The level of P1 protein also appears to
be regulated, since P1 has been detected as a fusion protein
with ubiquitin in the chlorarachniophyte algae (Archibald et
al., 2003).
Resistance to the antifungal sordarin has been mapped
earlier to the P0 domain associated with elongation factor
binding site. Sordarin resistant strains showed point
mutations clustered in the region around 130– 147 amino
acid position of the P0 protein (Gomez-Lorenzo and
Garcia-Bustos, 1998; Justice et al., 1999). The sordarin
resistance of W303dGP0 strain carrying the orthologous A.
fumigatus P0 (AfP0) protein, has been shown earlier to be
several fold higher than that of W303dGP0-ScP0 (Santos
and Ballesta, 2002). Amino acids 130 –147 were found to
be identical between AfP0 and ScP0, and by this new
analysis three point mutations at the positions E117A,
R122P and V124G were demonstrated to be responsible
for the sordarin resistance. PfP0 is very similar to AfP0
protein in these three positions. The charged glutamic acid
residue is replaced with isoleucine at 117 position, while
the residues 122 and 124 are proline and glycine, same as
in AfP0 (Fig. 7). Thus the higher resistance of
W303dGP0-PfP0 to sordarin is consistent with the changes
in this conserved domain, implicated in translation
elongation.
Amongst protozoans, Plasmodium is an Apicomplexan
parasite, whereas Leishmania is a kinetoplastid, and their
evolutionary distance has been postulated recently based on
the currently available genome information (Aravind et al.,
2003). The protozoans have a wide spread, and it is apparent
from the genomic data that the kinetoplastids are quite
separated from Apicomplexans. In several metabolic pathways, Plasmodium appears to be similar to the free-living
yeasts (Aravind et al., 2003). It possesses a yeast-like
mRNA capping apparatus, structurally and mechanistically
unrelated to that found in metazoans and plants (Ho and
Shuman, 2001). The complementation capability of PfP0
gene in S. cerevisiae, and its similarity in the sordarin
resistance properties with A. fumigatus, further strengthens
the evolutionary linkage of Plasmodium to fungi. Although
it has now become possible to carry out genetic manipulations in P. falciparum, disruption of vital genes continue to
be difficult to manipulate. The functional complementation
of ScP0 with PfP0 protein, as well as the closeness of
Apicomplexans to fungi, makes it possible to use S.
cerevisiae as a genetic system to dissect out some of the
multiple functions of PfP0 protein.
Acknowledgements
We are indebted to K. Rajeshwari for the monoclonal
antibodies used in this study. This work was supported by
funds obtained from Indian Council of Medical Research
and by Grants BMC2003-03387 and GEN2001-4707-C-0805 from the Ministerio de Ciencia y Technologia (Spain),
European Commission grant QLRT-2001-00892, and by an
institutional grant from the Fundacion Ramon Areces
(Madrid).
References
Adams, A., Gottschling, D.E., Kaiser, C.A., Sterns, T., 1997. Methods in
Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY, pp. 115 – 116.
Aravind, L., Iyer, L.M., Wellems, T.E., Miller, L.H., 2003. Plasmodium
biology: genomic gleanings. Cell 115, 771 – 785.
Archibald, J.M., Teh, E.M., Keeling, P.J., 2003. Novel ubiquitin fusion
proteins: ribosomal protein P1 and actin. J. Mol. Biol. 328, 771 – 778.
Ballesta, J.P., Remacha, M., 1996. The large ribosomal subunit stalk as a
regulatory element of the eukaryotic translational machinery. Prog.
Nucleic Acid Res. Mol. Biol. 55, 157 – 193.
Fidock, D.A., Nguyen, T.V., Dodemont, H.J., Eling, W.M., James, A.A.,
1998. Plasmodium falciparum: ribosomal P2 protein gene expression is
independent of the developmentally regulated rRNAs. Exp. Parasitol.
89, 125 – 128.
Gagou, M.E., Rodriguez-Gabriel, M.A., Ballesta, J.P., Kouyanou, S., 2000.
The ribosomal P-proteins of the medfly Ceratitis capitata form a
heterogeneous stalk structure interacting with the endogenous Pproteins, in conditional P0-null strains of the yeast Saccharomyces
cerevisiae. Nucleic Acids Res 28, 736 – 743.
Gomez-Lorenzo, M.G., Garcia-Bustos, J.F., 1998. Ribosomal P-protein
stalk function is targeted by sordarin antifungals. J. Biol. Chem. 273,
25041 – 25044.
Goswami, A., Chatterjee, S., Sharma, S., 1996. Cloning of a ribosomal
phosphoprotein P0 gene homologue from Plasmodium falciparum.
Mol. Biochem. Parasitol. 82, 117 – 120.
Gyuris, G.J., Golemis, E., Chertkov, H., Brent, R., 1993. Cdi1, a human G1
and S phase protein phosphatase that associates with Cdk2. Cell 75,
791 – 803.
Ho, C.K., Shuman, S., 2001. A yeast-like mRNA capping apparatus
in Plasmodium falciparum. Proc. Natl. Acad. Sci. U. S. A. 98,
3050 – 3055.
K. Aruna et al. / Gene 357 (2005) 9 – 17
Justice, M.C., Ku, T., Hsu, M.J., Carniol, K., Schmatz, D., Nielsen, J.,
1999. Mutations in ribosomal L10e confer resistance to the fungalspecific eukaryotic elongation factor 2 inhibitor sordarin. J. Biol.
Chem. 274, 4869 – 4875.
Kouyanou, S., Santos, C., Koliaraki, V., Ballesta, J.P.G., 2003. Protein
BmP0 from the silkworm Bombyx mori can be assembled and is
functional in the Saccharomyces cerevisiae ribosomal stalk in the
absence of the acidic P1 and P2 proteins. Gene 314, 173 – 179.
Lalioti, V.S., Perez-Fernandez, J., Remacha, M., Ballesta, J.P.G., 2002.
Characterization of interaction sites in the Saccharomyces cerevisiae
ribosomal stalk components. Mol. Microbiol. 46, 719 – 729.
Liljas, A., Thirup, S., Matheson, A.T., 1986. Evolutionary aspects of
ribosome-factor interactions. Chem. Scr. 26B, 109 – 119.
Mauro, V.P., Edelman, G.M., 2002. The ribosome filter hypothesis. Proc.
Natl. Acad. Sci. U. S. A. 99, 12031 – 12036.
Mazumder, B., Sampath, P., Seshadri, V., Maitra, R.K., DiCorleto, P.E.,
Fox, P.L., 2003. Regulated release of L13a from the 60S ribosomal
subunit as a mechanism of transcript-specific translational control. Cell
115, 187 – 198.
Miller, J.H., 1972. Experiments in Molecular Genetics. Cold Spring Harbor
Laboratory Press, New York.
Rajeshwari, K., et al., 2004. The P-domain of the P0 protein of Plasmodium
falciparum protects against challenge with malaria parasites. Infect.
Immun. 72, 5515 – 5521.
Remacha, M., Santos, C., Bermejo, B., Naranda, T., Ballesta, J.P.G., 1992.
Stable binding of the eukaryotic acidic phosphoproteins to the ribosome
is not an absolute requirement for in vivo protein synthesis. J. Biol.
Chem. 267, 12061 – 12067.
Remacha, M., Jimenez-Diaz, A., Bermejo, B., Rodriguez-Gabriel, M.A.,
Guarinos, E., Ballesta, J.P.G., 1995. Ribosomal acidic phosphoproteins
P1 and P2 are not required for cell viability but regulate the pattern of
17
protein expression in Saccharomyces cerevisiae. Methods Cell Biol. 15,
4754 – 4762.
Rodriguez-Gabriel, M.A., Remacha, M., Ballesta, J.P.G., 2000. The
RNA-interacting domain but not the protein interacting domain is
highly conserved in ribosomal protein P0. J. Biol. Chem. 275,
2130 – 2136.
Saenz-Robles, M.T., Remacha, M., Vilella, M.D., Zinker, S., Ballesta,
J.P.G., 1990. The acidic ribosomal proteins as regulators of the
eukaryotic ribosomal activity. Biochim. Biophys. Acta 1050, 51 – 55.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: a
laboratory manual, 2nd edR Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
Santos, C., Ballesta, J.P.G., 1994. Ribosomal protein P0, contrary to
phosphoproteins P1 and P2, is required for ribosome activity and
Saccharomyces cerevisiae viability. J. Biol. Chem. 269, 15689 – 15696.
Santos, C., Ballesta, J.P.G., 1995. The highly conserved protein P0 carboxyl
end is essential for ribosome activity only in the absence of proteins P1
and P2. J. Biol. Chem. 270, 20608 – 20614.
Santos, C., Ballesta, J.P., 2002. Role of the ribosomal stalk components in
the resistance of Aspergillus fumigatus to the sordarin antifungals. Mol.
Microbiol. 43, 227 – 237.
Uchiumi, T., Wahba, A.J., Traut, R.R., 1987. Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia
salina as determined by cross-linking. Proc. Natl. Acad. Sci. U. S. A.
84, 5580 – 5584.
Vinkenoog, R., et al., 1998. Malaria parasites contain two identical
copies of an elongation factor 1 alpha gene. Mol. Biochem. Parasitol.
94, 1 – 12.
Zurdo, J., et al., 2000. Assembly of Saccharomyces cerevisiae ribosomal
stalk, binding of P1 proteins is required for the interaction of P2
proteins. Biochemistry 39, 8929 – 8934.