SUPPLEMENTARY INFORMATION Specific incorporation of an artificial nucleotide opposite a mutagenic DNA adduct by a DNA polymerase Laura A. Wyss†, Arman Nilforoushan†, Fritz Eichenseher†, Ursina Suter†, Nina Blatter‡, Andreas Marx‡, Shana J. Sturla*† † Department of Health Sciences and Technology, Institute of Food Nutrition and Health, ETH Zürich, ‡ Schmelzbergstrasse 9, 8092 Zürich, Switzerland. Departments of Chemistry and Biology, Konstanz Research School Chemical Biology, University of Konstanz, Universitätsstrasse 10, 78457 Konstanz, Germany *Corresponding author: Shana J. Sturla, [email protected], Tel: +41 44 632 91 75 Contents: General Material and Methods .............................................................................................................................. S1 Chemical Reagents and Materials...................................................................................................................... S1 Enzymes ............................................................................................................................................................... S1 Oligonucleotides and DNA sequences ............................................................................................................. S2 Primer extension assays ..................................................................................................................................... S2 Steady-state kinetic analysis ............................................................................................................................. S3 Linear amplification ........................................................................................................................................... S3 Synthesis of nucleoside triphosphates ................................................................................................................. S3 Synthesis scheme ................................................................................................................................................ S5 NMR spectra ....................................................................................................................................................... S6 DNA polymerase-mediated single-nucleotide incorporation experiments .................................................... S13 Steady-state kinetic analysis of DNA polymerase catalysis .............................................................................. S15 References .............................................................................................................................................................. S15 General Material and Methods Chemical Reagents and Materials Reagents were purchased from Sigma Aldrich and used without further purification. Synthesis of nucleoside analogs and their conversion to corresponding phosphoramidites was undertaken as previously 1,2 6 3 described. The phosphoramidite derivative of O -BnG was prepared as previously described. Nonmodified 5’-O-dimethoxytrityl phosphoramidites were purchased from Link Technologies Ltd. Unlabeled 32 dNTPs were obtained from Invitrogen and [γ- P]ATP was purchased from PerkinElmer Life Sciences. For thin layer chromatography silica gel 60 F254 plates with aluminum backing were used. Flash column 1 13 chromatography was performed on a Biotage system with pre-packed Flash+ KP-SiO2 cartridges. H, C, and 31 P NMR spectra were recorded on a Bruker Biospin 400 MHz NMR instrument, and chemical shifts are reported in parts per million (ppm, δ) relative to the chemical shift of the respective NMR solvent. High resolution mass spectra were recorded on Thermo Scientific Exactive mass spectrometer with electrospray ionization. Enzymes Sulfolobus solfataricus DNA polymerase IV (Dpo4) was purchased from Trevigen®, Therminator DNA polymerase and DeepVentR (exo-) were purchased from New England Biolabs®, and KlenTaq was purchased S1 4 from myPOLS Biotec. KOD polymerase was expressed and purified as described before. KTqM747K mutant 1,5 DNA polymerase was expressed and purified as described before for KTq wild-type. Protein expression was conducted in E. coli BL21 (DE3 cells). Oligonucleotides and DNA sequences Oligonucleotides were either purchased from VbC Biotech or Microsynth. For sequences see Table S1. 6 Modified oligonucleotides 28mer X=O -BnG were synthesized on a Mermade 4 DNA synthesizer (Bioautomation Corporation) using β-cyanoethyl phospohoramidite chemistry. Oligonucleotides were synthesized in trityl-off mode and purified by reverse phase HPLC on a Zorbax Eclipse XDB C-18 column (5 μm, 4.6 x 150 mm, Table S1). DNA was cleaved from solid support in 30% aqueous ammonium hydroxide 6 at 55°C for 16 hours. The 28mer O -BnG template (-CXT-) was purified with a mobile phase gradient of 56 15% acetonitrile in 19 minutes. The 28mer O -BnG (-CXT-) template eluted at 19.1 minutes. The other 28mer 6 O -BnG templates (-GXT-), (-CXA-), and (-GXA-) were purified with a mobile phase gradient of 5-18% in 24 6 6 minutes. The 28mer O -BnG (-GXT-) eluted at 19.1 minutes, the 28mer O -BnG (-CXA-) and (-GXA-) at 18.4 minutes. Corresponding oligonucleotide fractions were collected, dried on a centrifugal vacuum concentrator and stored at -20°C until further use. The ssDNA concentration was determined on by UV spectroscopy at 260 nm on a NanoDrop 1000 spectrophotometer. Theoretical molar extinction coefficients of the DNA sequences were determined online at (http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/). Table S1. DNA sequences used. Primer Sequence (5' - 3') Source 23mer TAA TAC GAC TCA CTA TAG GGA GA VbC Biotech 19mer TAA TAC GAC TCA CTA TAG G Microsynth 28mer G ACT CGT CTC CCT ATA GTG AGT CGT ATT A VbC Biotech 28mer A ACT CAT CTC CCT ATA GTG AGT CGT ATT A VbC Biotech 28mer T ACT CTT CTC CCT ATA GTG AGT CGT ATT A VbC Biotech ACT CCT CTC CCT ATA GTG AGT CGT ATT A VbC Biotech Templates 28mer C 6 28mer –CXT- (X = O -BnG) ACT CXT CTC CCT ATA GTG AGT CGT ATT A 28mer –GXT- (X = O6-BnG) ACT GXT CTC CCT ATA GTG AGT CGT ATT A 6 ACT CXA CTC CCT ATA GTG AGT CGT ATT A 6 ACT GXA CTC CCT ATA GTG AGT CGT ATT A 28mer –CXA- (X = O -BnG) 28mer –GXA- (X = O -BnG) Primer extension assays Primer strands were radioactively labeled at their 5’end using T4 polynucleotide kinase (Promega) and [γP]ATP following manufacturer protocol. Primers and templates were annealed by incubation at 95°C for 5 minutes and slow cooling over 12 hours. End concentrations were 1 μM for primer and 1.5 μM for template. Standard primer extension reactions (10 μL) contained 1x reaction buffer, 5 nM enzyme, 15 nM DNA (15 nM primer and 22.5 nM template), and 10 μM dNTPs. For experiments with Dpo4, 10 nM DNA and 100 μM dNTPs were used. Primer/template, nucleotides and DNA polymerase were incubated at 55°C for 10 min, except for Dpo4 experiments, where incubation was conducted at 37°C for 30 min. Reactions were quenched by the addition of 10 μL PAGE gel loading buffer (80% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanole FF) and the product mixtures were analyzed by 15% polyacrylamide/7M urea denaturing gels and subjected to autoradiography (Bio-Rad). Quantification was carried out with Bio-Rad Quantity One software. 32 Buffers used are listed below: Dpo4: 1x AB buffer (50 mM Tris-HCl at pH 8.0, 50 mM NaCl, 2.5 mM MgCl2, 5 mM DTT, 100 μg/mL bovine serum albumin, and 5% glycerol) S2 KlenTaq and KTqM747K: 1x KTq buffer (50 mM Tris HCl (pH 9.2), 16 mM (NH4)2SO4, 2.5 mM MgCl2, 0.1% Tween 20) Therminator and DeepVentR (exo-): 1x Thermo Pol reaction buffer (20mM Tris-HCl (pH 8.8), 10mM (NH4)2SO4, 10mM KCl, 2mM MgSO4, 0.1% Triton® X-100) KOD: 1x KOD reaction buffer (120 mM Tris-HCl (pH 8.0), 10 mM KCl, 1.5 mM MgCl2, 10 mg/mL BSA, 0.1% Triton X-100) Steady-state kinetic analysis Steady-state kinetics parameters for single nucleotide incorporation by DNA polymerase KTqM747K were 6,7 determined under single completed hit conditions. The amount of n+1 product over a range of dNTP concentration was measured at 55°C. Reaction mix contained 5 nM enzyme, 100 nM primer, 150 nM template, and 1x KTq reaction buffer. Reactions were started by adding the prewarmed enzyme and DNA mix to pre-warmed dNTPs. Reactions were stopped using PAGE loading buffer. Reactions were separated on a 15% polyacrylamide/7M urea denaturing gel and visualized by autoradiography. Intensity of n+1 bands was quantified on the Quantity One Software (Bio-Rad). Resulting values were fit into Michaelis-Menten rectangular hyperbola using SigmaPlot12 Software (Systat Software) to obtain kinetic parameters vmax, KM, and kcat. Linear amplification Linear amplification reactions were incubated in a Biometra T3000 thermocycler, where 30 cycles of denaturation, annealing, and elongation were performed under following conditions: 30 seconds at 95°C, 30 6 seconds at 42°C, and 30 seconds at 55°C. Reaction mix contained 0.5 ng of O -BnG template DNA (28 nt), 300 nM primer (19 nt), 25 nM KTqM747K DNA polymerase, 1x KTq reaction buffer, 10 µM dNTPs supplemented with or without 10 µM BenziTP. Reactions were separated on a 20% polyacrylamide/7M urea denaturing gel, stained with SybrGold nucleic acid gel stain (Invitrogen) and visualized on a Bio-Rad + molecular imager Gel Doc XR Imaging System. Synthesis of nucleoside triphosphates ((2R,3S,5R)-5-(1H-benzo[d]imidazol-1-yl)-3-hydroxytetrahydrofuran-2-yl)methyl benzyl (4chlorobutyl)(methyl)phosphoramidate 2a (BIM OBt) To a solution of (4-chlorobutyl)(methyl)phosphoramidic dichloride (0.407 g, 1.71 mmol) in THF (5 mL) was added dropwise Hydroxybenzotriazole (0.461 g, 3.42 mmol, azeotropically dried twice in benzene) in pyridine (0.3 mL) and THF (5 mL). The resulting mixture was stirred under nitrogen atmosphere for 4 hours at 25°C, whereas a white precipitate formed. The white precipitate was filtered and the filtrate was added to a solution of Benzimidazole (BIM) nucleoside 1a (0.100 g, 0.43 mmol, dried over pyridine twice) in pyridine (2 mL). Then, N-methylimidazole (0.140 g, 1.71 mmol) was added and the mixture stirred at 25°C for 1 hour under nitrogen atmosphere. THF was removed under reduced pressure and the residue was extracted with DCM (2x) and washed with saturated aqueous NH4Cl (1x) and saturated aqueous NaHCO3 (1x). Combined organic layers were dried over NaSO4, filtered and concentrated. The crude product 2a (0.228 g) was used for the forthcoming reaction without further purification. Rf (SiO2, DCM:MeOH 95:5, vanillin stain) = 0.31. ((2R,3S,5R)-5-(1H-benzo[d]imidazol-1-yl)-3-hydroxytetrahydrofuran-2-yl)methyl 1H-benzo[d][1,2,3]triazol-1-yl (4chlorobutyl)(methyl)phosphoramidate 3a (BIM OBn) The crude 2a (0.228 g, 0.43 mmol) was dissolved in THF (2mL) and Benzyl alcohol (2.310 g, 21.35 mmol) was added in one portion. To the solution, 4-Dimethylaminopyridine (0.208 g, 1.71 mmol) was added and the reaction was stirred under nitrogen at 25°C for 16 hours. The resulting solution was concentrated under reduced pressure and purified by flash chromatography on a biotage system using a DCM:MeOH gradient (0-1% MeOH 3CV’s, 1-10% MeOH 15 CV’s, 10-20% 3 CV’s, 1 CV= 48 ml) yielding product 3a (0.115 g, 53%) as a 1 white foamy solid. Rf (SiO2, DCM:MeOH 95:5) = 0.38; H NMR (400 MHz, CDCl3) δ 8.03 (d, J = 23.1 Hz, 1H), 7.71 – 7.69 (m, 1H), 7.42 – 7.38 (m, 1H), 7.29 – 7.13 (m, 7H), 6.24 – 6.20 (m, 1H), 5.03 (broad s, 1H), 4.96 – 4.83 S3 (m, 2H), 4.62 – 4.53 (m, 1H), 4.14 – 3.98 (m, 3H), 3.36 (t, J = 6.2 Hz, 2H), 2.90 – 2.79 (m, 2H), 2.59 – 2.37 (m, 13 5H), 1.60 – 1.44 (m, 4H); C NMR (400 MHz, CdCl3): 144,00, 140.51, 136.07, 132.81, 128.68 (2C), 128.57, 127.94 31 (2C) 123.35, 122.76, 120.34, 110.68, 100.04, 84.97, 70.78, 68.26, 65.38, 48.24, 44.63, 40.12, 33.19, 29.42, 25.16; P NMR (400 MHz, D2O) relative to phosphoric acid standard: δ 11.28 (d, J = 12.9 Hz, 1P). HRMS (ESI) + calculated for C24H31ClN3O5P: [M+H ] m/z 508.1763, found: 508.1759. ((2R,3S,5R)-5-(1H-benzo[d]imidazol-1-yl)-3-hydroxytetrahydrofuran-2-yl)methyl triphosphate 4a (BIMTP) 3a (0.100 g, 0.20 mmol) was dissolved in 5 ml anhydrous DMF and given to a flask set under H2. A tip of palladium catalyst (10% Pd/C) was added and the mixture was stirred under a H2 atmosphere at 25°C for 45 minutes. The reaction mixture was filtered through a 0.45 μm syringe filter to remove the catalyst. To the filtrate, was added Tris(tetra-n-butylammonium) hydrogen pyrophosphate (0.108 g, 0.20 mmol) and the mixture was stirred for 30 minutes at 25°C under nitrogen atmosphere. DMF was removed under reduced pressure and residual was diluted in 2 mL MilliQ water. The resulting solution was purified twice by reversephase HPLC. First on a Phenomenex LUNA C18 column (250 x 10 mm) using an acetonitrile in 50 mM TEAA (pH 7) gradient (2-60% in 25 min, flow rate 2mL/min). Followed by a second purification on a Phenomenex Jupiter Proteo column (250 x 10 mm) with a 50% acetonitrile in 50 mM TEAA (pH 7) gradient (30-34% in 11 + min, flow rate 2.5 mL/min) yielding product 4a with TEA as counter ion (0.020 g, 24%; overall yield: 13%). + + For exchange of the TEA counter ion to Na form, 4a (0.020 g, 0.04 mmol) was dissolved in 1 mL MilliQ water, then NaClO4 (0.077 g, 0.63 mmol) was added and the mixture was stirred for 16 hours at 25°C. Then, Acetone (4 mL) was added and the mixture was centrifuged for 3 minutes at 14’000 g. The supernatant was carefully discarded and the pellet was dissolved in 0.5 mL water and lyophilized to give final sodiated 1 triphosphate 4a (0.013 g). H NMR (400 MHz, D2O) δ 8.79, (s, 1H), 7.85 – 7.81 (m, 2H), 7.56 – 7.48 (m, 2H), 6.61 (t, J = 6.7 Hz, 1H), 4.84 (dt, J = 6.7, 3.6 Hz, 2H), 4.37 – 4.21 (m, 3H), 2.89 (dt, J = 13.8, 6.9 Hz, 1H), 2.65 13 (ddd, J = 14.1, 6.2, 3.6 Hz, 1H); C NMR (400 MHz, D2O, referenced to acetone) δ 141.50, 140.48, 131.69, 31 123,87, 123.37, 118.18, 111.20, 85.21, 84,94, 70.41, 64.87, 38.28; P NMR (400 MHz, D2O) relative to phosphoric acid standard: δ -10.02 (d, J = 19.9 Hz, 1P), -11.21 (d, J = 19.3 Hz, 1P), -22.94 (t, J = 19.7 Hz, 1P). HRMS (ESI) + calculated for C12H17N2O12P3: [M-H ] m/z 472.9911, found: 472.9921. 1H-benzo[d][1,2,3]triazol-1-yl (((2R,3S,5R)-3-hydroxy-5-(2-oxo-2,3-dihydro-1H-benzo[d]imidazol-1yl)tetrahydrofuran-2-yl)methyl) (4-chlorobutyl)(methyl)phosphoramidate 2b (Benzi OBt) To a solution of (4-chlorobutyl)(methyl)phosphoramidic dichloride (2.180 g, 9.16 mmol) in THF (5 mL) was added dropwise Hydroxybenzotriazole (2.89 g, 1.83 mmol, azeotropically dried twice in benzene) in pyridine (1.42 mL, 1.83 mmol) and THF (10 mL). The resulting mixture was stirred under argon atmosphere for 4 hours at 25°C, whereas a white precipitate formed. The white precipitate was filtered and the filtrate was added to a solution of Hydroxybenzimidazole (Benzi) nucleoside 1b (0.572 g, 2.29 mmol, dried over pyridine twice) in pyridine (3 mL). Then, N-methylimidazole (0.752 g, 9.16 mmol) was added and the mixture stirred at 25°C for 3 hours 30 minutes under argon atmosphere. THF was removed under reduced pressure and the residue was extracted with DCM (2x) and washed with saturated aqueous NH4Cl (1x) and saturated aqueous NaHCO3 (1x). Combined organic layers were dried over NaSO4, filtered and concentrated. The resulting residue was purified by flash chromatography on a biotage system using a DCM:MeOH gradient (0-2% MeOH in 4 CV’s, 2-15% MeOH in 20 CV’s, 1 CV = 48 ml) yielding 2b* (0.589 g, 47%) as a 1 white solid. Rf (SiO2, DCM:MeOH 10 : 1, vanillin stain) = 0.39; H NMR (400 MHz, CDCl3): δ 8.16 (d, J = 5.4 Hz, 1H), 8.00 (d, J = 7.5 Hz, 1H), 7.72 (dd, J = 20.2, 8.4 Hz, 1H), 7.53 (td, J = 7.6, 3.8 Hz, 1H), 7.43 – 7.38 (m, 1H), 7.13 – 6.97 (m, 4H), 6.27 (dt, J = 13.4, 7.0 Hz, 1H), 4.80 (ddt, J = 39.8, 7.5, 4.7 Hz, 1H), 4.53 – 4.46 (m, 2H), 4.18 – 4.04 (m, 1H), 3.49 – 3.41 (m, 2H), 3.15 – 3.05 (m, 3H), 2.83 (t, J = 10.6 Hz, 3H), 2.37 – 2.30 (m, 1H), 2.17 31 (acetone), 2.01 (s, 1H), 1.68 – 1.61 (m, 4H); P NMR (400 MHz, CDCl3) relative to phosphoric acid standard: δ + 12.56 (1P), 12.78 (1P) (diastereomers); HRMS (ESI) calculated for C23H28ClN6O6P: [M+Na ] m/z 573.1389, found: 573.1396. S4 Benzyl (((2R,3S,5R)-3-hydroxy-5-(2-oxo-2,3-dihydro-1H-benzo[d]imidazol-1-yl)tetrahydrofuran-2-yl)methyl) (4chlorobutyl)(methyl)phosphoramidate 3b (Benzi OBn) 2b (0.150 g, 0.27 mmol) was dissolved in THF (2mL) and Benzyl alcohol (1.470 g, 13.60 mmol) was added in one portion. To the solution, 4-Dimethylaminopyridine (0.132 g, 1.10 mmol) was added and the reaction was stirred under argon atmosphere at 25°C for 16 hours. The reaction was concentrated under reduced pressure and purified by flash chromatography on a biotage system using a DCM:MeOH gradient (0-1% MeOH 1.5 CV’s, 1-10% MeOH 7.5 CV’s, 10-20% 1.5 CV’s (1 CV = 33 ml), yielding product 3b (0.100 g, 71%) as a white 1 foamy solid. Rf (SiO2, DCM:MeOH 95:5) = 0.38; H NMR (400 MHz, CDCl3) δ 9.82 (broad s, 1H), 7.39 – 7.29 (m, 5H), 7.19 (dd, J = 14.4, 7.8 Hz, 1H), 7.06 – 6.86 (m, 3H), 6.36 – 6.29 (m, 1H), 5.10 – 4.95 (m, 2H), 4.73 – 4.67 (m, 1H), 4.33 – 4.17 (m, 2H), 4.09 – 4.04 (m, 1H), 3.46 (t, J = 6.2 Hz, 2H), 3.03 – 2.94 (m, 2H), 2.92 – 2.81 (m, 13 1H), 2.59 (dd, J = 10.1, 2.5 Hz, 3H), 2.35 – 2.25 (m, 1H), 1.72 – 1.55 (m, 4H); C NMR (400 MHz, CDCl3) δ 154.48, 136.26, 128.73, 128.59, 128.42, 128.21, 128.04, 122.20, 121.47, 110.21, 109.87, 84,.17, 82.16, 71.60, 71.10, 68.40, 31 66.19, 65.37, 48.39, 44.73, 36.78, 33.37, 29.55, 25.29; P NMR (400 MHz, CDCl3) δ 11.25, 11.29. HRMS (ESI) + calculated for C24H31ClN3O6P: [M+Na ] m/z 546.1531, found: 546.1526. ((2R,3S,5R)-3-hydroxy-5-(2-oxo-2,3-dihydro-1H-benzo[d]imidazol-1-yl)tetrahydrofuran-2-yl)methyl triphosphate 4b (BenziTP) 3b (0.090 g, 0.17 mmol) was dissolved in 5 ml anhydrous DMF and given to a flask set under H2. A tip of palladium catalyst (10% Pd/C) was added and the mixture was stirred under an H2 atmosphere at 25°C for 40 minutes. The reaction mixture was filtered through a 0.45 μm syringe filter to remove the catalyst. To the filtrate, Tris(tetra-n-butylammonium) hydrogen pyrophosphate (0.094 g, 0.17 mmol) was added and the mixture was stirred for 30 minutes at 25°C under argon atmosphere. DMF was removed under reduced pressure and residual was diluted in 0.5 mL MilliQ water. The resulting solution was purified twice by reverse-phase HPLC: first on a Phenomenex LUNA C18 column (250 x 10 mm) with an acetonitrile in 50 mM TEAA (pH 7) gradient (2-60% in 25 min, flow rate 2mL/min); followed by a second purification on a Phenomenex Jupiter Proteo column (250 x 10 mm) with a 50% acetonitrile in 50 mM TEAA (pH 7) gradient (30-34% in 11 min, flow rate of 2.5 mL/min) yielding product 2d (0.025 g, 30%; overall yield: 10%) with + triethylammonium (TEA ) as counter ion. To exchange the counter ion to the sodiated form, product 4b (0.025 g, 0.05 mmol) was dissolved in 1 mL MilliQ water, then NaClO4 (0.093 g, 0.76 mmol) was added and the mixture was stirred for 16 hours at 25°C. Then, Acetone (4 mL) was added and the mixture centrifuged for 3 minutes at 14’000 g. The supernatant was carefully discarded and the pellet was dissolved in 0.5 mL 1 water and lyophilized to give final sodiated triphosphate 4b (0.012 g). H NMR (400 MHz, D2O) δ 7.55 – 7.53 (m, 1H), 7.27 – 7.23 (m, 3H), 6.35 (dd, J = 8.6, 6.6 Hz, 1H), 4.82 – 4.79 (m, 1H), 4.33 – 4.16 (m, 3H), 3.19 (q, J = 7.3 Hz, TEA salt), 2.93 (dt, J = 14.2, 8.0 Hz, 1H), 2.25 (ddd, J = 14.1, 6.6, 3.1 Hz, 1H), 1.28 (t, J = 7.3 Hz, TEA salt); 13 C NMR (400 MHz, D2O, referenced to acetone) δ 154.56, 127.38, 126.83, 122.32, 121.75, 110.75, 109,77, 84.05, 31 81.96, 70.07, 64.84, 35.10; P NMR (400 MHz, D2O) relative to phosphoric acid standard: δ -10.45 (d, J = 19.8 Hz, 1P), -11.28 (d, J = 20.0 Hz, 1P), -23.14 (t, J = 19.9 Hz, 1P). HRMS (ESI) calculated for C12H17 N2O13P3: [M-H+] m/z 488.9860, found: 488.9866. Synthesis scheme i) a) (4-chlorobutyl)(methyl)phosphoramidic dichloride, hydroxybenzotriazole, THF, pyridine; b) BIM/Benzi Nucleoside, N-methylimidazole, THF ii) Benzylic alcohol, 4-dimethylaminopyridine, THF iii) a) DMF, Pd/C, 10% H2; b) PPi Scheme S1. Synthesis approach for nucleoside triphosphate analogs BIMTP and BenziTP S5 NMR spectra 1 H NMR. ((2R,3S,5R)-5-(1H-benzo[d]imidazol-1-yl)-3-hydroxytetrahydrofuran-2-yl)methyl 1Hbenzo[d][1,2,3]triazol-1-yl (4-chlorobutyl)(methyl)phosphoramidate 3a (CDCl3) 31 P NMR. ((2R,3S,5R)-5-(1H-benzo[d]imidazol-1-yl)-3-hydroxytetrahydrofuran-2-yl)methyl 1Hbenzo[d][1,2,3]triazol-1-yl (4-chlorobutyl)(methyl)phosphoramidate 3a (CDCl3) S6 13 C NMR. ((2R,3S,5R)-5-(1H-benzo[d]imidazol-1-yl)-3-hydroxytetrahydrofuran-2-yl)methyl 1Hbenzo[d][1,2,3]triazol-1-yl (4-chlorobutyl)(methyl)phosphoramidate 3a (CDCl3) 1 H NMR. 2’-deoxy Bim 5’-triphosphate 4a (D2O) S7 31 P NMR. 2’-deoxy Bim 5’-triphosphate 4a (D2O) 13 C NMR. 2’-deoxy Bim 5’-triphosphate 4a (D2O) S8 1 H NMR. 5`- Benzi 1-benzotriazolyl N-methyl-N-(4-chlorobutyl) phosphoramidate 2b (CDCl3) 31 P NMR. 5`- Benzi benzyl N-methyl-N-(4-chlorobutyl) phosphoramidate 2b (CDCl3) S9 1 H NMR. 5`- Benzi benzyl N-methyl-N-(4-chlorobutyl) phosphoramidate 3b (CDCl3) 31 P NMR. 5`- Benzi benzyl N-methyl-N-(4-chlorobutyl) phosphoramidate 3b (CDCl3) S10 13 C NMR. 5`- Benzi benzyl N-methyl-N-(4-chlorobutyl) phosphoramidate 3b (CDCl3) 1 H-NMR. 2’ deoxy Benzi 5’-triphosphate triethylammonium salt 4b (D2O) S11 31 P NMR. 2’-deoxy Benzi 5’-triphosphate 4b (D2O) 13 C NMR. 2’-deoxy Benzi 5’-triphosphate 4b (D2O) S12 DNA polymerase-mediated single-nucleotide incorporation experiments A) 3' ATTATGCTGAGTGATATCCCTCT-X-CTCA 5' 5' TAATACGACTCACTATAGGGAGA DNA Pol Incorporation? Specificity? dNTP(s) or artificial nucleotides B) Template dNTP X=G M C Benzi X = O6-BnG C Benzi Figure S1: A) DNA polymerase-mediated primer extension and sequences used in this study. B) Dpo4-mediated incorporation of BenziTP opposite X=G, or O6-BnG (at 24 nt). Incubation at 37°C, 30 min; 5 nM enzyme, 10 nM DNA, 1x AB buffer, 2.5 mM MgCl2, 100 μM dNTPs. M, marker (23 nt); C, dCTP; Benzi, BenziTP. Figure S2: Therminator-mediated single nucleotide incorporation of natural dNTPs and nucleotide analogs opposite X=G, and O6BnG (at 24 nt). Incubation at 55°C, 10 min; 5 nM enzyme, 15 nM DNA, 1x ThermoPol reaction buffer, 10 μM dNTPs. M, marker (23 nt); 4, all four dNTPs; G, dGTP, A, dATP, T, dTTP; C, dCTP, BIM, BIMTP; Benzi, BenziTP. Figure S3. KOD-mediated single nucleotide incorporation of natural dNTPs and nucleotide analogs opposite X=G, and O6-BnG (at 24 nt). Incubation at 55°C, 10 min; 5 nM enzyme, 15 nM DNA, 1x KOD reaction buffer, 10 μM dNTPs. M, marker (23 nt); 4, all four dNTPs; G, dGTP, A, dATP, T, dTTP; C, dCTP, BIM, BIMTP; Benzi, BenziTP. Figure S4. DeepVentR (exo-)-mediated single nucleotide incorporation of natural dNTPs and nucleotide analogs opposite X=G and O6-BnG (at 24 nt). Incubation at 55°C, 10 min; 5 nM enzyme, 15 nM DNA, 1x ThermoPol reaction buffer, 10 μM dNTPs. M, marker (23 nt); 4, all four dNTPs; G, dGTP, A, dATP, T, dTTP; C, dCTP, BIM, BIMTP; Benzi, BenziTP S13 Template X = O6-BnG X= G 94% 14% 3% dNTP(s) M 4 G A T C BIM Benzi 4 9% 14% 5% 39% G A T C BIM Benzi Figure S5. KlenTaq-mediated single nucleotide incorporation of natural dNTPs and nucleotide analogs opposite X=G and O6-BnG (at 24 nt). Incubation at 55°C, 10 min; 5 nM enzyme, 15 nM DNA, 1x KTQ reaction buffer, 10 μM dNTPs. M, marker (23 nt); 4, all four dNTPs; G, dGTP, A, dATP, T, dTTP; C, dCTP, BIM, BIMTP; Benzi, BenziTP. Figure S6. KTqM747K-mediated incorporation of non-natural nucleotide BenziTP opposite templates X=A, T, and C (at 24 nt). Reactions were incubated at 55°C for 10 minutes: 5 nM enzyme, 15 nM DNA, 1x KTQ reaction buffer, increasing concentrations of BenziTP (10, 25, 50, 75, and 100 μM); M, marker (23 nt). Figure S7: A) KTqM747K-mediated running start primer extension experiments and sequences used in this study. Bases flanking X=O6-BnG were alternated and are indicated with Y and Z. B) KTqM747K-mediated full extension of template X=O6-BnG in varied sequence context. Incubation at 55°C for 10min: 5 nM enzyme, 15 nM DNA, 1x KTQ reaction buffer, 10 μM dNTPs for –TXC- and – TXG- sequences, or 50 μM dNTPs for –AXC- and –AXG- sequences. M19, 19 nt marker; M23, 23 nt marker; 4, all four dNTPs; 4+N, all four dNTPs plus BenziTP. S14 Steady-state kinetic analysis of DNA polymerase catalysis Table S2. Steady-state kinetic parameters for dNTP incorporation mediated by KlenTaq DNA polymerase X 6 O -BnG dNTP KM [μM] kcat -1 [min ] kcat/KM -1 -1 [µM min ] Efficiency rel. to a KTqM747K BenziTP 27 ± 3 0.72 0.026 0.2 a Relative efficiency equals efficiency (kcat/KM) relative to that of BenziTP incorporation opposite O6-BnG by KTqM747K DNA polymerase. Table S3. Steady-state kinetic parameters for dNTP incorporation mediated by KTqM747K DNA polymerase X A T C dNTP KM [μM] kcat -1 [min ] kcat/KM -1 -1 [µM min ] Efficiency rel. to a natural dNTPs Efficiency rel. to b BenziTP dTTP 0.28 ± 0.02 9.7 34 1 300 BenziTP 3.3 ± 0.3 4.1 1.2 0.03600 10 dATP 0.24 ± 0.03 8.5 36 1 300 42 ±8 0.38 0.009 0.00025 0.08 0.22 20 91 1 760 71 ± 8 0.14 0.002 0.000022 0.02 BenziTP dGTP c BenziTP a Relative efficiency equals efficiency (kcat/KM) relative to that of natural dNTP incorporation opposite natural template; bRelative efficiency equals efficiency (kcat/KM) relative to that of BenziTP incorporation opposite O6-BnG; cSingle experiment, 2nd band quantification. References (1) Gahlon, H. L.; Schweizer, W. B.; Sturla, S. J. J. Am. Chem. Soc. 2013, 135, 6384. (2) Gahlon, H. L.; Sturla, S. J. Chem. Eur. J. 2013, 19, 11062. (3) Mounetou, E.; Debiton, E.; Buchdahl, C.; Gardette, D.; Gramain, J. C.; Maurizis, J. C.; Veyre, A.; Madelmont, J. C. J. Med. Chem. 1997, 40, 2902. (4) Bergen, K.; Betz, K.; Welte, W.; Diederichs, K.; Marx, A. Chembiochem. 2013, 14, 1058. (5) Holzberger, B.; Rubini, M.; Moller, H. M.; Marx, A. Angew. Chem. Int. Ed. Engl. 2010, 49, 1324. (6) Boosalis, M. S.; Petruska, J.; Goodman, M. F. J. Biol. Chem. 1987, 262, 14689. (7) Creighton, S.; Bloom, L. B.; Goodman, M. F. Methods Enzymol. 1995, 262, 232. S15
© Copyright 2026 Paperzz