ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2009, p. 563–571
0066-4804/09/$08.00⫹0 doi:10.1128/AAC.00870-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Vol. 53, No. 2
Erythromycin- and Chloramphenicol-Induced Ribosomal Assembly
Defects Are Secondary Effects of Protein Synthesis Inhibition䌤
Triinu Siibak,1,2 Lauri Peil,1† Liqun Xiong,3 Alexander Mankin,3 Jaanus Remme,1 and Tanel Tenson2*
Institute of Molecular and Cell Biology, University of Tartu, Riia 23,1 and Institute of Technology, University of Tartu, Nooruse 1,2
Tartu, Estonia, and Center for Pharmaceutical Biotechnology, University of Illinois at Chicago, 900 S. Ashland Ave.,
Chicago, Illinois 606073
Received 1 July 2008/Returned for modification 26 August 2008/Accepted 13 November 2008
To investigate the mechanism by which ribosome assembly is
inhibited, we chose two inhibitors of the 50S subunit, erythromycin and chloramphenicol, and carried out experiments designed to differentiate between the two alternative hypotheses:
(i) direct inhibition due to the binding of antibiotics to the
precursor particles and (ii) indirect inhibition, when an imbalance in the production of components disturbs ribosome assembly. Our results appear to be more compatible with the
latter model.
The ribosome is a target for many medically important antibiotics (42, 56, 63). These drugs bind to either the small or the
large subunit and inhibit essential ribosome functions: decoding, peptidyl transfer, transit of the nascent peptide chain, or
activation of ribosome-associated GTPases. In addition, antibiotics cause many physiological changes; for example, they
induce stress response pathways and alter gene expression
patterns in other ways (23, 25, 45, 60).
One of the known ”side effects” of ribosome-targeting antibiotics is inhibition of ribosome assembly. This effect was originally described for chloramphenicol: defective particles sedimenting more slowly than mature ribosomal subunits were
observed in cells treated with this drug (19, 29). Such particles
contain precursor forms of rRNA and an incomplete set of
ribosomal proteins (1, 53). During chloramphenicol treatment,
ribosomal proteins are produced in nonstoichiometric
amounts (20). In addition, the equilibrium between the production of rRNA and ribosomal proteins is upset, and rRNA is
expressed in excess (30, 37, 49). It has been proposed that this
unbalanced synthesis of components is responsible for the
chloramphenicol-induced defects in ribosomal assembly (21).
More recently, Champney and colleagues suggested that
several other inhibitors of protein synthesis stall the assembly
of ribosomal subunits by binding to the respective precursor
particles. The drugs proposed to have such an effect included
macrolides and ketolides (10, 11, 15, 35, 59), streptogramin B
(16), lincosamides (16), aminoglycosides (36), evernimicin
(14), linezolid (12), and pleuromutilins (13). However, the
indirect mechanism of assembly inhibition cannot be excluded
for any of these drugs.
MATERIALS AND METHODS
Strains. Strain MG1655 (6) was used in all experiments involving Escherichia
coli. Clinical Staphylococcus aureus strains carrying mutations in chromosomal
copies of rRNA operons (43) were generously provided by Roland Leclercq. The
strains were UCN14 (carrying an A2058T mutation in four out of five rrl alleles),
UCN17 (with A2058G in four out of six rrl alleles), and UCN18 (with A2059G
in three out of five rrl alleles). The MIC for erythromycin in all three strains was
512 to 1,024 ␮g/ml, as determined in 96-well plates by the microbroth dilution
procedure (3).
Analysis of E. coli ribosomes. Cells were grown at either 25 or 37°C in 200 ml
2⫻ YT medium (46) until the A600 reached 0.2. At this point, either erythromycin
(final concentration, 100 ␮g/ml) or chloramphenicol (final concentration, 7 ␮g/
ml) was added; no antibiotic was added to the control culture. The cultures were
then incubated for a further 2 h or 1 h at 25 or 37°C, respectively. The cells were
collected by centrifugation in a Sorvall GS-3 rotor at 4,000 rpm and 4°C for 10
min and were resuspended in 1 ml lysis buffer (60 mM KCl, 60 mM NH4Cl, 50
mM Tris-HCl [pH 8], 6 mM MgCl2, 6 mM ␤-mercaptoethanol, 16% sucrose);
lysozyme and DNase I (Amresco, GE Healthcare) were added to final concentrations of 1 mg/ml and 20 U/ml, respectively. The cells were incubated for 15
min at ⫺70°C and then thawed in ice-cold water for 30 min. The freeze-thaw
cycle was repeated twice, followed by centrifugation at 13,000 ⫻ g and 4°C for 20
min. The supernatant was diluted twofold with buffer D (60 mM KCl, 60 mM
NH4Cl, 10 mM Tris-HCl [pH 8], 12 mM MgCl2, 6 mM ␤-mercaptoethanol).
Lysate (2 ml) was first loaded onto a 30-ml, 10 to 25% (wt/wt) sucrose gradient
prepared in buffer D and then centrifuged at 23,000 rpm in an SW28 rotor
(Beckman) at 4°C for 13.5 h.
Analysis of E. coli rRNA. RNA was precipitated from the sucrose gradient
fractions with 0.7 volume of isopropanol. The precipitate was dissolved in 200 ␮l
buffer D, and 1 ml 5 M guanidinium thiocyanate–4% Triton X-100 was added,
followed by vortexing for 20 min at room temperature. An SiO2 suspension (25
␮l, 50%) in distilled water (7) was added, followed by shaking for 10 min at room
temperature. The silica was precipitated by centrifugation at 3,000 ⫻ g for 1 min.
* Corresponding author. Mailing address: Institute of Technology,
University of Tartu, Nooruse 1, Tartu 50411, Estonia. Phone: 372 7374
844. Fax: 372 7374 900. E-mail: [email protected].
† Present address: Institute of Technology, University of Tartu,
Nooruse 1, Tartu, Estonia.
䌤
Published ahead of print on 24 November 2008.
563
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
Several protein synthesis inhibitors are known to inhibit ribosome assembly. This may be a consequence of
direct binding of the antibiotic to ribosome precursor particles, or it could result indirectly from loss of
coordination in the production of ribosomal components due to the inhibition of protein synthesis. Here we
demonstrate that erythromycin and chloramphenicol, inhibitors of the large ribosomal subunit, affect the
assembly of both the large and small subunits. Expression of a small erythromycin resistance peptide acting
in cis on mature ribosomes relieves the erythromycin-mediated assembly defect for both subunits. Erythromycin treatment of bacteria expressing a mixture of erythromycin-sensitive and -resistant ribosomes produced
comparable effects on subunit assembly. These results argue in favor of the view that erythromycin and
chloramphenicol affect the assembly of the large ribosomal subunit indirectly.
564
SIIBAK ET AL.
mM EDTA, 0.5% SDS), and extracted with phenol, phenol-chloroform, and
chloroform. Sodium acetate was added to 0.3 M. The RNA was ethanol precipitated and resuspended in 15 ␮l water.
Primer extension analysis was carried out as described previously (5) using
primer SaL2060 (GTAAAGCTCCACGGGGTC) and either 1.5 ␮l (from the
50S peak fractions) or 2.5 ␮l (from the 30S peak fractions) of RNA solution. The
reaction products were resuspended in 8 ␮l formamide with loading dyes, and
1-␮l samples were run on a 12% denaturing polyacrylamide gel. The gel was
dried and exposed to a PhosphorImager screen (Molecular Dynamics). Images
on the screen were scanned and analyzed using ImageQuant software.
RESULTS
Inhibition of ribosome assembly by erythromycin and chloramphenicol. As a starting point, we tested the previously described effects of chloramphenicol and erythromycin by analyzing the ribosomes obtained from antibiotic-treated cells by
sucrose gradient centrifugation. The drugs were used at concentrations causing similar levels of growth inhibition (after 8 h
of growth, the optical density of the culture fell to 70% of that
of the untreated control). Particles with sedimentation characteristics different from those of mature subunits accumulated
in response to treatment with either of the antibiotics (Fig. 1).
These more slowly sedimenting particles indicate ribosomal
assembly defects. We reproducibly observed that the defective
particles accumulating in response to erythromycin sedimented
notably differently from those accumulating in response to
chloramphenicol (compare Fig. 1c and e). Ribosomal assembly
defects are usually more pronounced at lower growth temperatures (18, 26, 44), so we tested the effects of chloramphenicol
and erythromycin at 25°C as well as at 37°C. Antibiotic-induced accumulation of several different assembly-defective
particles occurred at both growth temperatures; as expected,
the more slowly sedimenting particles accumulated in greater
amounts at the lower temperature (Fig. 1).
With both antibiotics, we observed an accumulation of particles sedimenting more slowly than 30S. To verify the nature
of these particles, we isolated RNA from the sucrose gradient
fractions and hybridized it with 16S rRNA- or 23S rRNAspecific probes. As expected, 16S RNA was found in the 30S
and 70S ribosomes, and 23S RNA was found in the 50S and
70S fractions, in untreated cells (Fig. 1). For cells treated with
either of the antibiotics, 23S rRNA was found in the 70S and
50S fractions and also in particles sedimenting at 40S (Fig. 1),
consistent with the idea that large ribosomal subunit assembly
is inhibited. Particles sedimenting more slowly than 30S after
treatment with both erythromycin and chloramphenicol contained 16S RNA (Fig. 1). This shows that in addition to the
inhibition of large subunit assembly, both drugs cause defects
in the biosynthesis of small subunits. This observation revealed
that antibiotics that target the large ribosomal subunit exclusively in fact impede the assembly of both the 50S and 30S
subunits.
Effects of the antibiotics on rRNA maturation. During the
assembly of ribosomal subunits, pre-rRNA associates with proteins and undergoes several cleavage events and nucleotide
modifications (28, 51, 62). rRNA processing depends on ribosome assembly (51). It is therefore expected that general inhibition of assembly will cause defects in rRNA processing. We
characterized the state of 5⬘ end processing of 16S and 23S
RNA in the antibiotic-induced assembly-defective particles.
During the assembly of the large subunit, RNase III cleaves
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
The precipitate was washed with 1 ml 5 M guanidinium thiocyanate, followed by
a wash with 1 ml 50% ethanol. The RNA was eluted by incubating the silica in
water for 5 min at 55°C. Centrifugation was used to precipitate the silica during
the washing and elution steps. Samples were stored at ⫺20°C.
Reverse transcription from primers GTTTGGGGTACGATTTGATG and
GCCAGCGTTCAATCTGAG was used to map the 5⬘ ends of 23S and 16S
rRNA, respectively (31, 32).
For dot blot analysis, purified RNA was denatured by addition of formamide
(20 ␮l), formaldehyde (6 ␮l), and 4 ␮l of buffer DB (0.2 M morpholinepropanesulfonic acid [MOPS; pH 7], 20 mM sodium acetate, 10 mM EDTA [pH 8]),
followed by incubation at 65°C for 5 min. The samples were cooled on ice, and
an equal volume of 20⫻ SSC (3 M NaCl plus 0.3 M sodium acetate) was added.
For every gradient profile, 0.2 pmol of 23S RNA from the 50S fraction was used
per sample. Equal volumes from the other gradient fractions were used to
prepare the RNA for dot blotting. Samples were applied to a Hybond N⫹
(Amersham) membrane using a vacuum blotter, followed by UV cross-linking.
The oligonucleotides used for primer extension (see above) were 5⬘ end-labeled
with 32P and used for hybridization. Prehybridization was performed for 4 h at
50°C in 6⫻ SSC, 5⫻ Denhardt’s solution, 0.5% (wt/vol) sodium dodecyl sulfate
(SDS), and 100 ␮g/ml salmon sperm DNA (46). Labeled probes were added,
followed by hybridization for 12 h at 50°C. The filters were washed at 50°C for 5
min in 2⫻ SSC–0.1% SDS (wt/vol) and for 10 min in 1⫻ SSC–0.1% SDS,
followed by autoradiography.
Peptide-mediated erythromycin resistance. E. coli cells containing plasmids
coding for an erythromycin resistance peptide (sequence MRLFV) (57) or a
control peptide (MNAIK) (61) were grown at 37°C in 500 ml 2⫻ YT medium
(46) until the A600 was 0.1. At this point, synthesis of the peptide was induced by
addition of isopropyl-␤-D-thiogalactopyranoside (IPTG) to a final concentration
of 1 mM. When the A600 reached 0.2, the cultures were divided into two 70-ml
aliquots. One sample received erythromycin to a final concentration of 50 ␮g/ml,
and the second was grown under the same conditions but without erythromycin.
One hour after the addition of erythromycin, the cells were collected and lysed,
and the ribosomes were analyzed as described above. No IPTG was added in the
otherwise similar control experiments.
Pulse-labeling. E. coli cells were grown at 37°C in 400 ml of tryptone (10
g/liter)–yeast extract (1 g/liter)–NaCl (10 g/liter) until the A600 reached 0.2.
Erythromycin (final concentration, 100 ␮g/ml) or chloramphenicol (final concentration, 7 ␮g/ml) was added, and the cultures were divided into 50-ml aliquots. After 5, 10, or 60 min of incubation at 37°C, 2 ␮Ci of [3H]uridine (38
Ci/mmol; GE Healthcare) per 50 ml of culture was added, followed by incubation
for 5 min at 37°C. In the experiment for which results are shown in Fig. 4a,
incorporation of the label was stopped by adding ice to the culture. The other
samples were treated by adding rifampin (rifampicin) (final concentration, 500
␮g/ml) for 5 min at 37°C, followed by ice. Cells were collected by centrifugation
and lysed, and ribosomes were analyzed by sucrose gradient centrifugation as
described above. Each sucrose gradient was fractionated into 40 fractions. Highmolecular-weight material was precipitated by adding an equal volume of 20%
trichloroacetic acid (TCA). The precipitates were collected on glass fiber filters,
and the radioactivity incorporated was measured by scintillation counting.
Preparation and analysis of S. aureus ribosomal subunits and precursors.
Cultures of S. aureus strains UCN14, UCN17, and UCN18 (43) were grown in 2
ml of tryptone soy broth (TSB) medium (4). They were diluted 100-fold into two
50-ml cultures and grown at 37°C until the A600 reached 0.1. Erythromycin was
added to one of the flasks to a final concentration of 128 ␮g/ml, and growth was
continued until the A600 reached ca. 0.6. Cells were pelleted in a Beckman JA-25
rotor (7000 rpm, 10 min, 4°C), and the pellets were washed once with 10 ml cold
buffer S (10 mM Tris-HCl [pH 7.8], 1 mM magnesium diacetate, 50 mM NH4Cl,
2 mM ␤-mercaptoethanol (10). After repelleting, the cells were resuspended in
400 ␮l buffer S. Lysostaphin (Sigma) and an RNase inhibitor (Roche) were
added to final concentrations of 50 ␮g/ml and 100 U/ml, respectively. The cell
suspension was incubated for 20 min at room temperature. Two units of RQ
DNase (Promega) were added to each sample, and after 5 min of incubation at
room temperature, the samples were spun for 10 min at 21,000 ⫻ g in a refrigerated tabletop centrifuge.
The cell lysate (A260, 10 to 20) was loaded onto a 10 to 40% sucrose gradient
prepared in buffer S. Gradients were centrifuged in a Beckman SW41 rotor at
24,500 rpm for 18 h at 4°C and were then fractionated through the UV monitor;
400-␮l fractions were collected. The optical density (A260) of the material in
individual fractions was determined using a NanoDrop spectrophotometer, and
ribosomal material was precipitated by adding sodium acetate to 0.3 M, followed
by 2 vol ethanol, and incubating at ⫺20°C overnight. The ribosomal precipitates
were collected by centrifugation for 10 min at 21,000 ⫻ g in a refrigerated
tabletop centrifuge, resuspended in 150 ␮l of buffer R (0.3 M sodium acetate, 5
ANTIMICROB. AGENTS CHEMOTHER.
VOL. 53, 2009
ANTIBIOTICS AFFECTING RIBOSOMAL ASSEMBLY
565
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
FIG. 1. Sucrose gradient profiles of ribosomes isolated from untreated (a and b), erythromycin-treated (c and d), or chloramphenicol-treated
(e and f) cells. The bacterial cultures were grown either at 37°C (a, c, and e) or at 25°C (b, d, and f). In panels c through f, solid lines represent
profiles from antibiotic-treated cells, and profiles from untreated cells (dotted lines) are added for better comparison. Dot blot analyses of 16S and
23S rRNAs isolated from the sucrose gradient fractions are shown at the bottom of each panel.
the precursor at positions ⫺3 and ⫺7 (2, 8, 50) relative to the
5⬘ end of mature 23S rRNA, while the final maturation occurs
in functional ribosomes. At 37°C, the ribosomes from untreated cells contain fully processed 23S RNA (marked in Fig.
2b as ⫹1). Only traces of longer molecules were observed in
the 50S fraction. At 25°C, processing intermediates that had
been cleaved at positions ⫺3 and ⫺7 accumulated, indicating
that processing is slower at lower growth temperatures.
Partially processed 23S RNA accumulated in the 30S, 40S,
and 50S fractions in response to antibiotic treatment. The 5⬘
end of 23S rRNA was either at position ⫺7 or position ⫺3, as
in the 50S fraction from untreated cells grown at 25°C. The fact
that neither erythromycin nor chloramphenicol treatment creates new processing intermediates suggests that assembly does
not follow alternative pathways creating dead-end products;
rather, the normal pathway is simply slowed down. On the
566
SIIBAK ET AL.
other hand, quantification of the intermediates shows that the
main intermediate in the untreated cells results from RNase
cleavage at position ⫺3, whereas the intermediate cleaved at
position ⫺7 accumulates predominantly in response to antibiotic treatment. These differences might have arisen because
the different protein contents of the particles influence the
specificity of the RNase. This interpretation is supported by
the previous observation that RNase III cleaves protein-free
pre-RNA at position ⫺7 and RNA assembled into ribosomal
subunits at position ⫺3 (2).
Similar effects were observed for 16S RNA processing. During normal 16S processing, the first cleavage is created by
RNase III at position ⫺115 (28, 51, 52). This is followed by
maturation steps creating heterogeneous 5⬘ ends. We observed
that the processing intermediate cleaved at position ⫺115 is
present in the 30S fraction isolated from untreated cells grown
at 25°C and, to a lesser extent, in cells grown at 37°C (Fig. 2).
The same intermediate accumulated in the 20S and 30S fractions from the antibiotic-treated cells, indicating that neither
erythromycin nor chloramphenicol treatment created 16S
RNA processing patterns different from those in untreated
cells but that they retarded 16S rRNA processing overall.
Expression of erythromycin resistance peptides rescues
drug-induced assembly defects. The peptide-mediated erythromycin resistance mechanism acts in cis only upon actively
translating mature ribosomes and does not influence the availability of erythromycin in the cell (33, 54). Antibiotic resistance
results from the synthesis of specific small peptides (E-peptides) that promote the dissociation of erythromycin from the
ribosomes synthesizing those peptides (33). This resistance
mechanism should allow one to distinguish between inhibition
of assembly by direct trapping of precursor particles and inhibition mediated through the general effect of the drug on
protein synthesis. If E-peptide expression reverses the erythromycin-induced assembly defects, that would argue in favor of
the indirect mechanism of inhibition.
To test the effects of the small peptides, we expressed one
E-peptide (MRLFV) and a control peptide (MNAIK) in E.
coli, and we examined ribosome assembly after erythromycin
treatment. Without erythromycin, E-peptide synthesis causes
some accumulation of precursor particles (Fig. 3). This might
indicate an inhibitory effect on the translational capacity of the
cell because of massive translation of the E-peptide minigene
present on a multicopy plasmid (33), possibly leading to reduced production of ribosomal proteins. When erythromycin
was added but the E-peptide was not expressed, incompletely
assembled subunits accumulated (Fig. 3). This inhibitory effect
of erythromycin on assembly was relieved by E-peptide expression (Fig. 3) but not by the control peptide (data not shown).
The observation that the resistance peptide can relieve assembly inhibition suggests that erythromycin inhibits ribosome synthesis through its general effect on translation rather than via
binding to assembly intermediates.
As described above, we have observed that erythromycin
and chloramphenicol cause rRNA processing defects. If Epeptide expression rescues the erythromycin-induced assembly
defect, it is also expected that the inhibition of processing will
be alleviated. We have studied the 5⬘ ends of 23S rRNA isolated from 50S fractions (indicated in Fig. 3). In the 50S fraction isolated from untreated cells, about 85% of the 23S rRNA
was fully processed at position ⫹1; if the E-peptide was expressed, 60 to 70% of the RNA was fully processed (consistent
with the small assembly defect in response to E-peptide expression); erythromycin treatment reduced the level of mature
RNA to 30 to 40%; erythromycin treatment together with
E-peptide expression led to 60 to 70% of mature 23S (data not
shown). With chloramphenicol treatment, there was about
50% mature 23S rRNA in the 50S fraction, and this percentage
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
FIG. 2. Primer extension analyses of the 5⬘ ends of 16S (a) and 23S
(b) RNAs isolated from the sucrose gradient fractions. The material
was isolated either from untreated cells (none) or from erythromycin
(Ery)- or chloramphenicol (Cam)-treated cultures grown at either 25
or 37°C. The sequencing lanes are shown on the left.
ANTIMICROB. AGENTS CHEMOTHER.
VOL. 53, 2009
did not change in response to E-peptide expression (data not
shown). These results show that E-peptide expression specifically alleviates the erythromycin-induced processing defect.
Effect of erythromycin on the assembly of erythromycinsensitive and erythromycin-resistant ribosomes in a mixed
population. If erythromycin inhibits ribosome assembly via
binding to intermediates, then the assembly of the subunits
carrying 23S rRNA with erythromycin resistance mutations
should not be affected. If cells express a mixed population of
wild-type and mutant ribosomes, direct binding of erythromycin to the intermediates is expected to slow down the assembly
of wild-type but not mutant ribosomes. On the other hand, if
inhibition of ribosome assembly results from the general effect
of the drug on protein synthesis, the assembly of both types of
ribosomes would be similarly affected. To discriminate between these scenarios, we used clinical strains of S. aureus
567
carrying erythromycin resistance mutations in several copies of
the RNA operons (43). We examined ribosome assembly in
three such strains: UCN14 (carrying an A2058T mutation in
four out of five rrl alleles), UCN17 (with A2058G in four out of
six rrl alleles), and UCN18 (with A2059G in three out of five rrl
alleles).
S. aureus cells were grown in the absence or presence of
erythromycin and then lysed, and ribosomal subunits were
analyzed in sucrose gradients (Fig. 4a). The ratio between
wild-type and mutant 23S RNA in various fractions was determined by primer extension (Fig. 4e). The results of analysis of
UCN18 (Fig. 4) reflect the general pattern observed for all
three strains tested. Since these strains are highly resistant to
erythromycin (MICs, 512 to 1,024 ␮g/ml), there was no significant accumulation of assembly-defective particles. Yet the 23S
rRNA and 5S rRNA were observed in the 30S peak from cells
grown with 128 ␮g/ml erythromycin (data not shown), indicating that some inhibition of ribosome assembly takes place. The
experimental data plots (Fig. 4d) show no significant preferential accumulation of wild-type 23S rRNA in the fraction
sedimenting more slowly than 50S. The assembly of 50S subunits carrying wild-type 23S rRNA and that of 50S subunits
carrying mutant 23S rRNA were inhibited to comparable extents. This observation suggests that erythromycin does not
inhibit assembly by binding to its site in the precursor particles.
Time course of antibiotic-induced inhibition of assembly. A
study of the kinetics of inhibition might provide additional
information about the mechanism involved. If the inhibition of
ribosome assembly is due to the lack of ribosomal proteins,
exposure to the drug would lead to the accumulation over time
of particles with gradually decreasing masses and therefore
gradually changing sedimentation coefficients. Alternatively, if
the drug blocks one particular step in the assembly pathway,
defined intermediate particles would accumulate.
To analyze the time course of inhibition of ribosome assembly by chloramphenicol and erythromycin, we profiled ribosomal particles from cells grown at 25°C for different times in
the presence or absence of the drugs. The RNA was labeled
with [3H]uridine for 5 min, the cells were lysed, and the ribosomal particles were analyzed by sucrose gradient centrifugation (Fig. 5a). The rate-limiting step of ribosomal subunit assembly is the final maturation step, which takes about 1 to 2
min at 37°C (32a). Completion of subunit assembly is manifested by incorporation of the newly assembled subunits into
the 70S pool. Consistent with this previous report, we observed
that the assembly of ribosomal subunits at 25°C in the absence
of the drugs was completed during the 5-min incubation with
[3H]uridine: during this short labeling period, a significant fraction of the assembled subunits was already incorporated into
70S ribosomes. Subunit assembly was completed during a further 5-min incubation (Fig. 5b). This additional incubation was
performed in the presence of rifampin, which inhibits the initiation of transcription, ensuring that no new rRNA precursors
are generated after the initial labeling period.
In the presence of either chloramphenicol or erythromycin,
assembly was significantly retarded even when the antibiotics
were added only 5 min before the [3H]uridine (Fig. 5a). With
longer antibiotic treatment, broad peaks of assembly intermediates accumulated between the 50S and 20S regions of the
gradient. This heterogeneity in the sizes of the defective par-
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
FIG. 3. Effects of resistance E-peptide expression on erythromycininduced assembly defects. Sucrose gradient profiles of ribosomes isolated from cells containing a plasmid for E-peptide expression are
shown. Addition of erythromycin (ery) or of IPTG, the inducer of
E-peptide expression, is indicated.
ANTIBIOTICS AFFECTING RIBOSOMAL ASSEMBLY
568
SIIBAK ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
FIG. 4. Effect of erythromycin on the assembly of sensitive and resistant ribosomes in a mixed population. S. aureus strain UCN18, carrying an
A2059G mutation in three out of five rrl alleles, was grown without (left panels) or with (right panels) erythromycin. The bacteria were lysed, and
ribosomal subunits were analyzed in sucrose gradients. (a) Flowthrough optical profiles of the sucrose gradient fractions. (b) Optical densities of
individual gradient fractions corresponding to the 30S-to-50S gradient area used in subsequent experiments. (c) Primer extension analysis of
wild-type and mutant 23S rRNA in individual gradient fractions. (d) Quantification of the gels in panels c. (e) Design of the primer extension assay.
VOL. 53, 2009
ANTIBIOTICS AFFECTING RIBOSOMAL ASSEMBLY
569
ticles agrees better with the indirect inhibition model (the
drugs inhibit ribosome assembly via inhibition of ribosomal
protein production and an imbalance in rRNA and ribosomal
protein synthesis) than with the model that presumes drug
binding to a specific assembly precursor, which would be expected to result in the accumulation of very specific assembly
intermediates. Although both erythromycin and chloramphenicol caused the accumulation of assembly-defective particles,
there was a slight difference between particles that accumulated after prolonged treatment with the drugs (Fig. 5, compare 10-min and 60-min time points): those that accumulated
in the presence of chloramphenicol sedimented more slowly
than those that accumulated in the presence of erythromycin.
This difference may be attributable to differences in the inhibition of production of specific ribosomal proteins.
DISCUSSION
It has been shown previously that treatment of cells with
protein synthesis inhibitors can lead to defects in ribosome
assembly. Two alternative explanations for this phenomenon
have been proposed. One model suggests that ribosomal subunit assembly is prevented because the production of ribosomal proteins is inhibited, resulting in an imbalance in the
amounts of individual proteins synthesized and a lack of stoichiometry with the newly made rRNA (20, 21). The other
model suggests that assembly is inhibited by antibiotic binding
to precursor particles (59). Sucrose gradient centrifugation
showed that radioactively labeled erythromycin cosedimented
with the precursor particles (59).
In this study, we carried out experiments designed to differentiate between these two scenarios. We used erythromycin
and chloramphenicol as model compounds. These drugs have
been used in many previous studies of antibiotic-mediated
inhibition of assembly. Both antibiotics bind to the 50S subunit
(47, 58). Chloramphenicol inhibits peptide bond formation by
preventing the aminoacyl-tRNA 3⬘ end from binding in the
peptidyl transferase center (47), whereas erythromycin hampers the progression of the nascent peptide chain through the
ribosomal exit tunnel (34, 55, 58).
Analysis of the ribosomal particles that accumulated in the
drug-treated cells revealed precursors that sedimented more
slowly than either the 30S or the 50S subunit (Fig. 1). In
antibiotic-treated cells, 23S RNA was present not only in 50S
subunits but also in fractions sedimenting more slowly than
50S. Similarly, 16S rRNA was also present in fractions sedimenting more slowly than 30S. This result shows that chloramphenicol and erythromycin inhibit the assembly of both the
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
FIG. 5. Pulse-labeling of rRNA. Schematic representations of the experiments are shown to the left of the experimental data. Solid lines, optical
density patterns of the sucrose gradients; shaded histograms, radioactivity profiles of the TCA-precipitated material. Ery, erythromycin; Cam,
chloramphenicol; Rif, rifampin. (a) Experiment performed without rifampin addition; (b) experiments in which pulse-labeling was followed by
incubation with rifampin.
570
SIIBAK ET AL.
novel assembly pathways leading to dead-end particles, in
agreement with previous reports that upon removal of the
drug, the precursor rRNA from the “chloramphenicol particles” is converted into normal 30S and 50S ribosomes without
prior degradation (1, 24, 39).
Starting from the middle of the 1990s, Champney and coworkers have reinvestigated the antibiotic-induced ribosomal
assembly defects (9, 10). They have described the assembly
defects in response to many inhibitors of protein synthesis,
including erythromycin. Our observations fully support the
previous reports that describe erythromycin-induced assembly
inhibition, although our conclusions about the mechanism differ. Usary and Champney have observed binding of radiolabeled erythromycin to precursors of the 50S subunit (59).
This was interpreted in the framework of direct inhibition of
assembly by the drug. However, mere binding of the drug to
the precursor need not necessarily lead to the stalling of assembly. One can easily imagine that precursor particles with
bound antibiotic can progress though the remaining steps of
the assembly pathway. Furthermore, in assembly experiments
using a cell-free system, erythromycin and other macrolide
inhibitors of protein synthesis notably stimulated the assembly
of the 50S subunit (27).
With both chloramphenicol and erythromycin treatment,
precursors of both the large and small ribosomal subunits
accumulated (Fig. 1). In contrast, in most of their experiments
with several protein synthesis inhibitors acting upon the large
ribosomal subunit, Champney et al. observed the accumulation
only of 50S subunit precursors. However, it is noteworthy that
30S subunit assembly is inhibited by some macrolides but not
others (11, 15, 35). One possible explanation is that the sucrose
gradient centrifugation conditions used in those studies do not
allow 30S assembly intermediates to be separated reliably from
the mature subunits. Another possibility is that the 30S assembly intermediates that accumulate in the presence of some
antibiotics are preferentially degraded, leading to seemingly
subunit-specific assembly defects.
ACKNOWLEDGMENTS
We thank Roland Leclercq for providing the S. aureus mutant
strains and Dorota Klepacki for help with some experiments. We thank
Ülo Maiväli and Niilo Kaldalu for valuable comments on the manuscript. The English language was corrected by BioMedES, United
Kingdom.
This work was supported by The Wellcome Trust International
Senior Fellowship (070210/Z/03/Z) (to T.T.), Estonian Science Foundation Grant 7509 (to J. R.), and NIH grant AI072445 from the
National Institute of Allergy and Infectious Diseases, NIH (to A.M.).
REFERENCES
1. Adesnik, M., and C. Levinthal. 1969. Synthesis and maturation of ribosomal
RNA in Escherichia coli. J. Mol. Biol. 46:281–303.
2. Allas, U., A. Liiv, and J. Remme. 2003. Functional interaction between
RNase III and the Escherichia coli ribosome. BMC Mol. Biol. 4:8.
3. Andrews, J. M. 2001. Determination of minimum inhibitory concentrations.
J. Antimicrob. Chemother. 48(Suppl. 1):5–16.
4. Atlas, A. M. 2006. Handbook of microbiological media for the examination
of food, 2nd ed. CRC Press, Boca Raton, FL.
5. Bailey, M., T. Chettiath, and A. S. Mankin. 2008. Induction of erm(C)
expression by noninducing antibiotics. Antimicrob. Agents Chemother. 52:
866–874.
6. Blattner, F. R., G. Plunkett III, C. A. Bloch, N. T. Perna, V. Burland, M.
Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor,
N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y.
Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science
277:1453–1474.
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
50S and 30S subunits. Because these drugs do not bind to the
small ribosomal subunit, the finding supports the hypothesis
that the inhibition of assembly is mediated through general
interference with protein synthesis and is not caused by antibiotic binding to precursor particles.
Most conventional antibiotic resistance determinants could
not be used to ascertain whether the assembly defect is caused
by the inhibition of precursor particles or mature ribosomes:
drug efflux pumps and antibiotic modification systems reduce
the concentration of the active compound and would therefore
have an effect in either case; modification of the binding site
might influence drug binding to both precursors and mature
particles. On the other hand, E-peptide-mediated erythromycin resistance (33, 54) involves only actively translating mature
ribosomes and does not influence the availability of erythromycin in the cell. Therefore, if assembly is inhibited by direct
stalling of the process caused by erythromycin binding to the
precursor particles, E-peptide-mediated resistance would not
relieve the drug-related assembly defects. However, our experiments showed that expression of the resistance E-peptide alleviates the inhibition of assembly (Fig. 3) and defects in 23S
rRNA processing (data not shown), arguing that the assembly
defects are not mediated through drug binding to intermediates.
In the mixed population of sensitive and mutant ribosomes,
stalling of assembly because of drug binding to the precursor
particles is expected to influence the assembly of wild-type
ribosomes much more significantly than that of mutants that
do not bind erythromycin. Yet our data show that in erythromycin-treated cells, the assembly of both sensitive and resistant
ribosomes is affected to approximately the same extent, arguing that drug binding to precursors does not stall assembly.
Finally, if assembly were inhibited because the drug binds to
precursor particles and prevents subsequent assembly steps,
defined assembly intermediates should accumulate. Instead,
our kinetics experiments (Fig. 5) showed the appearance of a
broad assembly-intermediate peak in drug-treated cells, a result more readily compatible with the hypothesis that assembly
defects result from a general inhibition of protein synthesis.
How can the inhibition of protein synthesis lead to defects in
ribosome assembly? It has been reported that several inhibitors of protein synthesis, including chloramphenicol and erythromycin, strongly increase the production of rRNA (17, 22, 24,
30, 37, 41, 48, 49). This effect is likely to be caused by the
decrease in protein synthesis capacity, activating feedback
mechanisms for rRNA transcription (40). On the other hand,
as protein synthesis is inhibited, there is less production of
ribosomal proteins. As a result, the molar ratio between rRNA
and ribosomal proteins will be skewed (20, 53). The excess of
rRNA over ribosomal proteins would lead to an accumulation
of heterogeneous particles characterized by diverse incomplete
sets of ribosomal proteins (21, 38), a scenario fully compatible
with our observations (Fig. 5).
In response to treatment with erythromycin or chloramphenicol, partially processed rRNA accumulates and can be
detected in several sucrose gradient fractions (Fig. 2). The
erythromycin- and chloramphenicol-treated samples contain
the same 5⬘ processing intermediates as those observed in the
untreated control; no new cleavage sites are observed. This
indicates that antibiotic treatment does not induce completely
ANTIMICROB. AGENTS CHEMOTHER.
VOL. 53, 2009
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
571
action: the josamycin and erythromycin cases. J. Biol. Chem. 279:53506–
53515.
Mabe, S., J. Eller, and W. S. Champney. 2004. Structure-activity relationships for three macrolide antibiotics in Haemophilus influenzae. Curr. Microbiol. 49:248–254.
Mehta, R., and W. S. Champney. 2002. 30S ribosomal subunit assembly is a
target for inhibition by aminoglycosides in Escherichia coli. Antimicrob.
Agents Chemother. 46:1546–1549.
Midgley, J. E., and W. J. Gray. 1971. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acid in chloramphenicol-inhibited cultures of Escherichia coli. Biochem. J. 122:149–159.
Nierhaus, K. H. 1991. The assembly of prokaryotic ribosomes. Biochimie
73:739–755.
Nomura, M., and K. Hosokawa. 1965. Biosynthesis of ribosomes: fate of
chloramphenicol particles and of pulse-labeled RNA in Escherichia coli. J.
Mol. Biol. 12:242–265.
Paul, B. J., W. Ross, T. Gaal, and R. L. Gourse. 2004. rRNA transcription in
Escherichia coli. Annu. Rev. Genet. 38:749–770.
Perel’man, B. V., L. G. Kolibaba, B. R. Belitskii, and R. S. Shakulov. 1979.
Effects of different concentrations of chloramphenicol on RNA synthesis in
E. coli. Biokhimiia 44:1968–1971. (In Russian.)
Poehlsgaard, J., and S. Douthwaite. 2005. The bacterial ribosome as a target
for antibiotics. Nat. Rev. Microbiol. 3:870–881.
Prunier, A. L., B. Malbruny, D. Tande, B. Picard, and R. Leclercq. 2002.
Clinical isolates of Staphylococcus aureus with ribosomal mutations conferring resistance to macrolides. Antimicrob. Agents Chemother. 46:3054–3056.
Roy-Chaudhuri, B., N. Kirthi, T. Kelley, and G. M. Culver. 2008. Suppression of a cold-sensitive mutation in ribosomal protein S5 reveals a role for
RimJ in ribosome biogenesis. Mol. Microbiol. 68:1547–1559.
Sabina, J., N. Dover, L. J. Templeton, D. R. Smulski, D. Soll, and R. A.
LaRossa. 2003. Interfering with different steps of protein synthesis explored
by transcriptional profiling of Escherichia coli K-12. J. Bacteriol. 185:6158–
6170.
Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory
manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Schlünzen, F., R. Zarivach, J. Harms, A. Bashan, A. Tocilj, R. Albrecht, A.
Yonath, and F. Franceschi. 2001. Structural basis for the interaction of
antibiotics with the peptidyl transferase centre in eubacteria. Nature 413:
814–821.
Sells, B. H. 1964. RNA synthesis and ribosome production in puromycintreated cells. Biochim. Biophys. Acta 80:230–241.
Shen, V., and H. Bremer. 1977. Chloramphenicol-induced changes in the
synthesis of ribosomal, transfer, and messenger ribonucleic acids in Escherichia coli B/r. J. Bacteriol. 130:1098–1108.
Sirdeshmukh, R., and D. Schlessinger. 1985. Ordered processing of Escherichia coli 23S rRNA in vitro. Nucleic Acids Res. 13:5041–5054.
Srivastava, A. K., and D. Schlessinger. 1990. Mechanism and regulation of
bacterial ribosomal RNA processing. Annu. Rev. Microbiol. 44:105–129.
Srivastava, A. K., and D. Schlessinger. 1989. Processing pathway of Escherichia coli 16S precursor rRNA. Nucleic Acids Res. 17:1649–1663.
Sykes, J., E. Metcalf, and J. D. Pickering. 1977. The nature of the proteins
in ‘chloramphenicol particles’ from Escherichia coli A19 (Hfr rel met rns).
J. Gen. Microbiol. 98:1–16.
Tenson, T., A. DeBlasio, and A. Mankin. 1996. A functional peptide encoded
in the Escherichia coli 23S rRNA. Proc. Natl. Acad. Sci. USA 93:5641–5646.
Tenson, T., M. Lovmar, and M. Ehrenberg. 2003. The mechanism of action
of macrolides, lincosamides and streptogramin B reveals the nascent peptide
exit path in the ribosome. J. Mol. Biol. 330:1005–1014.
Tenson, T., and A. Mankin. 2006. Antibiotics and the ribosome. Mol. Microbiol. 59:1664–1677.
Tenson, T., L. Xiong, P. Kloss, and A. S. Mankin. 1997. Erythromycin
resistance peptides selected from random peptide libraries. J. Biol. Chem.
272:17425–17430.
Tu, D., G. Blaha, P. B. Moore, and T. A. Steitz. 2005. Structures of MLSBK
antibiotics bound to mutated large ribosomal subunits provide a structural
explanation for resistance. Cell 121:257–270.
Usary, J., and W. S. Champney. 2001. Erythromycin inhibition of 50S ribosomal subunit formation in Escherichia coli cells. Mol. Microbiol. 40:951–
962.
VanBogelen, R. A., and F. C. Neidhardt. 1990. Ribosomes as sensors of heat
and cold shock in Escherichia coli. Proc. Natl. Acad. Sci. USA 87:5589–5593.
Vimberg, V., L. Xiong, M. Bailey, T. Tenson, and A. Mankin. 2004. Peptidemediated macrolide resistance reveals possible specific interactions in the
nascent peptide exit tunnel. Mol. Microbiol. 54:376–385.
Wilson, D. N., and K. H. Nierhaus. 2007. The weird and wonderful world of
bacterial ribosome regulation. Crit. Rev. Biochem. Mol. Biol. 42:187–219.
Yonath, A. 2005. Antibiotics targeting ribosomes: resistance, selectivity, synergism and cellular regulation. Annu. Rev. Biochem. 74:649–679.
Downloaded from aac.asm.org by Alexander Mankin on January 29, 2009
7. Boom, R., C. J. Sol, M. M. Salimans, C. L. Jansen, P. M. Wertheim-van
Dillen, and J. van der Noordaa. 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:495–503.
8. Bram, R. J., R. A. Young, and J. A. Steitz. 1980. The ribonuclease III site
flanking 23S sequences in the 30S ribosomal precursor RNA of E. coli. Cell
19:393–401.
9. Champney, W. S., and R. Burdine. 1996. 50S ribosomal subunit synthesis and
translation are equivalent targets for erythromycin inhibition in Staphylococcus aureus. Antimicrob. Agents Chemother. 40:1301–1303.
10. Champney, W. S., and R. Burdine. 1995. Macrolide antibiotics inhibit 50S
ribosomal subunit assembly in Bacillus subtilis and Staphylococcus aureus.
Antimicrob. Agents Chemother. 39:2141–2144.
11. Champney, W. S., and M. Miller. 2002. Inhibition of 50S ribosomal subunit
assembly in Haemophilus influenzae cells by azithromycin and erythromycin.
Curr. Microbiol. 44:418–424.
12. Champney, W. S., and M. Miller. 2002. Linezolid is a specific inhibitor of 50S
ribosomal subunit formation in Staphylococcus aureus cells. Curr. Microbiol.
44:350–356.
13. Champney, W. S., and W. K. Rodgers. 2007. Retapamulin inhibition of
translation and 50S ribosomal subunit formation in Staphylococcus aureus
cells. Antimicrob. Agents Chemother. 51:3385–3387.
14. Champney, W. S., and C. L. Tober. 2000. Evernimicin (SCH27899) inhibits
both translation and 50S ribosomal subunit formation in Staphylococcus
aureus cells. Antimicrob. Agents Chemother. 44:1413–1417.
15. Champney, W. S., and C. L. Tober. 2003. Preferential inhibition of protein
synthesis by ketolide antibiotics in Haemophilus influenzae cells. Curr. Microbiol. 46:103–108.
16. Champney, W. S., and C. L. Tober. 2000. Specific inhibition of 50S ribosomal
subunit formation in Staphylococcus aureus cells by 16-membered macrolide,
lincosamide, and streptogramin B antibiotics. Curr. Microbiol. 41:126–135.
17. Cortay, J. C., and A. J. Cozzone. 1983. Effects of aminoglycoside antibiotics
on the coupling of protein and RNA syntheses in Escherichia coli. Biochem.
Biophys. Res. Commun. 112:801–808.
18. Dabbs, E. R. 1991. Mutants lacking individual ribosomal proteins as a tool to
investigate ribosomal properties. Biochimie 73:639–645.
19. Dagley, S., and J. Sykes. 1959. Effect of drugs upon components of bacterial
cytoplasm. Nature 183:1608–1609.
20. Dennis, P. P. 1976. Effects of chloramphenicol on the transcriptional activities of ribosomal RNA and ribosomal protein genes in Escherichia coli. J.
Mol. Biol. 108:535–546.
21. Dodd, J., J. M. Kolb, and M. Nomura. 1991. Lack of complete cooperativity
of ribosome assembly in vitro and its possible relevance to in vivo ribosome
assembly and the regulation of ribosomal gene expression. Biochimie 73:
757–767.
22. Drobyshev, V. I., and R. S. Shakulov. 1976. Effect of streptomycin on RNA
synthesis in E. coli cells. Biokhimiia 41:1193–1199. (In Russian.)
23. Goh, E. B., G. Yim, W. Tsui, J. McClure, M. G. Surette, and J. Davies. 2002.
Transcriptional modulation of bacterial gene expression by subinhibitory
concentrations of antibiotics. Proc. Natl. Acad. Sci. USA 99:17025–17030.
24. Hosokawa, K., and M. Nomura. 1965. Incomplete ribosomes produced in
chloramphenicol- and puromycin-inhibited Escherichia coli. J. Mol. Biol.
12:225–241.
25. Hutter, B., C. Schaab, S. Albrecht, M. Borgmann, N. A. Brunner, C.
Freiberg, K. Ziegelbauer, C. O. Rock, I. Ivanov, and H. Loferer. 2004.
Prediction of mechanisms of action of antibacterial compounds by gene
expression profiling. Antimicrob. Agents Chemother. 48:2838–2844.
26. Iost, I., and M. Dreyfus. 2006. DEAD-box RNA helicases in Escherichia coli.
Nucleic Acids Res. 34:4189–4197.
27. Khaitovich, P., and A. S. Mankin. 1999. Effect of antibiotics on large ribosomal subunit assembly reveals possible function of 5S rRNA. J. Mol. Biol.
291:1025–1034.
28. King, T. C., R. Sirdeskmukh, and D. Schlessinger. 1986. Nucleolytic processing of ribonucleic acid transcripts in procaryotes. Microbiol. Rev. 50:
428–451.
29. Kurland, C. G., M. Nomura, and J. D. Watson. 1962. The physical properties
of the chloromycetin particles. J. Mol. Biol. 4:388–394.
30. Lazzarini, R. A., and E. Santangelo. 1968. Effect of chloramphenicol on the
synthesis and stability of ribonucleic acid in Bacillus subtilis. J. Bacteriol.
95:1212–1220.
31. Liiv, A., and J. Remme. 1998. Base-pairing of 23S rRNA ends is essential for
ribosomal large subunit assembly. J. Mol. Biol. 276:537–545.
32. Liiv, A., T. Tenson, T. Margus, and J. Remme. 1998. Multiple functions of
the transcribed spacers in ribosomal RNA operons. Biol. Chem. 379:783–
793.
32a.Lindahl, L. 1975. Intermediates and time kinetics of the in vivo assembly of
Escherichia coli ribosomes. J. Mol. Biol. 92:15–37.
33. Lovmar, M., K. Nilsson, V. Vimberg, T. Tenson, M. Nervall, and M. Ehrenberg. 2006. The molecular mechanism of peptide-mediated erythromycin
resistance. J. Biol. Chem. 281:6742–6750.
34. Lovmar, M., T. Tenson, and M. Ehrenberg. 2004. Kinetics of macrolide
ANTIBIOTICS AFFECTING RIBOSOMAL ASSEMBLY