Molecular Biology Today (2001) 2(2): 21-25.
Bacillus subtilis Oligopeptide-Binding Proteins 21
Peptide Binding to the Bacillus subtilis
Oligopeptide-Binding Proteins OppA and AppA
Antonia Picon1 and Karel H.M. van Wely*,2
Department of Microbiology, Groningen Biomolecular
Sciences and Biotechnology Institute, University of
Groningen, Haren, The Netherlands
1
Present address: Swammerdam Institute for Life Sciences,
Plantage Muidergracht 12, 1018 TV Amsterdam, The
Netherlands.
2
Present address: Erasmus University Rotterdam
Department of pathology, JNI - Room Be 332b, Postbus
1738, 3000 DR Rotterdam, The Netherlands
Abstract
The binding proteins of the two oligopeptide transport
systems present in Bacillus subtilis, OppA and AppA,
were expressed in a Lactococcus lactis strain that
lacks the native oppA gene. Both OppABs and AppA
were targeted to the cell surface, and shown to be
functional in assays that monitor the binding of
peptides by changes in intrinsic protein fluorescence.
The specificities of the two proteins were shown to be
different. An increase in fluorescence of OppABs was
observed upon binding of the peptides RGG, GLGL
and SLSQS. The peptides RDMPIQA, RPPGFSPFR and
SLSQSKVLPVPQ did not produce such an increase in
fluorescence. The only peptide that affected the
intrinsic fluorescence of AppA was RPPGFSPFR. Our
data indicate that OppABs has a relatively high affinity
for tri-, tetra- and pentapeptides but does not bind
longer peptides. The affinity of AppA seems to be
targeted to a limited set of longer oligopeptides, but
the protein still may bind short peptides with low
affinity.
Introduction
The binding-protein dependent permeases constitute an
important group of active transport systems in bacteria.
They are involved in the uptake of nutrients such as sugars,
amino acids, anions and peptides. They all consist of a
substrate-binding protein and a membrane-bound complex
formed by two hydrophobic integral membrane proteins or
domains, and two hydrophilic ATP-hydrolyzing subunits
(Higgins, 1992). The substrate-binding proteins determine
the specificity of the respective transport systems, and
therefore they play a key role in controlling the range of
molecules that may enter the cell (Sleigh et al., 1999). The
binding proteins are organized in two globular domains
connected by a short polypeptide linker. The ligand binds
*For correspondence. Email [email protected];
Tel. +31 10 4087947.
© 2001 Caister Academic Press
in a deep cleft formed between the two domains, which
close around the substrate in a manner similar to a “Venus
flytrap” (Quiocho and Ledvina, 1996). In case of the
peptide-binding proteins, a third domain of unknown
function bridges the other two.
Oligopeptide transport systems (Opp) possess some
of the most versatile binding-proteins, since they are able
to bind the large variety of peptides present in the medium.
Among the best characterized ones are the binding proteins
of Escherichia coli , Salmonella enterica serovar
typhimurium, and Lactococcus lactis. The Opp system of
E. coli is able to handle peptides from two to five amino
acids residues (Payne and Smith, 1994). The lowest KD
values for binding to E. coli OppA (OppAEc), found for triand tetrapeptides, are in the micromolar range (Guyer et
al. , 1986). The Opp system of S. enterica serovar
typhimurium bears a roughly similar peptide selectivity
(Sleigh et al., 1999). However, the Opp system of L. lactis
shows a very different peptide selectivity. This system is
able to transport peptides from four up to eighteen or more
residues (Detmers et al., 1998). The KD’s for binding to
OppALl range from millimoles for peptides smaller than
seven residues to micromoles for longer peptides
(Lanfermeijer et al., 1999).
Bacillus subtilis possesses two oligopeptide transport
systems, Opp (Perego et al., 1991; Rudner et al., 1991)
and App (Koide and Hoch, 1994). Opp plays a role in the
initiation of sporulation (Perego et al., 1991; Rudner et al.,
1991), in genetic competence (Solomon et al., 1995;
Lazazzera et al., 1997), and in nutrition of the cell (Koide
and Hoch, 1994). The App system has not been well
characterized, since the AppA of the B. subtilis reference
strain 168 and its derivatives is inactive due to a frameshift
mutation. Mutants in opp sporulate very poorly but second
site mutations resulting in a functional AppA, restore
sporulation and peptide transport (Koide and Hoch, 1994).
The substrate specificities of the binding proteins of both
systems, OppABs and AppA, have not been determined
directly, and it is not known whether these proteins have
binding characteristics similar to those of OppAEc or OppALl.
The identity between OppABs and AppA is 22% and both
these proteins are 20-30% identical to OppAEc, OppASt and
OppALl.
The purification of proteins from B. subtilis is not always
easy due to high proteolytic activity in this organism (Wu
et al., 1991). To avoid degradation problems, the genes
coding for the binding proteins OppABs and AppA were
expressed in a Lactococcus lactis strain lacking the native
binding protein OppA. This strategy allowed us to purify
the binding proteins and study their binding characteristics.
Further Reading
Caister Academic Press is a leading academic publisher of
advanced texts in microbiology, molecular biology and medical
research.
Full details of all our publications at caister.com
• MALDI-TOF Mass Spectrometry in Microbiology
Edited by: M Kostrzewa, S Schubert (2016)
www.caister.com/malditof
• Aspergillus and Penicillium in the Post-genomic Era
Edited by: RP Vries, IB Gelber, MR Andersen (2016)
www.caister.com/aspergillus2
• The Bacteriocins: Current Knowledge and Future Prospects
Edited by: RL Dorit, SM Roy, MA Riley (2016)
www.caister.com/bacteriocins
• Omics in Plant Disease Resistance
Edited by: V Bhadauria (2016)
www.caister.com/opdr
• Acidophiles: Life in Extremely Acidic Environments
Edited by: R Quatrini, DB Johnson (2016)
www.caister.com/acidophiles
• Climate Change and Microbial Ecology: Current Research
and Future Trends
Edited by: J Marxsen (2016)
www.caister.com/climate
• Biofilms in Bioremediation: Current Research and Emerging
Technologies
Edited by: G Lear (2016)
www.caister.com/biorem
• Flow Cytometry in Microbiology: Technology and Applications
Edited by: MG Wilkinson (2015)
www.caister.com/flow
• Microalgae: Current Research and Applications
• Probiotics and Prebiotics: Current Research and Future Trends
Edited by: MN Tsaloglou (2016)
www.caister.com/microalgae
Edited by: K Venema, AP Carmo (2015)
www.caister.com/probiotics
• Gas Plasma Sterilization in Microbiology: Theory,
Applications, Pitfalls and New Perspectives
Edited by: H Shintani, A Sakudo (2016)
www.caister.com/gasplasma
Edited by: BP Chadwick (2015)
www.caister.com/epigenetics2015
• Virus Evolution: Current Research and Future Directions
Edited by: SC Weaver, M Denison, M Roossinck, et al. (2016)
www.caister.com/virusevol
• Arboviruses: Molecular Biology, Evolution and Control
Edited by: N Vasilakis, DJ Gubler (2016)
www.caister.com/arbo
Edited by: WD Picking, WL Picking (2016)
www.caister.com/shigella
Edited by: S Mahalingam, L Herrero, B Herring (2016)
www.caister.com/alpha
• Thermophilic Microorganisms
Edited by: F Li (2015)
www.caister.com/thermophile
Biotechnological Applications
Edited by: A Burkovski (2015)
www.caister.com/cory2
• Advanced Vaccine Research Methods for the Decade of
Vaccines
• Antifungals: From Genomics to Resistance and the Development of Novel
• Aquatic Biofilms: Ecology, Water Quality and Wastewater
• Alphaviruses: Current Biology
• Corynebacterium glutamicum: From Systems Biology to
Edited by: F Bagnoli, R Rappuoli (2015)
www.caister.com/vaccines
• Shigella: Molecular and Cellular Biology
Treatment
Edited by: AM Romaní, H Guasch, MD Balaguer (2016)
www.caister.com/aquaticbiofilms
• Epigenetics: Current Research and Emerging Trends
Agents
Edited by: AT Coste, P Vandeputte (2015)
www.caister.com/antifungals
• Bacteria-Plant Interactions: Advanced Research and Future Trends
Edited by: J Murillo, BA Vinatzer, RW Jackson, et al. (2015)
www.caister.com/bacteria-plant
• Aeromonas
Edited by: J Graf (2015)
www.caister.com/aeromonas
• Antibiotics: Current Innovations and Future Trends
Edited by: S Sánchez, AL Demain (2015)
www.caister.com/antibiotics
• Leishmania: Current Biology and Control
Edited by: S Adak, R Datta (2015)
www.caister.com/leish2
• Acanthamoeba: Biology and Pathogenesis (2nd edition)
Author: NA Khan (2015)
www.caister.com/acanthamoeba2
• Microarrays: Current Technology, Innovations and Applications
Edited by: Z He (2014)
www.caister.com/microarrays2
• Metagenomics of the Microbial Nitrogen Cycle: Theory, Methods
and Applications
Edited by: D Marco (2014)
www.caister.com/n2
Order from caister.com/order
22 Picon and van Wely
Results
Expression and Localization of OppABs and AppA in
L. lactis Cells
The genes specifying OppABs and AppA were placed under
the control of the P32 promoter and in frame with a Cterminal 6-His-tag. To quantify the level of expression of
OppABs and AppA, cell extracts of AMP2/pAMP31, AMP2/
pAMP51 and AMP2/pAMP61 were subjected to Western
analysis (data not shown). The level of expression of
OppABs in AMP2 cells was approximately 8-fold lower than
that of OppALl. Since expression of OppALl from pAMP31
results in 8 to 12-fold overexpression (Picon et al., 2000),
the amount of OppABs is similar to that of OppALl in L. lactis
wild-type cells. The level of expression of AppA in AMP2
cells was 30-fold lower than that of OppALl in AMP2/
pAMP31.
To confirm that OppA Bs and AppA were not only
expressed but also exported and anchored to the cell
surface, cells were fractionated and membrane vesicles
were isolated as described (Putman et al., 1999). Western
analyses showed that both binding proteins were localized
in the membrane vesicle fraction (data not shown),
indicating that OppABs and AppA are correctly targeted to
the cell surface of L. lactis.
Peptide Binding to OppABs and AppA
Both binding proteins were purified and peptide binding
interactions were studied by means of intrinsic protein
fluorescence. The emission spectrum of OppABs showed
a maximum at 333 nm. Upon binding of certain peptides,
an increase in fluorescence was observed (Figure 1A). The
emission spectrum of AppA showed a maximum at 335
nm. A blue shift of approximately 2 nm together with an
increase in fluorescence was observed upon binding of
RPPGFSPFR (Figure 1B).
The increase in fluorescence at 315 nm, observed
upon binding of RGG, GLGL and SLSQS to OppABs, could
be fitted to a saturation curve as a function of the
concentration of added peptide (Figure 2A).
No change in fluorescence was observed with
RDMPIQA, RPPGFSPFR or SLSQSKVLPVPQ. In case
of AppA, a change in fluorescence was only observed with
RPPGFSPFR (Figure 2B); RGG, GLGL, SLSQS,
RDMPIQA or SLSQSKVLPVPQ did not elicit any effect.
The Delta Fmax values and the dissociation constants for
binding (Kd) were determined from the saturation curves
(Table 1).
These results show that both OppABs and AppA are
functionally expressed in L. lactis, and that the two proteins
have different substrate specificities.
Peptide Binding in the Presence of an Excess of a
Second Ligand
The binding constants of some peptides could not be
determined directly. To evaluate if these peptides were able
to interact with the binding proteins from B. subtilis, the
kinetic constants for binding of SLSQS to OppABs and for
binding of RPPGFSPFR to AppA were determined in the
presence
of
RDMPIQA,
RPPGFSPFR
or
SLSQSKVLPVPQ.
Neither binding of SLSQS to OppABs nor binding of
RPPGFSPFR to AppA were significantly affected in the
presence of another peptide. These results indicate that
OppABs specifically binds short oligopeptides (tri-, tetraand pentapeptides) and acts in a way similar to that of
OppASt and OppAEc. In contrast, AppA accepts longer
peptides, but does so with a more narrow specificity than
OppALl.
Discussion
Figure 1. Effect of saturating concentrations of peptide on the intrinsic protein
fluorescence of OppABs and AppA. Emission spectra were recorded in the
absence (solid lines) and presence (broken lines) of 66 mM of GLGL to
OppABs (A) and 255 mM of RPPGFSPFR to AppA (B).
OppABs and AppA were purified from the membrane fraction
of L. lactis cells lacking the native oppA gene, and were
shown to be active in peptide binding. The peptide-binding
proteins from B. subtilis seem to differ in substrate
specificity. A change in fluorescence was only recorded
for OppA Bs upon binding of peptides of three to five
residues. On the contrary, the fluorescence spectrum of
AppA was only changed upon addition of RPPGFSPFR.
The changes in fluorescence observed when peptides
with three to five residues bind to OppABs are in agreement
with data obtained for a B. subtilis Phe-requiring strain.
This strain was able to use the peptides FGG, FGFG or
FLEEI as source of Phe (Koide and Hoch, 1994). The
uptake of the pentapeptide pheromone ERGMT by a B.
subtilis Opp+, App- strain (Lazzazera et al., 1997) is also
consistent with the data reported here. The three-
Bacillus subtilis Oligopeptide-Binding Proteins 23
Figure 2. Concentration dependence of the fluoresence increase at 315
nm upon peptide addition. Concentration dependence of the fluorescence
increase at 315 nm upon addition of SLSQS (closed circles), GLGL (open
circles) and RGG (closed triangles) to OppABs (A) or RPPGFSPFR to AppA
(B). The concentration of both binding proteins was 1 µM.
dimensional structure of OppASt has revealed how tri- and
tetrapeptides are accomodated in the binding site, and
which residues are involved in peptide binding (Tame et
al., 1994; 1995; 1996). The main chain of the peptide is in
an extended conformation and forms parallel and
antiparallel ß-sheet interactions with some residues of
Table 1. Kinetic parameters for peptide binding to OppALl, OppABs and AppA.
OppA. The N-terminus of the peptide forms a salt-bridge
with the side-chain of Asp-419. Arg-413 and His-371 each
form a salt-bridge with the carboxylate groups of the triand tetrapeptide ligands, respectively. The same residues
are easily recognized in the primary sequence of OppABs
but cannot be found in AppA or OppALl (Figure 3).
The side-chains of the peptides are accomodated in
spacious and hydrated pockets, where few direct contacts
are made with the protein. Water molecules act as flexible
adapters that match the hydrogen-bonding requirements
between OppA and the ligand, and may shield charges on
the buried ligand. This adaptability not only allows for the
accomodation of different substrates, but also leaves room
for differences in the aminoacids that actually form the
pockets of the peptide-binding proteins themselves.
It has been shown that the App system is able to
support growth of a B. subtilis Opp— Phe-requiring strain
on tetra- and pentapeptides, but not on tripeptides (Koide
and Hoch, 1994). We did not observe changes in
fluorescence upon binding of tri-, tetra- or pentapeptides
when tested at submillimolar concentrations. Similarly,
binding of peptides of three to five residues to OppALl does
not result in a change in fluorescence under these
conditions (Lanfermeijer et al., 1999; Picon et al., 2000).
At least some of these peptides do bind to OppALl but with
Kd-values in the millimolar range (Lanfermeijer et al., 1999),
and can be used to meet the leu-requirements of L. lactis
(Picon et al., 2000). These high concentrations could not
be tested in the fluorescence assay for practical reasons.
Although data are lacking, it is possible that also AppA has
a low affinity for short peptides. Nevertheless, it is clear
that OppABs will have a more prominent role in the uptake
of these peptides when their availability is low.
Although OppABs or AppA were targeted correctly,
strains AMP2/pAMP51 and AMP2/pAMP61 were not able
to use several peptides as source of leucine, and no
transport of 3H-RPPGFSPFR was recorded for these
strains (data not shown). The degree of conservation
between the oligopeptide-binding proteins from B. subtilis
and OppALl is low, but the general domain structure seems
to be conserved. Sequence comparison of the integral
membrane components of these three oligopeptide
transport systems showed 30-40% identity. The six
membrane-spanning helices, predicted for the membrane
24 Picon and van Wely
Figure 3. Multiple sequence alignment of parts of the Oligopeptide binding proteins from S. enterica serovar typhymurium, E. coli, L. lactis and B. subtilis.
Sequences of the putative peptide binding region were aligned using the Clustal X program. Conserved residues are marked with an asterisk, while similar
residues are marked with a single or double dot. N, C3 and C4 correspond to interactions of OppASt with the N-terminus of peptides and the C-terminus of triand tetrapeptides, respectively. Characters in bold represent the identified peptide binding residues in S. enterica serovar typhimurium.
components, were located at very similar positions. Future
investigations may reveal the molecular basis for the
species-specificity of the Opp systems.
Experimental Procedures
Strains, Growth Conditions, Media and Chemicals
B. subtilis strains DB104 (Yang et al., 1984) and W23 (laboratory stock)
were grown in Luria Broth at 37˚ C with vigorous aeration (Sambrook et al.,
1989). Lactococcus lactis strain AMP2 (Picon et al., 2000) transformed
with Oppa or AppA expression vectors, was grown in M17 broth (Difco
Laboratories, East Molesey, U.K.) at 30˚ C or on M17 broth solidified with
1.5% agar, supplemented with 0.5% (w/v) glucose and 5 µg/ml erythromycin.
All peptides used were from Bachem Feinchemikalien AG (Bubendorf,
Switzerland); Ni-NTA resin was from Qiagen, Inc.; n-dodecyl-beta-Dmaltoside from Sigma (St. Louis, Mo.). All other chemicals were of reagent
grade and obtained from commercial sources.
General DNA Techniques
Plasmid and chromosomal DNA were isolated by the alkaline lysis method
as described by Sambrook et al. (1989). PCR was performed with VENT
DNA polymerase (New England Biolabs). After 30 cycles of amplification,
the PCR products were purified using the QIAquick spin PCR purification
kit (Qiagen). DNA modification enzymes were obtained from Boehringer
GmbH (Mannheim, Germany). Digestion and ligation of DNA fragments
was carried out according to the manufacturers recommendations. L. lactis
was transformed by electroporation. DNA was sequenced by the dideoxy
chain-termination method.
OppA and AppA Expression Vectors
The oppA gene from B. subtilis was obtained by PCR using chromosomal
DNA from strain DB104 as template and the primers 5'CATGCCATGGCAAAACGTTGGTCGATTG
and
5'CGCGGATCCTTTAAAATATGCG. The appA gene was obtained by PCR
using chromosomal DNA from strain W23 as template and the primers 5'CATGCCATGGCAAGACGGAAAACCGCAC
and
5'CGCGGATCCTTTTGCAAGCCACCA. In both cases a unique NcoI site
was engineered at the translation initiation site. Both PCR products were
digested with NcoI plus BamHI and ligated into the vector pAMP31 (Picon
et al., 2000), from which the fragment specifying the oppA gene of L. lactis
was removed. In this vector the oppA or appA genes on the NcoI-BamHI
fragments are placed under the control of the P32 promoter of L. lactis
subsp. cremoris Wg2 and in frame with a sequence specifying a 6-His-tag
at the C-terminus of the protein. The resulting plasmids were named
pAMP51 (oppA) and pAMP61 (appA).
Western Blot Analyses
Cells were harvested at the end of the exponential phase of growth, washed
once with water and resuspended in water to OD660 of approximately 10.
The cells were sonicated for 9 cycles of 5s at an amplitude of 4 µm with 15
s cooling, on ice, using an MSE Soniprep 150 probe sonicator (MSE
Bacillus subtilis Oligopeptide-Binding Proteins 25
Scientific Instruments, Crawley, UK). Subsequently, sample buffer was
added and the lysates were boiled for 5 min. Cell debris was removed by
centrifugation in an eppendorf centrifuge (14,000 rpm, 3 min). Samples (20
µg/lane) were subjected to SDS-10% polyacrylamide electrophoresis and
the proteins were transferred to polyvinylidene difluoride (PVDF) sheets
(Millipore) by semidry electroblotting. His-tagged OppA and AppA proteins
were detected with monoclonal anti His-tag antibodies DIA 900 (Dianova)
using the Western-LightTM chemiluninescence kit with CSPDTM as
substrate (Tropix Inc.).
Purification of OppA-His6 and AppA-His6
Both proteins were purified from membrane vesicles of L. lactis (Putman et
al., 1999) that were solubilized (5 mg protein/ml) in buffer A (50 mM
potassium phosphate, 100 mM KCl, 10% glycerol), pH 7.6, plus 0.2 % (w/
v) n-dodecyl-beta-D-maltoside (DDM). The mixture was incubated on ice
for 30 min, and the insoluble material was removed by centrifugation
(280,000 x g, 15 min). The solubilized membrane proteins were mixed with
Ni-NTA resin, previously equilibrated with buffer A plus 0.2 % DDM. The
mixture was incubated for 1 h at 4˚ C under continuous shaking, and
subsequently poured into a Bio-spin column (Bio-Rad). The column was
washed with 20 column volumes of buffer A, pH 6.5, plus 0.05% DDM and
15 mM imidazole. The proteins were eluted with buffer A, pH 6.5, plus
0.05% DDM and 500 mM imidazole. A desalting step on a PD10 column
(BioRad) was performed in order to remove the imidazole. Next, an anion
exchange step was included to remove nucleic acids and other minor
contaminants. Protein was loaded onto a DEAE sepharose fast flow column,
previously equilibrated with 50 mM KCl in buffer B (50 mM potassium
phosphate, pH 7.6, 10% glycerol) plus 0.05 % DDM. The column was
washed with increasing concentrations of KCl (50-200 mM) in buffer B plus
0.05 % DDM. OppABs and AppA proteins were present in the flow through
fractions. All handlings were performed at 4˚ C. The endogenous ligands
that copurify with the proteins were removed by controlled denaturationrenaturation with 2 M Guanidinium-HCl as described (Lanfermeijer et al.,
1999).
Intrinsic Protein Fluorescence
Peptide binding to both proteins was observed as changes in intrinsic protein
fluorescence, as described by Lanfermeijer et al. (1999), using an Aminco
4800 spectrofluorimeter. The effect of peptide addition on fluorescence was
measured at 15˚ C by exciting OppA or AppA (1 µM) at 280 nm with a slit
width of 2 nm and measuring the emission at 315 nm with a slit width of 8
nm. The changes in fluorescence as a function of peptide concentration
were analyzed according to a hyperbolic binding equation:
Delta F = (Delta Fmax* L)/(KdL + L)
where Delta F is the observed fluorescence at a certain peptide
concentration, L is the total peptide concentration, Delta Fmax is the
fluorescence change at infinite peptide concentration, and KdL is the
equilibrium dissociation constant.
Miscellaneous
Protein content was determined according to Lowry et al. (1951) using
bovine serum albumin as standard. The concentration and stability of purified
OppABs and AppA proteins were evaluated by measuring the absorption
spectrum between 240 and 340 nm. The extinction coefficients were
calculated according to Pace et al. (1995), yielding values of 105,895M-1 .
cm-1 for OppABs and 101,315 M-1 . cm-1 for AppA.
Acknowledgements
The authors thank Prof. Dr. B. Poolman for his help with the preparation of
the manuscript.
References
Detmers, F.J.M., Kunji, E.R.S., Lanfermeijer, F.C., Poolman, B., and Konings,
W.N. 1998. Kinetics and specificity of peptide uptake by the oligopeptide
transport system of Lactococcus lactis. Biochemistry 37: 16671-16679.
Guyer, C.A., Morgan, D.G., and Staros, J.V. 1986. Binding specificity of the
periplasmic oligopeptide-binding protein from Escherichia coli. J. Bac.
168: 775-779.
Higgins, C.F. 1992. ABC transporters: from microorganisms to man. Annu.
Rev. Cell Biol. 8: 67-113.
Koide, A., and Hoch, J.A. 1994. Identification of a second oligopeptide
transport system in Bacillus subtilis and determination of its role in
sporulation. Mol. Mic. 13: 417-426.
Lanfermeijer, F.C., Picon, A., Konings, W.N., and Poolman, B. 1999. Kinetics
and consequences of binding of nona- and dodecapeptides to the
oligopeptide binding protein (OppA) of L. lactis. Biochemistry 38: 14440-
14450.
Lazzazera, B.A., Solomon, J.M., and Grossman, A.D. 1997. An exported
peptide functions intracellularly to contribute to cell density signaling in
Bacillus subtilis. Cell. 89: 917-925.
Lowry, O.H., Rosebrough, N.J., Farr, A.J., and Randall, R.J. 1951. Protein
measurement with the Folin phenol reagent. J. Biol. Chem. 193: 265275.
Pace, C.N., Vajdos, F., Fee, L., Grimsley, G., and Gray, T. 1995. How to
measure and predict the molar absorption coefficient of a protein. Protein
Sci. 4: 2411-2423.
Payne, J.W., and Smith, M.W. 1994. Peptide transport by microorganisms.
Adv. Mic. Physiol. 36: 1-80.
Perego, M., Higgins, C.F., Pearce, S.R., Gallagher, M.P., and Hoch, J.A.
1991. The oligopeptide transport system of Bacillus subtilis plays a role
in the initiation of sporulation. Mol. Mic. 5: 173-185.
Picon, A., Kunji, E.R.S., Lanfermeijer, F.C., Konings, W.N., and Poolman,
B. 2000. Specificity mutants of the binding protein of the oligopeptide
transport system (OppA) of Lactococcus lactis. J. Bac. 182: 1600-1608.
Putman, M., van Veen, H.W., Poolman, B., and Konings, W.N. 1999.
Restrictive use of detergents in the functional reconstitution of the
secondary multidrug transporter LmrP. Biochemistry 38: 1002-1008.
Quiocho, F.A., and Ledvina, P.S. 1996. Atomic structure and specificty of
bacterial periplasmic receptors for active transport and chemotaxis.
Variation of common themes. Mol. Mic. 20: 17-25.
Rudner, D.Z., LeDeaux, J.R., Ireton, K., and Grossman, A.D. 1991. The
spo0K locus of Bacillus subtilis is homologous to the oligopeptide
permease locus and is required for sporulation and competence. J. Bac.
173: 1388-1398.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: a
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.
Sleigh, S.H., Seavers, P.R., Wilkinson, A.J., Ladbury, J.E. and Tame, J.R.H.
1999. Crystallographic and calorimetric analysis of peptide binding to OppA
protein. J. Mol. Biol. 291: 393-415.
Solomon, J.M., Magnuson, R., Srivastava, A., and Grossman, A.D. 1995.
Convergent sensing pathways mediate response to two extracellular
competence factors in Bacillus subtilis. Genes Develop. 9: 547-558.
Tame, J.R.H., Dodson, E.J., Murshudov, G.N., Higgins, C.F., and Wilkinson,
A.J. 1995. The crystal structures of the oligopeptide-binding protein OppA
complexed with tripeptide and tetrapeptide ligands. Structure 3: 13951406.
Tame, J.R.H., Murshudov, G.N., Dodson, E.J., Neil, T.K., Dodson, G.G.,
Higgins, C.F., and Wilkinson, A.J. 1994. The structural basis of sequenceindependent peptide binding by OppA protein. Science 264: 1578-1581.
Tame, J.R.H., Sleigh, S.H., Wilkinson, A.J., and Landbury, J.E. 1996. The
role of water in sequence-independent ligand binding by an oligopeptide
transporter protein. Nature structural biology 3: 998-1001.
Wu, X.C., Lee, W., Tran, L., and Wong, S.L. 1991. Engineering a B. subtilis
expression/secretion system with a strain deficient in six extracellular
proteases. J. Bac. 173: 4952-4958.
Yang, M.Y., Ferrari, A., and Henner, D.J. 1984. Cloning of the neutral
protease gene of B. subtilis and the use of the cloned gene to create an
in vitro-derived deletion mutation. J. Bac. 160: 15-21.