Laminar Shear Stress and 3ⴕ Polyadenylation of
eNOS mRNA
Martina Weber, Curt H. Hagedorn, David G. Harrison, Charles D. Searles
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Abstract—The 3⬘ poly(A) tail is important in messenger RNA stability and translational efficiency. In somatic tissues, 3⬘
polyadenylation of mRNAs has been thought to largely be a constitutively active process. We have reported that laminar
shear stress causes a brief increase in endothelial nitric oxide synthase (eNOS) transcription, followed by a prolonged
increase in eNOS mRNA stability. We sought to determine whether shear stress and other stimuli affected eNOS 3⬘
polyadenylation in endothelial cells. Under basal (static) conditions, eNOS mRNA possessed short 3⬘ poly(A) tails of
⬍25 nt. In contrast, laminar shear stress increased expression of eNOS transcripts with long poly(A) tails. ENOS
transcripts with longer poly(A) tails had prolonged half-lives (6 hours in static cells versus 18 hours in sheared cells).
Polysome analysis revealed that eNOS mRNA from sheared cells was shifted into more translationally active polysome
fractions compared with eNOS mRNA from static cells. Shear-induced lengthening of the eNOS 3⬘ poly(A) tail was the
result of increased nuclear polyadenylation. Furthermore, hydrogen peroxide and HMG Co-A reductase inhibitors, other
stimuli known to modulate eNOS expression posttranscriptionally, also induced eNOS 3⬘ poly(A) tail lengthening.
These results support the concept that shear stress modulates eNOS mRNA stability and translation via increased 3⬘
polyadenylation. We suggest that mRNA 3⬘ polyadenylation is a posttranscriptional mechanism used by endothelial
cells to regulate gene expression. (Circ Res. 2005;96:1161-1168.)
Key Words: endothelial nitric oxide synthase 䡲 mRNA stability 䡲 polyadenylation 䡲 posttranscriptional regulation
䡲 shear stress
L
scribed a mechanism for the posttranscriptional regulation
of eNOS expression during cell growth,18 the details for
modulation of mRNA stability by other stimuli, including
shear stress, remain poorly defined.
In mammalian cells, 3⬘ poly(A) tails have been shown to
regulate mRNA stability and translation.19,20 The cloned
sequences of bovine and human eNOS mRNAs were
reported to have 3⬘ poly(A) tails ⬇12 to 20 nucleotides in
length.21,22 Although these studies did not specifically
examine poly(A) tail length, the eNOS sequences were
derived from RNA libraries of cultured cells not exposed
to shear, suggesting that eNOS mRNA has a short 3⬘
poly(A) tail under baseline conditions. We hypothesized
that shear stress increases polyadenylation of eNOS
mRNA. We report that shear stress led to an increase in
eNOS transcripts with long poly(A) tails. We found that in
cells subjected to shear stress there was a shift of eNOS
mRNA from monosomes to polysomes, suggesting that a
functional sequela of increased polyadenylation was increased translation. Furthermore, long poly(A) eNOS
mRNA was more stable. These data provide evidence to
support a novel mechanism for regulation of eNOS
expression.
aminar shear stress is a potent stimulus for the
production of vascular nitric oxide (NO•) because of
its ability to increase both the activity and expression of
the endothelial nitric oxide synthase (eNOS).1–3 Endothelium-derived NO• is crucial for maintenance of vascular
homeostasis through its vasodilator activity;4 its ability to
inhibit smooth muscle growth,5 platelet aggregation,6 and
leukocyte adhesion,7 and its role in inhibiting lipid oxidation and regulating apoptosis in the vessel wall.8 Given
these properties of NO•, the shear stress-induced increase
in eNOS expression may be important in preventing
atherosclerosis. Indeed, areas of the vasculature exposed to
high shear stress appear to be protected from the development of atherosclerosis, and areas exposed to low shear
stress are prone to atherosclerotic lesion formation.9
Previously we have demonstrated that shear stress leads
to increased eNOS mRNA expression via 2 separate
mechanisms: a transient increase in eNOS transcription,
and stabilization of eNOS mRNA.10 Posttranscriptional
regulation of eNOS expression via modulation of eNOS
mRNA stability is now recognized as an important response of endothelial cells to numerous biophysical and
biochemical stimuli.11–17 Although we have recently de-
Original received October 18, 2004; revision received March 22, 2005; accepted May 9, 2005.
From the Division of Cardiology, Department of Medicine, Emory University School of Medicine and the Atlanta Veterans Administration Medical
Center, Atlanta, Ga.
Correspondence to Charles D. Searles, Division of Cardiology, Emory University School of Medicine, 1639 Pierce Dr, WMB 319, Atlanta, GA 30322.
E-mail [email protected]
© 2005 American Heart Association, Inc.
Circulation Research is available at http://www.circresaha.org
DOI: 10.1161/01.RES.0000170651.72198.fa
1161
1162
Circulation Research
June 10, 2005
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Figure 1. The effect of laminar shear stress on eNOS mRNA levels and translational activity in BAECs. A, eNOS mRNA levels in cells
exposed to no shear or 6 hours of laminar shear stress (15 dynes/cm2). eNOS mRNA was measured by quantitative real-time PCR.
Message levels are expressed as copy numbers normalized to ␮g of cDNA. Data are shown as mean⫾SEM (n⫽8). B, the UV absorbance profile at 254 nm of material sedimented through a sucrose gradient. Labeled are the positions of monosomes (80S) and different size polysomes. C, eNOS levels in progressively larger polysome fractions of static control and sheared BAECs (6 hours, 15 dynes/
cm2). eNOS mRNA from each fraction was measured by quantitative real-time PCR (normalized to GAPDH levels). Ribosomal subunits
(40S, 60S) and monosomes are in fractions 1 to 7; largest polysomes are in fraction 24. Shown are mean data from 3 experiments.
Materials and Methods
Materials
5,6-dichloro-1-␤-D-ribofuranosylbenzimidazole (DRB) was obtained
from Calbiochem. Cordycepin (3⬘-deoxyadenosine), cycloheximide,
actinomycin D, hydrogen peroxide, mevastatin, and all primers were
purchased from Sigma. Simvastatin was a generous gift from Merck
(Rahway, NJ) and was activated before use, as described earlier.15
Tissue Culture
Bovine aortic endothelial cells (BAECs; Cell Systems, Kirkland,
Wash) were cultured in Media 199 (M199; Cellgro, Mediatech)
containing 10% fetal calf serum (FCS; Hyclone Labortories) as
described earlier.23 Postconfluent BAECs between passages 4 to 8
were used for experiments. A cone-in-plate viscometer with a 1°
angle was used to shear cells.24
RNA Isolation
Total cellular RNA was isolated using TRI-Reagent (Molecular
Research Center Inc). For polysomal, cytosolic and nuclear fractionation, 2 ␮L linear acrylamide (Ambion) was added as a carrier
during RNA precipitation. The PARIS-Kit (Ambion) was used to
separate cytosolic and nuclear RNA fractions.
Rapid Amplification of cDNA Ends-PolyA Test
To measure the 3⬘ poly(A) tails of eNOS mRNA, Rapid Amplification of cDNA Ends-PolyA Test (RACE-PAT) was performed as
described previously.25 The details of RACE-PAT are provided in
the online data supplement at http://circres.ahajournals.org
Real Time RT-PCR
Real time RT-PCR was done with the Light Cycler (Roche) as
described earlier.26 Reverse transcription was performed as described for RACE-PAT, using primers and conditions described in
the online supplement.
Ribonuclease Protection Assays
A 600 nt band detected by eNOS RACE-PAT analysis was cloned
into the pCRII-TOPO vector (Invitrogen) and its orientation was
confirmed by DNA sequencing. A biotinylated antisense RNA probe
was prepared by in vitro transcription, using T7 RNA polymerase
(Mega Script kit, Ambion). Three to 10 ␮g of total RNA from
endothelial cells was hybridized with 374 pg of the biotinylated
eNOS RNA-probe overnight at 42°C. Unprotected RNA was digested with RNaseA/T1 (Ambion) in digestion buffer for 30 minutes
at 37°C; the reaction was stopped by RNA precipitation. The
samples were run on a 9% polyacrylamide gel containing urea. RNA
was electroblotted onto a positively charged nylon membrane, which
was developed using the Bright Star Biodetect Kit (Ambion).
Polysomal Fractionation
The analysis of polysomes was performed as described previously.27,28 The details of polysome fractionation are described in the
online supplement.
Results
eNOS mRNA Levels and Translational Activity in
Response to Shear Stress
We used real time quantitative RT-PCR to compare eNOS
mRNA levels in static control versus sheared BAECs. Shear
increased eNOS mRNA levels by 9-fold compared with
levels in nonsheared cells (Figure 1A). Because the increase
in eNOS mRNA has been shown to be associated with
increased eNOS protein levels,21 we hypothesized that translation of eNOS mRNA is also enhanced in response to shear.
Polyribosomes from sheared and control endothelial cells
were fractionated on the basis of size (Figure 1B), and the
quantity of eNOS mRNA in each fraction was determined
(Figure 1C). Polysome size reflects translation activity; transcripts that are associated with large polysomes are more
Weber et al
Shear Stress and eNOS mRNA
1163
Figure 2. PCR based method (RACEPAT) to measure the 3⬘ poly(A) ends of
eNOS mRNA from BAECS. A, Schematic
design for RACE-PAT used to examine
eNOS mRNA poly(A) tail length. B, 1.8%
agarose gel of RACE-PAT products
(⫾RNase H) derived from endothelial
cells. BAECs were exposed to 6 hours of
shear stress at 0, 3, 7.5, 10, or 15
dynes/cm2. This gel is representative of 3
separate experiments.
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
translationally active. We found that large polysomal fractions (⬎3 ribosomes/mRNA) from sheared cells had 2.5- to
10.5-fold more eNOS mRNA than those from static cells.
These data provide direct evidence that eNOS mRNA from
sheared cells was translated with increased efficiency.
Identification of eNOS Transcripts With Long
Poly(A) Tails With RACE-PAT
To determine the relationship between shear stress and eNOS
mRNA polyadenylation, a PCR based method (RACE-PAT)
was used to measure the poly(A) tail lengths of eNOS mRNA
under shear and static conditions (Figure 2). The minimum
predicted PCR product size was 237 nt: 225 nt of the eNOS
3⬘ untranslated region (UTR) plus a poly(A) tail of 12 nt or
less. The predominant RACE-PAT PCR product from both
sheared and nonsheared BAECs was 250 nt, consistent with a
poly(A) tail length of 25 nts (Figure 2B, lower arrow). As the
amount of shear stress was increased, PCR products larger
than 250 nt were observed, including a product that was
⬇600 nt (Figure 2B, upper arrow). This finding was consistent with lengthening of the 3⬘poly(A) tail that was proportional to the amount of shear stress. To confirm that the larger
PCR products were polyadenylated, RNA was subjected to
oligo (dT) hybridization and RNase H digestion before
RACE-PAT. RNase H digests RNA-DNA hybrids, and
poly(A) tails hybridized with oligo (dT) are degraded by
RNase H. When the RNase H digestion step was performed
before RACE-PAT, the PCR products greater than 250 nts
were not observed (Figure 2B), confirming that they were
eNOS transcripts with different length poly(A) tails. The
results of these RACE-PAT studies are compatible with shear
increasing the eNOS mRNA 3⬘ poly(A) tail length up to 300 nts.
The RACE-PAT PCR products of 250 nt and 600nt were
cloned into pCRII (Invitrogen) and sequenced. Multiple
clones from different experiments were sequenced, and both
of the RACE-PAT products had the predicted eNOS 3⬘UTR
sequence. As expected, the 250 nt PCR product had a
relatively short poly(A) tail length of 12 to 30 bases.
Although the entire sequence of the 600 nt product was not
able to be obtained, a minimum poly(A) tail size of 112 bases
was identified, confirming that it had a lengthened poly(A)
tail. Furthermore, the inability to obtain 3⬘ sequence beyond
112 adenines is consistent with its composition being
poly(A).
Identification of eNOS Transcripts With Long
Poly(A) Tails With RNase Protection Assay
To further examine shear-induced polyadenylation of eNOS
mRNA, RNase protection assays (RPAs) were performed
using a riboprobe that was antisense to the cloned 600 nt
RACE-PAT product. Total RNA from cells exposed to
increasing dynes/cm2 of shear stress was isolated and subjected to RPA analysis (Figure 3A). Consistent with the
RACE-PAT analysis, the predominant protected fragment in
nonsheared cells was ⬇250 nt, which had a poly(A) tail
calculated to be 25 nt. Importantly, RNA from cells exposed
to shear stress had a significant, dose-dependent increase in
longer protected fragments, specifically fragments of ⬇300
and 385 nt. These longer fragments had poly(A) tails calculated to be 75 and 160 nt in length, respectively, reflecting
increased polyadenylation with shear. To confirm that these
protected fragments were polyadenylated, cells were exposed
to 100 ␮mole/L cordycepin (3⬘-deoxyadenosine) for one hour
before 6 hours of shear. Cordycepin inhibits the formation of
mRNA with long poly(A) tails but allows for the correct
splicing and transport of transcribed mRNA.29 The longer
protected fragments (300 and 385 nt) were absent after
cordycepin pre-treatment (Figure 3C), verifying that they
were long poly(A) eNOS transcripts.
A time course experiment was performed to correlate the
duration of laminar shear stress with the quantity of long
poly(A) eNOS fragments (Figure 3B). The longer fragments
1164
Circulation Research
June 10, 2005
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Figure 3. The effect of shear duration and
shear dose on polyadenylation of eNOS
mRNA. A, top panel: RPA of total RNA
from BAECs exposed to 6 hours of shear
stress at 0, 3, 7.5, 10, or 15 dynes/cm2.
Riboprobe was targeted to the 3⬘ end of
eNOS mRNA as described in the Methods
section. Bottom panel: grouped densitometric data (mean⫾SEM) from 3 separate
experiments, expressed as a ratio of long
poly(A) eNOS mRNA (385 nt and 300 nt
bands) to total polyadenylated eNOS (250
nt, 385 nt and 300 nt bands). Asterisk indicates significant difference compared with
0 dynes/cm2 (P⬍0.01, Dunnett after 1-way
ANOVA). B, top panel: RPA of total RNA
from BAECs exposed to shear stress for 0
to 6 hours (15 dynes/cm2). Bottom panel:
grouped densitometric data (mean⫾SEM)
from 3 separate experiments expressed as
described above (*P⬍0.05 vs 0 hour,
**P⬍0.01 vs 0 hour, Dunnett after 1-way
ANOVA). C, RPA of total RNA from BAECs
subjected to cordycepin treatment (1 hour,
100 ␮mol/L) before shear stress (6 hours,
15 dynes/cm2). This blot is representative
of results from 3 separate experiments.
were observed after 2 hours of shear, and their levels
progressively increased up to 6 hours. Interestingly, the
appearance of long eNOS poly(A) transcripts at 2 hours of
shear stress temporally coincided with the reported onset of
increased eNOS mRNA stability,10 suggesting a role for
shear-induced polyadenylation in modulating eNOS mRNA
stability.
were more stable for at least 6 hours. After 6 hours,
polyadenylated eNOS transcripts from sheared cells had a
similar decay rate as those from control cells, but the
calculated overall half-life for the transcripts was longer (18
hours in sheared cells versus 6 hours in static cells). These
findings support the hypothesis that shear stress-induced
polyadenylation increases eNOS mRNA stability.
Stability of Polyadenylated eNOS mRNA
The Role of Nuclear Polyadenylation in eNOS 3ⴕ
mRNA Processing
DRB chase studies were performed to examine the stability of
polyadenylated eNOS mRNA. Before the addition of DRB to
the media, cells were exposed to shear stress for 6 hours. An
RPA analysis of polyadenylated eNOS mRNA was performed on cells that had been exposed to DRB for various
periods of time (Figure 4A). At the 0 hour time point, the
short poly(A) fragment was the predominant species in
control cells. In sheared cells, both short and long poly(A)
fragments were present at 0 hours. Over the next 18 hours,
there was a gradual decay in eNOS mRNA from control cells.
In contrast, the long poly(A) transcripts from sheared cells
did not decay until 6 hours, indicating that these transcripts
Transcription and polyadenylation are intimately coupled
processes.30,31 Genes undergoing enhanced transcription
would be expected to have increased nuclear polyadenylation.
However, lengthening of the 3⬘ poly(A) tail can also occur in
the cytoplasm through a process known as cytoplasmic
polyadenylation.32,33 Because shear stress increases the rate
of eNOS mRNA transcription,10 we hypothesized that shearinduced polyadenylation was a nuclear process involving the
nuclear transcription and polyadenylation machinery.
RNA was isolated from both nuclear and cytosolic fractions of sheared and static cells and subjected to RPA analysis
Figure 4. Stability of polyadenylated
eNOS mRNA. A, DRB-chase experiments
of static and sheared BAECs. Cells were
either exposed to no shear or 15
dynes/cm2 for 6 hours before the addition of DRB (60 ␮mol/L). Cells were harvested at time points indicated and RPA
analyses were performed to determine
the rate of eNOS mRNA decay. B,
Pooled densitometric analysis
(mean⫾SEM) from 3 separate experiments, expressed as percent of 0 hour
time point. For static cells, densitometry
was performed on the 250 nt band. For
sheared cells, densitometry was performed on the 250, 300, and 385 nt
bands together.
Weber et al
Shear Stress and eNOS mRNA
1165
Figure 5. Polyadenylated eNOS mRNA in
nuclear and cytosolic fractions. A, RPA
analysis of nuclear and cytosolic fractions from cells exposed to no shear or
15 dynes/cm2 for 6 hours. B, RPA of
nuclear and cytosolic fractions from cells
treated with DRB (60 ␮mol/L, 1 hour)
before being exposed to shear (15
dynes/cm2 for 6 hours) or static conditions. C, RPA of RNA in nuclear and
cytosolic fractions from cells treated actinomycin D (5 ␮g/mL, 1 hour) before
being exposed to shear (15 dynes/cm2
for 6 hours) or static conditions.
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
(Figure 5A). In sheared cells, nuclear extracts contained
predominantly long poly(A) eNOS transcripts, and cytosolic
extracts had both long and short poly(A) transcripts. In
nonsheared cells, eNOS transcripts were faintly detected in
nuclear extracts. Cytosolic extracts from control cells had
predominantly short poly(A) transcripts. These findings suggest that shear-induced polyadenylation of eNOS mRNA is a
nuclear process.
exported to the cytoplasm. However, transcription is not
completely essential for polyadenylation to occur in sheared
cells, as evidenced by the progressive increase in long
poly(A) fragments after actinomycin D treatment. The virtual
absence of long poly(A) fragments in cytosolic extracts of
both actinomycin D- and DRB-treated cells suggests that
cytoplasmic polyadenylation does not play a role in shearinduced lengthening of eNOS poly(A) tail.
Relationship Between Shear-Induced Transcription
and Polyadenylation
The Influence of Hydrogen Peroxide and Statins
on eNOS mRNA 3ⴕ Processing
To further examine the relationship between eNOS mRNA
transcription and polyadenylation, we determined the effect
of blocking transcription on shear-induced eNOS polyadenylation. BAECs underwent a 1 hour preincubation with DRB
(60 ␮mol/L) and were then exposed to shear stress. RPA
analysis was performed on nuclear and cytosolic extracts
obtained various times after shear stress (Figure 5B). DRB
pretreatment led to a dramatic decrease in the amount of long
poly(A) eNOS transcripts in nuclear extracts. Under these
conditions, the predominant protected fragment in cytosolic
extracts was that of the short poly(A) transcript. Thus,
blocking transcription with DRB severely attenuated shearinduced polyadenylation, signifying that eNOS transcription
and polyadenylation are linked.
DRB indirectly inhibits RNA polymerase II (RNAPII); it
modulates the activity of the regulatory kinases CDK 7 and
CDK 9. We also determined the effect of actinomycin D, a
direct inhibitor of RNAPII. BAECs underwent a 1 hour
preincubation with actinomycin D (5 ␮g/mL) and were
subsequently exposed to shear stress. After 2 hours of shear
stress there was a slight increase in the long polyadenylated
eNOS transcripts in nuclear extracts (Figure 5C). Greater
amounts of these protected fragments were seen after 4 to 6
hours of shear. Virtually no long poly(A) transcripts were
detected in cytosolic extracts from cells treated with actinomycin D and shear stress. These results confirm that transcription is important for long poly(A) eNOS transcripts to be
Hydrogen peroxide (H2O2) and 3-hydroxy-3 methylglutaryl
coenzyme A reductase inhibitors (statins) are known regulators of eNOS expression.13,15 H2O2 increases eNOS expression through both transcriptional and posttranscriptional
mechanisms, whereas statins increase eNOS expression
through an entirely posttranscriptional mechanism. We examined whether changes in eNOS 3⬘ polyadenylation also occur
after treatment with H2O2 or statin.
BAECS were exposed to either H2O2 (100 ␮mol/L for 24
hours) or statin (simvastatin, 10 ␮mol/L for 24 hours) and
RPA analysis was used to quantify changes in polyadenylated
eNOS mRNA (Figure 6). H2O2 treatment resulted in an
increase in long poly(A) eNOS transcripts. Statin treatment
also led to increased eNOS polyadenylation, but the response
was not as robust as that seen with shear stress or H2O2. These
data show that other stimuli can induce changes in eNOS 3⬘
polyadenylation, suggesting that this process may be a
common mechanism by which endothelial cells regulate
eNOS expression.
Discussion
The current studies provide insight into how laminar shear
stress increases eNOS mRNA stability and translational
activity by identifying a role for 3⬘ polyadenylation in the
posttranscriptional regulation of eNOS. In endothelial cells
exposed to shear stress, there was dramatic increase in
expression of eNOS transcripts with long 3⬘ poly(A) tails that
1166
Circulation Research
June 10, 2005
Figure 6. The effect of H2O2 and statin
on eNOS 3⬘ polyadenylation. A, top
panel: RPA of RNA from untreated cells
or cells treated with H2O2 (100 ␮mol/L,
24 hours). Bottom panel: group densitometric data (mean⫾SEM), expressed as
a ratio of long poly(A) eNOS mRNA to
total polyadenylated eNOS mRNA. Asterisk indicates significant difference compared with control (n⫽3, P⫽0.003,
unpaired t-test). B, RPA of RNA from
untreated cells or cells treated with statin
(simvastatin, 10 ␮mol/L, 24 hours). Bottom panel: group densitometric data
(mean⫾SEM), expressed as a ratio of
long poly(A) eNOS mRNA to total polyadenylated eNOS mRNA. Asterisk indicates significant difference compared
with control (n⫽4, P⫽0.0002, unpaired
t-test).
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
was dependent on the magnitude and duration of the shear
stress stimulus. These transcripts were more stable than those
from nonsheared cells, whose poly(A) tails were predominantly short (⬍25 nt). Furthermore, eNOS mRNA from
sheared cells was found to be more actively translated.
Finally, we found evidence that modulation of eNOS mRNA
polyadenylation occurs in response to other stimuli (H2O2 and
statins) known to increase eNOS mRNA stability. Interestingly, modulation of 3⬘polyadenylation does not appear to be
unique to the endothelial isoform of NOS. A recent report
describes a role for increased 3⬘ polyadenylation in the
regulation of the inducible isoform of NO synthase, iNOS.34
The initial step in mRNA degradation is removal of
the poly(A) tail, followed by removal of the 5⬘
7-methylguanosine cap and rapid exonuclease digestion.35–38
A long 3⬘ poly(A) tail is important to mRNA stabilization
because it facilitates binding of multiple poly(A) binding
protein (PABP1) molecules, which protects against ribonucleolytic attack.39 The poly(A) tail is also important in
allowing mRNA-ribosome interactions.40,41 In this regard,
PABP1 is involved in the formation of a “closed-loop”
structure where the 5⬘ and 3⬘ ends of the mRNA interact. We
found that eNOS translational activity was increased in
sheared endothelial cells, suggesting that this is a functional
sequela of increased polyadenylation. This concept is supported by our observation of long poly(A) RACE-PAT
products in large polysome fractions (data not shown).
In eukaryotic cells, transcription stimulates the assembly of
a protein complex that is involved in both transcription and
polyadenylation.30,31 Nuclear polyadenylation occurs immediately following 3⬘ cleavage of a newly-transcribed mRNA
precursor. In mammalian cells, the core polyadenylation
signal requires the presence of a hexanucleotide sequence, 10
to 30 nucleotides upstream from the 3⬘ cleavage site. The
published sequences for human22 and bovine21 eNOS both
appear to have hexanucleotide sequences that are single
nucleotide variants of the canonical sequence (AAUAAA).
These hexamer variants have been shown to be inefficient
signals for 3⬘ cleavage and polyadenylation. It is conceivable
that shear makes it possible for cells to overcome this
relatively inefficient polyadenylation signal.
Recently, it has become evident that some eukaryotic
mRNAs undergo cytoplasmic polyadenylation.19 As an example, the neuronal NMDA receptor mRNA has been shown
to undergo cytoplasmic polyadenylation in response to glutamate.42 We therefore considered the possibility that the
eNOS mRNA underwent cytoplasmic polyadenylation in
response to shear. The distribution of transcripts with long
poly(A) tails in nuclear and cytosolic extracts suggested,
however, these transcripts were synthesized primarily in the
nucleus. In nuclear extracts of sheared cells, the eNOS
transcripts predominantly had long poly(A) tails. In cytoplasmic extracts, both long and short poly(A) tails were observed.
This is compatible with the concept that long poly(A)
transcripts were synthesized in the nucleus, transported to the
cytoplasm and subsequently underwent some degree of
degradation.
The ability of DRB to attenuate shear-induced eNOS 3⬘
poly(A) tail lengthening further supports the concept that
eNOS polyadenylation is a nuclear process. DRB prevents
phosphorylation of RNAP II, a critical step in assembly of the
nuclear polyadenylation machinery.30,31,43 DRB and actinomycin D affect the phosphorylation state of RNAP II differently,44 and this may account for their somewhat dissimilar
effects. Actinomycin D is known to inhibit transcription, but
it can alter RNAP II phosphorylation and promote polyadenylation activity.44 This may explain the increase in long
poly(A) eNOS transcripts observed in the nuclear extracts
after actinomycin D treatment. Alternatively, actinomycin D
could be inhibiting the nuclear export of polyadenylated
eNOS mRNA.
The eNOS mRNA half-life determined in the present study
is consistent with our previous report.10 However, compared
with our previous analysis, there appeared to be a relatively
rapid decline in eNOS mRNA levels after 6 hours of DRB
treatment. The Northern analysis used in our previous assessment of stability showed a more gradual decline in eNOS
transcript levels. The RPA analysis used in the current studies
targeted the eNOS 3⬘UTR and therefore may more accurately
reflect acute changes in eNOS mRNA processing. We believe
that the pattern of protected fragments observed in our eNOS
Weber et al
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
mRNA stability studies shows that long poly(A) transcripts
become degraded into shorter transcripts over time.
The precipitous rate of decline in polyadenylated eNOS
mRNA stability 6 hours after the addition of DRB may reflect
the loss or degradation of factors that either enhance polyadenylation or stabilize the processed RNA. Indeed, the absence
of polyadenylated transcripts in cytoplasmic extracts of cells
pretreated with DRB or actinomycin D may be due to reduced
expression of a poly(A) mRNA stabilizing factor. Although
we have established that polyadenylation of eNOS mRNA is
increased by shear stress, we have not identified cis- and
trans-acting factors involved in this process. It is possible,
that shear stress increases transcription of factors responsible
for polyadenylation. Shear may also reduce expression of
cytoplasmic factors involved in mRNA deadenylation and
degradation. Future studies will need to address this issue.
Although the present study was performed using in vitro
shear conditions, it is possible that in vivo, in the presence of
constant blood flow, eNOS mRNA always has a long poly(A)
tail. Two findings from our studies indicate that modulation
of eNOS mRNA polyadenylation likely occurs in vivo. First,
there was a dose-dependent effect of shear stress on eNOS
polyadenylation. This would indicate that in vivo, sites of the
circulation with low shear stress would have eNOS transcripts with short poly(A) tails, whereas sites with high shear
stress would have transcripts with longer poly(A) tails.
Interestingly, a dose-dependent effect of shear on eNOS
mRNA levels has been observed in vivo.45 Second, polyadenylation was dependent on the duration of shear, suggesting
that brief periods of increased flow in vivo would have less of
an impact on eNOS polyadenylation than sustained increases
in flow. Furthermore, in preliminary studies, we have used
RACE-PAT on segments from mouse aorta and pig atrium
and have identified eNOS transcripts of varying poly(A) tail
lengths in these tissues (data not shown).
Shear stress is known to increase eNOS expression in
human endothelial cells,46,47 and we believe that our study is
relevant to the regulation of human eNOS. Like the bovine
polyadenylation signal, the human hexanucleotide sequence
appears to be a single nucleotide variant of the canonical
sequence. This would suggest that at baseline, polyadenylation of human eNOS is relatively inefficient, which is
consistent with the short poly(A) tail that is published for
human eNOS mRNA.22 In preliminary studies, we have
found increased polyadenylation of eNOS mRNA from
sheared human aortic endothelial cells (data not shown),
suggesting that a similar mechanism of regulation exists for
human eNOS.
Shear stress, H2O2, and statins are diverse stimuli, yet they
appear to share the ability to increase eNOS polyadenylation.
Shear stress and H2O2 are both known to increase the rate of
eNOS transcription and we found that they enhanced polyadenylation of eNOS in an analogous fashion. Statins, whose
mechanism for increased eNOS expression is entirely posttranscriptional, appeared to be a relatively weaker stimulus
for 3⬘ polyadenylation. These data support our observation
that transcriptional activation is important for polyadenylation, but, as evidenced by the response to statin, it is not
completely necessary.
Shear Stress and eNOS mRNA
1167
Recently, we described a mechanism for the posttranscriptional regulation of eNOS mRNA during cell growth that
involves binding of monomeric actin to the eNOS 3⬘UTR.18
Binding of monomeric actin was associated with decreased
eNOS mRNA stability, and H2O2 treatment led to a significant attenuation of binding activity. Interestingly, we found
only modest decrease in actin binding with statin treatment
and virtually no change in binding in response to shear. Taken
together, these data suggest that some features of regulatory
mechanisms for eNOS expression are common to diverse
stimuli, but there are also aspects of these mechanisms that
are distinct for a given stimulus. Further work will need to
define the interaction between common regulatory elements
and those that are specific to a particular stimulus.
Acknowledgments
This study was supported by National Institutes of Health (NIH)
grants HL04062-01, HL39006, PO1-58000, PO1-075209-01,
CA63640, and Merit Grant from the Veterans Administration. We
thank Tove Goldson and Choi Youkyung Hwang for their help with
the polysome analysis and RACE-PAT, respectively.
References
1. Corson MA, James NL, Latta SE, Nerem RM, Berk BC, Harrison DG.
Phosphorylation of endothelial nitric oxide synthase in response to fluid
shear stress. Circ Res. 1996;79:984 –991.
2. Kuchan MJ, Frangos JA. Role of calcium and calmodulin in flow-induced
nitric oxide production in endothelial cells. Am J Physiol. 1994;266:
C628 –C636.
3. Harrison DG, Venema RC, Arnal JF, Inoue N, Ohara Y, Sayegh H,
Murphy TJ. The endothelial cell nitric oxide synthase: is it really constitutively expressed? Agents Actions Suppl. 1995;45:107–117.
4. Palmer RM, Ferrige AG, Moncada S. Nitric oxide release accounts for the
biological activity of endothelium-derived relaxing factor. Nature. 1987;
327:524 –526.
5. Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromocyclic guanosine monophosphate inhibit mitogenesis and proliferation of
cultured rat vascular smooth muscle cells. J Clin Invest. 1989;83:
1774 –1777.
6. Alheid U, Frolich JC, Forstermann U. Endothelium-derived relaxing
factor from cultured human endothelial cells inhibits aggregation of
human platelets. Thromb Res. 1987;47:561–571.
7. Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous modulator
of leukocyte adhesion. Proc Natl Acad Sci U S A. 1991;88:4651– 4655.
8. Cai H, Harrison DG. Endothelial dysfunction in cardiovascular diseases:
the role of oxidant stress. Circ Res. 2000;87:840 – 844.
9. Ku DN, Giddens DP, Zarins CK, Glagov S. Pulsatile flow and atherosclerosis in the human carotid bifurcation. Positive correlation between
plaque location and low oscillating shear stress. Arteriosclerosis. 1985;
5:293–302.
10. Davis ME, Cai H, Drummond GR, Harrison DG. Shear stress regulates
endothelial nitric oxide synthase expression through c-Src by divergent
signaling pathways. Circ Res. 2001;89:1073–1080.
11. Yoshizumi M, Perrella MA, Burnett JC Jr, Lee ME. Tumor necrosis
factor downregulates an endothelial nitric oxide synthase mRNA by
shortening its half-life. Circ Res. 1993;73:205–209.
12. Hirata K, Miki N, Kuroda Y, Sakoda T, Kawashima S, Yokoyama M.
Low concentration of oxidized low-density lipoprotein and lysophosphatidylcholine upregulate constitutive nitric oxide synthase mRNA
expression in bovine aortic endothelial cells. Circ Res. 1995;76:958 –962.
13. Drummond GR, Cai H, Davis ME, Ramasamy S, Harrison DG. Transcriptional and posttranscriptional regulation of endothelial nitric oxide
synthase expression by hydrogen peroxide. Circ Res. 2000;86:347–354.
14. Eto M, Barandier C, Rathgeb L, Kozai T, Joch H, Yang Z, Luscher TF.
Thrombin suppresses endothelial nitric oxide synthase and upregulates
endothelin-converting enzyme-1 expression by distinct pathways: role of
Rho/ROCK and mitogen-activated protein kinase. Circ Res. 2001;89:
583–590.
1168
Circulation Research
June 10, 2005
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
15. Laufs U, La Fata V, Plutzky J, Liao JK. Upregulation of endothelial nitric
oxide synthase by HMG CoA reductase inhibitors. Circulation. 1998;97:
1129 –1135.
16. Searles CD, Miwa Y, Harrison DG, Ramasamy S. Posttranscriptional
regulation of endothelial nitric oxide synthase during cell growth. Circ
Res. 1999;85:588 –595.
17. Takemoto M, Sun J, Hiroki J, Shimokawa H, Liao JK. Rho-kinase
mediates hypoxia-induced downregulation of endothelial nitric oxide
synthase. Circulation. 2002;106:57– 62.
18. Searles CD, Ide L, Davis ME, Cai H, Weber M. Actin cytoskeleton
organization and posttranscriptional regulation of endothelial nitric oxide
synthase during cell growth. Circ Res. 2004;95:488 – 495.
19. Sachs A, Wahle E. Poly(A) tail metabolism and function in eucaryotes.
J Biol Chem. 1993;268:22955–22958.
20. Scorilas A. Polyadenylate polymerase (PAP) and 3⬘ end pre-mRNA
processing: function, assays, and association with disease. Crit Rev Clin
Lab Sci. 2002;39:193–224.
21. Nishida K, Harrison DG, Navas JP, Fisher AA, Dockery SP, Uematsu M,
Nerem RM, Alexander RW, Murphy TJ. Molecular cloning and characterization of the constitutive bovine aortic endothelial cell nitric oxide
synthase. J Clin Invest. 1992;90:2092–2096.
22. Marsden PA, Heng HH, Scherer SW, Stewart RJ, Hall AV, Shi XM, Tsui
LC, Schappert KT. Structure and chromosomal localization of the human
constitutive endothelial nitric oxide synthase gene. J Biol Chem. 1993;
268:17478 –17488.
23. Ramasamy S, Parthasarathy S, Harrison DG. Regulation of endothelial
nitric oxide synthase gene expression by oxidized linoleic acid. J Lipid
Res. 1998;39:268 –276.
24. Dewey CF, Jr., Bussolari SR, Gimbrone MA Jr, Davies PF. The dynamic
response of vascular endothelial cells to fluid shear stress. J Biomech Eng.
1981;103:177–185.
25. Choi YH, Hagedorn CH. Purifying mRNAs with a high-affinity eIF4E
mutant identifies the short 3⬘ poly(A) end phenotype. Proc Natl Acad Sci
U S A. 2003;100:7033–7038.
26. Szocs K, Lassegue B, Sorescu D, Hilenski LL, Valppu L, Couse TL,
Wilcox JN, Quinn MT, Lambeth JD, Griendling KK. Upregulation of
Nox-based NAD(P)H oxidases in restenosis after carotid injury. Arterioscler Thromb Vasc Biol. 2002;22:21–27.
27. Ruan H, Hill JR, Fatemie-Nainie S, Morris DR. Cell-specific translational
regulation of S-adenosylmethionine decarboxylase mRNA. Influence of
the structure of the 5⬘ transcript leader on regulation by the upstream open
reading frame. J Biol Chem. 1994;269:17905–11790.
28. Hill JR, Morris DR. Cell-specific translation of S-adenosylmethionine
decarboxylase mRNA. Regulation by the 5⬘ transcript leader. J Biol
Chem. 1992;267:21886 –21893.
29. Zeevi M, Nevins JR, Darnell JE Jr. Newly formed mRNA lacking polyadenylic acid enters the cytoplasm and the polyribosomes but has a shorter
half-life in the absence of polyadenylic acid. Mol Cell Biol. 1982;2:
517–525.
30. Hirose Y, Manley JL. RNA polymerase II is an essential mRNA polyadenylation factor. Nature. 1998;395:93–96.
31. Hirose Y, Manley JL. RNA polymerase II and the integration of nuclear
events. Genes Dev. 2000;14:1415–1429.
32. Richter JD. Cytoplasmic polyadenylation in development and beyond.
Microbiol Mol Biol Rev. 1999;63:446 – 456.
33. Mendez R, Richter JD. Translational control by CPEB: a means to the
end. Nat Rev Mol Cell Biol. 2001;2:521–529.
34. Murthy KG, Szabo C, Salzman AL. Cytokines stimulate expression of
inducible nitric oxide synthase in DLD-1 human adenocarcinoma cells by
activating poly(A) polymerase. Inflamm Res. 2004;53:604 – 608.
35. Wilusz CJ, Wormington M, Peltz SW. The cap-to-tail guide to mRNA
turnover. Nat Rev Mol Cell Biol. 2001;2:237–246.
36. Tourriere H, Chebli K, Tazi J. mRNA degradation machines in eukaryotic
cells. Biochimie. 2002;84:821– 837.
37. Mitchell P, Tollervey D. mRNA stability in eukaryotes. Curr Opin Genet
Dev. 2000;10:193–198.
38. Mitchell P, Tollervey D. mRNA turnover. Curr Opin Cell Biol. 2001;13:
320 –325.
39. Wang Z, Day N, Trifillis P, Kiledjian M. An mRNA stability complex
functions with poly(A)-binding protein to stabilize mRNA in vitro. Mol
Cell Biol. 1999;19:4552– 4560.
40. Mazumder B, Seshadri V, Fox PL. Translational control by the 3⬘-UTR:
the ends specify the means. Trends Biochem Sci. 2003;28:91–98.
41. Gallie DR. A tale of two termini: a functional interaction between the
termini of an mRNA is a prerequisite for efficient translation initiation.
Gene. 1998;216:1–11.
42. Huang YS, Jung MY, Sarkissian M, Richter JD. N-methyl-D-aspartate
receptor signaling results in Aurora kinase-catalyzed CPEB phosphorylation and alpha CaMKII mRNA polyadenylation at synapses. Embo J.
2002;21:2139 –2148.
43. McCracken S, Fong N, Yankulov K, Ballantyne S, Pan G, Greenblatt J,
Patterson SD, Wickens M, Bentley DL. The C-terminal domain of RNA
polymerase II couples mRNA processing to transcription. Nature. 1997;
385:357–361.
44. Casse C, Giannoni F, Nguyen VT, Dubois MF, Bensaude O. The transcriptional inhibitors, actinomycin D and alpha-amanitin, activate the
HIV-1 promoter and favor phosphorylation of the RNA polymerase II
C-terminal domain. J Biol Chem. 1999;274:16097–16106.
45. Tuttle JL, Nachreiner RD, Bhuller AS, Condict KW, Connors BA,
Herring BP, Dalsing MC, Unthank JL. Shear level influences resistance
artery remodeling: wall dimensions, cell density, and eNOS expression.
Am J Physiol Heart Circ Physiol. 2001;281:H1380 –H1389.
46. Uematsu M, Ohara Y, Navas JP, Nishida K, Murphy TJ, Alexander RW,
Nerem RM, Harrison DG. Regulation of endothelial cell nitric oxide
synthase mRNA expression by shear stress. Am J Physiol. 1995;269:
C1371–C1378.
47. Topper JN, Cai J, Falb D, Gimbrone MA, Jr. Identification of vascular
endothelial genes differentially responsive to fluid mechanical stimuli:
cyclooxygenase-2, manganese superoxide dismutase, and endothelial cell
nitric oxide synthase are selectively upregulated by steady laminar shear
stress. Proc Natl Acad Sci U S A. 1996;93:10417–10422.
Laminar Shear Stress and 3′ Polyadenylation of eNOS mRNA
Martina Weber, Curt H. Hagedorn, David G. Harrison and Charles D. Searles
Downloaded from http://circres.ahajournals.org/ by guest on June 16, 2017
Circ Res. 2005;96:1161-1168; originally published online May 19, 2005;
doi: 10.1161/01.RES.0000170651.72198.fa
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2005 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/96/11/1161
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/2005/08/15/01.RES.0000170651.72198.fa.DC1
http://circres.ahajournals.org/content/suppl/2005/05/19/01.RES.0000170651.72198.fav1.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/
Methods
Rapid amplification of cDNA ends-polyA test (RACE-PAT)
For reverse transcription (RT), one to three µg total RNA was hybridized with 0.5µmol/L
of the oligo (dT)12 primer [5’-GCGAGCTCCGCGGCCGCG(T)12-3’] and then incubated
at 50 °C for 60 min with 1 µl Superscript III, reverse transcriptase (200 U/µl, Invitrogen).
For negative control reactions, a 20 minute RNase H digestion (2 U/µl) was performed
prior to adding reverse transcriptase. RT-generated heterologous pools of cDNA were
amplified by polymerase chain reaction (PCR) using the 5’ eNOS-specific primer 5’CCC CTC CCA GCA GCG GTA TTC C-3’ and the RT oligo(dT)12 primer. PCR was
performed using 1 µl cDNA and Taq DNA polymerase (Invitrogen). The settings for the
thermal cycler were 94 °C for 3 min; 35 cycles of 94 °C for 45 sec, 55 °C for 30 sec, 72
°C for 1 min 30 sec; and termination at 72 °C for 10 min. The RACE-PAT products were
analyzed by 1.8% agarose gel electrophoresis.
Real Time RT-PCR
Reverse transcription was performed as described for RACE-PAT. Prior to PCR, cDNA
was subjected to RNase H digestion and purified with Micro Bio-Spin® 30
Chromatography Columns (Bio Rad, Hercules, California). PCR was performed on 2 µl
of cDNA using Platinum Taq (Invitrogen) and buffer that was provided with the enzyme.
The bovine eNOS primers were: 5’-CCCAACAGCCCCACGCTGACC-3’ and 5’-
CACTGTGATGGCCGAGCGAAGGTTG -3’. ENOS mRNA copy numbers were
normalized to GAPDH, which we found did not change in response to shear. GAPDH
primers were 5’-AATGGGGTGATGCTGGTGCTGAGTA-3’ and 5’GGAAGAATGGGAGTTGCTGTTGAAG-3’. For continuous fluorescence monitoring
of DNA specific binding, 0.5% SYBR® Green Dye (Roche) was used. The light cycler
settings were: 95 °C for 1 min; 45 cycles of 95 °C for 0 sec, 65 °C for 5 sec, 72 °C for 28
sec. The melting curves were obtained at the end of amplification by cooling the sample
at a rate of 20 °C/sec to 65 °C and increasing the temperature to 99 °C at 0.2 °C/sec.
Fluorescence was acquired every 0.2 °C.
Polysomal Fractionation
Static or sheared BAECs were exposed to cycloheximide (1 µg/µl) for 15 min at 37 °C
and lysed on ice for 20 minutes using buffer that contained KCl (100 mmol/L), Tris (20
mmol/L, pH 7.5), MgCl2 (5 mmol/L), Igepal (0.3%, Sigma), cycloheximide (100 µg/ml),
RNase inhibitor (100 units/ml, Invitrogen) and Protease Inhibitor Cocktail (4 µl/ml
Sigma). The lysate was centrifuged at 10,000 X g (4 °C, 10 minutes). The supernatant
was layered on top of a 15-45% sucrose gradient and centrifuged at 39,000 X g (4 °C , 75
minutes). Polysomes were fractionated into 500 µl samples with 60% sucrose solution.
Fractions were monitored by UV absorbance at 254 nm. RNA was isolated with TriReagent.
Methods
Rapid amplification of cDNA ends-polyA test (RACE-PAT)
For reverse transcription (RT), one to three µg total RNA was hybridized with 0.5µmol/L
of the oligo (dT)12 primer [5’-GCGAGCTCCGCGGCCGCG(T)12-3’] and then incubated
at 50 °C for 60 min with 1 µl Superscript III, reverse transcriptase (200 U/µl, Invitrogen).
For negative control reactions, a 20 minute RNase H digestion (2 U/µl) was performed
prior to adding reverse transcriptase. RT-generated heterologous pools of cDNA were
amplified by polymerase chain reaction (PCR) using the 5’ eNOS-specific primer 5’CCC CTC CCA GCA GCG GTA TTC C-3’ and the RT oligo(dT)12 primer. PCR was
performed using 1 µl cDNA and Taq DNA polymerase (Invitrogen). The settings for the
thermal cycler were 94 °C for 3 min; 35 cycles of 94 °C for 45 sec, 55 °C for 30 sec, 72
°C for 1 min 30 sec; and termination at 72 °C for 10 min. The RACE-PAT products were
analyzed by 1.8% agarose gel electrophoresis.
Real Time RT-PCR
Reverse transcription was performed as described for RACE-PAT. Prior to PCR, cDNA
was subjected to RNase H digestion and purified with Micro Bio-Spin® 30
Chromatography Columns (Bio Rad, Hercules, California). PCR was performed on 2 µl
of cDNA using Platinum Taq (Invitrogen) and buffer that was provided with the enzyme.
The bovine eNOS primers were: 5’-CCCAACAGCCCCACGCTGACC-3’ and 5’-
CACTGTGATGGCCGAGCGAAGGTTG -3’. ENOS mRNA copy numbers were
normalized to GAPDH, which we found did not change in response to shear. GAPDH
primers were 5’-AATGGGGTGATGCTGGTGCTGAGTA-3’ and 5’GGAAGAATGGGAGTTGCTGTTGAAG-3’. For continuous fluorescence monitoring
of DNA specific binding, 0.5% SYBR® Green Dye (Roche) was used. The light cycler
settings were: 95 °C for 1 min; 45 cycles of 95 °C for 0 sec, 65 °C for 5 sec, 72 °C for 28
sec. The melting curves were obtained at the end of amplification by cooling the sample
at a rate of 20 °C/sec to 65 °C and increasing the temperature to 99 °C at 0.2 °C/sec.
Fluorescence was acquired every 0.2 °C.
Polysomal Fractionation
Static or sheared BAECs were exposed to cycloheximide (1 µg/µl) for 15 min at 37 °C
and lysed on ice for 20 minutes using buffer that contained KCl (100 mmol/L), Tris (20
mmol/L, pH 7.5), MgCl2 (5 mmol/L), Igepal (0.3%, Sigma), cycloheximide (100 µg/ml),
RNase inhibitor (100 units/ml, Invitrogen) and Protease Inhibitor Cocktail (4 µl/ml
Sigma). The lysate was centrifuged at 10,000 X g (4 °C, 10 minutes). The supernatant
was layered on top of a 15-45% sucrose gradient and centrifuged at 39,000 X g (4 °C , 75
minutes). Polysomes were fractionated into 500 µl samples with 60% sucrose solution.
Fractions were monitored by UV absorbance at 254 nm. RNA was isolated with TriReagent.