JCS ePress online publication date 21 July 2009
Research Article
2877
Unconventional splicing of XBP1 mRNA occurs in the
cytoplasm during the mammalian unfolded protein
response
Aya Uemura, Masaya Oku, Kazutoshi Mori and Hiderou Yoshida*
Department of Biophysics, Graduate School of Science, Kyoto University, Japan
*Author for correspondence ([email protected])
Journal of Cell Science
Accepted 2 June 2009
Journal of Cell Science 122, 2877-2886 Published by The Company of Biologists 2009
doi:10.1242/jcs.040584
Summary
XBP1 is a key transcription factor that regulates the mammalian
unfolded protein response. Its expression is regulated by
unconventional mRNA splicing that is carried out by
endonuclease IRE1 and a specific, as yet unknown, RNA ligase
in response to the accumulation of unfolded proteins in the ER.
Conventional mRNA splicing occurs only in the nucleus, but it
has remained unclear whether unconventional splicing of XBP1
mRNA takes place in the nucleus, cytoplasm or both. Here, we
show that the catalytic domain of IRE1 contains a nuclear
exclusion signal to prevent IRE1 from mislocalizing to the
nucleus. In addition, RNA ligase, which joins XBP1 exons
cleaved by IRE1 was detected in the cytoplasm but not in the
Key words: ER stress, Unfolded protein response, RNA splicing,
IRE1, XBP1
Introduction
The endoplasmic reticulum (ER) is an organelle in which both
secretory and membrane proteins are synthesized. Proteins correctly
folded with assistance from ER chaperones are selectively exported
to the Golgi complex (Gething, 1997; Helenius and Aebi, 2004),
whereas unfolded or malfolded proteins are degraded by ERassociated protein degradation (ERAD) (Brodsky, 2007; Ruddock
and Molinari, 2006). The amounts of ER chaperones and ERAD
components are tightly regulated by a mechanism called the
unfolded protein response (UPR) or ER-stress response, and
increase through transcriptional induction of genes encoding ER
chaperones and ERAD components when unfolded proteins are
accumulated in the ER (ER stress) (Kohno, 2007; Malhotra and
Kaufman, 2007; Mori, 2003; Ron and Walter, 2007; Yoshida,
2007a). In yeast, the ER-stress response is regulated solely by the
IRE1 pathway. Ire1p is a transmembrane protein located in the ER
membrane, which contains an RNase domain in its cytoplasmic
portion (Cox et al., 1993; Mori et al., 1993). In response to ER
stress, unspliced (U) HAC1 mRNA is cleaved by Ire1p, and then
ligated by tRNA ligase Rlg1p (Cox and Walter, 1996; Gonzalez et
al., 1999; Kawahara et al., 1997; Kawahara et al., 1998; Mori et
al., 1996; Shamu and Walter, 1996; Sidrauski et al., 1996; Sidrauski
and Walter, 1997). Hac1pi translated from a spliced HAC1 mRNA
binds to the cis-acting element UPRE in the promoters of ER
chaperone genes as well as ERAD genes, and induces their
transcription (Kohno et al., 1993; Mori et al., 1998; Mori et al.,
2000; Mori et al., 1992; Ng et al., 2000; Travers et al., 2000). The
IRE1 pathway is conserved from yeast to mammals (Iwawaki et
al., 2001; Tirasophon et al., 1998; Wang et al., 1998), but IRE1α
and IRE1β, which are mammalian homologs of Ire1p, cleave
unspliced XBP1 mRNA instead of unspliced HAC1 mRNA in
response to ER stress (Calfon et al., 2002; Yoshida et al., 2001a).
Spliced XBP1 mRNA encodes an active transcription factor,
pXBP1(S), which activates transcription of its target genes,
including genes encoding ER chaperones and ERAD components,
to protect cells from ER-stress-induced apoptosis (Lee et al., 2003;
Yoshida et al., 2003; Yoshida et al., 2006a). Interestingly, unspliced
XBP1 mRNA is efficiently translated to produce pXBP1(U),
whereas translation of unspliced HAC1 mRNA is blocked by its
intron. pXBP1(U) binds pXBP1(S) and enhances its degradation;
pXBP1(U) is thought to be a negative regulator of the IRE1 pathway
(Tirosh et al., 2006; Yoshida et al., 2006b).
Mammalian cells have developed two additional regulatory
pathways, the ATF6 and PERK pathways. ATF6 is a transmembrane
protein located in the ER. Upon ER stress, it is transported to the
Golgi and sequentially cleaved by the proteases S1P and S2P,
resulting in release of its cytoplasmic part, pATF6(N) (Haze et al.,
1999; Okada et al., 2003; Ye et al., 2000). pATF6(N) containing
both DNA-binding and transcriptional activation domains
translocates into the nucleus, and activates transcription of its target
genes, such as ER chaperones and ERAD components as well as
XBP1 (Adachi et al., 2008; Haze et al., 2001; Okada et al., 2002;
Yamamoto et al., 2007; Yoshida et al., 1998; Yoshida et al., 2000;
Yoshida et al., 2001b). PERK is another transmembrane protein
located in the ER: it is a protein kinase that attenuates translation
in response to ER stress by phosphorylating the α-subunit of
eukaryotic translational initiation factor 2 (eIF2α) (Harding et al.,
2000a; Harding et al., 2001; Harding et al., 2000b; Harding et al.,
1999; Harding et al., 2003). The PERK pathway is also responsible
for translational induction of ATF4, a transcription factor whose
target genes include translational components as well as antioxidant
proteins.
nucleus. Moreover, the cytoplasm contained large amounts of
unspliced XBP1 mRNA compared with the nucleus. Most
unspliced XBP1 mRNA was converted to spliced mRNA by
unconventional splicing even if de novo transcription was
blocked, suggesting that cytoplasmic XBP1 mRNA, not nuclear
XBP1 mRNA, is a major substrate for unconventional splicing.
From these observations, we concluded that unconventional
splicing of XBP1 mRNA occurs predominantly in the cytoplasm.
Journal of Cell Science
2878
Journal of Cell Science 122 (16)
Importantly, the splicing of HAC1 and XBP1 mRNAs is
unconventional (Calfon et al., 2002; Gonzalez et al., 1999;
Kawahara et al., 1998; Sidrauski et al., 1996; Sidrauski and Walter,
1997; Yoshida, 2007b; Yoshida et al., 2001a). Conventional splicing
is catalyzed by the spliceosome, and involves a consensus sequence
at the border between an exon and an intron, such as GU-AG or
AU-AC, according to the so-called Chambon’s rule (Tarn and Steitz,
1997). During the conventional splicing reaction, the 5⬘ splice site
is cleaved first, and then the 3⬘ splice site is cut after formation of
a lariat structure. By contrast, the unconventional splicing reaction
is catalyzed by IRE1 and a specific RNA ligase, and is completely
independent of the spliceosome. There is a pair of characteristic
stem-loop structures at the exon-intron border instead of a
Chambon’s consensus sequence, and the cleavage of the 5⬘ and 3⬘
sites occurs randomly.
Conventional splicing takes place exclusively in the nucleus, but
it has been controversial where the splicing reaction of
unconventional splicing occurs (see Discussion). Unconventional
splicing of yeast HAC1 mRNA is thought to occur in the cytoplasm
(Ruegsegger et al., 2001), although Gething and colleagues argued
that it occurs in the nucleus as well as cytoplasm (Goffin et al.,
2006). Regarding mammalian unconventional splicing, it was
reported that IRE1 is localized in the inner nuclear membrane,
suggesting that it takes place in the nucleus (Lee et al., 2002).
However, it was also reported that the unconventional splicing
reaction could occur in the cytoplasm without nuclear processing
when the catalytic domain of IRE1 is ectopically expressed in the
cytoplasm (Back et al., 2006; Iwawaki and Akai, 2006).
In this study, we aimed to determine whether mammalian
unconventional splicing occurs in the nucleus, cytoplasm or both
by analyzing the subcellular localization of the splicing machinery,
including IRE1 and RNA ligase, in mammalian cells. We also
examined whether the major source of substrate for unconventional
splicing is the cytoplasmic or nuclear pool of XBP1(U) mRNA.
Results
The catalytic domain of IRE1α localized in the cytoplasm
Although IRE1α is assumed to be located in the ER membrane
(Niwa et al., 1999; Tirasophon et al., 1998), it is not clear whether
the catalytic domain of some fraction of IRE1 faces the nucleus or
cytosol, because the ER membrane is connected with the nuclear
membrane and IRE1 is a type I transmembrane protein. Preferential
localization to the inner nuclear membrane was also reported in a
subcellular fractionation study (Lee et al., 2002). To clarify this, a
plasmid expressing the C-terminal region of IRE1α (IRE1α-CTR,
corresponding to residues 469-977 of human IRE1α) tagged with
HA epitopes was transfected into cells (Fig. 1A). IRE1α-CTR was
clearly localized to the cytoplasm and excluded from the nucleus
(Fig. 2Aa-c). Although large molecules are known to be excluded
from the nucleus because the nuclear pore cannot accommodate
them, exclusion of IRE1α-CTR from the nucleus is not due to its
molecular size, because IRE1α-CTR fused with a nuclear
localization signal of the transcription factor ATF6α (NLS-IRE1αCTR) was localized in the nucleus (Fig. 1A and Fig. 2Ad-f). This
strongly suggests that the catalytic domain of IRE1 is equipped with
a nuclear exclusion signal (NES) to avoid mislocalization to the
nucleus, and that its cytoplasmic localization is relevant to its
function. The exogenous expression of each IRE1α construct was
confirmed by immunoblotting (Fig. 1B, lanes 3 and 4). Two bands
of IRE1α deletions were detected in lanes 3 and 4: the upper band
might represent an autophosphorylated form (activated form),
Fig. 1. Constructs expressing IRE1α derivatives. (A) Schematic representation
of each IRE1 construct. HA-tag and NLS are indicated by boxes, and numbers
show amino acid positions. (B-D) Expression level of each IRE1 construct.
Whole-cell lysates prepared from cells transfected with the indicated
constructs were subjected to immunoblotting with anti-HA antiserum.
Asterisks indicate non-specific bands. (E) Putative NES sequences found in
IRE1 family proteins from human, murine, Drosophila melanogaster,
Caenorhabditis elegans and Saccharomyces cerevisiae are aligned. Critical
residues of putative NES are highlighted, and numbers indicate amino acid
positions. Mutations introduced in human IRE1α are indicated by asterisks.
because only one band was detected when a kinase-defective mutant,
IRE1α-K599A, was expressed (Fig. 1C, lanes 10 and 14).
The NES of IRE1 is located in the RNase domain
To determine the location of the NES contained in the IRE1α-CTR,
the subcellular localization of deletion mutants lacking distinct
domain(s) was analyzed (Fig. 2B). Expression of these mutants was
confirmed by immunoblotting (Fig. 1B). A deletion mutant retaining
the RNase domain (IRE1α [571-977]) was excluded from the
nucleus (Fig. 2Bd-f), whereas other deletions lacking the RNase
domain (IRE1α [469-834], IRE1α [469-570] and IRE1α [571-834])
were detected in both the nucleus and the cytoplasm (Fig. 2Ba-c,gl). These findings suggest that the NES of IRE1α is located in the
RNase domain, although a deletion mutant containing only the
RNase domain (IRE1α [835-977]) formed aggregates in the
Journal of Cell Science
Cytoplasmic splicing in mammalian UPR
Fig. 2. The RNase domain of IRE1α contains the NES sequence.
(A) Subcellular localization of IRE1α-CTR and NLS-IRE1α-CTR. HeLa cells
were transfected with the indicated plasmid and stained with anti-HA
antiserum (panels a and d). Nuclei were stained with DAPI (panels b and e)
and images were merged (panels c and f). (B) Subcellular localization of
deletion mutants of IRE1α-CTR. The indicated deletion mutants were
transiently expressed in HeLa cells and processed as in A. (C) Subcellular
localization of an NES mutant of IRE1α-CTR was analyzed as in A. Scale
bars: 10 μm.
cytoplasm and therefore its localization could not be determined
(data not shown). Next, we searched the RNase domain for an NESlike sequence in silico, and found an NES-like sequence, as
expected, that was highly similar to the NES consensus [L-x(2,3)(LIVFM)-x(2,3)-L-x-(LI)] (la Cour et al., 2003) and well conserved
from yeast to humans (Fig. 1E). An IRE1α-CTR-NES mutant in
which two critical hydrophobic residues (Val918 and Leu922) were
mutated to glycine was found in the cytoplasm as well as nucleus
(Fig. 2C), suggesting that the NES-like sequence found in the RNase
domain actually functions as an NES. Since IRE1α-CTR does not
seem to have an NLS consensus sequence, the IRE1α-CTR-NES
mutant might stray into the nucleus through the nuclear pore by
diffusion (the nuclear pore complex can passively transport
2879
Fig. 3. Effect of ectopic expression of IRE1α-CTR in the cytoplasm or nucleus
on XBP1(U) mRNA. (A) Schematic representation of XBP1 mRNAs. Numbers
indicate amino acid positions. (B) HeLa cells were transfected with plasmid
expressing XBP1(U) mRNA together with constructs expressing HA-IRE1αCTR or HA-NLS-IRE1α-CTR as indicated. Total RNA was extracted from
transfected cells and analyzed by northern blotting (2% agarose gel) using an
XBP1 cDNA probe that corresponds to the 5⬘ portion of XBP1 mRNA (top
panel). Whole-cell extracts subjected to immunoblotting with anti-XBP1-A
antiserum (middle panel) or anti-HA antiserum (bottom panel). Each pair of
left and right panels are derived from the same exposure of the same gel.
(C) Deletion mutants of XBP1(U) mRNA expressed in HeLa cells with HANLS-IRE1α-CTR. XBP1 mRNA was detected as in the top panel in B.
macromolecules whose nucleocytoplasmic domain is smaller than
67 kDa, and IRE1α-CTR is 57.7 kDa). From these results, we
conclude that IRE1α contains an NES sequence so that its catalytic
domain faces the cytosol.
RNA ligase activity for unconventional XBP1 splicing is found
predominantly in the cytoplasm
The above findings prompted us to investigate the subcellular
localization of the specific RNA ligase that joins XBP1 mRNA
cleaved by IRE1. Since the gene for RNA ligase involved in
mammalian unconventional splicing has not yet been cloned, we
adopted an indirect approach, investigating the subcellular location
of RNA ligase activity. Our strategy was based on the notion that
ectopic expression of IRE1α-CTR in the subcellular compartment
where the RNA ligase resides would result in the production of
XBP1(S) mRNA and pXBP1(S), since XBP1(U) mRNA cleaved by
IRE1α-CTR could be ligated by the endogenous RNA ligase there.
By contrast, when IRE1α-CTR was expressed at a location lacking
Journal of Cell Science
2880
Journal of Cell Science 122 (16)
RNA ligase activity, the cleaved XBP1(U) mRNA would not be
ligated, leading to accumulation of cleaved mRNA. Since IRE1αCTR is known to form a dimer through its residual dimerization
potential in the cytoplasmic domain and can cleave substrate mRNA
(Gonzalez et al., 1999; Lee et al., 2008; Sidrauski and Walter, 1997),
we did not fuse an additional dimerization motif to IRE1α-CTR.
Upon immunoblotting, two bands of IRE1α-CTR (with or without
NLS) were detected (Fig. 3B, lanes 13-18), whereas only one band
was detected in the case of kinase-defective IRE1α-CTR-K599A
mutant (Fig. 1C, lanes 10 and 14), suggesting that the upper band
represents an autophosphorylated form (activated form), and that
IRE1α-CTR forms a dimer that is indeed active.
When HeLa cells were transfected with a plasmid expressing
XBP1(U) mRNA, 2.0 kb XBP1(U) mRNA was detected (Fig. 3B,
upper panel, lane 1), from which a pXBP1(U) protein of 29 kDa
was translated (Fig. 3B, middle panel, lane 7). Simultaneous
transfection with a plasmid expressing IRE1α-CTR resulted in
splicing of XBP1(U) mRNA, which led to the production of 50 kDa
pXBP1(S), as expected (Fig. 3B, middle panel, lane 8). It should
be noted that the size of XBP1 mRNA did not change appreciably
(Fig. 3B, middle panel, lane 2), because the intron removed by
unconventional splicing was very small (26 nucleotides). Evidently,
cytoplasmic expression of IRE1α-CTR resulted in both cleavage
and ligation of XBP1(U) mRNA, leading to the production of
XBP1(S) mRNA. By contrast, co-expression of NLS-IRE1α-CTR
with XBP1(U) mRNA produced a 0.7 kb truncated XBP1 mRNA,
whereas 2.0 kb XBP1(U) mRNA was reduced (Fig. 3B, middle
panel, lane 3). The amount of pXBP1(U) was markedly decreased
and pXBP1(S) was produced at a very low concentration (Fig. 3B,
middle panel, lane 9). Since the 0.7 kb band was detected using a
cDNA probe for the 5⬘ portion of XBP1(U) mRNA, and since the
splicing site is located at residue 164 (see Fig. 3A), this mRNA
band must have come from the 5⬘ portion of XBP1(U) mRNA,
which was cleaved by NLS-IRE1α-CTR, remained unligated and
accumulated in the nucleus.
To confirm this, 3⬘ deletion mutants of XBP1(U) mRNA were
expressed together with NLS-IRE1α-CTR in HeLa cells (Fig. 3C).
Deletion mutants containing the unconventional splicing site yielded
the 0.7 kb band (Fig. 3C, lanes 1-3), whereas a mutant lacking the
splicing site (1-133) did not (Fig. 3C, lane 4). This suggested that
the 3⬘ end of the 0.7 kb protein resides between 133 and 185, where
the unconventional splicing site of XBP1 exists. The 0.7 kb band
is smaller than a band of XBP1 [1-133] containing a poly(A) tail
(lanes 1-4), suggesting that the 0.7 kb band is not polyadenylated,
and that it is not produced by premature termination or altered
initiation of transcription. Although bisected mRNAs are thought
to be rapidly degraded by an mRNA quality control mechanism
such as nonstop mRNA decay (Frischmeyer et al., 2002; van Hoof
et al., 2002), Peter Walter and colleagues reported that truncated
HAC1 mRNA was indeed observed in the mutant of RNA ligase
rlg1-100 (Sidrauski et al., 1996). The small amount of bisected XBP1
mRNA observed in Fig. 3A seemed to survive the mRNA quality
control process, although most of the bisected XBP1 mRNA was
degraded. These results indicate that the activity of the RNA ligase
required for unconventional splicing resides predominantly in the
cytoplasm, not in the nucleus. We found that the expression level
of IRE1α-CTR was somewhat greater than that of NLS-IRE1αCTR (lanes 13-18), suggesting that it is not likely that excessive
expression of NLS- IRE1α-CTR caused a shortage of RNA ligase
and the consequent accumulation of truncated XBP1 mRNA. It is
also unlikely that low expression of NLS-IRE1-CTR resulted in
reduced cleavage of XBP1 mRNA, leading to little induction of
pXBP1(S), because cleaved XBP1 mRNA accumulated (Fig. 3B,
lane 3) and the amount of pXBP1(U) was also decreased (lane 9).
Moreover, expression of cytoplasmic IRE1α-CTR resulted in
cleavage of about one-third of XBP1(U) mRNA (judging from
reduction of pXBP1(U) protein in lanes 7 and 8 in Fig. 3B), whereas
that of NLS-IRE1α-CTR resulted in cleavage of more XBP1(U)
mRNA (Fig. 3B, lanes 7 and 9). The expression of cytoplasmic
IRE1α-CTR was higher than that of NLS-IRE1α-CTR (Fig. 3B,
lanes 14 and 15), suggesting that the RNase activity of NLS- IRE1αCTR is as effective as that of cytoplasmic IRE1α-CTR. Thus, it is
not likely that NLS-IRE1α-CTR is an ineffective RNase or that
overaccumulation of NLS-IRE1α-CTR in the nucleus disrupts
IRE1α-RNA ligase complexes (which might need to form in a
defined stoichiometric ratio), leading to cleavage but not ligation
in this situation. Since the amount of XBP1(U) mRNA located in
the nucleus is very limited (Fig. 4A), nascent XBP1(U) mRNA might
be cleaved by NLS-IRE1α-CTR upon transcription in the nucleus,
leading to accumulation of truncated XBP1 mRNA.
XBP1(U) mRNA is localized in the cytoplasm and associated
with membranes
Next, we analyzed the subcellular localization of XBP1(U) mRNA,
a substrate of unconventional splicing. First, the distribution of
XBP1(U) mRNA in the nucleus and cytoplasm was examined. HeLa
cells were incubated in PBS or HEPES containing 0.5% NP40,
which solubilizes the plasma membrane without disrupting the
nuclear membrane. The nucleus was separated from the cytoplasm
by centrifugation, and RNA and protein were extracted from the
nuclear and cytoplasmic fractions, and subjected to northern and
western blotting, respectively (Fig. 4). The purity of each fraction
Fig. 4. Subcellular fractionation of cellular RNA into nuclear and cytoplasmic
fractions. HeLa cells were treated with 0.5% NP40 in PBS (lanes 1 and 2) or
HEPES buffer (lanes 3 and 4) to solubilize the plasma membrane, and the
nuclear (Nu) and cytoplasmic (Cy) fractions were separated by centrifugation.
Each fraction was subjected to northern (A-C) and western (D,E) blotting. The
panels show XBP1 mRNA (A), GAPDH mRNA (B), ribosomal RNA (C),
lamin B (D) and GAPDH (E), respectively. Asterisks indicate non-specific
bands.
Journal of Cell Science
Cytoplasmic splicing in mammalian UPR
was verified by detecting a nuclear marker (lamin B) as well as a
cytoplasmic marker (GAPDH) (Fig. 4D,E). When cells were
disrupted in HEPES-NP40 solution, the nuclear fraction was
contaminated with cytoplasmic material (Fig. 4, lanes 3 and 4), but
purity was improved when cells were disrupted in PBS-NP40
solution (Fig. 4, lanes 1 and 2). Most rRNA was found in the
cytoplasmic fraction, although a small amount of rRNA was
recovered in the nuclear fraction (Fig. 4C). It is possible that rRNA
newly synthesized in the nucleolus might have been responsible
for such a nuclear localization. Most XBP1(U) mRNA as well as
GAPDH mRNA was localized in the cytoplasmic fraction (Fig.
4A,B), suggesting that XBP1(U) mRNA is rapidly exported from
the nucleus after transcription and accumulates in the cytoplasm,
and that there is only a small pool of XBP1(U) mRNA in the nucleus.
We next analyzed more precisely the subcellular location of XBP1
mRNA in the cytoplasm (Fig. 5). HeLa cells were disrupted by
three cycles of freeze-thawing, and then centrifuged to separate the
soluble materials, including cytosol and luminal materials of
organelles, from the insoluble materials, including the cellular
membrane. RNA and protein were extracted from each fraction,
and subjected to northern and western blotting. The purity of each
fraction was verified by checking for the presence of an ER
membrane marker (calnexin, CNX) and a cytosolic marker
(GAPDH) (Fig. 5C,D). CNX was found only in the insoluble
fraction, whereas most GAPDH protein was found in the soluble
fraction (although a small amount was detected in the insoluble
fraction) (Fig. 5C,D, lanes 1-4). Most GAPDH mRNA was found
in the soluble fraction, as expected (Fig. 5B, lanes 1-4). By contrast,
most mRNA encoding BiP (human gene HSPA5) was localized in
the insoluble fraction, reflecting the fact that it docks at the ER
membrane through the signal peptide contained in the BiP protein.
Fig. 5. Subcellular fractionation of cellular RNA into soluble and insoluble
fractions. (A-D) HeLa cells treated with or without 1 μM thapsigargin (TG) for
8 hours were subjected to three cycles of freeze-thawing, and the soluble (S)
and insoluble fractions (P) of cell lysates separated by centrifugation. RNA
and protein extracted from each fraction was analyzed by northern (A,B) and
western blotting (C,D), respectively. Each panel shows XBP1 mRNA (A), BiP
and GAPDH mRNAs (B), CNX (C) and GAPDH (D). (E) HeLa cells were
incubated with 1 μM thapsigargin for the indicated time, and cell lysates were
fractionated as described in A. RNA extracted from insoluble and soluble
fractions was subjected to RT-PCR with XBP1 primers. (F,G) Soluble (S) and
insoluble (P) fractions separated in E subjected to western blotting with antiCNX (F) and anti-GAPDH serum (G).
2881
Interestingly, most XBP1(U) mRNA was found in the insoluble
fraction rather than in the soluble fraction in the absence of an ERstress-inducing agent, thapsigargin (Fig. 5A, lanes 1 and 2),
suggesting that a large amount of XBP1(U) mRNA is associated
with some cellular membrane other than the nuclear membrane.
One possibility is that XBP1 mRNA is associated with this
membrane (possibly the ER membrane) so that it can be rapidly
processed by the unconventional splicing machinery in response to
ER stress. This idea is consistent with published results (Stephens
et al., 2005; Yanagitani et al., 2009) (see Discussion). When cells
were treated with thapsigargin for 8 hours, the amount of XBP1
mRNA was increased by transcriptional induction in response to
ER stress (Yoshida et al., 2000), and XBP1 mRNA fractionated into
the soluble fraction was increased, suggesting that XBP1(S) mRNA
was released from the membrane.
To confirm this, we performed RT-PCR analysis using
fractionated RNAs (Fig. 5E). In the absence of ER stress, only
XBP1(U) mRNA was found in both soluble and insoluble fractions
(Fig. 5E, lanes 1 and 5). After 8 hours of thapsigargin treatment,
the ratio between XBP1(S) mRNA and XBP1(U) mRNA in the
insoluble fraction was almost 1:1, whereas the ratio was
approximately 2:1 in the soluble fraction (Fig. 5E, lanes 4 and 8),
suggesting that XBP1(S) mRNA tends to be released from the
membrane. The purity of each fraction was checked by
immunoblotting using anti-CNX and anti-GAPDH antisera (Fig.
5F,G).
The major source of substrate for unconventional splicing is
cytoplasmic XBP1(U) mRNA
The above observations indicate that most XBP1(U) mRNA is
localized in the cytoplasm, suggesting that unconventional splicing
machinery uses the cytoplasmic pool of XBP1(U) mRNA. However,
it remained possible that the reaction of unconventional splicing
was coupled with transcription, and that nuclear XBP1 mRNA was
spliced in the nucleus and rapidly transported to the cytoplasm. To
exclude this possibility, de novo transcription was halted by adding
α-amanitin, an inhibitor of RNA polymerase II (Stirpe and Fiume,
1967) (Fig. 6A-C). In the absence of ER stress, XBP1 mRNA was
not spliced, and only small amounts of XBP1 and BiP (HSPA5)
mRNAs were observed (Fig. 6A-C, lane 1). When cells were treated
with thapsigargin for 8 hours to induce ER stress, most XBP1(U)
mRNA was spliced and the levels of XBP1 and BiP (HSPA5)
mRNAs were increased (Fig. 6A-C, lane 2). When cells were treated
with both α-amanitin and thapsigargin, transcriptional induction of
BiP and XBP1 was completely inhibited, indicating that de novo
transcription was completely abolished (Fig. 6A,B, lane 4). In this
situation, most XBP1(U) mRNA was converted to mature mRNA
(Fig. 6C, lane 4), suggesting that unconventional splicing of XBP1
can occur without de novo transcription, and that the unconventional
splicing machinery splices the pre-existing pool of XBP1(U)
mRNA, which is mostly cytoplasmic (see Fig. 4A, lanes 1-4). In
other words, the cytoplasmic pool of XBP1(U) mRNA is not a
‘dead-end’ product, but is rather a cryptic substrate for
unconventional splicing. We obtained essentially the same results
using other inhibitors of RNA polymerase II, such as actinomycin
D (Goldberg et al., 1962) and DRB (Sehgal et al., 1976) (Fig. 6D,E).
Thus, it is highly likely that the major source of substrate for
unconventional splicing is cytoplasmic XBP1(U) mRNA.
Considering the above evidence concerning IRE1, RNA ligase and
XBP1(U) mRNA together, we conclude that the unconventional
splicing of XBP1(U) mRNA occurs predominantly in the cytoplasm,
2882
Journal of Cell Science 122 (16)
Journal of Cell Science
Fig. 6. XBP1 splicing in the absence of de novo transcription. (A-C) Total
RNA extracted from HeLa cells was treated with or without 50 μg/ml αamanitin (AMA) and 1 μM thapsigargin (TG) for 4 hours, and subjected to
northern blotting (A,B) and RT-PCR analysis with XBP1 primers (C). The
panels show XBP1 mRNA (A), BiP and GAPDH mRNAs (B) and XBP1(U)
and XBP1(S) mRNAs, respectively. (D,E) HeLa cells were treated with
5 μg/ml actinomycin D or 25 μg/ml DRB and analyzed as in C.
where both the machinery and substrate for the unconventional
splicing exist.
Discussion
In the past, it has been controversial whether unconventional mRNA
splicing occurs in the nucleus, cytoplasm or both. This question is
very important, not only for research on RNA splicing, but also for
research on the ER-stress response, because the location of the
splicing reaction is closely linked with the biological significance
of the unconventional splicing (see below). Since XBP1 splicing
occurs very fast (15-30 minutes after ER stress) (see Fig. 6D,E)
compared with the cell cycle (approximately 24 hours in HeLa cells),
and ER stress arrests cells at G1 phase (Brewer et al., 1999), the
nucleus is separated from the cytoplasm during ER stress. Walter
and colleagues clearly demonstrated that unspliced HAC1 mRNA
is located in the cytoplasm and associated with stalled polysomes,
and that splicing of HAC1 can occur even if de novo transcription
is inhibited, strongly suggesting that unconventional splicing occurs
in the cytoplasm in yeast cells (Ruegsegger et al., 2001). However,
Gething and colleagues recently reported that yeast Ire1p contains
a nuclear localization sequence, and that HAC1 splicing requires
both nuclear localization of Ire1p and components of the nuclear
import machinery such as RanGAP and RanGEF (Goffin et al.,
2006). From these observations, they argued that newly synthesized
unspliced HAC1 mRNA is spliced in the nucleus, whereas the preexisting pool of unspliced HAC1 mRNA is spliced in the cytoplasm.
However, if this is the case, yeast cells have unconventional splicing
machinery in both the nucleus and cytoplasm, and point mutations
in the NLS of Ire1p should not abolish splicing of HAC1 mRNA
upon ER stress, contradicting their observations. Moreover, the NLS
sequences that they found in yeast Ire1p (KKKRKR and KKGR)
are not conserved in species. Thus, it seems plausible that yeast
unconventional splicing takes place in the cytoplasm.
As for mammalian unconventional splicing, the location of the
splicing reaction has remained elusive. Kaufman and colleagues
showed that IRE1 is localized to the inner nuclear envelope,
supporting the notion that XBP1 splicing occurs in the nucleus (Lee
et al., 2002), although they reported in a previous paper that IRE1
is located in the ER and the nuclear membrane (Holmer and
Worman, 2001; Tirasophon et al., 1998). They also reported that
XBP1(U) mRNA either transcribed in the cytosol by T7 RNA
polymerase or delivered to the cytosol by RNA transfection can be
spliced in response to ER stress, and that ectopic expression of the
catalytic domain of IRE1 in the cytoplasm induced XBP1 splicing
(Back et al., 2006). Iwawaki and colleagues reported similar results
(Iwawaki and Akai, 2006). These observations suggest that upon
artificial expression of XBP1 mRNA or IRE1 in the cytoplasm,
unconventional splicing can occur in the cytoplasm of mammalian
cells in the absence of nuclear processing. However, Walter and
colleagues reported that IRE1 residing in the ER is translocated to
the nucleus upon ER stress to cleave a substrate mRNA (Niwa et
al., 1999; Tirasophon et al., 1998). Thus, it is unclear whether XBP1
splicing occurs in the nucleus, or whether it actually occurs in the
cytoplasm in vivo.
Here, we tried to clearly determine whether mammalian
unconventional splicing occurs in the cytoplasm, nucleus or both.
We first examined whether IRE1 is located in the nucleus, especially
in the inner nuclear membrane (INM). Our finding that the catalytic
domain of IRE1α has a nuclear exclusion signal strongly suggests
that the NES of IRE1α has been evolved to prevent mislocalization
of the IRE1α catalytic domain to the nucleus (Figs 1 and 2).
Mislocalization of IRE1 would be detrimental to cells because the
nucleus is not the place where the unconventional splicing occurs
under normal physiological conditions, and mislocalization might
cause accidental cleavage of XBP1(U) mRNA. It is possible that
the NES is important to prevent mislocalization of IRE1α to the
inner nuclear envelope after reassembly of the nuclear envelope
after nuclear division.
The targeting of INM proteins such as lamin B receptor to the
INM has been well studied (Holmer and Worman, 2001). INM
proteins are synthesized in the ER and freely diffuse in the
interconnected membranes of the ER and nucleus; they move along
the nuclear pore complex and arrive at the INM. As a result of
binding to nuclear ligands such as lamins or chromatin, INM
proteins are retained there. Movement through the nuclear pore
complex is limited by protein size. Membrane proteins whose
nucleoplasmic domain is larger than 67 kDa cannot diffuse through
the nuclear pore complexes. INM proteins contain targeting signals
to the inner nuclear membrane called the inner nuclear membrane
sorting motif (INM-SM) (Braunagel et al., 2004). The INM-SM
contains two major features, namely, a hydrophobic stretch of 1820 amino acid residues constituting a transmembrane sequence and
a cluster of charged residues exposed within the cytoplasm or
nucleoplasm, which is positioned within 4-8 residues of the end of
the transmembrane sequence. Importin-α-16 is located adjacent to
the translocon protein Sec61α and recognizes the sorting motif of
INM proteins, and facilitates their sorting to the INM (Saksena et
al., 2006). Human IRE1 has neither an INM-SM nor a classical
NLS motif, strongly suggesting that human IRE1 is not an INM
protein. Since the cytoplasmic domain of human IRE1 is 57.7 kDa,
it can stray into the INM by diffusion through the nuclear pore
complex, and NES is crucial for preventing such mislocalization.
Our second finding, that ectopic expression of the catalytic
domain of IRE1α in the nucleus resulted in impairment of
unconventional splicing (Fig. 3), is consistent with the above results,
and strongly suggests that very little of the RNA ligase involved in
unconventional splicing resides in the nucleus. It is possible that
our findings that overexpression of cytoplasmic IRE1α-CTR
enhanced unconventional XBP1 splicing (Fig. 3B, lane 8) might
merely be an artifact caused by colocalization of the enzymes with
Journal of Cell Science
Cytoplasmic splicing in mammalian UPR
an otherwise quiescent pool of XBP1 mRNA. However, we propose
that the RNA ligase responsible for unconventional splicing actually
exists in the cytoplasm, because we overexpressed only cytoplasmic
IRE1, and not RNA ligase. Moreover, overexpression of NLS-IRE1
resulted in the truncation of XBP1 mRNA (Fig. 3B, lane 3),
indicating that the nuclear function required for cleavage of XBP1
mRNA is not impaired. The expression of cytoplasmic IRE1α-CTR
was higher than that of NLS-IRE1α-CTR (Fig. 3B, lanes 14 and
15), meaning that it is unlikely that overaccumulation of NLSIRE1α-CTR in the nucleus disrupts IRE1-RNA ligase complexes.
Kaufman and colleagues reported that both NLS-IRE1α-CTR and
cytoplasmic IRE1α-CTR showed a low level of XBP1 to GFP
mRNA splicing that did not increase upon AP20187 treatment
(AP20187 was used to dimerize membrane bound-IRE1), whereas
membrane-bound IRE1-CTR produced mostly spliced XBP1-GFP
mRNA in response to AP20187 treatment (Back et al., 2006). The
discrepancy between their results and ours might be due to some
difference in experimental methods. They used reverse transcription
PCR to measure exogenously transfected XBP1-GFP mRNA,
whereas we examined XBP1 mRNA by northern blot analysis.
The mammalian RNA ligase responsible for unconventional
splicing has not yet been identified, and the mammalian genome
seems to contain no ortholog of yeast tRNA ligase RLG1, which
ligates unspliced HAC1 mRNA cleaved by Ire1p. Although it is
thought that Rlg1p localizes to the nucleus (Clark and Abelson,
1987) and tRNA splicing occurs in the nucleus, Yoshihisa and
colleagues reported that Sen2p and Sen54p, components of tRNA
splicing endonuclease, are located not in the nucleus, but on the
mitochondrial surface (Yoshihisa et al., 2003), suggesting that Rlg1p
could be distributed in the cytoplasm. Indeed, Weissman and
colleagues showed that Rlg1p localizes to the cytoplasm (Huh et
al., 2003). In plants, Arabidopsis and Oryza tRNA ligases, as well
as tRNA splicing endonuclease and 2⬘-phosphotransferase, are
reported to be preferentially located in the nucleus, although they
also seem to be targeted to other cellular compartments, including
the chloroplasts and the mitochondria (Englert and Beier, 2005).
Thus, it is possible that mammalian tRNA ligase is located in the
cytoplasm, although it remains unclear whether the RNA ligase
involved in mammalian unconventional splicing is a tRNA ligase.
There is accumulating evidence supporting the notion that the
mechanism of tRNA ligation is highly diverged between yeast and
mammals (Abelson et al., 1998; Hopper and Phizicky, 2003; Laski
et al., 1983; Sawaya et al., 2003), although HeLa cells have a minor
RNA ligase activity with the same biochemical hallmarks as yeast
tRNA ligase (Zillmann et al., 1991). Actually, XBP1 splicing is intact
in mice deficient in Trpt1, which encodes murine tRNA splicing
2⬘-phosphotransferase (Harding et al., 2008). Inactivation of Trpt1
eliminates all detectable 2⬘-phosphotransferase activity from
cultured mouse cells, suggesting that tRNA-splicing 2⬘phosphotransferase is not involved in XBP1 splicing.
Finally, we clearly demonstrated that the pool of XBP1(U) mRNA
in the cytoplasm is very large compared with that in the nucleus
(Fig. 4), and that the cytoplasmic XBP1(U) mRNAs are spliced in
response to ER stress even if de novo transcription is blocked (Fig.
6). This suggests that unconventional splicing uses the cytoplasmic
pool of XBP1(U) mRNA as the source of its substrate, although it
is still possible that nuclear XBP1(U) mRNA is also used as a source
if an unidentified mRNA transport mechanism shuttles the
cytoplasmic pool of XBP1(U) mRNA into the nucleus for splicing.
Kaufman and colleagues previously reported that XBP1(U) mRNA
was equally detected in both the nuclear and cytoplasmic fractions
2883
(Back et al., 2006), which is inconsistent with our observation that
most XBP1(U) mRNA is localized in the cytoplasm. It is possible
that this discrepancy is again due to differences in the experimental
procedures. Kaufman and colleagues measured the levels of
exogenously transfected XBP1-GFP transcripts by reversetranscription PCR, which might be at saturation and consequently
could grossly underestimate the pool of cytoplasmic XBP1 mRNA.
Based on experiments using a temperature-sensitive mutant of
RNA polymerase II, Ruegsegger and colleagues reported that yeast
HAC1 splicing does not require de novo transcription (Ruegsegger
et al., 2001), suggesting that the mechanism of unconventional
splicing is conserved between yeast and mammals. Back and coworkers reported that de novo transcription is essential for XBP1
splicing (Back et al., 2006), contradicting our results. The
discrepancy between these and our data might be derived from the
differences of the methods used. We measured endogenous XBP1
mRNA, whereas they measured exogenously transfected XBP1GFP mRNA.
The discovery that most XBP1(U) mRNA is associated with
membranes in the cytoplasm (Fig. 5) is consistent with a previous
report by Nicchitta and colleagues, in which they separated cytosolic
RNA from ER-associated RNA by centrifugation through a sucrose
gradient, and found that XBP1 mRNA was rich in the ER-associated
fraction (Stephens et al., 2005). Kohno and colleagues also
independently found that XBP1(U) mRNA associates with the ER
membrane (Yanagitani et al., 2009). It is reasonable to suggest that
XBP1(U) mRNA is concentrated on the ER membrane, where IRE1
senses the situation of the ER. Since XBP1(U) mRNA showed more
affinity for membranes than its spliced product, it is possible that
IRE1 retains XBP1(U) mRNA by binding its splicing site. From
these three lines of evidence, i.e. that the catalytic domain of IRE1
and RNA ligase activity were localized in the cytoplasm and
cytoplasmic XBP1(U) mRNA was the main source of splicing
substrate, together with the previous reports, we concluded that
mammalian unconventional splicing occurs predominantly in the
cytoplasm, as in the case for yeast unspliced HAC1 mRNA, and
that the mechanism of the unconventional splicing is well conserved
from yeast to mammals.
This conclusion raises another important question: why do
eukaryotic cells use cytoplasmic splicing to regulate ER stress
instead of nuclear splicing? One of the possible answers to the above
question is that cytoplasmic splicing is simpler than nuclear splicing.
In the case of nuclear splicing, signals from the ER must be
transmitted to the nucleus to activate the splicing machinery. After
the splicing reaction, spliced mRNA should be transported to the
cytosol for translation. After translation, XBP1 protein has to go
back to the nucleus to activate the transcription of ER chaperone
genes. Thus, signaling molecules need to cross the nuclear
membrane three times. In the case of cytoplasmic splicing, XBP1
protein is the only signal molecule that crosses the nuclear
membrane, because splicing and translation can occur in the
cytosol. Another possible answer to the question is that cytoplasmic
splicing is more energy efficient. There is a large pool of XBP1(U)
mRNA in the cytoplasm, from which a negative regulator,
pXBP1(U), is translated (Yoshida et al., 2006b). However, nuclear
splicing cannot use this pool of substrate because cytoplasmic
XBP1(U) mRNA might not be transported to the nucleus (shuttling
of cytoplasmic mRNA to the nucleus has not been discovered thus
far), and requires de novo transcription and translation as well as
transport of mRNA to the cytosol, thus probably consuming more
ATP. Induction of transcription and translation are usually time-
2884
Journal of Cell Science 122 (16)
consuming processes (XBP1 mRNA and protein require 2 hours
and 4 hours to reach their maxima in response to ER stress,
respectively), compared with nuclear transport of transcription
factors and it takes 3-9 minutes for NF-AT to translocate into the
nucleus upon Ca2+ signaling (Kwon et al., 2008). These additional
processes could still be a good point for introducing a layer of
regulation, but the ER-stress response does not seem to require it.
Moreover, unintended translation of pXBP1(U) from unspliced
mRNA still continues during ER stress. By contrast, cytoplasmic
splicing can convert cytoplasmic XBP1(U) mRNA to XBP1(S)
mRNA in response to ER stress, and can rapidly produce an active
transcription factor, pXBP1(S), simultaneously shutting off
pXBP1(U) production, while consuming less time and energy. We
speculate that eukaryotic cells have evolved such a mechanism of
cytoplasmic splicing to optimally regulate the ER-stress response
during evolution.
Materials and Methods
Cell culture
Journal of Cell Science
HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM: glucose
at 4.5 g/l) supplemented with 10% fetal calf serum, 2 mM glutamine and antibiotics,
100 U/ml penicillin-100 μg/ml streptomycin. Cells were maintained at 37°C in a
humidified 5% CO2 95% air atmosphere.
Transient transfection of cultured cells
Transient transfection of HeLa cells was carried out by the standard calcium phosphate
method (Sambrook et al., 1989; Yoshida et al., 2006a). HeLa cells cultured in 24well or 60-mm dishes were incubated with precipitates of calcium phosphate
containing plasmids for 6 hours at 37°C. After washing with phosphate-buffered saline
(PBS) to remove CaPO4-DNA precipitates, cells were incubated in fresh medium for
24 hours and harvested for analysis.
Construction of plasmids
pcDNA-human IRE1α was a kind gift from Randal J. Kaufman (University of
Michigan, Ann Arbor, MI). A plasmid expressing IRE1α-CTR (pCMV-HA-IRE1αCTR) was constructed by inserting a cDNA encoding residues 468-997 of human
IRE1α into an XhoI site of pCMV-HA vector, whereas pCMV-HA-NLS-IRE1α-CTR
was made by inserting residues 308-330 of ATF6α (containing a nuclear localization
signal) into a BglII site of pCMV-HA-IRE1α-CTR. Expression plasmids for a series
of IRE1α deletions fused with a HA tag were made by ligating the PCR product of
the corresponding region with pCMV-HA. pCMV-HA-IRE1α-CTR-NES mutant was
constructed by PCR-based site-directed mutagenesis, using a commercially available
kit (QuikChange Site-Directed Mutagenesis Kit: Stratagene) and a pair of primers
(AGCTGCCTGCAGAGGGGCGGGAGACGGGGGGGTCCCTCCCCGA and TCGGGGAGGGACCCCCCCGTCTCCCGCCCCTCTGCAGGCAGCT). To construct
a plasmid expressing XBP1(U) mRNA [pcDNA-pXBP1(U)], a 1787 bp fragment of
XBP1 cDNA encoding pXBP1(U), including the 3⬘-untranslated region, was cloned
into an XhoI site of pcDNA3.1 vector (Invitrogen). Expression plasmids for a series
of pXBP1(U) deletion mutants were made by ligating the PCR product of the
corresponding region with pcDNA3.1.
Immunocytochemistry
HeLa cells grown on coverslips were transiently transfected with appropriate
expression plasmids by the calcium phosphate method described above. Cells were
fixed with 2% paraformaldehyde in PBS containing 2 mg/ml NaIO4 and 10 mg/ml
lysine for 10 minutes, permeabilized with 0.2% Triton X-100 in PBS for 10 minutes,
and stained with appropriate antisera. Coverslips were mounted with 90% glycerol,
10% PBS containing 100 ng/ml DAPI. Fluorescent microscopy was carried out with
an E800 microscope (Nikon) and ORCA-ER digital camera (Hamamatsu photonics).
Immunoblotting
Cells grown in a 60 mm culture dish were harvested with a cell scraper and pelleted
by centrifugation. The pellet was suspended in 20 μl of ice-cold PBS containing
protease inhibitors (100 μM AEBSF, 80 μM aprotinin, 1.5 μM E-64, 2 μM leupeptin,
5 μM bestatin and 1 μM pepstatin A, 10 μM MG132), mixed with 20 μl of 4⫻ SDSsample buffer (200 mM Tris-HCl (pH 6.8), 400 mM DTT, 8% SDS and 40% glycerol),
and immediately boiled at 100°C for 10 minutes. Portions of samples (10 μl) were
subjected to SDS-polyacrylamide gel electrophoresis using 4-20% gradient gels,
transferred onto a Hybond-P membrane (GE), and incubated with various antisera,
according to standard protocols (Sambrook et al., 1989). Anti-XBP1-A (produced
previously) detects both pXBP1(U) and pXBP1(S) (Yoshida et al., 2001a). Anti-IRE1α
antiserum was raised by immunizing rabbits with the 218-366 region of human IRE1α
fused with glutathione S-transferase. An ECL western blotting detection kit (GE) and
a LAS-3000 lumino image analyzer (Fuji Film) were used to detect antigens.
Northern blot hybridization analysis
Total RNA extracted from cells with guanidine-phenol was separated by
electrophoresis on a 2% or 3% agarose gel containing 2.2 M formaldehyde, blotted
onto a Hybond-N+ membrane (GE), hybridized with alkaline phosphatase-conjugated
cDNA probes, and detected with a LAS-3000 lumino image analyzer using the Gene
Images AlkPhos Direct Labeling and Detection System (GE).
RT-PCR
RT-PCR of XBP1 mRNA was performed essentially as described previously (Yoshida
et al., 2001a). 10 μg total RNA was reverse-transcribed with MMLV reverse
transcriptase (Invitrogen) and amplified with Ex-Taq polymerase (Takara) using a
pair of primers that correspond to nucleotides 493-512 (CGCGGATCCGAATGAAGTGAGGCCAGTGG) and 834-853 (GGGGCTTGGTATATATGTGG) of
XBP1 mRNA, respectively. Amplified fragments covering a 26 nucleotide intron
(nucleotides 531-556) and flanking exon fragments were separated on 4-20%
polyacrylamide gels, visualized by staining with Gel Red (Biotium) and detected
using an LAS-3000 (Fuji Film).
Subcellular fractionation
To prepare the nuclear and cytoplasmic fractions of cells, HeLa cells grown on 60mm dishes were collected using a cell scraper, and incubated in 0.5% NP40-PBS
solution or 0.5% NP40-HEPES solution (20 mM HEPES-KOH, pH 7.9, 100 mM
KCl, 10% glycerol, 1 mM MgCl2, 1 mM 2-mercaptoethanol) at 4°C for 10 minutes
to solubilize the plasma membrane. After centrifugation at 500 g for 5 minutes at
4°C, the precipitate containing the nuclei was separated from the supernatant
containing the cytoplasm, and both fractions were subjected to western and northern
blotting. To separate the soluble and insoluble fractions, HeLa cells collected from
60 mm dishes were subjected to three cycles of freeze-thawing in PBS, and
centrifuged at 17,800 g for 10 minutes at 4°C. Precipitates and supernatants
containing the insoluble and soluble fractions, respectively, were subjected to
western, northern and RT-PCR analyses.
We thank Randal J. Kaufman for providing human IRE1α cDNA.
We also thank Takashi Yura, Tohru Yoshihisa, Kenji Kohno and
Elizabeth Nakajima for critical reading of the manuscript and Kaoru
Miyagawa for technical and secretarial assistance. This work was
supported by Yamada Science Foundation, the PRESTO-SORST
program of the Japan Science and Technology Agency, and grants from
the Ministry of Education, Culture, Sports, Science, and Technology
(MEXT) of Japan (No. 18050013, 19370086, 20052014 and 201998).
It was also financially supported in part by the Global Center of
Excellence Program A06 ‘Formation of a Strategic Base for Biodiversity
and Evolutionary Research: from Genome to Ecosystem’ from MEXT.
References
Abelson, J., Trotta, C. R. and Li, H. (1998). tRNA splicing. J. Biol. Chem. 273, 1268512688.
Adachi, Y., Yamamoto, K., Okada, K., Yoshida, H., Harada, A. and Mori, K. (2008).
ATF6 is a transcription factor specialized in the regulation of quality control proteins in
the endoplasmic reticulum. Cell Struct. Funct. 33, 75-89.
Back, S. H., Lee, K., Vink, E. and Kaufman, R. J. (2006). Cytoplasmic IRE1alphamediated XBP1 mRNA splicing in the absence of nuclear processing and endoplasmic
reticulum stress. J. Biol. Chem. 281, 18691-18706.
Braunagel, S. C., Williamson, S. T., Saksena, S., Zhong, Z., Russell, W. K., Russell,
D. H. and Summers, M. D. (2004). Trafficking of ODV-E66 is mediated via a sorting
motif and other viral proteins: facilitated trafficking to the inner nuclear membrane.
Proc. Natl. Acad. Sci. USA 101, 8372-8377.
Brewer, J. W., Hendershot, L. M., Sherr, C. J. and Diehl, J. A. (1999). Mammalian
unfolded protein response inhibits cyclin D1 translation and cell-cycle progression. Proc.
Natl. Acad. Sci. USA 96, 8505-8510.
Brodsky, J. L. (2007). The protective and destructive roles played by molecular chaperones
during ERAD (endoplasmic-reticulum-associated degradation). Biochem. J. 404, 353363.
Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbard, S. R., Harding, H. P., Clark, S.
G. and Ron, D. (2002). IRE1 couples endoplasmic reticulum load to secretory capacity
by processing the XBP-1 mRNA. Nature 415, 92-96.
Clark, M. W. and Abelson, J. (1987). The subnuclear localization of tRNA ligase in yeast.
J. Cell Biol. 105, 1515-1526.
Cox, J. S. and Walter, P. (1996). A novel mechanism for regulating activity of a transcription
factor that controls the unfolded protein response. Cell 87, 391-404.
Cox, J. S., Shamu, C. E. and Walter, P. (1993). Transcriptional induction of genes encoding
endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell
73, 1197-1206.
Journal of Cell Science
Cytoplasmic splicing in mammalian UPR
Englert, M. and Beier, H. (2005). Plant tRNA ligases are multifunctional enzymes that
have diverged in sequence and substrate specificity from RNA ligases of other
phylogenetic origins. Nucleic Acids Res. 33, 388-399.
Frischmeyer, P. A., van Hoof, A., O’Donnell, K., Guerrerio, A. L., Parker, R. and
Dietz, H. C. (2002). An mRNA surveillance mechanism that eliminates transcripts lacking
termination codons. Science 295, 2258-2261.
Gething, M. J. (1997). Guidebook to Molecular Chaperones and Protein-Folding Catalysts.
Oxford: Oxford University Press.
Goffin, L., Vodala, S., Fraser, C., Ryan, J., Timms, M., Meusburger, S., Catimel, B.,
Nice, E. C., Silver, P. A., Xiao, C. Y. et al. (2006). The unfolded protein response
transducer Ire1p contains a nuclear localization sequence recognized by multiple {beta}
importins. Mol. Biol. Cell 17, 5309-5323.
Goldberg, I. H., Rabinowitz, M. and Reich, E. (1962). Basis of actinomycin action. I.
DNA binding and inhibition of RNA-polymerase synthetic reactions by actinomycin.
Proc. Natl. Acad. Sci. USA 48, 2094-2101.
Gonzalez, T. N., Sidrauski, C., Dorfler, S. and Walter, P. (1999). Mechanism of nonspliceosomal mRNA splicing in the unfolded protein response pathway. EMBO J. 18,
3119-3132.
Harding, H. P., Zhang, Y. and Ron, D. (1999). Protein translation and folding are coupled
by an endoplasmic-reticulum- resident kinase. Nature 397, 271-274.
Harding, H. P., Novoa, I., Zhang, Y., Zeng, H., Wek, R., Schapira, M. and Ron, D.
(2000a). Regulated translation initiation controls stress-induced gene expression in
mammalian cells. Mol. Cell 6, 1099-1108.
Harding, H. P., Zhang, Y., Bertolotti, A., Zeng, H. and Ron, D. (2000b). Perk is essential
for translational regulation and cell survival during the unfolded protein response. Mol.
Cell 5, 897-904.
Harding, H. P., Zeng, H., Zhang, Y., Jungries, R., Chung, P., Plesken, H., Sabatini, D.
D. and Ron, D. (2001). Diabetes mellitus and exocrine pancreatic dysfunction in perk–/–
mice reveals a role for translational control in secretory cell survival. Mol. Cell 7, 11531163.
Harding, H. P., Zhang, Y., Zeng, H., Novoa, I., Lu, P. D., Calfon, M., Sadri, N., Yun,
C., Popko, B., Paules, R. et al. (2003). An integrated stress response regulates amino
acid metabolism and resistance to oxidative stress. Mol. Cell 11, 619-633.
Harding, H. P., Lackey, J. G., Hsu, H. C., Zhang, Y., Deng, J., Xu, R. M., Damha, M.
J. and Ron, D. (2008). An intact unfolded protein response in Trpt1 knockout mice
reveals phylogenic divergence in pathways for RNA ligation. RNA 14, 225-232.
Haze, K., Yoshida, H., Yanagi, H., Yura, T. and Mori, K. (1999). Mammalian
transcription factor ATF6 is synthesized as a transmembrane protein and activated by
proteolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell 10, 3787-3799.
Haze, K., Okada, T., Yoshida, H., Yanagi, H., Yura, T., Negishi, M. and Mori, K. (2001).
Identification of the G13 (cAMP-response-element-binding protein-related protein) gene
product related to activating transcription factor 6 as a transcriptional activator of the
mammalian unfolded protein response. Biochem. J. 355, 19-28.
Helenius, A. and Aebi, M. (2004). Roles of N-linked glycans in the endoplasmic reticulum.
Annu. Rev. Biochem. 73, 1019-1049.
Holmer, L. and Worman, H. J. (2001). Inner nuclear membrane proteins: functions and
targeting. Cell Mol. Life Sci. 58, 1741-1747.
Hopper, A. K. and Phizicky, E. M. (2003). tRNA transfers to the limelight. Genes Dev.
17, 162-180.
Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S., Howson, R. W., Weissman, J.
S. and O’Shea, E. K. (2003). Global analysis of protein localization in budding yeast.
Nature 425, 686-691.
Iwawaki, T. and Akai, R. (2006). Analysis of the XBP1 splicing mechanism using
endoplasmic reticulum stress-indicators. Biochem. Biophys. Res. Commun. 350, 709-715.
Iwawaki, T., Hosoda, A., Okuda, T., Kamigori, Y., Nomura-Furuwatari, C., Kimata,
Y., Tsuru, A. and Kohno, K. (2001). Translational control by the ER transmembrane
kinase/ribonuclease IRE1 under ER stress. Nat. Cell Biol. 3, 158-164.
Kawahara, T., Yanagi, H., Yura, T. and Mori, K. (1997). Endoplasmic reticulum stressinduced mRNA splicing permits synthesis of transcription factor Hac1p/Ern4p that
activates the unfolded protein response. Mol. Biol. Cell 8, 1845-1862.
Kawahara, T., Yanagi, H., Yura, T. and Mori, K. (1998). Unconventional splicing of
HAC1/ERN4 mRNA required for the unfolded protein response. Sequence-specific and
non-sequential cleavage of the splice sites. J. Biol. Chem. 273, 1802-1807.
Kohno, K. (2007). How transmembrane proteins sense endoplasmic reticulum stress.
Antioxid. Redox Signal. 9, 2295-2303.
Kohno, K., Normington, K., Sambrook, J., Gething, M. J. and Mori, K. (1993). The
promoter region of the yeast KAR2 (BiP) gene contains a regulatory domain that responds
to the presence of unfolded proteins in the endoplasmic reticulum. Mol. Cell. Biol. 13,
8778-8790.
Kwon, O. Y., Kwon, I. C., Song, H. K. and Jeon, H. (2008). Real-time imaging of NFAT nucleocytoplasmic shuttling with a photoswitchable fluorescence protein in live cells.
Biochim. Biophys. Acta. 1780, 1403-1407.
La Cour, T., Gupta, R., Rapacki, K., Skriver, K., Poulsen, F. M. and Brunak, S. (2003).
NESbase version 1.0: a database of nuclear export signals. Nucleic Acids Res. 31, 393396.
Laski, F. A., Fire, A. Z., RajBhandary, U. L. and Sharp, P. A. (1983). Characterization
of tRNA precursor splicing in mammalian extracts. J. Biol. Chem. 258, 11974-11980.
Lee, A. H., Iwakoshi, N. N. and Glimcher, L. H. (2003). XBP-1 regulates a subset of
endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol.
Cell. Biol. 23, 7448-7459.
Lee, K., Tirasophon, W., Shen, X., Michalak, M., Prywes, R., Okada, T., Yoshida, H.,
Mori, K. and Kaufman, R. J. (2002). IRE1-mediated unconventional mRNA splicing
and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded
protein response. Genes Dev. 16, 452-466.
2885
Lee, K. P., Dey, M., Neculai, D., Cao, C., Dever, T. E. and Sicheri, F. (2008). Structure
of the dual enzyme Ire1 reveals the basis for catalysis and regulation in nonconventional
RNA splicing. Cell 132, 89-100.
Malhotra, J. D. and Kaufman, R. J. (2007). The endoplasmic reticulum and the unfolded
protein response. Semin. Cell Dev. Biol. 18, 716-731.
Mori, K. (2003). Frame switch splicing and regulated intramembrane proteolysis: key words
to understand the unfolded protein response. Traffic 4, 519-528.
Mori, K., Sant, A., Kohno, K., Normington, K., Gething, M. J. and Sambrook, J. F.
(1992). A 22 bp cis-acting element is necessary and sufficient for the induction of the
yeast KAR2 (BiP) gene by unfolded proteins. EMBO J. 11, 2583-2593.
Mori, K., Ma, W., Gething, M. J. and Sambrook, J. (1993). A transmembrane protein
with a cdc2+/CDC28-related kinase activity is required for signaling from the ER to the
nucleus. Cell 74, 743-756.
Mori, K., Kawahara, T., Yoshida, H., Yanagi, H. and Yura, T. (1996). Signalling from
endoplasmic reticulum to nucleus: transcription factor with a basic-leucine zipper motif
is required for the unfolded protein-response pathway. Genes Cells 1, 803-817.
Mori, K., Ogawa, N., Kawahara, T., Yanagi, H. and Yura, T. (1998). Palindrome with
spacer of one nucleotide is characteristic of the cis-acting unfolded protein response
element in Saccharomyces cerevisiae. J. Biol. Chem. 273, 9912-9920.
Mori, K., Ogawa, N., Kawahara, T., Yanagi, H. and Yura, T. (2000). mRNA splicingmediated C-terminal replacement of transcription factor Hac1p is required for efficient
activation of the unfolded protein response. Proc. Natl. Acad. Sci. USA 97, 4660-4665.
Ng, D. T., Spear, E. D. and Walter, P. (2000). The unfolded protein response regulates
multiple aspects of secretory and membrane protein biogenesis and endoplasmic
reticulum quality control. J. Cell Biol. 150, 77-88.
Niwa, M., Sidrauski, C., Kaufman, R. J. and Walter, P. (1999). A role for presenilin-1
in nuclear accumulation of Ire1 fragments and induction of the mammalian unfolded
protein response. Cell 99, 691-702.
Okada, T., Yoshida, H., Akazawa, R., Negishi, M. and Mori, K. (2002). Distinct roles
of activating transcription factor 6 (ATF6) and double-stranded RNA-activated protein
kinase-like endoplasmic reticulum kinase (PERK) in transcription during the mammalian
unfolded protein response. Biochem. J. 366, 585-594.
Okada, T., Haze, K., Nadanaka, S., Yoshida, H., Seidah, N. G., Hirano, Y., Sato, R.,
Negishi, M. and Mori, K. (2003). A serine protease inhibitor prevents endoplasmic
reticulum stress-induced cleavage but not transport of the membrane-bound transcription
factor ATF6. J. Biol. Chem. 278, 31024-31032.
Ron, D. and Walter, P. (2007). Signal integration in the endoplasmic reticulum unfolded
protein response. Nat. Rev. Mol. Cell. Biol. 8, 519-529.
Ruddock, L. W. and Molinari, M. (2006). N-glycan processing in ER quality control. J.
Cell Sci. 119, 4373-4380.
Ruegsegger, U., Leber, J. H. and Walter, P. (2001). Block of HAC1 mRNA translation
by long-range base pairing is released by cytoplasmic splicing upon induction of the
unfolded protein response. Cell 107, 103-114.
Saksena, S., Summers, M. D., Burks, J. K., Johnson, A. E. and Braunagel, S. C. (2006).
Importin-alpha-16 is a translocon-associated protein involved in sorting membrane
proteins to the nuclear envelope. Nat. Struct. Mol. Biol. 13, 500-508.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sawaya, R., Schwer, B. and Shuman, S. (2003). Genetic and biochemical analysis of the
functional domains of yeast tRNA ligase. J. Biol. Chem. 278, 43928-43938.
Sehgal, P. B., Darnell, J. E., Jr and Tamm, I. (1976). The inhibition by DRB (5,6-dichloro1-beta-D-ribofuranosylbenzimidazole) of hnRNA and mRNA production in HeLa cells.
Cell 9, 473-480.
Shamu, C. E. and Walter, P. (1996). Oligomerization and phosphorylation of the Ire1p
kinase during intracellular signaling from the endoplasmic reticulum to the nucleus.
EMBO J. 15, 3028-3039.
Sidrauski, C. and Walter, P. (1997). The transmembrane kinase Ire1p is a site-specific
endonuclease that initiates mRNA splicing in the unfolded protein response. Cell 90,
1031-1039.
Sidrauski, C., Cox, J. S. and Walter, P. (1996). tRNA ligase is required for regulated
mRNA splicing in the unfolded protein response [see comments]. Cell 87, 405-413.
Stephens, S. B., Dodd, R. D., Brewer, J. W., Lager, P. J., Keene, J. D. and Nicchitta,
C. V. (2005). Stable ribosome binding to the endoplasmic reticulum enables compartmentspecific regulation of mRNA translation. Mol. Biol. Cell 16, 5819-5831.
Stirpe, F. and Fiume, L. (1967). Effect of alpha-amanitin on ribonucleic acid synthesis
and on ribonucleic acid polymerase in mouse liver. Biochem. J. 103, 67-68.
Tarn, W. Y. and Steitz, J. A. (1997). Pre-mRNA splicing: the discovery of a new
spliceosome doubles the challenge. Trends Biochem. Sci. 22, 132-137.
Tirasophon, W., Welihinda, A. A. and Kaufman, R. J. (1998). A stress response pathway
from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein
kinase/endoribonuclease (Ire1p) in mammalian cells. Genes Dev. 12, 1812-1824.
Tirosh, B., Iwakoshi, N. N., Glimcher, L. H. and Ploegh, H. L. (2006). Rapid turnover
of unspliced Xbp-1 as a factor that modulates the unfolded protein response. J. Biol.
Chem. 281, 5852-5860.
Travers, K. J., Patil, C. K., Wodicka, L., Lockhart, D. J., Weissman, J. S. and Walter,
P. (2000). Functional and genomic analyses reveal an essential coordination between
the unfolded protein response and ER-associated degradation. Cell 101, 249-258.
van Hoof, A., Frischmeyer, P. A., Dietz, H. C. and Parker, R. (2002). Exosome-mediated
recognition and degradation of mRNAs lacking a termination codon. Science 295, 22622264.
Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M. and Ron, D.
(1998). Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO
J. 17, 5708-5717.
2886
Journal of Cell Science 122 (16)
Journal of Cell Science
Yamamoto, K., Sato, T., Matsui, T., Sato, M., Okada, T., Yoshida, H., Harada, A. and
Mori, K. (2007). Transcriptional induction of mammalian ER quality control proteins
is mediated by single or combined action of ATF6alpha and XBP1. Dev. Cell 13, 365376.
Yanagitani, K., Imagawa, Y., Iwawaki, T., Hosoda, A., Saito, M., Kimata, Y. and Kohno,
K. (2009). Cotranslational targeting of XBP1 protein to the membrane promotes
cytoplasmic splicing of its own mRNA. Mol. Cell 34, 191-200.
Ye, J., Rawson, R. B., Komuro, R., Chen, X., Dave, U. P., Prywes, R., Brown, M. S.
and Goldstein, J. L. (2000). ER stress induces cleavage of membrane-bound ATF6 by
the same proteases that process SREBPs. Mol. Cell 6, 1355-1364.
Yoshida, H. (2007a). ER stress and diseases. FEBS J. 274, 630-658.
Yoshida, H. (2007b). Unconventional splicing of XBP-1 mRNA in the unfolded protein
response. Antioxid. Redox Signal. 9, 2323-2333.
Yoshida, H., Haze, K., Yanagi, H., Yura, T. and Mori, K. (1998). Identification of the
cis-acting endoplasmic reticulum stress response element responsible for transcriptional
induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper
transcription factors. J. Biol. Chem. 273, 33741-33749.
Yoshida, H., Okada, T., Haze, K., Yanagi, H., Yura, T., Negishi, M. and Mori, K. (2000).
ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cisacting element responsible for the mammalian unfolded protein response. Mol. Cell.
Biol. 20, 6755-6767.
Yoshida, H., Matsui, T., Yamamoto, A., Okada, T. and Mori, K. (2001a). XBP1 mRNA
is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly
active transcription factor. Cell 107, 881-891.
Yoshida, H., Okada, T., Haze, K., Yanagi, H., Yura, T., Negishi, M. and Mori, K. (2001b).
Endoplasmic reticulum stress-induced formation of transcription factor complex ERSF
including NF-Y (CBF) and activating transcription factors 6alpha and 6beta that activates
the mammalian unfolded protein response. Mol. Cell. Biol. 21, 1239-1248.
Yoshida, H., Matsui, T., Hosokawa, N., Kaufman, R. J., Nagata, K. and Mori, K. (2003).
A time-dependent phase shift in the mammalian unfolded protein response. Dev. Cell
4, 265-271.
Yoshida, H., Nadanaka, S., Sato, R. and Mori, K. (2006a). XBP1 is critical to protect
cells from endoplasmic reticulum stress: evidence from site-2 protease-deficient Chinese
hamster ovary cells. Cell Struct. Funct. 31, 109-116.
Yoshida, H., Oku, M., Suzuki, M. and Mori, K. (2006b). pXBP1(U) encoded in XBP1
pre-mRNA negatively regulates unfolded protein response activator pXBP1(S) in
mammalian ER stress response. J. Cell Biol. 172, 565-575.
Yoshihisa, T., Yunoki-Esaki, K., Ohshima, C., Tanaka, N. and Endo, T. (2003).
Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease
mainly localizes on the mitochondria. Mol. Biol. Cell 14, 3266-3279.
Zillmann, M., Gorovsky, M. A. and Phizicky, E. M. (1991). Conserved mechanism of
tRNA splicing in eukaryotes. Mol. Cell. Biol. 11, 5410-5416.