Disruption of Naⴙ,HCO3ⴚ Cotransporter NBCn1 (slc4a7)
Inhibits NO-Mediated Vasorelaxation, Smooth Muscle Ca2ⴙ
Sensitivity, and Hypertension Development in Mice
Ebbe Boedtkjer, MD, PhD; Jeppe Praetorius, MD, PhD; Vladimir V. Matchkov, PhD;
Edgaras Stankevicius, MD; Susie Mogensen; Annette C. Füchtbauer; Ulf Simonsen, MD, PhD;
Ernst-Martin Füchtbauer, PhD; Christian Aalkjaer, MD, DMSc
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Background—Disturbances in pH affect artery function, but the mechanistic background remains controversial. We
investigated whether Na⫹,HCO3⫺ cotransporter NBCn1, by regulating intracellular pH (pHi), influences artery function
and blood pressure regulation.
Methods and Results—Knockout of NBCn1 in mice eliminated Na⫹,HCO3⫺ cotransport and caused a lower steady-state
pHi in mesenteric artery smooth muscle and endothelial cells in situ evaluated by fluorescence microscopy. Using
myography, arteries from NBCn1 knockout mice showed reduced acetylcholine-induced NO-mediated relaxations and
lower rho-kinase-dependent norepinephrine-stimulated smooth muscle Ca2⫹ sensitivity. Acetylcholine-stimulated NO
levels (electrode measurements) and N-nitro-L-arginine methyl ester–sensitive L-arginine conversion (radioisotope
measurements) were reduced in arteries from NBCn1 knockout mice, whereas relaxation to NO-donor S-nitroso-Nacetylpenicillamine, acetylcholine-induced endothelial Ca2⫹ responses (fluorescence microscopy), and total and
Ser-1177 phosphorylated endothelial NO-synthase expression (Western blot analyses) were unaffected. Reduced
NO-mediated relaxations in arteries from NBCn1 knockout mice were not rescued by superoxide scavenging.
Phosphorylation of myosin phosphatase targeting subunit at Thr-850 was reduced in arteries from NBCn1 knockout
mice. Evaluated by an in vitro assay, rho-kinase activity was reduced at low pH. Without CO2/HCO3⫺, no differences
in pHi, contraction or relaxation were observed between arteries from NBCn1 knockout and wild-type mice. Based on
radiotelemetry and tail-cuff measurements, NBCn1 knockout mice were mildly hypertensive at rest, displayed
attenuated blood pressure responses to NO-synthase and rho-kinase inhibition and were resistant to developing
hypertension during angiotensin-II infusion.
Conclusions—Intracellular acidification of smooth muscle and endothelial cells after knockout of NBCn1 inhibits NO-mediated
and rho-kinase–dependent signaling in isolated arteries and perturbs blood pressure regulation. (Circulation. 2011;124:00-00.)
Key Words: pH 䡲 hypertension 䡲 blood pressure 䡲 nitric oxide 䡲 rho-kinase
B
occur physiologically and pathologically, but have been
difficult to investigate experimentally, and little is known
about their vascular effects.9 It has, however, been proposed
that endothelial enzymes (eg, endothelial nitric oxide synthase [eNOS]10 and endothelin converting enzyme11), vascular ion channels (eg, Ca2⫹-activated K⫹ channels12,13 and
L-type Ca2⫹ channels14) and the Ca2⫹ sensitivity of the
contractile machinery9,15,16 are important pHi-affected targets.
Nitric oxide signaling in the cardiovascular system affects
blood pressure regulation,17–20 development of atherosclerosis,20 and thrombocyte aggregation.21 The catalytic activity of
the isolated NO synthase displays a bell-shaped pH depen-
lood pressure dysregulation is a major cause of human
disease. Hypertension is a risk factor for development of
coronary heart disease, stroke, and peripheral vascular disease1–3 whereas hypotension is related to syncope and falls.4,5
Both hyper- and hypotension increase overall mortality.6 – 8
Editorial see p ●●●
Clinical Perspective on p ●●●
Arterial tone regulation is important for blood pressure
control and is modulated by local and systemic factors.
Sustained changes in intracellular pH (pHi) of vascular
smooth muscle cells (VSMCs) and endothelial cells (ECs)
Received December 21, 2010; accepted August 8, 2011.
From the Department of Biomedicine (E.B., J.P., V.V.M., E.S., S.M., U.S., C.A.), the Water and Salt Research Center (E.B., J.P., V.V.M., S.M., C.A.),
and Department of Molecular Biology (A.C.F., E.F.), Aarhus University, Aarhus, Denmark; and the Department of Physiology, Medical Academy,
Lithuanian University of Health Sciences, Kaunas, Lithuania (E.S.).
The online-only Data Supplement is available with this article at http://circ.ahajournals.org/lookup/suppl/doi:10.1161/CIRCULATIONAHA.
111.015974/-/DC1.
Correspondence to Ebbe Boedtkjer, Department of Biomedicine, Aarhus University, Ole Worms Allé 6, DK-8000 Aarhus C, Denmark. E-mail
[email protected]
© 2011 American Heart Association, Inc.
Circulation is available at http://circ.ahajournals.org
DOI: 10.1161/CIRCULATIONAHA.110.015974
1
2
Circulation
October 25, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 1. NBCn1 is expressed in mouse mesenteric artery ECs. A, NBCn1 expression was detected in the EC layer of mouse mesenteric arteries using whole-mount immunofluorescence imaging with an antibody against the N-terminus of NBCn1. The periphery of 1
positive EC is highlighted. B, No staining of the EC layer was seen when the primary antibody was preincubated with the immunizing
peptide. C, Low magnification electron micrograph showing a collapsed artery fixed in a wire myograph. Opposite, VSMC-containing
wall sections are seen with opposing EC layers surrounding the artery lumen (arrow). D, High-magnification electron micrograph of the
EC highlighted by a rectangle in panel C. Arrows indicate gold particles associated with the plasma membrane. Some gold particles
seemed associated with vesicular structures or invaginations of the cell membrane (arrow heads). No staining was seen when the primary antibody was omitted (not shown). VSMCs indicates vascular smooth muscle cells; ECs, endothelial cells.
dency with significant changes at physiological pHi levels.10
Modulation of eNOS activity by pHi has never been shown in
intact arteries or in vivo, and the importance of this phenomenon for cardiovascular function remains to be established.
The rho-kinase regulates VSMC Ca2⫹ sensitivity by phosphorylation and inactivation of the myosin light chain phosphatase,22 and rho-kinase– dependent signaling in VSMCs is
necessary for development of hypertension to angiotensin-II
infusion.23 Regulation of rho-kinase signaling by pHi has not
previously been addressed.
Regulation of pHi depends on membrane acid-base transporters, such as Na⫹/H⫹ exchangers24 and Na⫹,HCO3⫺ cotransporters. Electroneutral Na⫹,HCO3- cotransport was first demonstrated in VSMCs.25 Subsequently, NBCn1 (slc4a7) was cloned
from rat aorta and human skeletal muscle26,27 and characterized
as an electroneutral Cl⫺-independent Na⫹,HCO3⫺ cotransporter.26 Knockout (KO) studies elucidated its importance for
auditory and ocular functions.28 NBCn1 is the only Na⫹,HCO3⫺
cotransporter of the slc4 family found at messenger RNA level
in mouse resistance arteries,9 and is expressed in both VSMCs
and ECs.9,29 In VSMCs, NBCn1 is responsible for the
Na⫹,HCO3⫺ cotransport.9 In ECs, the functional importance of
Na⫹,HCO3⫺ cotransport has only been investigated in cultured
cells.30,31
We hypothesized that NBCn1 modulates artery tone and
blood pressure control through regulation of pHi. We demonstrate that NBCn1 is crucial for pHi regulation in ECs and
VSMCs and maintains NO production and VSMC Ca2⫹
sensitivity. NBCn1 KO mice are mildly hypertensive at rest,
display attenuated blood pressure responses to NO-synthase
and rho-kinase inhibition, and are resistant to developing
hypertension during angiotensin-II infusion.
Disease, Toronto, Canada) containing the pMS1 gene trap vector
integrated 434 bases upstream of the MEAD start codon. Heterozygous mice were back-crossed into wild-type (WT) C57BL/6J mice
for at least 7 generations before the animals were investigated. All
animal procedures were approved by the Danish Animal Care and
Use Committee under the Danish Ministry of Justice.
Isolated mesenteric arteries from adult mice were mounted in wire
myographs and pHi and Ca2⫹ dynamics investigated using fluorescence
confocal or wide-field microscopy. Gene expression was studied using
quantitative reverse-transcriptase polymerase chain reaction, Western
blot analyses, whole-mount immunofluorescence imaging, and immunogold electron microscopy. Nitric oxide concentrations in arteries were
measured intraluminally using NO-sensitive electrodes, whereas NOsynthase activity was determined from the conversion rate of L-arginine
to L-citrulline using radioisotopes. Phosphorylation of eNOS at Ser1177 and of the myosin phosphatase targeting subunit (MYPT) at
Thr-850 were investigated by Western blot analyses using phosphospecific antibodies. Rho-kinase activity as a function of pH was
measured using an in vitro assay based on a phospho-specific monoclonal antibody. Blood pressure was measured using radiotelemetry or
by determining the tail blood volume with a volume-pressure recording
sensor and an occlusion tail-cuff.
Data are expressed as mean⫾SEM. Unpaired 2-tailed Student t
test was used for comparison of 1 variable between 2 groups. To
evaluate the effects of 2 variables on the measured variable, we used
2-way ANOVA followed by Bonferroni post tests. When the
variable was measured multiple times for each mouse, a repeated
measures 2-way ANOVA was employed. Concentration-response
relationships were analyzed using sigmoidal curve fits with variable
slope and the derived log(EC50), and maximum values were compared with extra sum-of-squares F tests. The genotype and sex
distribution of pups were compared using ␹2 tests. P⬍0.05 was
considered statistically significant; n equals number of mice. Statistical analyses were performed using Microsoft Excel 2007 or
GraphPad Prism 5.02 software. An expanded Materials and Methods
section is included in the online-only Data Supplement.
Methods
NBCn1 is expressed in plasma membranes of mouse mesenteric
artery VSMCs.9,29 The NBCn1 promoter is active in mouse
ECs,29 and we confirmed the expression of NBCn1 in mouse
Mice with a targeted disruption of the NBCn1 gene were produced
using embryonic stem cells (40G1; Centre for Modeling Human
Results
Boedtkjer et al
Vascular Role of Naⴙ,HCO3ⴚ Cotransporter NBCn1
3
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 2. NBCn1 is the only Na⫹,HCO3⫺ cotransporter in VSMCs from mouse mesenteric arteries. A, NBCn1 messenger RNA and protein were not detected in mesenteric arteries from NBCn1 KO mice (n⫽4 –5). B, After an NH4⫹ prepulse, VSMCs from WT mice (n⫽5)
displayed faster pHi recovery in the presence of CO2/HCO3⫺ than in its nominal absence. C, After an NH4⫹ prepulse, no difference in
pHi recovery rate was seen between VSMCs from NBCn1 KO mice (n⫽5) investigated with or without CO2/HCO3⫺. D, Net Na⫹dependent base uptake in the presence of CO2/HCO3⫺ and 600 ␮mol/L amiloride calculated at average pHi values between 6.4 and
6.7. Na⫹,HCO3⫺ cotransport was abolished in arteries from NBCn1 KO mice. E, Net base uptake in the absence of CO2/HCO3⫺ with or
without 600 ␮mol/L amiloride calculated at an average pHi of 6.4. Na⫹/H⫹ exchange (HCO3⫺ free) was enhanced in VSMCs from
NBCn1 KO compared with WT mice. F, Vascular smooth muscle cells from NBCn1 KO displayed reduced steady-state pHi compared
with WT mice (n⫽6) in the presence but not in the absence of CO2/HCO3⫺. Comparisons in panels A and D were made with 2-tailed
unpaired Student t-tests. In panel E and F, repeated measures 2-way ANOVA was performed followed by Bonferroni post tests.
*P⬍0.05, **P⬍0.01, ***P⬍0.001. pHi indicates intracellular pH; NS, not significantly different versus WT.
mesenteric artery ECs using whole-mount immunofluorescence
imaging and immunogold electron microscopy (Figure 1). Disruption of the NBCn1 gene eliminated NBCn1 messenger RNA
and protein expression in mesenteric arteries (Figure 2A).
Heterozygous breeding resulted in a nonmendelian distribution (P⬍0.05) with 18.2⫾2.1% KO, 27.1⫾2.4% WT, and
54.7⫾2.7% heterozygous pups among 329 mice genotyped
(at 3 weeks of age; online-only Data Supplement Figure Ia).
Thus, the number of NBCn1 KO mice was reduced by one
third of the expected number, indicating reduced conception
or increased intrauterine or neonatal mortality. No significant effect of NBCn1 KO was seen on the sex distribution
of the pups (online-only Data Supplement Figure Ia), and
KO mice displayed normal growth (online-only Data
Supplement Figure Ib).
Regulation of pHi in VSMCs
Vascular smooth muscle cells were acidified with the NH4⫹
prepulse technique32 (online-only Data Supplement Figure
II). Addition of NH4Cl elicited abrupt intracellular alkalinization caused by influx of NH3 followed by a slower
acidification due to NH4⫹ entry. Washout of NH4Cl caused
intracellular acidification as rapid efflux of NH3 left protons
to accumulate intracellularly. NH4Cl was washed out into a
Na⫹-free solution to inhibit Na⫹-dependent transport. In
arteries from WT mice, the amiloride-insensitive base uptake
on readdition of Na⫹ was faster in the presence of CO2/
HCO3⫺ than in its absence (Figure 2B, D, and E). This Na⫹and HCO3⫺-dependent base uptake was abolished in arteries
from NBCn1 KO mice (Figure 2C through E), demonstrating
that NBCn1 is responsible for the Na⫹,HCO3⫺ cotransport in
VSMCs, and no other Na⫹-dependent HCO3⫺ transporter
compensates for the KO of NBCn1.
With CO2/HCO3⫺ present, steady-state pHi was 0.14⫾0.04
pH units lower in VSMCs from NBCn1 KO compared with
WT mice (Figure 2F). Removal of CO2/HCO3⫺ acidified
VSMCs from WT (⌬pHi⫽⫺0.18⫾0.05; n⫽6) but not
NBCn1 KO mice (⌬pHi⫽⫺0.01⫾0.03; n⫽6; P⬍0.01), con-
4
Circulation
October 25, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 3. NBCn1 is the only Na⫹,HCO3⫺
cotransporter in ECs from mouse mesenteric arteries. A, Average responses of ECs
to removal of bath Na⫹ in the presence of
CO2/HCO3⫺ and 600 ␮mol/L amiloride
(n⫽6 –7). In contrast to ECs from WT mice,
no acidification on removal of Na⫹ was
observed in ECs from NBCn1 KO mice. B,
Average changes in pHi on Na⫹ removal in
the presence of CO2/HCO3⫺ and
600 ␮mol/L amiloride (n⫽6 –7). C, Average
steady-state pHi of ECs with and without
CO2/HCO3⫺ (n⫽5–7). Endothelial cells from
NBCn1 KO displayed reduced pHi compared with WT mice in the presence but
not in the absence of CO2/HCO3⫺. D, Average responses of ECs to removal of bath
Na⫹ with CO2/HCO3⫺ absent (n⫽5–7). E,
Average changes in pHi on Na⫹ removal
with CO2/HCO3⫺ absent (n⫽5–7). The acidification was enhanced in ECs from NBCn1
KO mice. F, Average net base uptake on
removal and readdition of bath Na⫹ with
CO2/HCO3⫺ absent (n⫽5–7). Base uptake
was enhanced in ECs from NBCn1 KO
mice. Comparisons were made with
2-tailed unpaired Student t tests, except in
panel C where 2-way ANOVA followed by
Bonferroni post tests was employed.
*P⬍0.05, **P⬍0.01, ***P⬍0.001. pHi indicates intracellular pH; NS, not significantly
different versus WT.
firming that the acidification is caused by inhibition of
Na⫹,HCO3⫺ cotransport.
We measured Na⫹/H⫹-exchange activity as HCO3⫺independent amiloride-sensitive acid extrusion after an NH4⫹
prepulse (Figure 2B and C). Vascular smooth muscle cells from
NBCn1 KO mice displayed larger Na⫹/H⫹-exchange activity
than VSMCs from WT mice (Figure 2B, C, and E). Amiloridesensitive base uptake in VSMCs from NBCn1 KO mice was not
significantly different in the presence [Jbase⫽13.6 mmol/
(L 䡠 min); n⫽5] or absence [Jbase⫽15.0 mmol/(L 䡠 min); n⫽5;
P⫽0.42] of CO2/HCO3⫺ (Figure 2C). Without CO2/HCO3⫺, the
NHE1-selective inhibitor cariporide (1 ␮mol/L) caused a larger
decrease of VSMC steady-state pHi in arteries from NBCn1 KO
(⌬pHi⫽⫺0.15⫾0.01; n⫽5) than WT mice (⌬pHi⫽⫺0.09⫾
0.02; n⫽5; P⬍0.05). These results support the conjecture that
NHE1 is responsible for Na⫹/H⫹ exchange in VSMCs of
mouse mesenteric arteries.33 In VSMCs from NBCn1 KO
mice, we demonstrate a compensatory increase in Na⫹/H⫹exchange activity which is however insufficient to normalize
steady-state pHi.
was abolished in ECs from NBCn1 KO mice (Figure 3A and
B). After removal of bath Na⫹, pHi of ECs from WT mice
approached pHi of ECs from NBCn1 KO mice (Figure 3A),
suggesting that transport by NBCn1 is inhibited but not
reversed by extracellular Na⫹ removal.
With CO2/HCO3⫺ present, EC steady-state pHi was
0.25⫾0.08 pH units lower in arteries from NBCn1 KO compared with WT mice (Figure 3C). Without CO2/HCO3⫺, steadystate pHi was similar in ECs from WT and NBCn1 KO mice
(Figure 3C). These data provide evidence that NBCn1 is the only
active Na⫹,HCO3⫺ cotransporter in ECs and no other
Na⫹,HCO3⫺ cotransporter compensates for the KO of NBCn1.
With CO2/HCO3⫺ absent, the rate and extent of acidification
on Na⫹ removal and the rate of pHi recovery on Na⫹ readdition
were significantly increased in ECs from NBCn1 KO compared
with WT mice (Figure 3D through F), suggesting a compensatory increase in Na⫹/H⫹-exchange activity. Despite this, no
increase in NHE1 protein expression was found in mesenteric
arteries from NBCn1 KO mice by Western blot analyses
(online-only Data Supplement Figure V).
Regulation of pHi in ECs
Relaxation of Isolated Arteries
4,4-diisothiocyanatostilbene-2,2⬘-disulphonate (DIDS)insensitive Na⫹,HCO3- cotransport was detected in ECs from
WT mice after an NH4⫹ prepulse (online-only Data Supplement Figure IIIa through d), but more reliably determined
from the change in pHi on removal of bath Na⫹ (online-only
Data Supplement Figure IIIe through g and Figure IV). We
showed previously that 600 ␮mol/L amiloride or 1 ␮mol/L
cariporide eliminates any change in pHi after Na⫹ removal
with CO 2 /HCO 3 ⫺ absent. 33 With CO 2 /HCO 3 ⫺ and
600 ␮mol/L amiloride present, acidification on Na⫹ removal
Endothelium-dependent relaxation to acetylcholine was
⬇30% reduced in arteries from NBCn1 KO compared with
WT mice with CO2/HCO3⫺ present (Figure 4A and B and
online-only Data Supplement Figure VI), whereas no difference was seen without CO2/HCO3⫺ (Figure 4F). The difference in relaxation with CO2/HCO3⫺ present was abolished by
100 ␮mol/L NO-synthase inhibitor N-nitro-L-arginine methyl
ester (L-NAME; Figure 4C and D), and the L-NAME–
sensitive relaxation was reduced in arteries from NBCn1 KO
mice under these conditions (Figure 4E). Without CO2/
Boedtkjer et al
Vascular Role of Naⴙ,HCO3ⴚ Cotransporter NBCn1
5
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 4. N-nitro-L-arginine methyl ester–sensitive vasorelaxation is reduced in arteries from NBCn1 KO mice. A, Force recordings
showing the response of norepinephrine-precontracted arteries to acetylcholine with CO2/HCO3⫺ present. B, Relaxations to acetylcholine were smaller in arteries from NBCn1 KO than WT mice (n⫽10 –12) with CO2/HCO3⫺ present. C, Force recordings showing the
response of norepinephrine-precontracted arteries to acetylcholine after treatment with 100 ␮mol/L L-NAME in the presence of CO2/
HCO3⫺. D, No difference in relaxations to acetylcholine were seen between arteries from NBCn1 KO and WT mice (n⫽10 –12) after
treatment with 100 ␮mol/L L-NAME in the presence of CO2/HCO3⫺. E, N-nitro-L-arginine methyl ester–sensitive relaxations (difference
between relaxations before and after L-NAME treatment) were smaller in arteries from NBCn1 KO than WT mice (n⫽10 –12) with CO2/
HCO3⫺ present. F, With CO2/HCO3⫺ absent, no difference in relaxation to acetylcholine was seen between norepinephrineprecontracted arteries from NBCn1 KO and WT mice (n⫽7–11). G, No difference in relaxation to acetylcholine was seen between norepinephrine-precontracted arteries from NBCn1 KO and WT mice (n⫽7–11) after treatment with 100 ␮mol/L L-NAME in the absence of
CO2/HCO3⫺. H, With CO2/HCO3⫺ absent, no difference in L-NAME–sensitive relaxations (difference between relaxations before and
after L-NAME treatment) were seen between arteries from NBCn1 KO and WT mice (n⫽7–11). Comparisons were made with repeated
measures 2-way ANOVA followed by Bonferroni post tests. *P⬍0.05, **P⬍0.01, ***P⬍0.001, NE indicates norepinephrine; ACh, acetylcholene; L-NAME, N-nitro-L-arginine methyl ester; and NS, not significantly different versus WT.
HCO3⫺, relaxation to acetylcholine was impaired (Figure
4F), but no difference in L-NAME–sensitive or L-NAME–
insensitive vasorelaxation was observed (Figure 4G–H) between arteries from NBCn1 KO and WT mice. These data
suggest that the low pHi in ECs from NBCn1 KO mice
inhibits NO-mediated relaxations.
The responsiveness of VSMCs to NO was investigated by
exposing norepinephrine-precontracted arteries to NO-donor
S-nitroso-N-acetylpenicillamine. No difference in the relaxant response to NO-donor S-nitroso-N-acetylpenicillamine
was found between arteries from NBCn1 KO and WT mice
with or without CO2/HCO3⫺ (P⫽0.73; Figure 5A).
Our findings therefore suggest reduced endothelial NO
production in NBCn1 KO mice. In accordance with these
findings, measurements with NO-sensitive electrodes indicated smaller acetylcholine-induced increases in intraluminal
NO concentration in arteries from NBCn1 KO compared with
WT mice (Figure 5B). Nitric oxide–synthase inhibitor asymmetrical dimethylarginine (300 ␮mol/L) completely abol-
ished the acetylcholine-stimulated increase in intraluminal
NO concentration (Figure 5B).
Reduced NO bioavailability caused by an increased oxidative stress would provide an alternative explanation for the
reduced L-NAME–sensitive vasorelaxation in arteries from
NBCn1 KO mice. Scavenging of superoxide using polyethylene glycol superoxide dismutase (PEG-SOD; 200 U/mL)
increased acetylcholine-induced relaxations more in arteries
from WT than NBCn1 KO mice (Figure 5C). Consequently,
vasorelaxation to acetylcholine in the presence of PEG-SOD
was greater in arteries from WT than NBCn1 KO mice
(Figure 5D). Similarly, the difference in relaxant response
between arteries from NBCn1 KO and WT mice persisted
after treatment with 100 ␮mol/L of the cell-permeant SOD
mimetic tempol (Figure 5D). These findings are consistent
with previous reports that alkalinization rather than acidification promotes superoxide production34 and support the
conjecture that reduced NO production rather than reduced
NO bioavailability explains the reduced NO-mediated relax-
6
Circulation
October 25, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 5. Reduced L-NAME–sensitive relaxations in arteries from NBCn1 KO mice are accompanied by smaller acetylcholine-induced NO
release and persist after superoxide scavenging. Vascular smooth muscle cell responsiveness to NO is unchanged whereas NO synthase
activity is reduced in arteries from NBCn1 KO mice. A, No difference (P⫽0.56) in the response to NO donor S-nitroso-N-acetylpenicillamine
was seen between arteries from NBCn1 KO and WT mice (n⫽6 – 8) with or without CO2/HCO3⫺. Log(EC50) and maximum responses derived
from sigmoidal curve fits were compared with extra sum-of-squares F tests. B, Acetylcholine-induced increases in intraluminal NO concentrations were reduced in arteries from NBCn1 KO compared with WT mice (n⫽5) with CO2/HCO3⫺ present. Comparisons were made with a
2-way ANOVA and the overall probability level stated. C, Acetylcholine-induced vasorelaxation (relative to time control) after superoxide scavenging with 200 U/mL PEG-SOD was attenuated in arteries from NBCn1 KO compared with WT mice (n⫽5– 6) with CO2/HCO3⫺ present.
Comparison was made with a 2-tailed unpaired Student t test. D, With CO2/HCO3⫺ present, the difference in vasorelaxation between arteries
from NBCn1 KO and WT mice persisted after superoxide scavenging with 200 U/mL PEG-SOD (Di; n⫽5– 6) or 100 ␮mol/L tempol (Dii; n⫽6).
Comparisons were made with repeated measures 2-way ANOVA followed by Bonferroni post tests. E, With CO2/HCO3⫺ present, L-NAME–
sensitive conversion of L-[14C]arginine during 30 minutes stimulation with 3 ␮mol/L acetylcholine was reduced in intact aortic segments from
NBCn1 KO compared with WT mice (n⫽6 –7). Comparison was made with unpaired 2-tailed Student t test. *P⬍0.05, **P⬍0.01, SNAP indicates S-nitroso-N-acetylpenicillamine; ADMA, asymmetrical dimethylarginine; PEG-SOD, polyethylene glycol superoxide dismutase; L-NAME,
N-nitro-L-arginine methyl ester; and NS, not significantly different versus WT.
ations in arteries from NBCn1 KO mice. Reduced eNOS
activity was further confirmed by the finding that L-NAME–
sensitive conversion of L-[14C]arginine was greatly attenuated
in isolated aortic segments from NBCn1 KO compared with
WT mice during stimulation with 3 ␮mol/L acetylcholine
(Figure 5E).
Reduced NO production can arise from reduced eNOS
expression or lower activity of the expressed enzyme. Western blot analyses showed no difference in eNOS expression
between arteries from NBCn1 KO and WT mice (Figure 6A).
Also, phosphorylation of eNOS at Ser-1177 was not significantly different between arteries from NBCn1 KO and WT
mice (Figure 6B). The endothelial intracellular Ca2⫹ response, which is important for acetylcholine signaling and
eNOS activation, was not significantly different between
arteries from NBCn1 KO and WT mice (Figure 6C through
E). With CO2/HCO3⫺ absent, the endothelial intracellular
Ca2⫹ response was equally attenuated in arteries from
NBCn1 KO and WT mice (Figure 6D and E), likely accounting for the smaller acetylcholine-induced relaxations seen
under these conditions (Figure 4F). These findings provide
evidence that KO of NBCn1 results in reduced acetylcholineinduced NO production through a pHi-mediated intracellular
Ca2⫹-independent inhibition of eNOS activity.
Contraction of Isolated Arteries
Tension development to norepinephrine was not significantly
different between arteries from NBCn1 KO and WT mice in
the presence of CO2/HCO3⫺ (Figure 7A). Incubation with
100 ␮mol/L L-NAME did not affect resting artery tone, but
increased the sensitivity of arteries from WT mice to norepinephrine with respect to tension development (Figure 7A). In
arteries from NBCn1 KO mice, this increase in norepinephrine sensitivity was strongly reduced (Figure 7A), suggesting
that basal and/or norepinephrine-stimulated NO production is
reduced and unmasking a difference in VSMC contractility
Boedtkjer et al
Vascular Role of Naⴙ,HCO3ⴚ Cotransporter NBCn1
7
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 6. Expression of total and Ser-1177
phosphorylated eNOS and the EC intracellular Ca2⫹ responses to acetylcholine are
unaffected by NBCn1 KO. A, No difference
in eNOS expression was detected between
arteries from NBCn1 KO and WT mice
(n⫽9 –10). Representative bands and results
of the densitometric analysis are shown.
⫹/⫹ and -/- denote WT and NBCn1 KO,
respectively. Comparison was made with a
2-tailed unpaired Student t test. B, No difference in the extent of eNOS phosphorylation at Ser-1177 was seen between mesenteric arteries from NBCn1 KO and WT mice
(n⫽5). Representative bands for eNOS
phosphorylated at Ser-1177 and results of
the densitometric analysis are shown. ⫹/⫹
and -/- denote WT and NBCn1 KO, respectively. C, No difference in the EC intracellular Ca2⫹ response to acetylcholine was
seen between arteries from NBCn1 KO and
WT mice (n⫽5) with CO2/HCO3⫺ present.
D, Without CO2/HCO3⫺, no difference in the
EC intracellular Ca2⫹ response to acetylcholine was seen between arteries from
NBCn1 KO and WT mice (n⫽5). E, Average
intracellular Ca2⫹ responses (n⫽5) on addition of acetylcholine. Comparisons were
made with repeated measures 2-way
ANOVA followed by Bonferroni post tests.
*P⬍0.05, **P⬍0.01. eNOS indicates endothelial nitric oxide synthase; ACh, acetylcholine; and NS, not significantly different
versus WT.
between arteries from NBCn1 KO and WT mice. No difference in the VSMC intracellular Ca2⫹ response to norepinephrine was seen between arteries from NBCn1 KO and WT
mice with L-NAME and CO2/HCO3⫺ present (Figure 7B).
Rho-kinase inhibition with 10 ␮mol/L Y-27632 or fasudil
abolished the difference in tension development after
L-NAME treatment (Figure 7A). Y-27632 did not affect the
VSMC intracellular Ca2⫹ response to norepinephrine (Figure
7B). These results show that VSMC Ca2⫹ sensitivity is
reduced in arteries from NBCn1 KO mice in a rho-kinase–
dependent manner. Consistent with these findings, when
Y-27632 was added in the absence of L-NAME, norepinephrine-sensitivity was lower in arteries from WT compared with
NBCn1 KO mice (Figure 7C). We furthermore showed that
phosphorylation of MYPT at Thr-850, which is one of the
major targets of the rho-kinase, was decreased in 100 ␮mol/L
L-NAME–treated, 1 ␮mol/L norepinephrine–stimulated arteries from NBCn1 KO compared with WT mice (Figure 7D).
Phosphorylation of MYPT at Thr-850 was reduced by
89⫾8% (n⫽5; P⬍0.001 versus control) when mesenteric
small arteries from WT mice were pretreated with 10 ␮mol/L
Y-27632. Total expression of MYPT relative to pan-actin did
not differ between mesenteric small arteries from NBCn1 KO
and WT mice (0.87⫾0.04 in NBCn1 KO compared with
1.00⫾0.10 in WT; n⫽5– 6; P⫽0.21).
Without CO2/HCO3⫺, pHi of both ECs and VSMCs were
identical in NBCn1 KO and WT mice (Figures 2F and 3C).
Under these conditions, L-NAME only slightly increased
norepinephrine sensitivity with respect to tension development, and no difference between arteries from NBCn1 KO
and WT mice was found (Figure 7E). Hence, NBCn1 KO
most likely affects tension development because of the defect
in pHi regulatory function. Consistent with this, norepinephrine sensitivity of L-NAME–treated arteries from WT mice
was reduced with respect to tension development (Figure 7A
and E; P⬍0.05) when VSMCs were acidified by removal of
CO2/HCO3⫺ (Figure 2F). In arteries from NBCn1 KO mice,
removal of CO2/HCO3⫺ affected neither VSMC pHi (Figure
2F) nor tension development to norepinephrine (Figure 7A
and E; P⫽0.31).
The reason for reduced rho-kinase activity at low VSMC
pHi might involve several pHi-affected targets; however, we
investigated whether direct effects of pHi on the rho-kinase
could play a role. The isolated rho-kinase was pH sensitive
with appreciable changes in catalytic activity in a physiologically relevant pH range (online-only Data Supplement Figure VIIa). Deduced from these results, the difference in
steady-state pHi between VSMCs from NBCn1 KO and WT
mice (Figure 2F) would result in ⬇10% inhibition of rhokinase activity (online-only Data Supplement Figure VIIa).
Even such moderate changes in rho-kinase activity (eg, with
0.1 ␮mol/L Y-27632; online-only Data Supplement Figure
VIIb) can cause changes in norepinephrine sensitivity
(online-only Data Supplement Figure VIIc), comparable to
the difference between L-NAME–treated arteries from
NBCn1 KO and WT mice with CO2/HCO3⫺ present (Figure
7A and online-only Data Supplement Table I). We propose
that reduced rho-kinase activity due to a lower VSMC pHi
contributes to the reduced VSMC Ca2⫹ sensitivity in NBCn1
KO mice (online-only Data Supplement Figure VIII).
8
Circulation
October 25, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 7. Arteries from NBCn1 KO mice display impaired resting and/or norepinephrine-induced NO production and lower rho-kinase– dependent Ca2⫹ sensitivity. A, No difference in tension development to norepinephrine was seen between arteries from NBCn1 KO and WT
mice under control conditions with CO2/HCO3⫺ present (n⫽14 –15; P⫽0.08). After treatment with 100 ␮mol/L L-NAME, lower sensitivity to
norepinephrine was seen in arteries from NBCn1 KO than WT mice (n⫽10; P⬍0.01). This difference was abolished when L-NAME–treated
arteries were incubated with 10 ␮mol/L of the rho-kinase inhibitors Y-27632 (n⫽5– 6; P⫽0.83) or fasudil (n⫽5; P⫽0.78). B, No difference in
average VSMC intracellular Ca2⫹ response was seen between arteries from NBCn1 KO and WT mice (n⫽5) in the presence of 100 ␮mol/L
L-NAME with (P⫽0.27) or without (P⫽0.97) 10 ␮mol/L Y-27632. C, With CO2/HCO3⫺ present, treatment with 10 ␮mol/L Y-27632 resulted in
a greater sensitivity to norepinephrine with respect to tension development in arteries from NBCn1 KO compared with WT mice (n⫽6;
P⬍0.01). D, Phosphorylation of MYPT at Thr-850 was reduced in arteries from NBCn1 KO compared with WT mice (n⫽3–7). Representative
bands for phosphorylated and total MYPT and results of the densitometric analysis are shown. ⫹/⫹ and -/- denote WT and NBCn1 KO,
respectively. Comparison was performed with a 2-way ANOVA and the overall probability value reported. E, With CO2/HCO3⫺ absent, no
difference in tension development to norepinephrine was seen between arteries from NBCn1 KO and WT mice under control conditions
(n⫽13–14; P⫽0.15) or in the presence of 100 ␮mol/L L-NAME (n⫽5– 6; P⫽0.72). Log(EC50) and maximum values were derived from sigmoidal curve fits, compared with extra sum-of-squares F tests, and reported in online-only Data Supplement Table I. *P⬍0.05. L-NAME indicates
N-nitro-L-arginine methyl ester; MYPT, myosin phosphatase targeting subunit.
Blood Pressure Regulation
Systemic mean arterial pressure (MAP) of NBCn1 KO
mice was 9 to 12 mm Hg higher than that of WT mice
whereas no significant difference in heart rate (HR) was
observed (Figure 8A).
During treatment with L-NAME (100 mg/kg body weight
daily) in the drinking water, the increase in MAP was significantly blunted in NBCn1 KO compared with WT mice (Figure
8B). The concomitant decrease of HR was also reduced in
NBCn1 KO mice (Figure 8B), consistent with the blunted blood
pressure response causing a smaller baroreflex-mediated inhibition. Daily doses of 600 mg L-NAME per kg body weight gave
a similar result (⌬MAP ⫽4.5⫾2.5 mm Hg in NBCn1 KO versus
20.2⫾4.2 mm Hg in WT mice; n⫽5– 6; P⬍0.05). Mean arterial
pressure and HR returned to pretreatment levels when mice were
given access to water without L-NAME after the treatment
period. The MAP increase and HR reduction after L-NAME
ingestion have been shown to depend on an active eNOS.18
Hence, our findings corroborate the finding that NO production
is reduced in NBCn1 KO mice and underscore its importance for
integrated cardiovascular control.
Vasoconstriction and hypertension development to angiotensin II depend on VSMC rho-kinase activation.23,35 Compared with WT mice, NBCn1 KO mice were remarkably
resistant to developing hypertension during angiotensin-II
infusion (Figure 8C and D). Angiotensin II increased HR of
NBCn1 KO mice considerably, whereas this effect was
partially blunted by an apparent baroreflex-mediated inhibition in WT mice (Figure 8D). The differential effects of
angiotensin-II infusion were unlikely to be attributed to a
difference in aldosterone signaling because the expression of
the epithelial sodium channel (ENaC) did not significantly
differ between kidneys from NBCn1 KO and WT mice
(online-only Data Supplement Figure IX).
We investigated rho-kinase activity in vivo by intraperitoneal administration of Y-27632, which affects blood pressure
regulation through changes in peripheral vascular resistance.36 The change in MAP after injection of Y-27632 (10
mg/kg body weight) was reduced in NBCn1 KO compared
with WT mice when administered alone (Figure 8E), to
L-NAME-treated (100 mg/kg body weight daily; Figure 8F),
Boedtkjer et al
Vascular Role of Naⴙ,HCO3ⴚ Cotransporter NBCn1
9
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 8. NBCn1 KO mice are mildly hypertensive at rest, display attenuated blood pressure responses to NO synthase and rho-kinase
inhibition, and are resistant to developing hypertension to angiotensin II. A, Resting MAP was higher in NBCn1 KO compared with WT
mice whereas resting HR was not different. The effect was seen with radiotelemetry (Ai, n⫽12–14) and tail-cuff (Aii; n⫽19 –22) measurements. B, The increase in MAP and the concomitant change in HR on treatment with L-NAME in the drinking water were attenuated in
NBCn1 KO compared with WT mice (n⫽12–14). N-nitro-L-arginine methyl ester intake relative to body weight was not different between
NBCn1 KO and WT mice. C, Average MAP before and during continuous angiotensin-II infusion in NBCn1 KO and WT mice (n⫽7– 8).
D, The MAP increase during angiotensin-II infusion was reduced and the HR increase augmented in NBCn1 KO compared with WT
mice (n⫽7– 8). E, The change in MAP after i.p. injection of 10 mg Y-27632 per kg body weight was smaller in NBCn1 KO compared
with WT mice. The star denotes significant interaction (ie, the effect of Y-27632 was significantly different between NBCn1 KO and WT
mice; comparison was made with repeated measures 2-way ANOVA). F, The change in MAP after i.p. injection of 10 mg Y-27632 per
kg body weight was smaller in L-NAME–treated NBCn1 KO than WT mice and the parallel increase in HR attenuated. The effect was
seen with radiotelemetry (Fi; n⫽5–7) and tail-cuff (Fii; n⫽7– 8) measurements. The stars in the left panel denote significant interaction
(ie, the effect of Y-27632 was significantly different between NBCn1 KO and WT mice; comparison was made with repeated measures
2-way ANOVA). No difference in MAP and HR changes were seen between NBCn1 KO and WT mice after i.p. saline injection. G, The
change in MAP after i.p. injection of 10 mg Y-27632 per kg body weight was attenuated in angiotensin-II–treated NBCn1 KO compared
with WT mice (n⫽5– 8). Comparisons were made with unpaired 2-tailed Student t tests. *P⬍0.05, **P⬍0.01, ***P⬍0.001. MAP indicates
mean arterial pressure; HR, heart rate; and NS, not significantly different versus WT.
or to angiotensin-II–treated mice (Figure 8G). The parallel
increase in HR was also attenuated in NBCn1 KO mice
(Figure 8F). The MAP and HR changes after intraperitoneal
saline injection were not significantly different between
NBCn1 KO and WT mice (Figure 8F). Our results are
consistent with reduced rho-kinase– dependent VSMC Ca2⫹
sensitivity altering blood pressure control in NBCn1 KO
mice.
Discussion
We describe a novel role for transmembrane acid-base
movement in NO-mediated vasorelaxation, rho-kinase–
dependent VSMC Ca2⫹ sensitivity, and blood pressure regulation. The signaling pathways proposed to be affected by
pHi after NBCn1 KO are summarized in online-only Data
Supplement Figure VIII. Previously, sustained pHi changes
have been difficult to induce experimentally, and as a
10
Circulation
October 25, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
consequence vascular effects of maintained pHi disturbances
have largely been unknown. We used functional genetics to
inactivate NBCn1, impede pHi regulation in ECs and
VSMCs, and study the importance of a normal pHi level for
blood pressure control and mesenteric artery function, which
contributes to peripheral vascular resistance.37
The catalytic activity of isolated NO synthase displays a
bell-shaped pH dependency, with an optimum level around
pH 7.5 and prominent changes in the physiological pHi
range.10 Direct inhibition of eNOS activity by low EC pHi is
of sufficient magnitude to quantitatively account for the
changes in acetylcholine-induced vasorelaxation observed in
the present study. We propose that intracellular acidification
after KO of NBCn1 inhibits NO production because eNOS is
intrinsically pH sensitive.
Although large acute changes in VSMC pHi produce
dramatic changes in artery tone,38 – 40 the effects of smaller
and sustained changes in VSMC pHi appear more subtle.
Studies using chemical permeabilization describe pH-induced
changes in VSMC Ca2⫹ sensitivity, but with conflicting
reports as to whether the sensitivity is increased or decreased
with acidification.15,16 Recently, we suggested that sustained
intracellular acidification reduces VSMC Ca2⫹ sensitivity
during norepinephrine stimulation.9 Our current findings
support this and suggest an effect on rho-kinase signaling.
We find that isolated rho-kinase displays an intrinsic pH
sensitivity of a magnitude sufficient to explain the reduced
norepinephrine sensitivity of arteries from NBCn1 KO mice.
Although there is considerable cross-talk between the NO and
the rho-kinase signaling pathways,41– 43 reduced VSMC Ca2⫹
sensitivity and lower NO production in arteries from NBCn1
KO mice do not appear to be interdependent. Firstly, the
reduced effect of rho-kinase inhibition in arteries from
NBCn1 KO mice was observed both before and after
L-NAME treatment (ie, even when NO production is abolished). Secondly, according to previous reports, reduced
concentrations of NO enhance rho-kinase activity and Ca2⫹
sensitivity,42,43 whereas rho-kinase inhibition increases eNOS
activity.41 For these reasons, our findings suggest lower
VSMC Ca2⫹ sensitivity in arteries from NBCn1 KO mice
caused by pHi-mediated inhibition of the rho-kinase signaling
pathway independently of the simultaneous reduction in
endothelial NO production.
Importantly, the differences in pHi and the functional
differences between arteries from WT and KO mice were
abolished in the absence of CO2/HCO3⫺. This strongly
implicates pHi rather than secondary changes consequent to
the prolonged KO as the cause of the functional changes.
Acid-base disturbances are common clinical manifestations of metabolic, renal, and pulmonary disease. Intracellular
acidification may also develop secondary to ischemia or
possibly as a consequence of genetic mutations in NBCn1. It
is plausible that such pHi disturbances contribute to differences in cardiovascular susceptibility among individuals, and
the described pHi-mediated effects on artery function and
blood pressure control provide a novel target to consider for
future treatment strategies.
In conclusion, this study provides the first direct evidence that
membrane acid-base transport is crucial for artery function and
blood pressure regulation. Knockout of NBCn1 acidifies mesenteric artery ECs and VSMCs, inhibits NO-mediated relaxations, and diminishes rho-kinase– dependent VSMC Ca2⫹ sensitivity. In agreement with the changes in artery function, we
show that NBCn1 KO mice are mildly hypertensive at rest,
display attenuated blood pressure responses to NO synthase and
rho-kinase inhibition, and are resistant to developing hypertension during angiotensin-II infusion.
Acknowledgments
The authors wish to thank Dr Donna Briggs Boedtkjer for fruitful
discussions and editing assistance. Jørgen Andresen, Helle Høyer,
Zhila Nikrozi, Viola Mose Larsen, Jane Rønn and Lisbeth Ahm
Hansen are thanked for expert technical assistance.
Sources of Funding
The Water and Salt Research Center and Danish Center for Transgenic Mice were established and supported by the Danish National
Research Foundation. This work was supported by the Danish
Council for Independent Research (10-094816 to Dr Boedtkjer and
271-06-0472 to Dr Aalkjaer) and the Danish Heart Foundation
(08-10-R68-A2179-B719-22494 to Dr Boedtkjer).
Disclosures
None.
References
1. Gorelick PB. New horizons for stroke prevention: PROGRESS and
HOPE. Lancet Neurol. 2002;1:149 –156.
2. MacMahon S, Peto R, Cutler J, Collins R, Sorlie P, Neaton J, Abbott R,
Godwin J, Dyer A, Stamler J. Blood pressure, stroke, and coronary heart
disease. Part 1: prolonged differences in blood pressure: prospective
observational studies corrected for the regression dilution bias. Lancet.
1990;335:765–774.
3. Makin A, Lip GY, Silverman S, Beevers DG. Peripheral vascular disease
and hypertension: a forgotten association? J Hum Hypertens. 2001;15:
447– 454.
4. Weimer LH, Williams O. Syncope and orthostatic intolerance. Med Clin
North Am. 2003;87:835– 865.
5. Kapoor WN. Syncope. N Engl J Med. 2000;343:1856 –1862.
6. Masaki KH, Schatz IJ, Burchfiel CM, Sharp DS, Chiu D, Foley D, Curb
JD. Orthostatic hypotension predicts mortality in elderly men: the
Honolulu Heart Program. Circulation. 1998;98:2290 –2295.
7. Rose KM, Eigenbrodt ML, Biga RL, Couper DJ, Light KC, Sharrett AR,
Heiss G. Orthostatic hypotension predicts mortality in middle-aged
adults: the Atherosclerosis Risk In Communities (ARIC) Study.
Circulation. 2006;114:630 – 636.
8. Kannel WB. Role of blood pressure in cardiovascular disease: the Framingham Study. Angiology. 1975;26:1–14.
9. Boedtkjer E, Praetorius J, Aalkjaer C. NBCn1 (slc4a7) mediates the
Na⫹-dependent bicarbonate transport important for regulation of intracellular pH in mouse vascular smooth muscle cells. Circ Res. 2006;98:
515–523.
10. Fleming I, Hecker M, Busse R. Intracellular alkalinization induced by
bradykinin sustains activation of the constitutive nitric oxide synthase in
endothelial cells. Circ Res. 1994;74:1220 –1226.
11. Ahn K, Beningo K, Olds G, Hupe D. The endothelin-converting enzyme
from human umbilical vein is a membrane-bound metalloprotease similar
to that from bovine aortic endothelial cells. Proc Natl Acad Sci U S A.
1992;89:8606 – 8610.
12. Schubert R, Krien U, Gagov H. Protons inhibit the BKCa channel of rat
small artery smooth muscle cells. J Vasc Res. 2001;38:30 –38.
13. Peers C, Green FK. Inhibition of Ca2⫹-activated K⫹ currents by intracellular acidosis in isolated type I cells of the neonatal rat carotid body.
J Physiol. 1991;437:589 – 602.
14. Klockner U, Isenberg G. Intracellular pH modulates the availability of
vascular L-type Ca2⫹ channels. J Gen Physiol. 1994;103:647– 663.
15. Gardner JP, Diecke FP. Influence of pH on isometric force development
and relaxation in skinned vascular smooth muscle. Pflugers Arch. 1988;
412:231–239.
Boedtkjer et al
Vascular Role of Naⴙ,HCO3ⴚ Cotransporter NBCn1
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
16. Mrwa U, Achtig I, Ruegg JC. Influences of calcium concentration and pH
on the tension development and ATPase activity of the arterial actomyosin contractile system. Blood Vessels. 1974;11:277–286.
17. Huang PL, Huang Z, Mashimo H, Bloch KD, Moskowitz MA, Bevan JA,
Fishman MC. Hypertension in mice lacking the gene for endothelial nitric
oxide synthase. Nature. 1995;377:239 –242.
18. Lemmer B, Arraj M. Effect of NO synthase inhibition on cardiovascular
circadian rhythms in wild-type and eNOS-knock-out mice. Chronobiol
Int. 2008;25:501–510.
19. Aisaka K, Gross SS, Griffith OW, Levi R. NG-methylarginine, an inhibitor of endothelium-derived nitric oxide synthesis, is a potent pressor
agent in the guinea pig: does nitric oxide regulate blood pressure in vivo?
Biochem Biophys Res Commun. 1989;160:881– 886.
20. Moncada S, Higgs A. The L-arginine-nitric oxide pathway. N Engl J Med.
1993;329:2002–2012.
21. Freedman JE, Sauter R, Battinelli EM, Ault K, Knowles C, Huang PL,
Loscalzo J. Deficient platelet-derived nitric oxide and enhanced hemostasis in mice lacking the NOSIII gene. Circ Res. 1999;84:1416 –1421.
22. Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita T,
Tamakawa H, Yamagami K, Inui J, Maekawa M, Narumiya S. Calcium
sensitization of smooth muscle mediated by a Rho-associated protein
kinase in hypertension. Nature. 1997;389:990 –994.
23. Guilluy C, Bregeon J, Toumaniantz G, Rolli-Derkinderen M, Retailleau
K, Loufrani L, Henrion D, Scalbert E, Bril A, Torres RM, Offermanns S,
Pacaud P, Loirand G. The Rho exchange factor Arhgef1 mediates the
effects of angiotensin II on vascular tone and blood pressure. Nat Med.
2010;16:183–190.
24. Orlowski J, Grinstein S. Diversity of the mammalian sodium/proton
exchanger SLC9 gene family. Pflugers Arch. 2004;447:549 –565.
25. Aalkjaer C, Cragoe EJ Jr. Intracellular pH regulation in resting and
contracting segments of rat mesenteric resistance vessels. J Physiol.
1988;402:391– 410.
26. Choi I, Aalkjaer C, Boulpaep EL, Boron WF. An electroneutral sodium/
bicarbonate cotransporter NBCn1 and associated sodium channel. Nature.
2000;405:571–575.
27. Pushkin A, Abuladze N, Lee I, Newman D, Hwang J, Kurtz I. Cloning,
tissue distribution, genomic organization, and functional characterization
of NBC3, a new member of the sodium bicarbonate cotransporter family.
J Biol Chem. 1999;274:16569 –16575.
28. Bok D, Galbraith G, Lopez I, Woodruff M, Nusinowitz S, BeltrandelRio
H, Huang W, Zhao S, Geske R, Montgomery C, Van Sligtenhorst I,
Friddle C, Platt K, Sparks MJ, Pushkin A, Abuladze N, Ishiyama A,
Dukkipati R, Liu W, Kurtz I. Blindness and auditory impairment caused
by loss of the sodium bicarbonate cotransporter NBC3. Nat Genet. 2003;
34:313–319.
11
29. Boedtkjer E, Praetorius J, Fuchtbauer EM, Aalkjaer C. Antibodyindependent localization of the electroneutral Na⫹-HCO3⫺ cotransporter
NBCn1 (slc4a7) in mice. Am J Physiol Cell Physiol. 2008;294:
C591–C603.
30. Taylor CJ, Nicola PA, Wang S, Barrand MA, Hladky SB. Transporters
involved in regulation of intracellular pH in primary cultured rat brain
endothelial cells. J Physiol. 2006;576:769 –785.
31. Sun B, Vaughan-Jones RD, Kambayashi JI. Two distinct HCO3⫺dependent H⫹ efflux pathways in human vascular endothelial cells. Am J
Physiol Heart Circ Physiol. 1999;277:H28 –H32.
32. Roos A, Boron WF. Intracellular pH. Physiol Rev. 1981;61:296 – 434.
33. Boedtkjer E, Aalkjaer C. Insulin inhibits Na⫹/H⫹ exchange in vascular
smooth muscle and endothelial cells in situ: involvement of H2O2 and
tyrosine phosphatase SHP-2. Am J Physiol Heart Circ Physiol. 2009;296:
H247–H255.
34. Liu R, Carretero OA, Ren Y, Wang H, Garvin JL. Intracellular pH
regulates superoxide production by the macula densa. Am J Physiol Renal
Physiol. 2008;295:F851–F856.
35. Matrougui K, Tanko LB, Loufrani L, Gorny D, Levy BI, Tedgui A,
Henrion D. Involvement of Rho-kinase and the actin filament network in
angiotensin II–induced contraction and extracellular signal-regulated
kinase activity in intact rat mesenteric resistance arteries. Arterioscler
Thromb Vasc Biol. 2001;21:1288 –1293.
36. Takahara A, Sugiyama A, Satoh Y, Yoneyama M, Hashimoto K. Cardiovascular effects of Y-27632, a selective Rho-associated kinase inhibitor, assessed in the halothane-anesthetized canine model. Eur
J Pharmacol. 2003;460:51–57.
37. Fenger-Gron J, Mulvany MJ, Christensen KL. Mesenteric blood pressure
profile of conscious, freely moving rats. J Physiol. 1995;488:753–760.
38. Aalkjaer C, Mulvany MJ. Effect of changes in intracellular pH on the
contractility of rat resistance vessels. Prog Biochem Pharmacol. 1988;
23:150 –158.
39. Apkon M, Weed RA, Boron WF. Motor responses of cultured rat cerebral
vascular smooth muscle cells to intra- and extracellular pH changes. Am J
Physiol. 1997;273:H434 –H445.
40. Smith GL, Austin C, Crichton C, Wray S. A review of the actions and
control of intracellular pH in vascular smooth muscle. Cardiovasc Res.
1998;38:316 –331.
41. Wolfrum S, Dendorfer A, Rikitake Y, Stalker TJ, Gong Y, Scalia R,
Dominiak P, Liao JK. Inhibition of Rho-kinase leads to rapid activation
of phosphatidylinositol 3-kinase/protein kinase Akt and cardiovascular
protection. Arterioscler Thromb Vasc Biol. 2004;24:1842–1847.
42. Chitaley K, Webb RC. Nitric oxide induces dilation of rat aorta via
inhibition of rho-kinase signaling. Hypertension. 2002;39:438 – 442.
43. Williams J, Bogwu J, Oyekan A. The role of the RhoA/Rho-kinase
signaling pathway in renal vascular reactivity in endothelial nitric oxide
synthase null mice. J Hypertens. 2006;24:1429 –1436.
CLINICAL PERSPECTIVE
It has long been speculated that disturbed intracellular pH (pHi) regulation could be important for development of artery
dysfunction and cardiovascular disease. The lack of experimental techniques allowing for selective changes in pHi without
affecting extracellular conditions has, however, precluded direct studies into the effects of pHi disturbances in the artery wall. In
the present study, we used a functional genetics approach to abolish expression of the Na⫹,HCO3 cotransporter NBCn1, which
is responsible for pHi control in both vascular smooth muscle and endothelial cells. The cardiovascular function was greatly
disturbed by the low intracellular pH resulting from lack of NBCn1 expression. Our findings for the first time directly
demonstrate the potential of pHi disturbances in the artery wall and add to the existing complexity of signaling pathways involved
in control of artery contractile function and blood pressure. NBCn1 knockout mice were mildly hypertensive at rest but protected
against angiotensin-II–induced hypertension. The molecular basis for the altered artery function originated from reduced
endothelial NO production and inhibited rho-kinase signaling. Hence, disturbed pHi in the artery wall affects key signaling
pathways and may prove particularly important for development of artery dysfunction during conditions of local ischemia or
possibly in patients with genetic mutations in NBCn1. These new mechanisms implicated in blood pressure regulation and
cardiovascular control provide a potential new target to consider in the treatment of artery dysfunction and blood pressure
disturbances.
Disruption of Na+,HCO3− Cotransporter NBCn1 (slc4a7) Inhibits NO-Mediated
Vasorelaxation, Smooth Muscle Ca 2+ Sensitivity, and Hypertension Development in Mice
Ebbe Boedtkjer, Jeppe Praetorius, Vladimir V. Matchkov, Edgaras Stankevicius, Susie
Mogensen, Annette C. Füchtbauer, Ulf Simonsen, Ernst-Martin Füchtbauer and Christian
Aalkjaer
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Circulation. published online September 26, 2011;
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2011 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circ.ahajournals.org/content/early/2011/09/25/CIRCULATIONAHA.110.015974
Data Supplement (unedited) at:
http://circ.ahajournals.org/content/suppl/2011/09/21/CIRCULATIONAHA.110.015974.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:
http://circ.ahajournals.org//subscriptions/
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
SUPPLEMENTAL MATERIAL
Materials and Methods
Generation of the mouse model
Mice with a targeted disruption of the NBCn1 gene were produced using a gene trap mutagenesis approach.
Embryonic stem cells (40G1, Centre for Modeling Human Disease, Canada) containing the pMS1 gene trap
vector integrated 434 bases upstream of the MEAD start codon were injected into B6D2F2 mouse
blastocysts as previously described1. The location of the gene trap vector was confirmed by sequencing PCR
products spanning its boundaries (Supplementary Fig. 10). Chimeric males were bred with C57BL/6J
females. Agouti offspring was tested for the presence of the disrupted NBCn1 allele by PCR using genomic
tail DNA. Heterozygous mice were backcrossed into WT C57BL/6J mice for at least 7 generations before the
animals were investigated. For genotyping, a common forward primer was used for the WT and KO allele:
5’-TTCGAAAGTCTGTAGAACTTCCG-3’. The KO allele was detected with the following reverse primer:
5’-GGTGCACTCTCAGTACAATCTG-3’, while the reverse primer for the WT allele was as follows: 5’GAGACAAAAGAAGACAGACATTCGTATC-3’. All animal procedures were approved by the Danish
Animal Care and Use Committee under the Danish Ministry of Justice.
Myograph and fluorescence experiments
Adult mice (>7 weeks of age) were killed by cervical dislocation and the mesenteric bed excised. In all
experimental series, NBCn1 KO and WT mice were matched for age and gender. Mesenteric small arteries
were mounted in wire myographs (DMT, Denmark) and force measurements performed as previously
described2. Consequences of superoxide-scavenging for acetylcholine-induced vasorelaxation were studied
using PEG-SOD (200 U/mL, preincubated for up to 1 hour) and tempol (100 µmol/L, preincubated for 30
minutes), which have previously been shown to increase cellular oxidative resistance3.
Measurement of pHi and acid-base transport activities in VSMCs and ECs were carried out as previously
described2,4. VSMC pHi was measured using wide-field microcopy of arteries loaded with 2',7'-bis-(2carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF; Invitrogen). Confocal microscopy was used to detect
pHi-dependent fluorescence from ECs in arteries loaded with 2',7'-bis-(2-carboxypropyl)-5-(and-6)carboxyfluorescein (BCPCF; Invitrogen). The fluorescence ratios were calibrated using the high-K+ nigericin
method as previously described5. Net base uptake was calculated in the pHi-range 6.4-6.7 (compared values
were calculated at the same mean pHi) by multiplying the pHi recovery rate with the buffering capacity6.
Buffering capacity of VSMCs was calculated from the change in pHi upon addition and washout of NH4Cl as
previously described2. No difference in buffering capacity was found (at pHi=7.0) between arteries from
NBCn1 KO (β=43±4 mmol/L) and WT mice (β=41±4 mmol/L; P=0.68) in the presence of CO2/HCO3-. In
accordance with previous results from smooth muscle cells4,7, removing CO2/HCO3- did not result in a
measurable change in intracellular buffering capacity of VSMCs from neither NBCn1 KO (β=45±7 mmol/L)
nor WT mice (β=54±7 mmol/L; P=0.43 vs. NBCn1 KO). The inability to measure a change in buffering
capacity following removal of CO2/HCO3- may be explained by the relatively high intrinsic buffering
capacity compared to the expected contribution from the CO2/HCO3- buffering system. Multiple studies2,4,7
have shown that the intrinsic buffering capacity of mouse smooth muscle cells varies between approximately
50 and 100 mmol/L in the pHi-range 6.5 to 7.0. In the same pHi-range, the contribution from CO2/HCO3- is
theoretically6 5-10 mmol/L and therefore not expected to substantially affect total buffering capacity.
Amiloride or cariporide were used to inhibit Na+/H+-exchange only in experiments where Na+,HCO3-cotransport activity was quantified.
To evaluate intracellular Ca2+-responses of ECs to acetylcholine, arteries were mounted in a pressure
myograph (DMT) and slowly perfused (~1 mL/hour) intraluminally for 1 hour at 37°C with a physiological
salt solution (PSS) containing 2.5 µmol/L Calcium Green-1 and 3 µmol/L Fura Red (Invitrogen) in a loading
buffer containing Pluronic F127 and Cremophor EL in DMSO (final concentration 0.1%). Subsequently,
arteries were mounted in a confocal wire myograph (DMT) and investigated using a Zeiss confocal
microscope (Axiovert 200M equipped with an LSM Pascal exciter) with a 40× objective (LD CApochromat; NA 1.10; Zeiss, Germany). Arteries were excited at 488 nm and emission light from ECs
1
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
collected in the range 505-545 nm (F505-545) and at wavelengths longer than 560 nm (F>560). An original
experiment is shown in Supplementary Figure 11. As a measure of the intracellular concentration of Ca2+, the
average ratio (F505-545/F>560) of the cells in the field of view was expressed normalized to the baseline ratio.
The intracellular Ca2+-response of VSMCs was evaluated using Fura-2 (Invitrogen) combined with widefield microscopy as previously described2.
The compositions of the salt solutions used for functional experiments have previously been described7.
Western blot analyses of protein expression levels
Protein expression levels in mouse mesenteric arteries were investigated by Western blot analyses.
Previously described antibodies against NBCn18, eNOS (ab5589; Abcam)12, αENaC (custom made by
Phosphosolutions Inc. AP 4007) and NHE1 (1950 anti NHE1 serum; generously provided by Mark
Donowitz)9 were employed. For these experiments, approximately 10 mesenteric arteries were dissected free,
snap frozen in liquid nitrogen, lysed in a dissection buffer (0.3 mol/L sucrose, 25 mmol/L imidazole, 1
mmol/L EDTA (pH 7.2), containing 8.5 µmol/L leupeptin and 1 mmol/L phenylmethylsulfonyl fluoride) and
spun through a QiaShredder (Qiagen). A sample buffer was added to obtain a final content of 3% (wt/vol)
sodium dodecyl sulfate (SDS), 40 mmol/L 1,4-dithiothreitol (DTT), 6% (vol/vol) glycerol, 10 mmol/L Tris
(pH 6.8) and bromophenol blue. The samples were heated at 65°C for 15 min and stored at 4°C until use.
Total protein content was determined for each sample with the RC DC protein assay (Bio-Rad Laboratories,
Denmark). Immunoblotting was carried out as previously described8. Densitometric analyses were performed
using ImageJ software (Rasband; NIH, USA). To control for uneven loading, a Coomassie staining was
performed or pan-actin expression (antibody 4968s; Cell Signaling) was determined and the corrected band
densities reported after normalization to the average WT level.
Western blot analyses of protein phosphorylation levels
Phosphorylation of MYPT at Thr-850 was evaluated using a phosphospecific antibody (04-773; Millipore)
and an antibody that recognizes total MYPT (sc-25618; Santa Cruz). Mesenteric small arteries, superior
mesenteric arteries and segments of thoracic aorta from WT and NBCn1 KO mice were preincubated with
100 µmol/L L-NAME for 15 minutes and then stimulated with 1 µmol/L norepinephrine in PSS for 5
minutes at 37°C. Arteries were exposed to ice-cold 10 mmol/L DTT in acetone with 10% trichloroacetic acid
and kept on dry ice. After storage for 20 hours at -80°C, arteries were washed three times with 10 mmol/L
DTT in acetone and then kept at -80°C until further handling. Subsequently, arteries were immersed in a 1:1
mixture of sample buffer (1 mmol/L DTT, 58 mmol/L Tris-HCl, 1.6% (wt/vol) SDS, 5% (vol/vol) glycerol,
0.02% bromophenol blue) and lysis buffer (20 mmol/L Tris-HCl, 5 mmol/L EGTA, 150 mmol/L NaCl, 20
mmol/L glycerophosphate, 10 mmol/L NaF, 1% (vol/vol) Triton X-100, 0.1% (vol/vol) Tween-20; pH 7.5)
containing 10 µL/mL Halt protease and phosphatase inhibitor cocktail (Thermo Scientific) and heated to
50°C for 10 minutes with agitation. Following homogenization with pellet pestles (Sigma-Aldrich) and
sonication for 45 seconds, the samples were centrifuged at 9,450 g (Centrifuge 5417 R; Eppendorf) for 10
minutes. A 7.2 µL sample of the supernatant (mixed with 2.8 µL sample buffer) was loaded in each lane of
an SDS-polyacrylamide gel to quantify expression of MYPT phosphorylated at Thr-850 while a 0.8 µL
sample (mixed with 9.2 µL sample buffer) was loaded to quantify total MYPT expression. Proteins were
separated by gel electrophoresis and transferred to polyvinylidene difluoride membranes blocked with 0.3%
i-block (Applied Biosystems). Membranes were probed with the relevant primary antibody and then with a
secondary goat anti-rabbit antibody (G21234; Invitrogen) conjugated to horseradish peroxidase. Bound
antibody was detected by enhanced chemiluminescence (ECL Plus; GE Healthcare). The abundance of
MYPT phosphorylated at Thr-850 was determined by densitometry using ImageJ software (Rasband; NIH,
USA), expressed relative to total MYPT expression and normalized to the average WT level. In addition,
total MYPT expression relative to pan-actin expression (antibody 4968s; Cell Signaling) was determined.
Phosphorylation of eNOS at Ser-1177 was investigated with a phosphospecific antibody (9571; Cell
Signaling). Mesenteric arteries were precontracted with 3 µmol/L norepinephrine and then stimulated with 3
µmol/L acetylcholine in PSS for 2 minutes at 37°C. The arteries were snap frozen in liquid nitrogen and
stored at -80°C until further handling. Arteries were submerged in 50 µL lysis buffer containing 10 µL/mL
Halt protease and phosphatase inhibitor cocktail (Thermo Scientific) and homogenized using pellet pestles
(Sigma-Aldrich). Samples were sonicated for 45 seconds and centrifuged at 9,450 g for 10 minutes. The total
2
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
protein concentration of the supernatant was measured using the DC protein assay (Bio-Rad Laboratories)
and 10 µg total protein diluted in sample buffer was loaded in each lane of an SDS-polyacrylamide gel.
Electrophoresis, immunoblotting and quantification were performed as described above.
Quantitative RT-PCR
The levels of NBCn1 mRNA expressed in mesenteric arteries of WT and homozygous NBCn1 KO mice
were investigated using TaqMan quantitative RT-PCR as previously described2.
Immunofluorescence imaging and immunogold electron micoscopy
The expression of NBCn1 in ECs was investigated in isolated mouse mesenteric arteries using a previously
described antibody8. Whole-mount immunofluorescence imaging and immunogold electron microscopy were
performed as previously described2.
Rho-kinase activity assay
Rho-kinase activity was measured using an in vitro assay based on a phosphospecific monoclonal antibody
and a human rho-kinase II control consisting of amino acid residues 11-552 (CycLex Co., Japan). The assay
which evaluates phosphorylation of the myosin light chain phosphatase was performed according to the
manufacturer’s recommendations with absorbance measured at 450 nm.
NO-measurements
Using NO-sensitive electrodes, the increase in NO concentration upon stimulation of norepinephrineprecontracted superior mesenteric arteries with acetylcholine was recorded as previously described10. ADMA
was used to inhibit eNOS activity in these experiments to avoid interference of L-NAME with the electrode.
NO-synthase activity measurements
L-arginine to L-citrulline conversion was measured in intact aortic segments using a modification of the
method previously described by Gürdal et al11.The thoracic aorta was dissected out, cut into 5 mm segments,
submerged in PSS containing 10 µCi/mL L-[14C]arginine (Perkin Elmer, Denmark) for 60 minutes, washed
twice with PSS, left for 30 minutes in PSS with or without 100 µmol/L L-NAME and finally exposed to 3
µmol/L acetylcholine for 30 minutes. All incubation steps were performed at 37°C in an atmosphere of 5%
CO2 balance air. Next, the aortic segments were transferred to 300 µL ice-cold 15% trichloroacetic acid and
left on ice for one hour. Samples were vortexed and then centrifuged (1,500 g) for 10 minutes at 4°C. 280 µL
supernatant was mixed with 125 µL 10 mmol/L EDTA and 500 µL 1:1 freon/tri-n-octylamine. Following
vortexing, the samples were left for 10 minutes and then centrifuged (12,000 g) for 10 minutes at 4°C. 300
µL of the upper aqueous phase was mixed with 700 µL 20 mmol/L Hepes (pH 6.0). This mixture was added
to columns of Dowex AG50WX-8 resin. Formed L-[14C]citrulline was eluted with 3 mL distilled water. A
0.5 mL sample of the eluate was mixed with 5 mL scintillation cocktail (Opti-Fluor; Perkin Elmer) and the
amount of radioactivity determined in a Tri-Carb 2910 TR liquid scintillation analyzer (Perkin Elmer). Since
the intact aortic segments contain multiple other cell types than ECs, it is expected that L-arginine
conversion will involve other processes than eNOS-catalyzed conversion to L-citrulline. We measured eNOS
activity as the L-NAME-sensitive part of L-[14C]arginine conversion, which in aortic segments from WT
mice accounted for approximately 25% of total L-[14C]arginine conversion. The L-NAME-insensitive L[14C]arginine conversion was not significantly different between aortic segments from NBCn1 KO and WT
mice.
Blood pressure measurements
Systemic blood pressure and heart rate were measured from NBCn1 KO and WT mice using radiotelemetry
(Data Sciences International, USA; Supplementary Fig. 12a) or by determining the tail blood volume with a
volume pressure recording sensor and an occlusion tail-cuff (CODA System, Kent Scientific, USA;
Supplementary Fig. 12b). For tail-cuff measurements, in accordance with manufacturer’s recommendation,
mice were trained for a minimum of three days prior to interventions. To reduce the variability, resting blood
pressure was calculated from telemetry recordings obtained during the light cycle (6 a.m. to 6 p.m.) when the
activity parameter was 0. To inhibit NO production in vivo, mice were treated with L-NAME in the drinking
3
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
water. Blood pressure, water consumption and body weight were measured under each condition. L-NAME
intake relative to body weight did not significantly differ between NBCn1 KO and WT mice.
To investigate blood pressure responses to continuous angiotensin II infusion, NBCn1 KO and WT mice
were anesthetized by intraperitoneal injections with a combination of fluanisone (10 mg/kg body weight),
fentanyl (0.3 mg/kg body weight) and midazolam (1 mg/kg body weight) to allow for subcutaneous
implantation of osmotic minipumps (Alzet model 1002; Durect, USA) containing a concentration of
angiotensin II sufficient to allow for infusion rates of 2000 ng/kg body weight/min; a dose intermediate to
the dosages previously reported to induce hypertension in mice12-14. A similar anesthesia regimen was used
for implanting the transmitters for telemetric blood pressure measurements.
The in vivo effect of rho-kinase inhibition was investigated by measuring blood pressure prior to and up to 2
hours after intraperitoneal injection of 10 mg Y-27632 per kg body weight. This dose of Y-27632 has
previously been shown to cause a significant blood pressure decrease in WT mice in the investigated time
period15. As a vehicle control, similar experiments were performed with injection of saline.
Statistics
Data are expressed as mean±SEM. Unpaired, two-tailed Student’s t-test was used for comparison of one
variable between two groups. To evaluate the effects of two variables on the measured variable, we used
two-way ANOVA followed by Bonferroni post-tests. When the variable was measured multiple times for
each mouse, a repeated measures two-way ANOVA was employed. Concentration-response relationships
were analyzed using a sigmoidal curve fit with variable slope and the derived log(EC50)- and maximumvalues compared with extra sum-of-squares F-tests. The genotype and sex distribution of pups were
compared using χ2-tests. A probability value (P-value) smaller than 0.05 was considered statistically
significant; n equals number of mice. Statistical analyses were performed using Microsoft Excel 2007 or
GraphPad Prism 5.02 software.
4
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
logEC50
Tension development
CO2/HCO3
NBCn1+/+
-5.81±0.04
NBCn1-/-5.73±0.03
CO2/HCO3- + 100 µmol/L L-NAME
NBCn1+/+
-6.19±0.06
NBCn1-/-5.95±0.04**
CO2/HCO3 + 100 µmol/L L-NAME + 0.1 µmol/L Y-27632
-5.93±0.09
NBCn1+/+
CO2/HCO3 + 100 µmol/L L-NAME + 10 µmol/L Y-27632
-5.57±0.12
NBCn1+/+
-5.59±0.05
NBCn1-/CO2/HCO3- + 100 µmol/L L-NAME + 10 µmol/L fasudil
-5.61±0.16
NBCn1+/+
-5.66±0.06
NBCn1-/CO2/HCO3 -free
NBCn1+/+
-5.73±0.03
NBCn1-/-5.79±0.04
CO2/HCO3--free + 100 µmol/L L-NAME
NBCn1+/+
-5.92±0.11
NBCn1-/-5.88±0.07
CO2/HCO3NBCn1+/+
-5.98±0.04
NBCn1-/-6.00±0.03
CO2/HCO3- + 10 µmol/L Y-27632
-5.31±0.07
NBCn1+/+
-/-5.51±0.06**
NBCn1
logEC50
VSMC intracellular Ca2+-response (∆Fura-2 ratio)
CO2/HCO3- + 100 µmol/L L-NAME
NBCn1+/+
-6.37±0.22
NBCn1-/-6.43±0.10
CO2/HCO3- + 100 µmol/L L-NAME + 10 µmol/L Y-27632
-6.33±0.17
NBCn1+/+
-6.09±0.12
NBCn1-/-
Maximum (N/m)
2.79±0.09
2.80±0.06
3.23±0.12
2.96±0.08
3.23±0.16
1.16±0.12
1.19±0.06
1.48±0.20
1.50±0.08
2.68±0.07
2.76±0.08
2.94±0.23
3.18±0.17
3.12±0.09
3.21±0.08
1.50±0.11
1.58±0.11
Maximum
0.049±0.006
0.049±0.003
0.046±0.004
0.056±0.004
Supplementary Table 1. Log(EC50)- and maximum-values corresponding to the norepinephrine
concentration-response curves in Figure 7 and Supplementary Figure 6. **P<0.01 vs. WT with similar
treatment; otherwise P≥0.05 vs. WT with similar treatment. The horizontal line in the tension development
data divides the data into two independent experimental series.
5
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 1. (a) Heterozygous breeding of the generated mouse model resulted in a nonmendelian distribution between the genotypes (P<0.05) but the expected distribution between the sexes
(P=0.62; n=329). Comparisons were made with χ2-tests. (b) NBCn1 KO mice displayed normal growth with
no significant difference (P=0.57) in weight development between NBCn1 KO and WT mice (n=7-8).
Comparison was made with a repeated measures two-way ANOVA.
6
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 2. Original trace showing the pHi changes during an NH4+-pulse. The experiment
was performed on an artery from a WT mouse in the presence of CO2/HCO3-. Addition of NH4Cl to the bath
induces abrupt intracellular alkalinization caused by rapid influx of NH3. This is followed by a slower
acidification as NH4+ enters the cells. Upon washout of NH4Cl, NH3 rapidly leaves the intracellular
compartment, leaving H+ behind and causing intracellular acidification. The recovery of pHi from this
acidification was studied in the presence and absence of bath Na+ to measure the activity of Na+-dependent
base uptake.
7
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 3. Na+,HCO3--cotransport in ECs is insensitive to 200 µmol/L DIDS. (a) Washout
from an NH4+-prepulse induced intracellular acidification. The concentration of NH4Cl was kept low at 5
mmol/L to avoid EC blebbing seen with higher concentrations4. Addition of bath Na+ in the presence of 600
µmol/L amiloride activated a HCO3--dependent pHi recovery (n=6). (b) Average net Na+-dependent base
uptake after an NH4+-prepulse (n=6). (c) NH4+-prepulse experiments performed in the presence of
CO2/HCO3- with or without 200 µmol/L DIDS (n=6). The concentration of NH4Cl was kept low at 5 mmol/L
to avoid EC blebbing seen with higher concentrations4. (d) Average net Na+-dependent base uptake after an
NH4+-prepulse in the presence of CO2/HCO3- with or without 200 µmol/L DIDS (n=6). (e,f) Removal of bath
Na+ in the presence of CO2/HCO3- and 600 µmol/L amiloride produced intracellular acidification, which was
insensitive to 200 µmol/L DIDS (n=5). (g) Average acidification upon removal of bath Na+ in the presence
of CO2/HCO3- and 600 µmol/L amiloride with or without 200 µmol/L DIDS (n=5). Comparisons were made
with paired two-tailed Student's t-tests. NS: Not significantly different, **P<0.01 vs. control.
8
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 4. Original trace of the pHi changes in ECs of an artery from a WT mouse. The
effect of removing bath Na+ in the presence of CO2/HCO3- and 600 µmol/L amiloride is shown. Since net
acid-extrusion mediated by Na+,HCO3--cotransport depends on extracellular Na+, omission of bath Na+
inhibits the transport and causes intracellular acidification, which is reversible upon readdition of bath Na+.
The lower time resolution of the EC compared to VSMC pHi recordings was chosen to reduce tissue damage
caused by sustained laser light exposure.
9
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 5. The expression of NHE1 protein in mesenteric arteries from NBCn1 KO and WT
mice was investigated by Western blot analyses (n=4-5). As previously reported16, NHE1 migrates as two
bands of approximately 85 and 105 kDa. Data are corrected for loading differences determined by
Coomassie staining. Comparison was made with unpaired two-tailed Student's t-test. NS: Not significantly
different vs. WT.
10
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 6. Vasorelaxation to high concentrations (10 µmol/L) of acetylcholine was reduced
in arteries from NBCn1 KO compared to WT mice. This finding suggests that maximal relaxation (and not
only the sensitivity) to acetylcholine is reduced. The tendency towards a smaller relaxation to 10 µmol/L
acetylcholine compared to 3 µmol/L acetylcholine (Fig. 4) might be explained by a vasocontractile response
initiated by high acetylcholine concentrations17. Comparison was made with unpaired two-tailed Student's ttest. **P<0.01 vs. WT.
11
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 7. Direct pHi-mediated effects on rho-kinase activity may contribute to the lower
rho-kinase-dependent Ca2+-sensitivity in arteries from NBCn1 KO mice. (a) Isolated rho-kinase activity was
modulated by pH in the relevant range (n=4). (b) Isolated rho-kinase activity was concentration-dependently
reduced by Y-27632. (c) With CO2/HCO3- present, the sensitivity to norepinephrine with respect to tension
development was reduced by low concentrations of Y-27632 in L-NAME treated arteries from WT mice
(n=4) with no effect on maximum tension. Log(EC50)- and maximum-values were derived from a sigmoidal
curve fit, compared with extra sum-of-squares F-tests and reported in Supplementary Table 1.
12
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 8. Schematic representation of the pathways proposed to be affected by pHi in the
vasculature. NBCn1 contributes to pHi control by transporting HCO3-, which in turn consumes cytosolic H+.
ACh, Acetylcholine; Ang-II, Angiotensin II; Arg, Arginine; CaM, Calmodulin; DAG, Diacyl glycerol;
eNOS, Endothelial NO-synthase; IP3, Inositol 1,4,5-trisphosphate; L-NAME, N-nitro-L-arginine methyl
ester; MLC, Myosin Light Chain; MLC-P, Phosphorylated Myosin Light Chain; MLCK, Myosin Light
Chain Kinase; MLCP, Myosin Light Chain Phosphatase; MLCP-P, Phosphorylated (inactive) Myosin Light
Chain Phosphatase; NE, Norepinephrine; PIP2, Phosphatidylinositol-4,5-bisphosphate; Vm, Membrane
Potential.
13
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 9. The expression of ENaC protein in kidneys from NBCn1 KO and WT mice
treated with angiotensin II infusion for 9 days was investigated by Western blot analyses (n=6-7).
Comparison was made with unpaired two-tailed Student's t-test. +/+ and -/- denote WT and NBCn1 KO,
respectively. NS: Not significantly different vs. WT.
14
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
……TGATAAGCACACCACAAGTGACACACCTTCACAGAGGGACAGAAATGTATTTAATCCTTCAATGTCCATTTGTGATGG
AGACCATCACCTCCACACCCAGGTAGATAGTAGACAAGCACCCTACCTATAGGGTCGACCCAAGAGTGGGACAGGTTGT
GGAACTAGGCCAGTGCAGGGAGTGCACTAGGCAAGTTGCTAAATGTATCCCCTCTTTTACAGGGTCCACGATAGAGTTA
CCTCTAGGAGAGAAACTTGCAGAGGCAGAGAATGAATCTGGCGTCGTCCTGTTTCTCTCCTGCTTGTAAAACACGTGGT
GAGGAGCTGAATGGGGTGATGACCCCATTCCACTTCGAAAGTCTGTAGAACTTCCGATTCGAAAAACCGAGTTCCACTCT
CAGCCTCGGTCAATTAAGTCTTTACAAAGAGGGGCGGGGCCTCCGGGAAACTGACCTGGGGGGCGCAGTTTTTTTTCC
GTCTTTTCCTTTTCTGCTCCCCAGGGGGAAACCAGCCTTCCACTCCCAGGGAATGCTTGCTTCTAGCCACTGTCCATACT
CAGCCACTCTGCCCTGTTTCCCACCCTAGTCAAAGCATCCTCTGGAGTCTCTGCTCAGCTACACAGGGCCTTTTTCCCTT
CACGCCGATGCCTAGGGAGGGAGAGCGGCTTAGCAGCTCTGGAGCTTGCAGCCCCCCCTGCCCTTGCCGCCACCGGC
TTCTTGCTGACCCCGACGGCCTTCCTGGCCCCCGTCAGTTTCTTCTCCGTCTGAGAATAGTGTATGCGGCGACCGAGTT
GCTCTTGCCCGGCGTCAATACGGGATAA……….4kb….……TCTGCCAGTTTGAGGGGACGACGACAGTATCGGCCTCAG
GAAGATCGCACTCCAGCCAGCTTTCCGGCACCGCTTCTGGTGCCGGAAACCAGGCAAAGCGCCATTCGCCATTCAGGC
TGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAA
GGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGGATCCTCTAGAGTCCAGATCTG
CGATAACTTCGTATAATGTATGCTATACGAAGTTATCGATGCATGCGATCTGCGGTTCTTCTTCTTTGGTTTTCGGGACCT
GGGACGGGGAGGCGACAGACCCTTCCGAGCTGCTGATTGGCTGATACGAATGTCTGTCTTCTTTTGTCTCCGCCCTACC
TCCAAGCCCCTTAGCCACTGGAGGCGGTCGCTCGACGCCGGACCTGGTGCCTAACAGGCAGGGGGCGTGCTCCGGGG
GGGGCGTGCCGGAGCGCGCCCCGCCCCCGCCCCCGCCCCCGCCCCCCAGCCCCGCCCCCCGCCCCGCCCCCGCCC
GGGCGCCGCTGCCTCCTCCGCGCCGCGTCCTCTGCCCGTCTCAGTCCTCGCGGCACGCCGTTGCCTCTCTCTCCCGGA
GAACGTCCCGCGCTCGCAGCGGTCGCCGCACTCCGGGGCCAGCTCTCGGCGGCCAGCGCTCCGCACAGGGTCTCCCT
CCGCGTGCCCGTCTCTGCTGCGGTCGCGGCCTCTCAGAGCTCCGGGGCGGGCCATGGAGGCAGACGGGGCCGGCG
AGCAGATGAGACCGCTACTCACGCGGGTAAGGAGCGGGGAGGCCGAGGCCCGCAGACAAAGGCGGCGTCGCGGCGG
GGCTGCCGGCGGCCTATGCTGGCGGCCGCGCGCCGCCGTCGCCGGCGGCGTCGCGGCGGGGCTGCCGGCGGCCTA
TGCTGGCGGCCGCGCGCCGCCGTCGCCTTTGTGTGGCGGGGGTCGCAGGGGACGGCCGGCTTCGAGCCCTCGGGGA
CGCCTCTCCCGAGGACGCGTGTCCGCCGCCGCAGTGCCCGGCTCTCAGACGCGCGGCTCCGGGAGCCGTGTTCTCCC
GCCGCGTGGACGCTGCCGTCCTTCAGCCCAGGCTGCTGTTCCTGCCGCCGCCGCCGCCTTCAGCCTGTGGCCGGAGT
CGGGACCGGCCGTCGGGGCCGGCGCT……
Start codon
gene trap
~4kb
exon
intron
Supplementary Figure 10. The genomic structure of the mutant allele. The upper panel shows the results
from sequencing of PCR products spanning the gene trap boundaries. The location of the start codon and the
displayed exon were determined from comparisons with the most recent mouse cDNA clone
(NM_001033270.2). The gene trap is located 434 bases upstream of the MEAD start codon (emphasized by
larger and bold font). The provided sequence excluding the gene trap is identical to the relevant part of the
published genomic sequence (NT_039595) for C57BL/6J.
15
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 11. Endothelial intracellular Ca2+-reponses detected by confocal microscopy of
arteries loaded by intraluminal perfusion with Calcium Green-1 and Fura Red. (a) A single image from a
time series in which the effect of acetylcholine was investigated. (b,c) The fluorescence signals recorded
from two individual cells (marked b and c in panel a) during acetylcholine (ACh) stimulation. The green
lines (F505-545) represent the Calcium Green-1 signals, while the red lines (F>560) represent the Fura Red
signals. (d) The response of the F505-545/F>560 fluorescence ratio averaged from all the cells in the field of
view.
16
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Figure 12. Original blood pressure recordings using (a) radiotelemetry or (b) a volume
pressure recording sensor and an occlusion tail-cuff.
17
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
Supplementary Reference List
(1) Wertz K, Füchtbauer E-M. B6D2F1 - an improved mouse hybrid strain for the production of
ES cell germ line chimeras. Transgene 1994;1:277-80.
(2) Boedtkjer E, Praetorius J, Aalkjaer C. NBCn1 (slc4a7) mediates the Na+-dependent
bicarbonate transport important for regulation of intracellular pH in mouse vascular smooth
muscle cells. Circ Res 2006;98:515-23.
(3) Beckman JS, Minor RL, Jr., White CW, Repine JE, Rosen GM, Freeman BA. Superoxide
dismutase and catalase conjugated to polyethylene glycol increases endothelial enzyme
activity and oxidant resistance. J Biol Chem 1988;263:6884-92.
(4) Boedtkjer E, Aalkjaer C. Insulin inhibits Na+/H+ exchange in vascular smooth muscle and
endothelial cells in situ: involvement of H2O2 and tyrosine phosphatase SHP-2. Am J
Physiol Heart Circ Physiol 2009;296:H247-H255.
(5) Aalkjaer C, Cragoe EJ, Jr. Intracellular pH regulation in resting and contracting segments of
rat mesenteric resistance vessels. J Physiol 1988;402:391-410.
(6) Roos A, Boron WF. Intracellular pH. Physiol Rev 1981;61:296-434.
(7) Boedtkjer E, Praetorius J, Fuchtbauer EM, Aalkjaer C. Antibody-independent localization of
the electroneutral Na+-HCO3- cotransporter NBCn1 (slc4a7) in mice. Am J Physiol Cell
Physiol 2008;294:C591-C603.
(8) Damkier HH, Nielsen S, Praetorius J. An anti-NH2-terminal antibody localizes NBCn1 to
heart endothelia and skeletal and vascular smooth muscle cells. Am J Physiol Heart Circ
Physiol 2006;290:H172-H180.
(9) Sardet C, Counillon L, Franchi A, Pouyssegur J. Growth factors induce phosphorylation of
the Na+/H+ antiporter, glycoprotein of 110 kD. Science 1990;247:723-6.
(10) Simonsen U, Wadsworth RM, Buus NH, Mulvany MJ. In vitro simultaneous measurements
of relaxation and nitric oxide concentration in rat superior mesenteric artery. J Physiol
1999;516:271-82.
(11) Gurdal H, Can A, Ugur M. The role of nitric oxide synthase in reduced vasocontractile
responsiveness induced by prolonged alpha1-adrenergic receptor stimulation in rat thoracic
aorta. Br J Pharmacol 2005;145:203-10.
(12) Cervenka L, Maly J, Karasova L, Simova M, Vitko S, Hellerova S, Heller J, El-Dahr SS.
Angiotensin II-induced hypertension in bradykinin B2 receptor knockout mice.
Hypertension 2001;37:967-73.
(13) Matsuno K, Yamada H, Iwata K, Jin D, Katsuyama M, Matsuki M, Takai S, Yamanishi K,
Miyazaki M, Matsubara H, Yabe-Nishimura C. Nox1 is involved in angiotensin II-mediated
hypertension: a study in Nox1-deficient mice. Circulation 2005;112:2677-85.
18
Supplemental Material
Boedtkjer et al. Vascular role of Na+,HCO3--cotransporter NBCn1
(14) Lee DL, Sturgis LC, Labazi H, Osborne JB, Jr., Fleming C, Pollock JS, Manhiani M, Imig
JD, Brands MW. Angiotensin II hypertension is attenuated in interleukin-6 knockout mice.
Am J Physiol Heart Circ Physiol 2006;290:H935-H940.
(15) Shin HK, Salomone S, Potts EM, Lee SW, Millican E, Noma K, Huang PL, Boas DA, Liao
JK, Moskowitz MA, Ayata C. Rho-kinase inhibition acutely augments blood flow in focal
cerebral ischemia via endothelial mechanisms. J Cereb Blood Flow Metab 2007;27:9981009.
(16) Goss G, Orlowski J, Grinstein S. Coimmunoprecipitation of a 24-kDa protein with NHE1,
the ubiquitous isoform of the Na+/H+ exchanger. Am J Physiol 1996;270:C1493-C1502.
(17) Vanhoutte PM, Tang EHC. Endothelium-dependent contractions: when a good guy turns
bad! J Physiol 2008;586:5295-304.
19