From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Retroviral Transduction and Expression of the Human Alkyltransferase
cDNA Provides Nitrosourea Resistance to Hematopoietic Cells
By J a m e s A. Allay, Luba L. Durnenco, Orner N. Koc, Lili Liu, and Stanton L. Gerson
Myelosuppression is the dose-limiting toxicity for nitrosourea chemotherapy. This toxicity predominantly involves
modification of the 0' position of guanine with an alkyl moiety. The enzyme responsible for repair of 0'-alkylguanine
adducts, O'-alkylguanine-DNA alkyltransferase (alkyltransferase), is expressed at lowlevels in bone marrow (BM)cells.
High alkyltransferase expression prevents the cytotoxicity
and carcinogenicity ofnitrosoureas in several transgenic and
in vitro gene transfer models. We used gene transfer using
a novel myeloproliferative sarcoma virus (MPSV) based retrovirus (vM5MGMT) to express the human alkyltransferase
cDNA (MGMT) in human and murine hematopoietic cells.
Transduced K562 cells had very high levels of alkyltransferase expression and significantly increased resistance to 1.3bis (2-chloroethyl) nitrosourea (BCNU) as compared with un-
transduced K562 cells. Primary murine BM progenitors
showed a high transduction efficiency with vM5MGMT and
have increased BCNU resistance in vitro. After BM transplantation with vM5MGMT-transduced BM cells and BCNU
treatment of these mice, BM, spleenand thymus had a 10- to
40-fold increase in alkyltransferaseexpression that persisted
for at least 23 weeks posttransplantion. Progenitor cells procured from mice expressing high levels of alkyltransferase
also had increasedresistance to BCNU. Thus, an MPSVbased retroviral vector transduces mouse and human hematopoietic cells at high efficiency and results in high levels of
gene expression both in vitro and in vivo. Overexpression
of the alkyltransferase protein may protect hematopoietic
progenitors from nitrosourea-induced myelosuppression.
0 1995 by The American Societyof Hematology.
T
duced by attack at the0' position of guanine (G).'" Decomposition of methylating agents suchas procarbazine orstreptozotocin,liberatesamethyl
(m)diazonium ion, forming
06mG," whereas with chloroethylating agents such as 1,3bis (2-chloroethyl) nitrosourea (BCNU), a chloroethyl group
isliberated, forming O'chloroethylG.'* In theabsence of
DNA repair, 06mG preferentially base pairs with thymine
(T) during DNA replication, ultimately leading to a G-to-A
point mutation,I3 or the 06mG:T is recognized by the mismatch repair system and abortively replaced with a cytosine
(C) without repair ofthe O'mG adduct resulting in cytotoxicthe 06-chloroethylG adductundergoes
ity. On the other hand,
rearrangementto N'O'ethanoguanine,whichis
then converted to a very cytotoxic interstrand crosslink."
The DNA repair protein 06alkylguanine-DNA alkyltransferase (alkyltransferase)(E.C.2.1.1.63)
is themain repair
enzyme involved in removing these DNA le~ions.'~~''
The
alkyltransferase covalently transfers the 06alkylguanine adduct to a cysteine residue withinitsactivesite,leavinga
normal guanine residue in the DNA. This results in irreversible inactivation of the protein and hence a one-to-one relationship between the number of adducts repaired and the
number of alkyltransferase molecules in the nucleus.I6 We
have shown thatthechemosensitivity
of BM cells to the
nitrosoureas is caused by low levels of alkyltransferase in
hematopoietic precursor^.'^^"
As a precedent for the studies described
here, we have
expressed both the bacterial and human alkyltransferase proteins in mammalian cells and in transgenic mice. Overexpression of the alkyltransferase protein protected cells from
nitrosourea induced cytotoxicity. For instance, when bacterial alkyltransferase, coded by the ada gene, was expressed
at high levels in NIH 3T3, CCL-I and rat kidney NRK cell
lines after retroviral transduction, these cells became more
resistant to BCNU cytotoxicity.*'),*' Expression of ada in the
liver of transgenic mice lowered the levels of persistent 0'methylguanine adductsin transgenic mice treated with methylnitrosourea.22 Overexpression of the human alkyltransferase gene resultedina100-foldprotection
againstBCNU
cytotoxicity and a 25%
decrease in mutation frequency as
compared with untransfected Chinese hamster ovary (CHO)
HE OBSERVATION that myelosuppression
is the doselimiting toxicity for many chemotherapeutic agents has
led to considerationof transferring drug resistance genes into
hematopoietic precursors. For instance,themultiple
drug
resistance gene 1 ( M D R I ) codes for thep-glycoprotein transmembrane pump responsible for
transporting lipophilic compounds, including manynaturally occurring chemotherapeutic agents, out of the cell.' Transgenic mice that express the
within bonemarrow
human MDRI cDNAathighlevels
(BM) cells are resistant to the toxicity induced by several
of these agent^.^,',^ Expression has also been increased by
transduction of MDRl into murine hematopoietic progenitors using retroviral vectors.5-* Transduced BM cells show
increasedresistance toagentssuchas
taxolboth invitro
and, after BM transplantation, in vivo.'-* In addition, it has
recently been shown by Ward et al' that CD34+ progenitors
transduced with a retrovirus containing the human MDRI
cDNA can be enriched for cells expressingMDRI
high levels
in vitro by treatment with taxol.
Overexpression of MDRI does not increase resistance to
alkylating agents. Rather,resistanceis mediated by DNA
repair enzymes, glutathione and glutathione-S-transferases,
and polyamines. DNA repair isparticularlyimportant
for
one class of alkylating agents-the nitrosoureas, triazines,
and tetrazines. These agents forma variety of DNA adducts,
but the predominant mutagenic and cytotoxic lesion is in-
From the Departments of Medicine and Biology and The Cancer
Research Center, Case Western Reserve University School of Medicine, Cleveland, Ohio.
Submitted October 7, 1994; accepted February 9, 1995.
Supported in part by Public Health Service Grants No.
P30CA43703, R01 CA63193, and ROIES06288.
Address reprint requests to Stanton L. Gerson, MD, Department
of Medicine, BRB-3W, Case Western Reserve University School of
Medicine, 10900 Euclid Ave, Cleveland, OH 441064937,
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereb)) marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
0006-4971/95/851I -0125$3.00/0
3342
Blood, Vol 85,No 1 1 (June l), 1995: pp 3342-3351
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3343
GENE TRANSFER OF MGMT
MPSV
Neo
MGMT
vvvvvvl
LTR
Kpn 1
Barn HI
+
&HI
Kpnl &a1
PCR prlmcm (152 bp.)
4
sal I
4
4.7 Kb.
*
Fig 1. vM5MGMT is an MPSV based retroviral vector derived from vM5neo. The human alkyltransferase cDNA (MGMT) was cloned into a
unique Barn HI site upstream of neo. Both cDNAs ara transcribedfrom the MPSV 5’ LTR. 5’SD = 5‘ splice donor, 5’SA. 3’SA = 5’ and 3’ splice
acceptors, respectively. Alsoshown are relevant restriction sites and location of PCR primers for a 152-bp fragment of the MGMTcDNA.
Helper virus assays. Supernatant from virally-infected NIH
3T3, K562, and mouse BM cells (BM), and serum from mice transplanted with virally-infected BM cells were used to infect NIH 3T3
cells to detect infectious virus. NIH-lac cells, an NIH 3T3 cell line
containing a lacZ provirus, were also infected with the above supernatant and serum to detect proviral rescue. Secondary supernateinfected NIH 3T3 cells were ( l ) selected in 1 mg/mL G418 and
scored for colony growth, (2) procured for DNA to detect proviral
sequences by PCR amplification, or (3) cultured for 1 month at
which time supernatant was reassayed for viral particles. Supernatant
from secondary supernate NIH-lac-infected cells was used to infect
NIH 3T3 cells that were stained with X-gal to detect lacZ+ pgalactosidase-expressing cells. Supernatant from both ecotropic and
amphotropic vM5MGMT producers was assayed in this manner bimonthly from virus collections used for experimentation. At no time
was replication-competent retrovirus derived from vM5MGMT detected using the above assays, with a limit of detection of approximately 2 X 1O“j colony-forming units (CFUs)/mL.
K562 rransduction. At 80% confluence, amphotropic vM5MGMT producer cells were treated with 10 pg/mL mitomycin C
for 2 hours, washed 4 times in serum-containing medium, trypsinized, and replated in complete medium. Twenty-four hours later, 2.5
X 105/mL K562 cells were added along with human interleukin-3
(IL-3) (100 U/mL, kindly provided by Genetics Institute, Cambridge,
MA), GM-CSF (100 U/mL, kindly provided by Sandoz Research
Institute, Nutley, NJ) and 6 pg/mL polybrene. Forty-eight hours
later, the nonadherent K562 cells were procured and either analyzed
MATERIALS AND METHODS
for gene transfer or grown in medium containing 500 pg/mL G4 18.
Virus. As shown in Fig 1, pM5MGMT was constructed from
Selected cells were analyzed after 4 weeks.
pM5ne0, derived from MPSV (kindly provided by Dr C. S t o ~ k i n g ~ ~ ) .
Transduction of mouse BM cells. Murine BM was transduced
The backbone contains the neomycin resistance gene (neo) driven
as
described by other^.^"^^ Briefly, 48 hours after treatment with
off the MPSV 5’ LTR, two unique cloning sites (BamHI andEcoRI)
150 mg/kg 5-fluorouracil (5-FU) intraperitoneally, BM wasprocured
upstream of the neo gene, a packaging site that extends into the gag
from 8- to 10-week-old C3WHEN mice (Charles River, North Willgene ($’) and splice donor and acceptor sites. Two transcripts are
mington, MA) and prestimulated at 1 X lo6 cells/mL in complete
driven off the MPSV LTR; one encodes the full-length provirus,
medium for 48 hours with murine stem cell factor (SCF) (kindly
whereas the spliced transcript encodes neo only. The human alkylprovided by Amgen [Thousand Oaks, CA]), murine IL-3 and murine
transferase cDNA (MGMT) was cloned from the alkyltransferase
IL-6 (both kindly provided by DNAX, Palo Alto, CA). These cells
expressing colon cancer cell line, Vac0 6 (kindly provided by Dr
were then cocultured for 48 hours on mitomycin C-treated (see
J.K.V. Willson) using RNA-polymerase chain reaction (PCR),23 and
above) ecotropic vM5MGMT or vM5lac retroviral producer cells or
inserted into the BamHI site of pM5neo in the same orientation as
blank plates (mock infected) in fresh cytokines and polybrene. The
the 5’ LTR. Virus producing cell lines were made by transfecting
cells were then procured and analyzed for BCNU resistance or transpM5MGMT DNA into the ecotropic-producing GP + E8638 and
planted into lethally irradiated mice.
~ ~ To increase viral
amphotropic-producing GP + e n ~ A M 1 2lines.
In vitro BCNU treatmenr. The 1.5 X lo6 vM5MGMT-infected
titer, a modified supernatant “ping-pong” method was used.@
or vM5lac-infected murine BM cells or 6 X 10’ vM5MGMT-infected
Clones were selected in G418, titered by limiting dilution on NIH
or uninfected K562 cells were resuspended in serum-free media.
3T3 cells for G418 resistance, and assayed for MGMT expression
BCNU was dissolved in ethanol, diluted in serum free media, and
by Northern blot and for alkyltransferase activity. pM5lac was conadded to the cell cultures within 10 minutes of reconstitution. The
structed as previously described3’and contains the bacterial lacZ
cells were incubated for 2 hours at 37°C. procured, and washed in
gene in place of the MGMT cDNA. Both GP + E86 and GP +
envAM12 cell lines producing vM5lac were isolated as described
serum-free media. Mouse BM cells (1 X 10’) were mixed with
above.
methylcellulose, SCF (100 ng/mL), IL-3 ( I 00 U/mL), and pokeweed
cells.23Finally, in a model of secondary leukemias in humans, transgenic mice that overexpress MGMT in the thymus were markedly protected from developing methlynitrosourea-induced thymic
High-efficiency retroviral gene transduction of hematopoietic progenitor cells has been achieved for several species,
including mice, monkeys, and
Most vectors use
the Moloney murine leukemia virus (MoMuLV) backb ~ n e , ~ ’and
. ~ ’ in many cases gene expression in primary BM
cells, both in vitro and in vivo, is quite
For this
reason, we used the myeloproliferative sarcoma virus backbone (MPSV), a retrovirus with a wider host expression
range than MoMuLV vectors, caused, at least in part, by
point mutations in the transcriptional control U3 region of
the long terminal repeat (LTR).35 MPSV has been used to
express granulocyte-macrophage colony-stimulating factor
(GM-CSF) in factor-dependent myeloid cell lines36and by
Clapp et a137to evaluate the ontogeny of hematopoietic stem
cells in mouse BM and in rat fetal liver. In this study we
show that the MGMT gene expressed from MPSV expresses
alkyltransferase at high levels and results in decreased
BCNU cytotoxicity in K562 cells and primary murine hematopoietic progenitor cells both in vitro and in vivo.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
ALLAY ET AL
3344
mitogen spleen cell-conditioned media (Terry Fox Laboratories,
Stem Cell Technologies, Vancouver, BC, Canada) and plated in
triplicate at 37°C in 5% COz. Five-hundred K562 cells were mixed
with methylcellulose, hIL-3 (100 U/mL), and GM-CSF (100 UlmL)
and plated in triplicate at 37°Cin5% COz. After 10 to 12 days,
colonies greater than 50 cells were enumerated and large colonies
were picked for PCR analysis of proviral integration. For murine
BM cultures, 10 to 12 pooled colonies were assayed for MGMT
expression by RNA-PCR. Differential survival between treatment
groups was analyzed by paired t-test of the mean BCNU ICso and
comparisons at each dose of BCNU.
EM rransplantation. Eight- to ten-week-old C3WHEN mice
were lethally irradiated (1,050 rad, Cobalt source) and transplanted
4 hours later with 0.5 to 1.0 X IO‘ retrovirally or mock-transduced
BM cells or BM cells procured from primary transplant recipients.
All animals were housed in microisolator cages and given sterile
rodent chow ad libitum with drinking water supplemented with 20
U/mL bacitracin and 4 mg/mL neomycin for one week before and
three weeks after transplant. To enrich for transduced BM progenitor
cells expressing MGMT in vivo, transplanted mice were treated with
5, 10, 15, or 25 mgkg BCNU intraperitoneally 2 to 10 weeks after
transplantation. Because the aim of these experiments was to enhance transduction and expression, all mice received BCNU before
analysis.
Spleen CFU (CFU-S)assay. Eight- to ten-week-old C3HfHEN
mice were lethally irradiated (1,050 rad, Cobalt source) and transplanted with S X lo4BM cells. After 12 days, the mice were killed
and spleen colonies were enumerated under a dissecting microscope.
The colonies were isolated for further analysis.
PCR provirus analysis. DNAwas prepared from tissues using
1 mg/mL proteinase K in a buffer containing 50 mmol/L TRIS-HCI
pH 8.0, 10 mmol/L EDTA, 100 mmol/L NaC1, and 1% Triton X100. Samples were incubated 12 to 18 hours at 5 5 T , a 1:5 dilution
in H20was boiled and IO pL wasused for PCR (E. McGuire,
University of Pittsburgh, personal communication, December 1992).
Blood cells were prepared by diluting 10 pL of blood in 400 pL of
10 mmol/L EDTA and 10 mmol/L NaCI, washing twice, resuspending in water, and boiling for 3 minutes. A 350-bp mouse
P-globin fragment was amplified using the proximal primer 5’
GAAGITGGGTGCTTGGAGAC 3’, distal primer 5’ GAGCATGCTCCCTAGAATCG 3’. a 152-bp human MGMT fragment was amplified using the proximal primer S’ C’ITCACCATCCCGT’XTTCCAG 3’, distal primer 5‘ CTTCTCATTGCTCCTCCCACT 3’. and/
or a 800-bp neo fragment was amplified using the proximal primer
5‘ CAAGATGGAGG’ITCTCCG 3’ and distal primer 5’ CCAGAGTCCCGCTCAGAAGAACTCGTC 3’. The fragments were separated on a 2% agarose gel and detected by either ethidium bromide
stain or Southern blot.
RNA-PCR. Purified total RNA or RNA prepared using the proteinase W r i t o n X-100 method (as above) was digested extensively
(30 to60 minutes) with DNase1 (amplification grade; BRL, Gaithersberg, MD) according tothe manufacturer’s instructions. Reverse
transcription and PCR were performed using the Perkin-Elmer Cetus
(Norwalk, CT) RNA-PCR kit following the manufacturer’s instructions. Under these conditions, PCR without reverse transcriptase
failed to amplify, indicating complete DNA digestion.
Alkyltransferase assay. Tissue alkyltransferase was measured as
previously described.” Briefly, enzyme activity was measured as
t3H]-rnethyl groups removed from [3H]-06-MeGpresent in calf thymusDNA alkylated with [3H]-methylnitrosourea (specific activity
of 0.047 fmol O6-MeG/1 pg DNA). The alkylated [’H]-06-MeG and
N7-methylguanine bases were separated by high-performance liquid
chromatography (HPLC) and quantified by liquid scintillation. N7methylguanine was used as the internal standard. Alkyltransferase
activity was expressed as fmol O‘-MeG removed/l pg DNA. All
assays were repeated two to five times per sample.
Western blots. Tissues were lysed by sonication and boiling in a
buffer containing 50 m m o w TRIS-HCI, pH 6.3,2% sodium dodecyl
sulfate (SDS), 1% P-mercaptoethanol, 0.1 m o m dithiothreitol
(DTT), S% sucrose, and 300 pmol/L Na02 thovanadate. Total protein was quantitated by a modified Bradford assay (Bio-Rad Laboratories, Hercules, CA), and 30 to 50 pg of denatured proteinwas
separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE)
and electroblotted onto Immobilon PC (S&S, Keene, NH). Human
alkyltransferase was detected using the monoclonal antibody
(MoAb) MT3.1M(kindly provided by D. Bigner and T. Brent). Signal was detected using a goat-antimouse IgG conjugated to horseradish peroxidase and developed via chemiluminescence using the ECL
kit from Amersham according to the manufacturer’s instructions.
Band intensity was quantified using a standard curve of cell extract
from K562 cells infected with vM5MGMT that express high levels
of MGMT, using a Bio-Rad densitometer.
RESULTS
Retroviralvectorexpression
in K562 cells. Ecotropic
and amphotropic vM5MGMT producer cell lines derived
from GP + E86 and GP + envAM12, respectively, were
established by transfection of the pM5MGMT plasmid (Fig
1). Viral supernatant was collected daily for 6 days from
producer cells that were initially 80% confluent. The viral
titer increased over a 6-day period: fourfold in ecotropic
producers (0.5 -+ 0.3 to 2.2 ? 0.1 X lo6 CFU/mL; n = 3),
and 2.5-fold in amphotropic producers (0.5 2 0.6 to 1.2 2
0.5 X lo6 CFU/mL;n = 3). Supernatants collected on days
4 through 6 were used for the gene-transfer experiments. All
assays for replication competent retrovirus, both in vitro and
in vivo, were negative throughout this study.
To determine viral integration and expression in hematopoietic cells, vM5MGMT-transduced, G418-selected K562
cells were examined. Southern blots showed intact genomic
provirus, and Northern blots showed intact full length and
correctly spliced viral transcripts (data not shown).
vM5MGMT infection of K562 results in BCNU resistance.
To determine whether alkyltransferase expression from
vMSMGMTin K562 cells increased resistance to nitrosoureas, K562- and vM5MGMT-transduced K562 cells were
exposed to increasing concentrations of BCNUandthen
plated in methylcellulose. Figure 2 shows that uninfected
K562 cells had an ICso of 1.5 pmoVL BCNU, whereas
vM5MGMT-infected, unselected K562 cells had an IC5oof
4.7 y m o E BCNU ( P .02), and infected cells selected for 4
weeks in G418 had an IC500f32 ymoVL BCNU ( P = .001).
Similar results were obtained in cells evaluated for the neo
gene G418 resistance (data not shown).
Infection and expression of vM5MGMT in primary murine
hematopoietic progenitorcells.
Primary murine hematopoietic cells were infected as described in Materials and
Methods. To detect provirus in colony-forming unit-cell
(CFU-C), PCR amplification of a 152-bp region of the human MGMT cDNA and a 350-bp region of the P-globin
gene was used. A high proportion of individual CFU-C progenitors (223/278) collected over the course of six separate
gene transduction experiments were positive for MGMT.
Expression of MGMT mRNA in pools of 8 to 10 colonies
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
GENETRANSFER
OF MGMT
3345
.................a-..........
.......p-................
0-
Q
vM5MGMT transduced
G41 8 selected
‘Q
8
vM5MGMT
transduced
p<o.o001
p<o.o001
20
10
0
l
1
40
0
BCNU pM
BCNU pM
Fig 4. BCNU resistance in vM5MGMT-transduced murine hemato5-FU-treated mice was infected
poietic progenitorsin vitro. BM from
with vM5MGMT or vM5lac by coculture and cytokine stimulation.
Cells were then treated with BCNU and plated in a hematopoietic
progenitor assay and scored for survival relative t o an untreated
control. (*l0 pmol/L BCNU, P = .04; +* 20 pmol/L BCNU, P = .03;
**+ 30 pmol/L and 40 pmol/L BCNU, P < .0001.)
Fig 2. BCNU resistance in vM5MGMT-transduced K562 cells. K562
cells were infected with amphotropic vM5MGMT. Transduced K562
cells were treatedwith BCNU immediately after transduction or after
G418 selection, plated in methylcellulose, and scored for survival
relative t o an untreated control. Uninfected K562 cells served as a
control. ( P < .0001, vM5MGMT transduced v K562, and vM5MGMT
transduced G418 selected Y K562, for allBCNU concentrations examined.)
in three separate paired experiments, the mean BCNU ICs0
for the vM5MGMTtransduced BM progenitors was 16.3
pmol/L compared with 11.6 pmol/L for the vM5Lac transduced or untransduced BM progenitors ( P = .03). At all
concentrations of BCNU examined, the survival advantage
of the vM5MGMT transduced BM progenitors was significantly greater than that of the controls ( P < .01).
In vivopersistence of vMSMGMT provirus in murine
hematopoietic cells. Lethally irradiated mice were transplanted with vM5MGMT-transduced BM. Because enrichment was noted after G418 selection of vM5MGMT-transduced K562 cells in vitro (Fig 2) all mice were treated with
BCNU ip at 2, 4, and/or I O weeks after transplantation.
Twenty-four transplant recipients were killed and analyzed
between 7 and 54 weeks after transplantation for proviral
integration and expression in hematopoietic tissues. Overall,
was detected by RNA-PCR in 17/22 pools. Figure 3 shows
representative PCR amplifications. Similar results were obtained in colonies evaluated for the neo gene (data not
shown). To assay transduction of early hematopoietic progenitors, day 12 CFU-S (CFU-SI2)were analyzed. A majority of CFU-SI2(25/34) were positive for the vM5MGMT
provirus by PCR. Of these, 7/12 showed expression by RNAPCR and/or Western blot.
vM5MGMT- or vM5lac-transduced or uninfected murine
BM progenitors were assayed for resistance to BCNU. Figure 4 shows a representative experiment where vM5MGMT
transduced progenitors showed increased resistance to
BCNU relative to those transduced withvMSlac,withan
increase in the BCNU ICs0 from 14.4 to 21 pmol/L. Overall,
Fig 3. vM5MGMT integration and expression in
primary murine hematopoietic progenitors. BM
cells
from 5-FU-treated mice
were
infected
with
vM5MGMT by coculture with cytokine stimulation.
Individual progenitor colonies or pooled progenitor
colonies were assayed for proviral integration and
expression, respectively. Shown are representative
PCR amplifications. (A)PCR amplification of a 152-bp
fragment of the MGMT cDNA and a 350-bp fragment
representing a coamplified p-globin internal control.
Lanes 1-10, left, mouse a; lanes 1-5, right, mouse b.
(B) Reverse transcription and PCR amplification of a
152-bp MGMTfragment.
(+, with reverse transcriptase; -, indicates reverse transcriptase omitted). The positive control is RNA from vM5MGMT
transduced, G418-selected K562 cells.
30
A
1
2
3
4
5
8
7
8
9
1
0
1
2
3
4
5
e
a
hloMn
#GMT
B
152
b
p
+
+
-
+
-
+
.
+
-
+
-
+
pos
-
+
W
313
111
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3346
ALLAY
ET AL
Table 1. PCR Analysis of Long-Term vM5MGMT ProviralPersistence in Hematopoietic Tissue of Mice
Transplanted With vM5MGMT-Transduced BM
~~~
~
~
Weeks After Transplantation
Priman/ BMT Recipients
7
16
112
BM
Spleen
011
Thymus
111
Blood
ND
CFU-C
313
8/10
9111
111
711
3131
ND
911
2120
2121358
CFU-Sl2
717
616
212
717
711
ND
313
l141169
14/18
Sample
~~~
54
Secondary BMT Recipients
23
37
8
30
42
56
~~
ND
212
313
ND
30134
ND
ND
ND
8112
ND
518
ND
ND
10116
NDND
511 30138
ND
ND
212
9
Abbreviation: ND, not determined.
Lethally irradiated mice were transplanted with BM transduced with vM5MGMT (weeks 7 through 54). Secondary BMT recipients (weeks 8
through 56) were transplanted with vM5MGMT-transduced BM from primarytransplant recipients. All mice were killed at indicated times and
BM, spleen, thymus, peripheral blood, and BM-derived progenitors (CFU-C, CFU-S12)were analyzed for vM5MGMT proviral presence by PCR.
The proportion of samples with evidence of provirus by PCR are shown.
CFU-S,2 and to generate seven secondary transplant recipients. As indicated in Table 1 and representative data shown
in Fig 6C, the majority of CFU& contained an integrated
provirus detected by PCR. In addition, a large majority of
BM, BM-derived progenitors, spleen, and thymus samples
from these mice showed evidence of persistent proviral integration by PCR.
In vivo expression of the transduced human MGMT cDNA.
The composite data for expression by RNA-PCR and Westem blot are shown in Table 2. Expression from vM5MGMT
Table 1 shows 18/22 of the BM samples, 22/24 of the spleen
samples, 19/23 of the thymus samples, and 14/15 of the
peripheral blood samples showed evidence of proviral integration by PCR. In addition, 364/573 of the C m - C colonies
cultured from recipient BM from 17 mice in S separate experiments had evidence of integrated provirus byPCRof
the MGMT cDNA. Figure 5B shows a representative PCR
of the presence of provirus in CFU-C.
BM was procured from one mouse per time point at 7,16,
and 32 weeks after transplantation to assay for the provirus in
MGMT
Lac
BM S p l Thy PB BM Spl Thy PB
A
l 2 3 4 5 6 7 8 9 1 0 1 2 3 4 5
B
C
%o por
1
2
3
4
5
6
7
x
n
e
g
x
w
x
p
152bp -b
.
Fig 5. vM5MGMT provirus detected
in hematopoietic tissuesin vivo Lethally irradiated mice were transplanted
with vM5MGMT or VM5lac
transduced BM cells. Mice wereanalyzed between seven and 54 weeks for presence of the provirus within hematopoietic
tissues. Shown are
representative PCR results. BM, BM, Spl, spleen, Thy,thymus, PB, peripheral blood. (A) Southern blot ofDNA amplified for the152-bpfragment
of the MGMT cDNA from mice transplanted with BM transduced with vM5MGMT or vM5lac. A coamplified 350-bp P-globin fragment, used
as an internal control, was present on the gel in all vM5lac and vM5MGMT transduced tissues, but did not hybridize with the UP-labeled
MGMT probe. (B) Gel showing the152-bp MGMT PCR fragment in untreated CFU-C colonies (lanes 1-10, left) and CFU-C colonies treated with
BCNU (lanes 1-5, right) from BMof vM5MGMT transduced mice. The 350-bp coampliiied 0-globinserves as an internal control.(C) vM5MGMT
proviral integrationin secondary CFU-S12.PCR coamplification of a 152-bp MGMT fragment and a 350-bp 0-globin fragment. Also shown isa
secondary CFU-S12from a mouse transplantedwith vM5lac-transduced BM cells (neg) and H 2 0 as negative controls, and pM5MGMT (pos) as
a positive control.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
GENETRANSFEROF
A
3347
MGMT
B M S D I T h Y S P I
pos
~
-
152 bp
+
+
-
+
-
+
.
+
I
-
+
I
BM, and four mice transplanted with vMSlac,or mock transducedBM, P = .OOOS). Atall concentrations ofBCNU
examined, the BM progenitors from mice transplanted with
vM5MGMT-transduced BM had a significantly greater survival than the concurrent controls ( P < .01).
DISCUSSION
2 l k d -b
Fig 6. vM5MGMT expression in vivo. Lethallyirradiatedmice
were transplanted with vM5MGMT-transduced BM cells and analyzed for MGMT expression between 7 and 37 weeks after hansplantation. Spl, spleen, Thy, thymus, PB, peripheral blood. (AI Total
RNA was isolated fromtissues and used as a template in RNA-PCR
amplifications for MGMT expression. Samples where reverse transcriptase was omitted(-1 were negative. The positive control(pos) is
RNA from vM5MGMT-transduced, G418-selected K562 cells.x, blank
lane. (B) Tissues were lysed and protein extracts (50 p g l were separated on a 13% SDS-PAGE. The subsequent blot was probed with
MoAb (MT3.1U) directed against human alkyltransferase and developed using chemiluminescence. Protein extracts from spleen
a
from
a mouse transplanted with vM5lac-transduced BM served as the negative control (-1. Positive controls are protein extracts (1.5,3.0 pg)
from vM5MGMT-transduced, G418-selected K562 cells.
was detected in the BM and thymus up to 23 weeks after
transplantation in 11/14 mice, and in the spleens of 15/18
mice up to 37 weeks. Similarly, the majority of hematopoietic progenitors (CFU-C and CFU-S12) assayed showed
MGMT expression (Fig 7). Alkyltransferase activity was
markedly increased in BM, spleen, and thymus as shown in
Fig 6 , reaching mean values of 839 fmol/yg protein in BM,
40-fold above endogenous levels (21 fmol/yg protein); 8 10
fmol/yg protein in spleen,lO-fold above endogenous levels
(78 fmollyg protein); and 1 183 fmol/yg protein in thymus,
14-fold above endogenous levels (87 fmol/pg protein).
Given the high rate of gene transduction and expression, no
change in alkyltransferase wasnoted in mice exposed to
high doses of BCNU.
To assess whether BM progenitors from mice that were
recipients of vMSMGMT-transduced BM were resistant to
BCNU-induced cytotoxicity, we determined the BCNU survival of marrow-derived CFU-C. All animals with detectable
vMSMGMT proviral integration and expression in the BM
had increased survival after BCNU exposure relative to uninfected or vM5lac infected controls assayed concurrently.
Figure 8 shows a representative experiment using BM from
mice transplanted 18 weeks earlier withvM5MGMT- or
vMSlac-transducedmarrow. MGMT expressing micehad
increased resistance to BCNU, with anincrease in the BCNU
ICso from 5 to 9 ymol/L. A small proportion of progenitors
appeared particularly resistant with 3% and 1 o/o CFU-C survival at 40 and 50 ymol/L, respectively, in the vM5MGMT
group compared with none in the vMSlac group. Overall,
themeanBCNUICso for the vM5MGMT-transduced BM
was 13.2 pmol/L, whereas for mock or vM5lac-transduced
BM, the mean BCNU ICso was 9.7 ymol/L (four independent, paired viral transductionhansplantation experiments,
a total of six mice transplanted with vMSMGMT-transduced
In these studies the MPSV-based
retroviral
vector,
vMSMGMT, was used to increase alkyltransferase expression and reduce nitrosourea induced cytotoxicity in human
and mouse hematopoietic cells. Amphotropic vM5MGMT
transduced K562 cells showed significantly increased BCNU
resistance immediately after transduction relative to untransduced K562 cells. After G418 selection, these cells had extremely high levels of alkyltransferase activity and the
BCNU ICso was over 15-fold higher than in untransduced
K562 cells. Primary murine BM cells transduced with ecotropic vM5MGMT express human alkyltransferase in vitro
and in vivo at high levels for prolonged periods of time in
multiple hematopoietic lineages after BM transplantation.
vM5MGMT-transduced BM progenitor cells also had increased resistance to BCNU relative to mock and vM5lactransduced BM progenitors both in vitro and in vivo.
The MPSV LTR derived from pM5neo contains a point
mutation in the enhancer region that creates an additional
SPI binding
This additional transcriptional enhancer
binding site has been hypothesized to be responsible for the
increase in its expression in many hematopoietic cell lines,"6
and in mouse BM and BM-derived progenitors J7 when compared with the MoMuLV LTR or other internal promoters.
In addition, expression in embryonic carcinoma cells from
pM5neo-derived vectors have been de~cribed?~
whereas
many MoMuLV vectors are transcriptionally silent in these
precursor
These factors make
MPSV vectors attractive for gene therapy where high expression of the transduced
gene is required.
In our studies, the most striking result was
that
vM5MGMT transduction of hematopoietic progenitors resulted in a 10- to 40-fold increase over endogenous
alkyltransferase levels in lymphoid and myeloidcells in vivo,
Table 2. Expression of the Human Alkyltransferase Gene in
Lethally Irradiated MiceTransplanted With
vM5MGMT-Transduced BM
Weeks After Transplantation
Sample
7
16
23
31
3/3
213
3/3
ND
ND
011
~~~~
BM
Spleen
Thymus
CFU-C
CFU-S,,
416
616
515
41/57
213
4/5
111616
315
ND
13/33
ND
ND
011
Abbreviation: ND, not determined.
Mice transplanted with vM5MGMT-transduced BM were sacrificed
at the indicated times after transplantation and the BM, spleen, thymus, and BM-derived progenitors (CFU-C and CFU-St2) were collected.These samples were assayed forhuman alkyltransferase
expression by RNA-PCR and Western blot. The proportion of these
samples showing evidence of expression is shown.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3348
ALLAY ET AL
3000-
2000W
1000-
0
A
W
B
vM5NIGMT
+
I
+
+
Spleen
Thymus
representing a significant increase in the DNA repair capacity of 06-guanine adducts in these cells. In previous studies,
transgenic mice and cell lines that overexpressed MGMT
had increased repair of both 06mG adducts after methylating
agent exposure and 06-chloroethyl precrosslink lesions after
BCNU exposure.2s24 In
hematopoietic progenitors, increased
DNA repair capacity should increase drug resistance and
protect cells from the mutagenic and carcinogenic effects of
these adducts.
To enrich for high expressing cells, selection was applied
to transduced K562 cells in vitro. vM5MGMT transduced,
G418-selected K562 cells had very highalkyltransferase levels, reaching levels seen in MGMT transfected C H 0 cellsz3
and the thymus of mice transgenic for the MGMT-CD2
gene.z4These K562 cells also had high levels of expression
of the neo gene from the MPSV LTR. Northern analysis
showed approximately equal abundance of the full length
and spliced proviral mRNA (J.A. Allay, S.L. Gerson, manuscript in preparation). Thus, with this vector, selection in
G418 did not alter the production of full-length mRNA encoding MGMT from the provirus.
Based on these results, the mouse transplant studies were
designed to select for cells expressing the MGMT transgene
by treating the mice with BCNU after reconstitution. As
noted above, mouse tissue expression of MGMT resulted in a
marked increase in alkyltransferase activity over endogenous
levels. Nonetheless, because there was no other selection,
these hematopoietic tissues most likely contain cells with
I
Fig 7. Alkyltransferaseactivity of tiuuas from mice transplanted with vM5MGMT-transd u d BM.Lethdtyirradiated
mice
were
transplanted
with
vM5MOMT-transduced BM cells
andanalyzedforalkyltransferase activity between seven and
37 weaksaftartransplantation
using a biochemical assay or
densitometric
quantitation
of
Western blots. The graph shows
thespread
of alkyltransferase
activity (in fmollmg protain) in
the BM, spleens, and thymuses
ofnormalmice
(-1 andmice
transplanted with vM5MOMTtransduced (+) BM.
quite variable expression of the two transduced genes. This
limits measurements of efficacy based on myelosuppression
because many cells wouldnot express levels of MGMT
necessary for detectable drug resistance.
We were interested in the issue of in vivo selection of
hematopoietic precursors expressing MGMT. However, only
3 of 24 mice transplanted with MGMT transduced cells did
not receive BCNU.In general, we achieved a high level
of gene transfer and high mean levels of alkyltransferase
expression in MGMT transplanted mice after BCNU treatment. We were unable to detect a difference in mice left
untreated compared with mice treated with BCNU in BM
cellularity or in the proportion of CFU-C that was either
proviral positive or more resistant to BCNU in vitro. However, of note, four mice (1/3 untreated and 3/21 exposed to
BCNU) had evidence of poor gene transfer efficiency, ie,
BM CFU-C hadlowor no vMSMGMT transduction and
showed no expression of human alkyltransferase, and there
was no evidence of proviral presence and low or no human
alkyltransferase expression in hematopoietic tissues. These
mice had no evidence of increased CFU-C resistance to
BCNU in vitro over that observed in control mice. In contrast, when provirus was detected, CFU-C expressed MGMT
and had increased BCNU resistance.
While this suggests that MGMT gene transduction was
associated with BCNU resistance, a direct comparison of
vM5MGMT transduced progenitors between transplanted
mice with or without BCNU administration wasnotper-
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
GENETRANSFER
3349
OF MGMT
h
Fig 8. BCNU resistance in murine hematopoietic
progenitors. M i transplanted with vM5MGMT- or
treated
with
v M 5 l a c - t r a ~ c e d BM cells were
BCNU 2 and 10 weeksaftertransplantationand
killed after 18 wwks. BM from these animals was
analyzed for BCNU resistance
as in Fig 5. ( P c. .OOO1
for a11 BCNU concentrations examinedl
0.1
0
formed. In vivo selection of genetically transduced cells expressing MGMT would require a large cohort of transplanted
mice, half of which would receive repeated doses of BCNU,
using endpoints of white blood cells, marrow cellularity and
in vitro BCNU resistance of CFU-C. Animals receiving repeated doses of BCNU would be expected to more uniformly
express alkyltransferase.
An alternative strategy would be to use an alkyltransferase
molecule that is resistant to the inhibitor O%enzylguanine,"
such as the bacterial:' mouse:'
or mutant forms of the human alkyltransferase?* These recently described mutants
should enhance the survival advantage of transduced cells
after treatment with the combination of 06-benzylguanine
and BCNU compared with that seen with BCNU alone.
Our data indicate a modest but significant increase in
BCNU resistance in BM progenitors from vMSMGMT transplanted mice relative to vM5lac or mock-transplanted
mice.The degree of protection is somewhat less than might
have been predicted by the increase in repair capacity, and
could be the result of several parameters involving alkylation
of DNA by BCNU and its repair. First, the major cytotoxic
lesion induced by BCNU is the interstrand DNA cross-link.'*
Because the preferred substrate of the alkyltransferase is
the 06-methylguanine
repair of the precross-link
adduct may occur at a slower rate allowing some cross-links
to form even in the presence of the active enzyme. Second,
because 06-chloroethylguanine is a minor alkylation product
of chloroethylnitroso~reas~~
there may be additional BCNUinduced cytotoxic lesions not repairable by MGMT.
The relative increase in BCNU resistance was greater in
K562 cells than murine BM after vM5MGMT transduction.
This can be attributed to the fact that murine BM cells have
low but detectable endogenous alkyltransferase levels,
io
io
30
40
50
D
BCNU pM
whereas K562 cells lack activity completely, and also that
other potential resistance mechanisms to BCNU cytotoxicity
may not be present in K562 cells, whereas they may be
operative in normal hematopoietic precursors. For instance,
we previously reported that treatment of K562 cells with an
alkyltransferase inhibito8' did not sensitize these cells to
BCNU, whereas inhibiting alkyltransferase in BM progenitors resulted in a 2- to 3-fold reduction in their BCNU LDso.
Even after alkyltransferase depletion, BM progenitors remained more resistant to BCNU than K562 cells.M This
indicates that other repair mechanisms such as nucleotide
excision repair?' g1utathione?' glutathione-S-transfera~e~~
and polyamines,@'
which have been shown to play a role in
chloroethylnitrosourea resistance in some tumors,may play
a role in BCNU resistance in BM progenitors.
The observation that vMSMGMT transduction increases
alkyltransferase levels and BCNU resistance in murine and
human hematopoietic cells has led us to evaluate transduction of human CD34' hematopoietic precursors with the
anticipation that similar protection from BCNU-induced cytotoxicity will occur.
ACKNOWLEDGMENT
We thank Dr Wade Clapp for insightful discussionsand Jennifer
Steckley, Kelly Barrett, Julie Smith,andEsther Allay for expert
technical assistance. T. Breutandand D. Bigner are thanked for
supplying "3.1 MoAb.
REFERENCES
1. Chin K-V, Pastan I, Gottesman M
M
: Function and re.gulation
of thehumanmultidrug resistance gene. Adv Cancer Res 60:157,
1993
2. Galski H, Sullivan M, Willingham MC, Chin K-V, Gottesman
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3350
MM, Pastan I, Merlino GT: Expression of a human multidrug resistance cDNA (MDRI) in the bone marrow of transgenic mice: Resistance to daunomycin-induced leukopenia. MolCellBiol
9:4357,
1989
3. Mickisch GH, Merlino GT, Galski H, Gottesman MM, Pastan
I: Transgenic mice that express the human multidrug-resistance gene
in the bone marrowenable a rapid identification of agents that reverse
drug resistance. Proc Natl Acad Sci 88:547, 1991
4. Mickisch GH, Licht T, Merlino GT, Gottesman MM, Pastan
I: Chemotherapy and chemosensitization of transgenic mice which
express the human multidrug resistance gene in bone marrow: Efficacy, potency, potency and toxicity. Can Res 51:5417, 1991
5. McLachlin JR, Eglitis MA, Ueda K, Kantoff PW, Pastan I H,
Anderson W F, Gottesman MM: Expression of a human complementary DNA for the multidrug resistance gene in murine hematopoietic
precursor cells with the useof retroviral gene transfer. J Natl Cancer
Inst 82:1260, 1990
6. Hanania EG, Deisseroth AB: Serial transplantation shows that
early hematopoietic precursor cells are transduced by MDR-l retroviral vector in a mouse gene therapy model. Cancer Gene Ther
l:2l, 1994
7. Sorrentino BP, Brandt SJ, Bodine DM, Gottesman MM, Pastan
I, Cline A, Nienhuis AW: Selection of drug-resistant bone marrow
cells in vivo after retroviral transfer of human MDRI. Science
257:99, 1992
8. Podda S, Ward M, Himelstein A, Richardson C, de la FlorWeiss E, Smith L, Gottesman MM, Pastan I, Bank A: Transfer and
expression ofthehuman
multiple drug resistance gene into live
mice. Roc Natl Acad Sci USA 89:9676, 1992
9. Ward M, Richardson C, Pioli P, Smith L, Podda S, Goff S,
Hesdorffer C, Bank A: Transfer and expression of the human multiple drug resistance gene in human CD34+ cells. Blood 84:1408,
1993
10. Pegg AE: 06alkylguanine-DNA alkyltransferase: Regulation
and importance in response to alkylating carcinogenic and therapeutic agents. Cancer Res 50:6119, 1990
11. Richardson KK, Richardson FC, Crystal RM, Swenberg JA,
Skopek TR: DNA base changes and alkylation following in vivo
exposure of Escherichia coli to N-methyl-N-nitrosourea. Proc Natl
Aca Sci 84:344, 1989
12. Tong WP, Kirk MC, Ludlum DB: Formation of the cross
link l-(N3-deoxycyctidyl), 2-(NI-deoxyguanosiny1)-ethane inDNA
treated with N,N1-bis(2-chloroethyl)-N-nitrosourea.Cancer Res
42:3102, 1982
13. Toorchen D, Topal MD: Mechanisms of chemical mutagenesis and carcinogenesis: Effects on DNA replication of methylation
at the 06-guanine position of dGTP. Carcinogenesis 4:1591, 1983
14. Pegg AE, Weist L, Foote RS, Mitra S, Perry W: Purification
and properties of 06-methylguanine-DNA transmethylase from rat
liver. J Biol Chem 258:2327, 1983
15. Pegg AE, Sciccitano D, Dolan ME: Comparison of the rates
of repair of Oh-alkylguaninesin DNA by rat liver and bacterial 06alkylguanine-DNA alkyltransferase. Cancer Res 44:3806, 1984
16. Bogden JM, Eastman A, Bresnick E: A system in mouse liver
for the repair of O'-methylguanine lesions in methylated DNA. Nuc
Acids Res 9:3089, 1981
17. Gerson SL, Miller K, Berger NA: O'Alkylguanine-DNA alkyltransferase activity in humanmyeloid cells. J Clin Invest 76:2106,
1985
18. Gerson SL, Trey JE, Miller K, Berger NA: Comparison of 06alkylguanine-DNA alkyltransferase activity based on cellular DNA
content in human, rat, and mouse tissues. Carcinogenesis 7:745,
1986
19. Gerson SL, Trey JE, Miller K, Benjamin E: Repair of Ob-
ALLAY ET AL
alkylguanine during DNA synthesis in murine bone marrow hematopoietic precursors. Cancer Res 47:89, 1987
20. Dumenco LL, Warman B, Hatzoglou M, Lim IK, Abboud
SL, Gerson SL: Increase in nitrosourea resistance in mammalian
cells by retrovirally mediated gene transfer of bacterial Oh-alkylguanine-DNA alkyltransferase. Cancer Res 49:6044, 1989
21.Lim IK, Dumenco LL, Hatzoglou M, Hanson RW, Gerson
SL: Increased drug resistance following retroviral gene transfer of
a chimeric P-enolpyruvate carboxykinase (GTP)-bacterial Oh-alkylguanine-DNA alkyltransferase gene into NRK cells. Carcinogenesis
1I :737, 1990
22. Dumenco LL, Arce C, Norton K, Yun J, Wagner T, Gerson
SL: Enhanced repair of 0'-methylguanine DNA adducts in the liver
of transgenic mice expressing the ada gene. Cancer Res 51:1991
23. Minnick DT, Gerson SL, Dumenco LL, Veigl ML, Sedwick
WD: Specificity of bischloroethylnitrosourea-induced mutation in a
Chinese hamster ovary cell line transformed to express human 06alkylguanine-DNA alkyltransferase. Cancer Res 53:997, 1993
24. Dumenco LL, Allay E, Norton K, Gerson SL: The prevention
of thymic lymphomas in transgenic mice by human O'-alkylguanineDNA alkyltransferase. Science 259:219, 1993
25. Dick JE, Kamel-Reid S, Murdoch B, Doedens M: Gene transfer into normal human hematopoietic cells using in vitro and in vivo
assays. Blood 78:624, 1991
26. Cournoyer D, Scarpa M, Mitani K, Moore KA, Markowitz
D, Bank A, Belmont JW, Caskey CT: Gene transfer of adenosine
deaminase into primitive human hematopoietic progenitor cells. Human Gene Ther 2:203, 1991
27. Nienhuis AW, McDonagh KT, Bodine DM: Gene transfer
into hematopoietic stem cells. Cancer 67:2700, 1991
28. Kantoff PW, Gillo AP, MacLachlin JR. Bordignon C, Eglitis
MA, KernanNA, Moen RC, Kohn DB, Yu SF, Karson E: Expression
of human adenosine deaminase in nonhuman primates after retrovirus-mediated gene transfer. J Exp Med 166:219, 1987
29. Karlsson S: Treatment of genetic defects in hematopoietic
cell function by gene transfer. Blood 78:2481, 1991
30. McIvor RS, Johnson MJ, Miller AD, Pitts S, Williams SR,
Valerio D,Martin Jr. DW, Verma IM: Human purine nucleoside
phosphorylase and adenosine deaminase: Gene transfer into cultured
cells and murine hematopoietic stem cells by using recombinant
amphotropic retroviruses. Mol Cell Biol 7:838, 1987
3 1. Williams DA, Orkin SH, Mulligan RC: Retrovirus-mediated
transfer of human adenosine deaminase gene sequences into cells in
culture and into murine hematopoietic cells in vivo. Proc Natl Acad
Sci USA 83:2566, 1986
32. Bowtell D, Cory S, Johnson G, Gonda T: Comparison of
expression in hematopoietic cells by retroviral vectors carrying two
genes. J of Virol 62:2464, 1988
33. Williams DA, Lim B, Spooncer E, Longtine J, Dexter TM:
Restriction of expression of an integrated recombinant retrovirus in
primary butnot immortalized murine hematopoietic stem cells.
Blood 71:1738, 1988
34. Dzierzak E, Papayannopoulou T, Mulligan R: Lineage-specific expression of a human @-globingene in murine bone marrow
transplant recipients reconstituted with retrovirus-transduced stem
cells. Nature 331:35, 1988
35. Stocking C, Kollek R, Bergholz U, Ostertag W: Point mutations in the U3 region of the long terminal repeat of Moloney murine
leukemia virus determine disease specificity of the myeloproliferative sarcoma virus. Virology 153:145, 1986
36. Laker C, Stocking C, Bergholz R, Hess N, De Lamarter JF,
Ostertag W: Autocrine stimulation after transfer of the granulocyte/
macrophage colony-stimulating factor gene and autonomous growth
are distinct but interdependent steps in the oncogenic pathway. Proc
Natl Acad Sci USA 84:8458, 1987
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
GENE TRANSFER OF MGMT
37. Clapp DW, Freie B, Srour E, Yoder MC, Fortney K, Gerson
SL: Myeloproliferative sarcoma virus directed expression of P-galactosidase following retrovirus transduction of murine hematopoietic cells. J Exp Hematol 1995 (in press)
38. Markowitz D, Goff S, Bank A: A safe packaging line for
gene transfer: Separating viral genes on two different plasmids. J
Virol 62:1120, 1988
39. Markowitz D, Goff S, Bank A: Construction and use of a
safe and efficient amphotropic packaging cell line. Virology 167:400,
1988
40. Bodine DM, McDonagh KT, Brandt SJ, Ney PA, Agricola
B, Byme E, Nienhuis AW: Development of a high-titer retrovirus
producer cell line capable of gene transfer into rhesus monkey hematopoietic stem cells. Proc Natl Acad Sci USA 87:3738, 1990
41. Williams DA: Expression of introduced genetic sequences in
hematopoietic cells following retroviral-mediated gene transfer.
Hum Gene Ther 1:229, 1990
42. Bodine DM, Karlsson S, Nienhuis AW: Combination of interleukins 3 and 6 preserves stem cell function in culture and enhances retrovirus-mediated gene transfer into hematopoietic stem
cells. Proc Natl Acad Sci USA 86:8897, 1989
43. Luskey BD, Rosenblatt M, Zsebo K, Williams DA: Stem cell
factor, interleukin-3 (IL3), and IL-6 promote retroviral-mediated
gene transfer into murine hematopoietic stem cells. Blood 80:396,
1992
44. Von Wronski M, Harris L, Tan0 K, Mitra S, Bigner D, Brent
T: Cytosine methylation and suppression of 06-methylguanine-DNA
methyltransferase expression in humanrhabdomyosarcoma cell lines
and xenografts. Oncol Res 4:167, 1992
45. Stocking C, Kollek R, Bergholz U, Ostertag W: Long terminal
repeat sequences impart hematopoietic transformation properties to
the myeloproliferative sarcoma virus. Proc Natl Acad Sci USA
825746, 1985
45. Beck-Engeser G, Stocking C, Just U, Albritton L, Dexter M,
Spooncer E, Ostertag W: Retroviral vectors related to the myeloproliferative sarcoma virus allow efficient expression in hematopoietic
stem and precursor cell lines, but retroviral infection is reduced in
more primitive cells. Hum Gene Ther 2:1991
47. Franz T, Hilberg F, Seliger B, Stocking C, Ostertag W: Retroviral mutants efficiently expressed in embryonal carcinoma cells.
Proc Natl Acad Sci USA 83:3292, 1986
48. Barklis E, Mulligan RC, Jaenisch R: Chromosomal position or
virus mutation permits retrovirus expression in embryonal carcinoma
cells. Cell 47:391, 1986
3351
49. Gerson SL, Zborowska E, Norton K, Gordon N, Willson JKV:
Synergistic efficacy of O‘-benzylguanine and 1,3-bis(2-chloroethyl)l-nitrosourea (BCNU) in a human colon cancer xenograft completely
resistant to BCNU. Biochem Pharmacol 45483, 1993
50. Dolan ME, Pegg AE, Dumenco LL, Moschel RC, Gerson SL:
Comparison of the inactivation of mammalian and bacterial 06alkylguanine-DNA-alkyltransferase by 06-benzylguanine and Ohmethylguanine. Carcinogenesis 12:2305, 1991
5 1. Elder RH, Margison GP, Rafferty JA: Differential inactivation
of mammalian and Escherichia coli 06-benzylguanine. Biochem J
298:23 1, 1994
52. Crone TM, Goodtzova K, Edara S, Pegg AE: Mutations in
human 06-DNA Alkyltransferase imparting resistance to 0‘”benzylguanine. Cancer Res 54:6221, 1994
53. Pegg AE: Mammalian 06alkylguanine-DNA alkyltransferase:
Regulation and importance in response to alkylating carcinogenic
and therapeutic agents. Cancer Res 50:6119, 1990
54. Ludlum DB: DNA Alkylation by the Halonitrosoureas: Nature of modifications produced andtheir enzymatic repair or removal.
Mutation Res 233:117, 1990
55. Gerson SL, Trey J E, Miller K: Potentiation cytotoxicity in
human leukemic cells by inactivation of 06-alkyltransferase-DNA
alkyltransferase. Cancer Res 48:1521, 1988
56. Gerson SL, Trey JE: Modulation of nitrosourea resistance in
myeloid leukemias. Blood 71:1487, 1988
57. Bronstein SM, Skopek TR, Swenberg JA: Efficient repair
of 06-ethylguanine, but not 04-ethylthymine or O’-ethylthymine, is
dependent upon 06-alkylguanine-DNA alkyltransferase and nucleotide excision repair activities in human cells. Cancer Res 52:2008,
1992
58. Evans CG, Bodell WJ, Tokuda K, Doane-Setzer P, Smith MT:
Glutathione and related enzymes in rat brain tumor cell resistance to
1,3-bis(2-chloroethyl)-l-nitrosoureaand nitrogen mustard. Cancer
Res 47:2525, 1987
59. Hansson J, Edgren M, Ehrsson H, Ringborg U, NilssonB:
Effect of d,l,-buthionine-S,R-sulfoximineon cytotoxicity and DNA
cross-linking induced by bifunctional DNA-reactive cytostatic drugs
in human melanoma cells. Cancer Res 48:19, 1988
60. Seidenfeld J, Komar KA: Chemosensitization of cultured human carcinoma cells to 1,3-bis(2-chloroethyl)-l-nitrosourea by
difluoromethylomithine-induced polyamine depletion. Cancer Res
45:2132, 1985
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1995 85: 3342-3351
Retroviral transduction and expression of the human alkyltransferase
cDNA provides nitrosourea resistance to hematopoietic cells
JA Allay, LL Dumenco, ON Koc, L Liu and SL Gerson
Updated information and services can be found at:
http://www.bloodjournal.org/content/85/11/3342.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.