Published January 20, 2015
Effect of dietary conjugated linoleic acid on marbling
and intramuscular adipocytes in pork1
K. M. Barnes,*2 N. R. Winslow,† A. G. Shelton,* K. C. Hlusko,* and M. J. Azain‡
*Division of Animal and Nutritional Sciences, and †Division of Resource Management, West Virginia University,
Morgantown 26506; and ‡Department of Animal and Dairy Science, University of Georgia, Athens 30602
ABSTRACT: Dietary CLA has been reported to
decrease backfat and increase marbling in pigs. Our
objective was to determine whether the increase in
marbling involved changes in intramuscular adipocyte
number or size or both. Twenty barrows (53 kg) were
penned in pairs and pens were randomly assigned to
receive diets containing either 1% soybean oil (SBO)
or CLA (60% CLA isomers) for 6 wk. Body weight
and feed intake were determined weekly. At slaughter,
loin samples were obtained and flash frozen for RNA
extraction and real-time reverse-transcription PCR
analysis of gene expression. After a 24-h chill, loin eye
area and backfat depth were measured and subjective
marbling and color scores were assigned. Loin, backfat,
and belly fat samples were obtained for fatty acid analysis by gas chromatography. Loin samples were also
frozen in ice-cold isopentane for histological analysis of
intramuscular adipocytes. Dietary CLA did not affect
BW or feed intake at any point (P > 0.10), nor did
treatment groups differ in HCW (P = 0.417) or loin
color (P = 0.500). The CLA-fed pigs did have less (P
= 0.018) backfat and smaller (P = 0.047) loin eye area
than SBO-fed pigs and had a trend for an increase (P
= 0.069) in marbling score. Relative gene expression for
markers of preadipocytes (preadipocyte factor 1; Pref1), differentiating adipocytes (PPARγ), and mature
adipocytes [fatty acid binding protein 4 (FABP4) and
perilipin (PLIN)] were determined and normalized to
the expression of acidic ribosomal phosphoprotein. No
significant differences were detected, but the expression
of PPARγ (P = 0.265), PLIN (P = 0.265), and FABP4
(P = 0.148) was numerically greater in CLA-fed pigs
than in SBO-fed pigs. Loin samples were stained with
Oil Red O to identify intramuscular adipocytes. The
average cell area was increased (P = 0.030) in CLAfed pigs. The cis-9,trans-11 and trans-10,cis-12 CLA
isomers were incorporated (P = 0.006) into backfat and
belly fat, but only trans-10,cis-12 CLA was increased in
the loin (P = 0.004) of CLA-fed pigs. The proportion of
SFA was increased (P = 0.006) by CLA in all tissues.
These results indicate that the increase in marbling in
pigs fed CLA may be related to increased intramuscular adipocyte size, and the combination of increased
marbling and degree of saturation could improve the
eating quality of CLA-fed pork.
Key words: backfat, conjugated linoleic acid, fatty acid profile, intramuscular adipocyte, marbling, pig
©2012 American Society of Animal Science. All rights reserved.
J. Anim. Sci. 2012. 90:1142–1149
http://dx.doi.org/10.2527/jas.2011-4642
INTRODUCTION
Conjugated linoleic acids are a group of isomers of
linoleic acid that have multiple biological activities. Dietary CLA reduces body fat in several species (Park et
al., 1997; Ostrowska et al., 1999; Azain et al., 2000; Risérus et al., 2001). In pigs, CLA reduced backfat (Dugan et al., 1997; Thiel-Cooper et al., 2001; Wiegand
1
This work was funded in part by the West Virginia University
Senate Grants for Research and Scholarship and is published with
the approval of the director of the West Virginia Agriculture and
Forestry Experiment Station as scientific paper number 3120.
2
Corresponding author: [email protected]
Received August 29, 2011.
Accepted November 8, 2011.
et al., 2001, 2002), increased marbling score (Dugan
et al., 1999; Gatlin et al., 2002; Wiegand et al., 2002),
and increased intramuscular lipid (Dugan et al., 1999;
Thiel-Cooper et al., 2001; Wiegand et al., 2002). This is
important for the swine industry because intramuscular
fat is positively correlated with pork quality, specifically tenderness (Brewer et al., 2001; Wood et al., 2004;
Lonergan et al., 2007) and juiciness (DeVol et al., 1988;
Fernandez et al., 1999; Brewer et al., 2001; Wood et
al., 2004).
Intramuscular fat can be affected by both the number and size of intramuscular adipocytes. It is unknown
whether CLA feeding alters intramuscular adipocyte number or size. Increased mRNA expression of
adipocyte-specific genes PPARγ and adipocyte fatty
acid binding protein 4 (FABP4) were reported in the
1142
1143
Conjugated linoleic acid and pork intramuscular adipocytes
muscle of CLA-fed pigs (Meadus et al., 2002), suggesting increased adipocytes. This is also supported by cell
culture where cells isolated from porcine intramuscular
adipose tissue increased adipocyte gene expression and
lipid accumulation, whereas cells isolated from subcutaneous adipose tissue decreased lipid accumulation
and gene expression in response to trans-10,cis-12 CLA
(Zhou et al., 2007).
Our objective was to determine whether the increase
in marbling in CLA-fed pigs was attributable to changes in intramuscular adipocytes. We examined mRNA
expression of adipocyte-specific genes and histological
staining of adipocytes within the loin. We also determined the fatty acid profile of the loin, because some
specific fatty acids affect pork eating quality (Cameron
and Enser, 1991; Lonergan et al., 2007; Cannata et al.,
2010).
MATERIALS AND METHODS
All animal procedures were approved by the West
Virginia University Animal Care and Use Committee.
Experimental Design and Treatments
Twenty barrows (PIC 380 × Cambrough 23) were
blocked on BW and assigned to pens of 2 pigs per pen.
Pens were randomly assigned to receive finishing diets (Table 1) containing either 1% soybean oil (SBO)
or 1% CLA oil (LUTA-CLA, 60% CLA isomers, 50:50
cis-9,trans-11:trans-10,cis-12; provided by BASF, Offenbach/Quiech, Germany) for 6 wk. Diets were formulated to meet NRC (1998) requirements for growing
pigs of 80 to 120 kg. The diets were designed to be
marginal in protein and lysine at the initiation of the
study to stimulate fat deposition. The fatty acid profile
of the diets is available in Supplemental Table 1, available in the online version of this paper. Pigs, feed, and
feeders were weighed weekly to calculate ADG, ADFI,
and G:F. Two days after the final BW and feed intake
measurements, the pigs were humanely slaughtered at
Country Pride Meats (Friendsville, MD) and a HCW
was determined.
Carcass Measurements
Carcasses were chilled for 24 h postmortem before
measurements were taken. The right side of each carcass was ribbed between the 10th and 11th rib, and loin
eye area and 10th-rib backfat were measured. Subjective color and marbling scores (Pork Quality Standards,
National Pork Producers Council) were assigned. Percentage lean was calculated using the HCW, 10th-rib
backfat, and loin eye area as described (National Swine
Improvement Federation, 1997). One chop per pig was
frozen for percentage lipid analysis. For lipid analysis,
the chop was freeze dried, ground, and extracted with
ether. Percentage lipid was determined as the weight
difference in samples after ether extraction and drying
24 h in a 70°C oven.
Real-Time Reverse-Transcription PCR
Loin samples were obtained (from the ventral side of
the loin near the 10th rib) at slaughter, flash frozen in
liquid nitrogen, and stored at −80°C until analysis. The
relative abundance of preadipocyte factor 1 (Pref1;
also known as delta-like 1 homolog), PPARγ, perilipin
(PLIN), and FABP4 were determined as described previously (Barnes et al., 2009), with modifications. Total
RNA was extracted (80–120 mg of tissue) with TRIzol
Reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol. The RNA pellet was dissolved in
diethylpyrocarbonate-treated, nuclease-free, sterile water (Fisher Scientific, Fairlawn, NJ) and quantitated using a ND-1000 UV-Vis Spectrophotometer (NanoDrop
Technologies, Wilmington, DE). Total RNA (1 μg) was
heat denatured (80°C for 3 min, then chilled on ice)
and reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) following
the manufacturer’s instructions. Gene-specific primers
were designed to span a splice-junction and amplify
~100-bp segments (Table 2). The final real-time reactions contained 10 ng of reverse-transcribed RNA, 0.2
μM gene-specific forward and reverse primers, and 1×
iQ SYBR Green Supermix (Bio-Rad Laboratories). Reactions were performed in an iCylcer Thermal Cycler
(Bio-Rad Laboratories) with an initial stage of 95°C
for 4 min, followed by 40 cycles of 95°C for 15 s, 60°C
for 30 s, and 72°C for 30 s. A dissociation curve was
Table 1. Dietary formulation of finishing diet fed to
barrows
Item
Ingredient, % as fed
Corn
Soybean meal
Meat and bone meal
Oil1
Limestone
Salt
Lysine
Vitamin-mineral premix2
Calculated analysis
CP, %
Lysine, %
ME, kcal/kg
Available P, %
Calcium, %
Value
84.99
10.83
2.11
1.00
0.65
0.17
0.005
0.25
 
13.55
0.60
3,265.61
0.19
0.50
1
Soybean oil (SBO diet) or LUTA-CLA (CLA diet) supplied by
BASF (Offenbach/Quiech, Germany); 60% CLA isomers, 50:50 cis9,trans-11:trans-10,cis-12.
2
Supplied per kilogram of diet: manganese, 0.02%; zinc, 0.02%; iron,
0.01%; copper, 0.0025%; iodine, 0.0003%; selenium, 0.00003%; folic
acid, 0.69 mg; choline, 386 mg; riboflavin, 6.61 mg; biotin, 0.03 mg;
vitamin B6, 1.38 mg; niacin, 27.56 mg; pantothenic acid, 6.61 mg;
thiamine, 2.20 mg; menadione, 0.83 mg; vitamin B12, 0.01 mg; vitamin
E, 16.53 IU; vitamin D3, 2,133 ICU; vitamin A, 7,716 IU.
1144
Barnes et al.
1
Table 2. Details of primers used for real-time reverse-transcription PCR
Gene2
GenBank accession No.
Forward primer
Reverse primer
FABP4
Pref1
PPARγ
PLIN
ARP
NM_001002817
NM_001126101
NM_214379
NM_001038638
NM_001098598
aattgggccaggaatttgat
gggatggacacctctgtgac
cggggttccactatggagtt
cctccagccaaggaagagtc
caatgttgccagcgtatgtc
tctttccatcccacttctgc
ggggcaggagcactcatact
tggatccgacagttaagatcg
gttccaaccctgctcacg
cttttcagcaagtgggaagg
Product size, bp
108
110
109
95
133
1
Primer pairs designed with Primer3 software (http://frodo.wi.mit.edu/primer3/).
FABP4 = fatty acid binding protein 4, adipocyte; Pref1 = preadipocyte factor 1 (also known as delta-like 1 homolog, transcript variant 2);
PLIN = perilipin 1; ARP = acidic ribosomal phosphoprotein (ribosomal phosphoprotein large PO subunit).
2
run for each plate to confirm the production of a single
product, and an example reaction was run on an agarose gel to confirm the correct size of the product. The
amplification efficiency for each gene was determined
using the DART program (Peirson et al., 2003). The
mRNA relative abundance was calculated according to
Pfaffl (2001), accounting for gene-specific efficiencies,
normalized to acidic ribosomal phosphoprotein, and set
relative to the mean of the SBO-fed pigs.
Histology
Histological staining of intramuscular adipocytes
with Oil Red O (Sigma-Aldrich, St. Louis, MO) was
performed as described (Dubowitz and Sewry, 2007).
Loin samples were obtained from a single chop per
pig, taken at the 10th- and 11th-rib interface. Three
samples per chop (similar locations for each pig) were
collected, attached to cork with OCT Compound (Ted
Pella Inc., Redding, CA), frozen in the liquid phase of
isopentane (2-methylbutane, ACROS Chemicals, Fisher Scientific) previously cooled in liquid nitrogen, and
stored at −80°C until analysis. Ten-micron cryosections
were obtained using a Leica CM 1850 cryostat (Leica
Microsystems Inc., Buffalo Grove, IL) and collected
onto Superfrost Plus Gold slides (Fisher Scientific).
One cryosection per sample was fixed and stained with
Oil Red O (Sigma-Aldrich) as described previously
(Poulos et al., 2001). Samples were visualized using a
Nikon Eclipse TE2000-S inverted microscope (Nikon,
Tokyo, Japan). Pictures of 3 fields per section were
taken with a Q Imaging Retiga 2000R camera using Q
capture 2.90.1 software (Quantitative Imaging Corporation, Surrey, British Columbia, Canada). Adipocyte
area was determined using Northern Eclipse software
(Empix Imaging Inc., Cheektowaga, NY). Data are expressed as follows: adipocyte, number per centimeter
squared; total adipocyte area, micrometers squared per
centimeter squared; and average adipocyte area, micrometers squared per cell.
Fatty Acid Analysis
Total fatty acids from the diets, loin (sample taken
at the 10th- and 11th-rib interface), backfat (sample
taken from the second layer of subcutaneous fat at the
10th- and 11th-rib interface), and belly fat (sample
taken from the middle of the ventral side of the belly)
were methylated and extracted (Park and Goins, 1994).
Fatty acid methyl esters were analyzed by gas chromatography as previously reported (Ramsay et al., 2001).
Statistical Analysis
The pen was the experimental unit for all analyses
(n = 5/diet). Means and SEM were determined using
the PROC MEANS command of SAS (SAS Inst. Inc.,
Cary, NC). To account for the small sample size, data
were analyzed using the nonparametric Wilcoxon rank
sum of SAS testing the effect of diet. For the histology
samples, the main effect of sample location within the
loin and the interaction of location with diet were tested with ANOVA (PROC MIXED of SAS) and found to
be nonsignificant; therefore, the 3 locations were averaged and analyzed in the same manner as the rest of
the data. Differences were considered significant if P <
0.05 and a trend if 0.05 < P < 0.10.
RESULTS AND DISCUSSION
The CLA-fed pigs did not differ from SBO-fed controls in final BW (P = 0.500; Table 3), ADG (P =
0.417), or ADFI (P = 0.500) but did have slightly reduced G:F (P = 0.047). This is in contrast to previous
reports of no difference (Ramsay et al., 2001; White
et al., 2009) or improvements (Ostrowska et al., 1999;
Thiel-Cooper et al., 2001; Wiegand et al., 2001, 2002;
Weber et al., 2006) in G:F with CLA feeding. The reduction in G:F in our study is quite small (0.01) and
may relate to the length of CLA feeding because our
pigs were fed the experimental diets for only 6 wk and
Weber et al. (2006) observed an increase in G:F only
in the second half of their 8-wk feeding period. Hot
carcass weight also did not differ (P = 0.417; Table 4)
between CLA- and SBO-fed pigs, which was expected
given the lack of a difference in final BW or rate of BW
gain.
Similar to previous reports (Dugan et al., 1997; Ostrowska et al., 1999; Thiel-Cooper et al., 2001; Wiegand et al., 2001, 2002; Weber et al., 2006), our CLAfed pigs had reduced (P = 0.047) backfat. Many factors
can affect the ability of dietary CLA to cause a reduction in backfat, including added fat in the diet (added
fat tends to reduce the CLA effect), backfat depth of
1145
Conjugated linoleic acid and pork intramuscular adipocytes
1
Table 3. Effect of dietary CLA on growth parameters of barrows
Diet2
Item
Initial BW, kg
Final BW, kg
ADG, kg/d
ADFI, kg/d
G:F
SBO
51.34
101.54
1.26
3.44
0.36
±
±
±
±
±
CLA
2.04
3.77
0.06
0.14
0.01
53.97
102.95
1.22
3.51
0.35
±
±
±
±
±
P-value
0.85
2.00
0.03
0.17
0.01
0.146
0.500
0.417
0.500
0.047
1
Mean ± SEM.
SBO = 1% soybean oil; CLA = 1% LUTA-CLA to provide 0.6% CLA isomers, 50:50 cis-9,trans-11:trans10,cis-12 (n = 5 pens/diet).
2
the pigs not fed CLA (pigs with >23 mm subcutaneous fat thickness tend to respond better than those
with <20 mm), and gender (barrows tend to be fatter
than gilts and therefore more responsive; Azain, 2003).
Given these factors, it is not surprising that we did
detect a reduction in backfat because our diets had no
added fat beyond the CLA or SBO, the control pigs
had 30-mm backfat (which we stimulated by feeding
a diet marginal in protein and lysine initially), and we
used barrows. Additionally, many pork quality traits,
including intramuscular fat and fatty acid composition,
are affected by the breed of the pigs (Wood et al., 2004)
and it is likely that the breed (or genetic line) would
affect the response to dietary CLA, although this has
not been tested directly.
Our CLA-fed pigs also had smaller (P = 0.047)
loin eye areas than SBO-fed pigs (Table 4). Although
this was not expected, there has been one other report (Thiel-Cooper et al., 2001) of reduced loin eye
area with pigs fed 1% CLA isomers (a slightly larger
dose than our diets that contained ~0.6% CLA isomers). Conversely, others have reported increased loin
eye area (Wiegand et al., 2002; Weber et al., 2006) or
dissected lean tissue (Dugan et al., 1997, 1999) in pigs
fed CLA. Still others have reported no change in muscling (Ramsay et al., 2001; Wiegand et al., 2001; Gatlin
et al., 2002; White et al., 2009). In the current study,
the decreases in backfat and loin eye area were offset
when we calculated an estimated percentage lean of the
carcass, resulting in no differences (P = 0.265) between
CLA- and SBO-fed pigs (Table 4). Previously, no difference (Gatlin et al., 2002) and increased (Wiegand et
al., 2002; Weber et al., 2006) calculated percentage lean
were reported in CLA-fed pigs. The smaller loin eye
areas in the CLA-fed pigs, and consequently the lack
of a difference in percentage lean, may be an artifact of
having a small sample size.
Pork quality measurements of subjective color and
marbling were made on the loins. We detected no difference (P = 0.500) in loin color but a trend toward
increased (P = 0.069) marbling in the CLA-fed pigs
(Table 4). The increase in marbling was confirmed by
measuring the percentage lipid of a single loin chop
per pig, which also tended (P = 0.072) to be increased
in the CLA-fed pigs. The increases observed in our
current study, 28% in marbling score and 35% in percentage lipid, are similar in magnitude to significant
increases (6–37%) published previously (Dugan et al.,
1999; Wiegand et al., 2001, 2002; Gatlin et al., 2002).
Nonsignificant increases (2.5–32%) have also been reported (Dugan et al., 1997; Thiel-Cooper et al., 2001;
White et al., 2009), as well as no change in marbling
score (Weber et al., 2006). We felt that the increases in
marbling score and intramuscular lipid percentage were
sufficient to allow us to proceed with the intramuscular
adipocyte analysis.
Table 4. Effect of dietary CLA on carcass measurements of barrows1
Diet2
Item
HCW, kg
10th-rib backfat, mm
10th-rib loin eye area, cm2
Estimated carcass lean,3 %
Color4
Marbling4
Loin lipid,5 %
1
SBO
80.86
30.23
36.29
47.78
2.68
2.43
2.81
±
±
±
±
±
±
±
2.782
1.47
0.76
0.82
0.09
0.21
0.48
CLA
82.09
25.40
34.16
48.66
2.70
3.10
3.79
±
±
±
±
±
±
±
1.80
1.06
0.56
0.51
0.22
0.39
0.42
P-value
0.417
0.018
0.047
0.265
0.500
0.069
0.072
Mean ± SEM.
SBO = 1% soybean oil; CLA = 1% LUTA-CLA (BASF, Olfenbach/Quiech, Germany) to provide 0.6% CLA
isomers, 50:50 cis-9,trans-11:trans-10,cis-12 (n = 5 pens/diet).
3
Calculated from HCW, loin eye area, and backfat measurements.
4
Pork Quality Standards; color: 1 to 6; marbling: 1 to 10.
5
Analyzed by ether extraction of 1 chop/pig.
2
1146
Barnes et al.
high- and low-intramuscular fat pigs (Gandolfi et al.,
2011). The PLIN protein expression, as measured by
immunofluorescence, was associated exclusively with
the intramuscular adipocytes and was increased in the
high intramuscular fat (average 4.52%) pigs as compared with the low intramuscular fat (average 1.53%)
pigs, whereas PLIN mRNA expression in the semi-
Figure 1. Effect of dietary CLA on adipocyte-specific gene expression in loin muscle. Barrows (n = 5 pens/diet) were fed finishing diets
containing either 1% soybean oil (SBO) or CLA oil (contained 60%
CLA isomers, 50:50 cis-9,trans-11:trans-10,cis-12; provided by BASF,
Offenbach/Quiech, Germany) for 6 wk. Relative mRNA expression of
genes specific for preadipocytes [preadipocyte factor 1 (Pref1)], differentiating adipocytes (PPARγ), or mature adipocytes [fatty acid
binding protein 4 (FABP4) and perilipin (PLIN)] were analyzed by
real-time reverse-transcription PCR, normalized to acidic ribosomal
phosphoprotein expression, and compared with the average of the
SBO-fed pigs. Error bars represent the SEM.
We first used an indirect measure of intramuscular
adipocytes by measuring the relative abundance of
mRNA known to be specific for preadipocytes (Pref1),
differentiating (PPARγ), and mature (FABP4 and
PLIN) adipocytes in loin muscle samples. We detected
no significant differences in the relative expression of
any of the genes between CLA- and SBO-fed pigs (Figure 1). The PPARγ, FABP4, and PLIN mRNA, all expressed in adipocytes, were numerically increased but
not significantly different (P = 0.365, 0.148, and 0.265,
respectively) in the CLA-fed pigs. This may indicate
that the increase in percentage lipid in the loin muscle is
associated with increased intramuscular adipose tissue,
as has been reported for pigs that naturally differed in
intramuscular fat content (Gandolfi et al., 2011). Meadus et al. (2002) have also reported increased PPARγ
and FABP4 mRNA expression in the muscle of barrows
fed CLA. Stromal vascular cells isolated from pork loin
intramuscular adipose tissue and differentiated in vitro
have responded to supplemental CLA in culture with
increased mRNA expression of PPARγ and FABP4 as
well (Zhou et al., 2007). Our results are consistent with
these other reports even though they did not reach a
statistically significant P-value, likely a result of our
small sample size. Expression of FABP4 has been previously associated with intramuscular fat because pigs
classified as having high intramuscular fat (average
2.82%) had numerically increased FABP4 mRNA and
significantly more FABP4 protein than pigs classified
as having low intramuscular fat (average 1.15%; Damon
et al., 2006). The FABP4 protein expression was also
positively correlated with intramuscular fat percentage
and intramuscular adipocyte number (Damon et al.,
2006). A similar greater effect on protein expression
than mRNA expression was observed with PLIN in
Figure 2. Effect of dietary CLA on histological analysis of intramuscular adipocyte number and size in loin muscle. Barrows (n = 5
pens/diet) were fed finishing diets containing either 1% soybean oil
(SBO) or CLA oil (contained 60% CLA isomers, 50:50 cis-9,trans11:trans-10,cis-12; provided by BASF, Offenbach/Quiech, Germany)
for 6 wk. Samples were stained with Oil Red O (Sigma-Aldrich, St.
Louis, MO) to identify adipocytes in 3 fields/section, 3 sections/pig,
and 2 pigs/pen, and pen averages were calculated. A) Adipocytes were
counted and expressed per centimeters squared. B) Total adipocyte
area was determined and expressed as micrometers squared per centimeters squared. C) Total adipocyte area was divided by the number of
adipocytes to calculate the average adipocyte area and was expressed
as micrometers squared per cell. Error bars represent the SEM.
1147
Conjugated linoleic acid and pork intramuscular adipocytes
1
Table 5. Effect of dietary CLA on loin fatty acid profile of barrows
Diet3
2
Fatty acid, mg/100
mg of fatty acids
SBO
14:0
16:0
16:1
18:0
18:1
18:2
cis-9,trans-11 CLA
trans-10,cis-12 CLA
18:3n-6
18:3n-3
20:0
20:1
20:2
20:3
20:4
22:4
22:5
22:6
SFA
MUFA
PUFA
1.25 ± 0.04
25.30 ± 0.51
3.21 ± 0.24
12.23 ± 0.29
45.64 ± 0.93
7.25 ± 0.55
0.65 ± 0.37
ND4
0.29 ± 0.12
0.57 ± 0.21
0.47 ± 0.12
0.99 ± 0.05
0.43 ± 0.04
0.18 ± 0.02
1.22 ± 0.13
0.20 ± 0.02
0.12 ± 0.01
0.005 ± 0.01
39.25 ± 0.60
49.84 ± 1.02
10.92 ± 1.40
CLA
1.66
28.68
4.63
13.29
39.86
5.88
0.95
0.45
0.43
0.63
0.78
1.05
0.38
0.16
0.90
0.16
0.09
0.03
44.40
45.54
10.06
±
±
±
±
±
±
±
±
±
±
±
±
±
±
±
±
±
±
±
±
±
0.06
0.44
0.19
0.06
0.32
0.16
0.05
0.05
0.04
0.14
0.08
0.09
0.07
0.03
0.11
0.02
0.01
0.03
0.48
0.18
0.44
P-value
0.006
0.006
0.006
0.006
0.006
0.018
0.072
0.004
0.072
0.105
0.047
0.500
0.072
0.105
0.072
0.047
0.105
0.500
0.006
0.006
0.500
1
Mean ± SEM.
SFA = sum of all SFA identified; MUFA = sum of all MUFA identified; PUFA = sum of all PUFA identified.
3
SBO = 1% soybean oil; CLA = 1% LUTA-CLA (BASF, Olfenbach/Quiech, Germany) to provide 0.6% CLA
isomers, 50:50 cis-9,trans-11:trans-10,cis-12 (n = 5 pens/diet).
4
ND = not detected.
2
membranosus muscle did not significantly differ between groups. It is possible that we may have detected
a greater difference between CLA- and SBO-fed pigs
had we measured the protein expression of these genes
rather than the mRNA expression. We do not know
whether the trend for changes in gene expression in the
CLA-fed pigs is a direct effect of CLA or a secondary
effect in response to the increased intramuscular adipose tissue. This area needs future research. It is also
unclear from these data whether the small increase in
gene expression is related to increased intramuscular
adipocyte number, size, or both.
We conducted histological analysis of the loin muscle
and stained for lipid with Oil Red O to identify the intramuscular adipocytes. We detected no significant difference in adipocyte number per area (P = 0.202; Figure 2A) or in total adipocyte area (P = 0.202; Figure
2B) between CLA- and SBO-fed pigs. However, total
adipocyte area was numerically (21%) increased. We
did detect a significant (P = 0.030) increase in average adipocyte area (Figure 2C). Our data indicate that
the increase in intramuscular fat in the CLA-fed pigs
appears to be associated with a greater increase in intramuscular adipocyte size than number. To our knowledge, this is the first report of intramuscular adipocyte
number or size in CLA-fed pigs. However, our results
are not consistent with in vitro data where CLA supplementation increased adipocyte differentiation (Ding
et al., 2000; Zhou et al., 2007), which would increase
the number of adipocytes, or with a previous report
comparing pigs with high and low intramuscular fat
that observed an increase in adipocyte number but no
change in the diameter of the intramuscular adipocytes
(Damon et al., 2006). In contrast, in cattle intramuscular adipose tissue was reported to increase via both
hypertrophy and hyperplasia (Cianzio et al., 1985). It
is possible that our small sample size limited our ability
to detect differences in intramuscular adipocyte number (which were numerically increased, 6 to 7%) in the
current study.
The fatty acid composition of pork also has been correlated with its eating quality (Cameron and Enser,
1991; Wood et al., 2004; Lonergan et al., 2007; Cannata et al., 2010). Tissue concentrations of SFA and
MUFA are positively correlated with pork quality,
whereas PUFA are negatively correlated with quality
traits such as tenderness (Cameron and Enser, 1991;
Lonergan et al., 2007; Cannata et al., 2010). Specifically, palmitic acid (16:0) has been positively (Lonergan
et al., 2007) and linoleic (18:2) and arachidonic (20:4)
acids negatively (Cannata et al., 2010) correlated with
juiciness. In our study, the CLA-fed pigs had a greater
(P = 0.006) percentage of SFA with a corresponding
decrease (P = 0.006) in MUFA and no significant differences in PUFA (P = 0.500) in the loin (Table 5).
Specifically, myristic acid (14:0), palmitic acid, palmitoleic acid (16:1), stearic acid (18:0), trans-10,cis-12
CLA, and arachidic acid (20:0) were increased (P <
0.05), whereas oleic acid (18:1), linoleic acid, and adrenic acid (22:4) were decreased (P < 0.05) in CLA-fed
1148
Barnes et al.
pigs. Cis-9,trans-11 CLA and γ-linolenic acid (18:3 n-6)
tended to be increased (P = 0.072) and eicosadienoic
acid (20:2) and arachidonic acid (P = 0.072) tended to
be decreased in the loins of CLA-fed pigs. The increase
in SFA with CLA feeding was reported previously (Eggert et al., 2001; Gatlin et al., 2002; Wiegand et al.,
2002; Weber et al., 2006) and appears to be due to
inhibition of stearoyl-CoA desaturase by CLA (Park et
al., 2000; Smith et al., 2002). These changes in the fatty
acid profile of the loin have the potential to increase the
eating quality of the pork from CLA-fed pigs.
We also determined the fatty acid profile of 2 adipose
depots, backfat and belly fat, for comparison (Supplemental Tables 2 and 3, available in the online version
of this paper). We observed a greater accumulation of
CLA in the adipose tissue depots (P = 0.006; Supplemental Tables 2 and 3) as well as a greater increase (P
= 0.006) in SFA, with a subsequent decrease in MUFA
(P = 0.006) and a tendency toward a decrease in PUFA
(P = 0.072) in the backfat (Supplemental Table 1). In
the belly fat, there was a greater (P = 0.030) percentage of SFA, a trend for less (P = 0.072) MUFA, and a
decrease (P = 0.018) in PUFA in CLA-fed pigs (Supplemental Table 3). The greater effect of dietary CLA
on adipose tissue fatty acid profile than on muscle was
observed previously (Eggert et al., 2001; Ramsay et al.,
2001; Wiegand et al., 2002).
In all of the tissues, we detected cis-9,trans-11 CLA
in the SBO-fed pigs (Table 5; Supplemental Tables 2
and 3). This corresponds to a small amount of cis9,trans-11 CLA found in the SBO diet (Supplemental
Table 1). We expect that the CLA was in the meat
and bone meal, or possibly there were small amounts
in the SBO. Only the cis-9,trans-11 isomer was found
in the SBO diet and loin samples. Work in rodents has
clearly demonstrated that the trans-10,cis-12 isomer is
responsible for the changes in body fat (Park et al.,
1999; Hargrave et al., 2002), whereas the cis-9,trans-11
isomer has no effect. We are unable to differentiate the
isomer-specific effects in this study; however, it is likely
that the effects we observed of CLA feeding on backfat
depth, marbling, and intramuscular adipocytes are attributable to the addition of the trans-10,cis-12 isomer.
In summary, dietary CLA decreased backfat and
tended to increase marbling in our pigs. The increase in
marbling appears to be associated with increased intramuscular adipose tissue, and the increase seems to be
attributable to a larger increase in intramuscular adipocyte size than number. The combination of increased
marbling and a more saturated fatty acid profile may
increase the eating quality of CLA-fed pork.
LITERATURE CITED
Azain, M. J. 2003. Conjugated linoleic acid and its effects on animal
products and health in single-stomached animals. Proc. Nutr.
Soc. 62:319–328.
Azain, M. J., D. B. Hausman, M. B. Sisk, W. P. Flatt, and D.
E. Jewell. 2000. Dietary conjugated linoleic acid reduces rat
adipose tissue cell size rather than cell number. J. Nutr.
130:1548–1554.
Barnes, K. M., J. K. Evenson, A. M. Raines, and R. A. Sunde. 2009.
Transcript analysis of the selenoproteome indicates that dietary
selenium requirements of rats based on selenium-regulated selenoprotein mRNA levels are uniformly less than those based on
glutathione peroxidase activity. J. Nutr. 139:199–206.
Brewer, M. S., L. G. Zhu, and F. K. McKeith. 2001. Marbling effects on quality characteristics of pork loin chops: Consumer
purchase intent, visual and sensory characteristics. Meat Sci.
59:153–163.
Cameron, N. D., and M. B. Enser. 1991. Fatty acid composition of
lipid in longissimus dorsi muscle of Duroc and British landrace pigs and its relationship with eating quality. Meat Sci.
29:295–307.
Cannata, S., T. E. Engle, S. J. Moeller, H. N. Zerby, A. E. Radunz,
M. D. Green, P. D. Bass, and K. E. Belk. 2010. Effect of visual
marbling on sensory properties and quality traits of pork loin.
Meat Sci. 85:428–434.
Cianzio, D. S., D. G. Topel, G. B. Whitehurst, D. C. Beitz, and H.
L. Self. 1985. Adipose tissue growth and cellularity: Changes in
bovine adipocyte size and number. J. Anim. Sci. 60:970–976.
Damon, M., I. Louveau, L. Lefaucheur, B. Lebret, A. Vincent, P. Leroy, M. P. Sanchez, P. Herpin, and F. Gondret. 2006. Number of
intramuscular adipocytes and fatty acid binding protein-4 content are significant indicators of intramuscular fat level in crossbred large white × Duroc pigs. J. Anim. Sci. 84:1083–1092.
DeVol, D. L., F. K. McKeith, P. J. Bechtel, J. Novakofski, R. D.
Shanks, and T. R. Carr. 1988. Variation in composition and
palatability traits and relationships between muscle characteristics and palatability in a random sample of pork carcasses. J.
Anim. Sci. 66:385–395.
Ding, S.-T., R. L. McNeel, and H. J. Mersmann. 2000. Conjugated
linoleic acid increases the differentiation of porcine adipocytes
in vitro. Nutr. Res. 20:1569–1580.
Dubowitz, V., and C. A. Sewry. 2007. Muscle Biopsy, A Practical
Approach. 3rd ed. Saunders Elsevier, Philadelphia, PA.
Dugan, M. E. R., J. L. Aalhus, L. E. Jeremiah, J. K. G. Kramer, and
A. L. Schaefer. 1999. The effects of feeding conjugated linoleic
acid on subsequent pork quality. Can. J. Anim. Sci. 79:45–51.
Dugan, M. E. R., J. L. Aalhus, A. L. Schaefer, and J. K. G. Kramer. 1997. The effect of conjugated linoleic acid on fat to lean
repartitioning and feed conversion in pigs. Can. J. Anim. Sci.
77:723–725.
Eggert, J. M., M. A. Belury, A. Kempa-Steczko, S. E. Mills, and A.
P. Schinckel. 2001. Effects of conjugated linoleic acid on the
belly firmness and fatty acid composition of genetically lean
pigs. J. Anim. Sci. 79:2866–2872.
Fernandez, X., G. Monin, A. Talmant, J. Mourot, and B. Lebret.
1999. Influence of intramuscular fat content on the quality of
pig meat—1. Composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. Meat Sci. 53:59–65.
Gandolfi, G., M. Mazzoni, P. Zambonelli, G. Lalatta-Costerbosa, A.
Tronca, V. Russo, and R. Davoli. 2011. Perilipin 1 and perilipin 2 protein localization and gene expression study in skeletal
muscles of European cross-breed pigs with different intramuscular fat contents. Meat Sci. 88:631–637.
Gatlin, L. A., M. T. See, D. K. Larick, X. Lin, and J. Odle. 2002.
Conjugated linoleic acid in combination with supplemental dietary fat alters pork fat quality. J. Nutr. 132:3105–3112.
Hargrave, K. M., C. Li, B. J. Meyer, S. D. Kachman, D. L. Hartzell,
M. A. Della-Fera, J. L. Miner, and C. A. Baile. 2002. Adipose
depletion and apoptosis induced by trans-10, cis-12 conjugated
linoleic acid in mice. Obes. Res. 10:1284–1290.
Lonergan, S. M., K. J. Stalder, E. Huff-Lonergan, T. J. Knight, R.
N. Goodwin, K. J. Prusa, and D. C. Beitz. 2007. Influence of
lipid content on pork sensory quality within pH classification.
J. Anim. Sci. 85:1074–1079.
Meadus, W. J., R. MacInnis, and M. E. R. Dugan. 2002. Prolonged
dietary treatment with conjugated linoleic acid stimulates porcine muscle peroxisome proliferator activated receptor γ and
Conjugated linoleic acid and pork intramuscular adipocytes
glutamine-fructose aminotrasferase gene expression in vivo. J.
Mol. Endocrinol. 28:79–86.
National Swine Improvement Federation. 1997. Guidelines for uniform swine improvement programs. Accessed Jul. 10, 2011.
http://www.nsif.com.
NRC. 1998. Nutrient Requirements of Swine. 10th rev. ed. ed. Natl.
Acad. Press, Washington, DC.
Ostrowska, E., M. Muralitharan, R. F. Cross, D. E. Bauman, and
F. R. Dunshea. 1999. Dietary conjugated linoleic acids increase
lean tissue and decrease fat deposition in growing pigs. J. Nutr.
129:2037–2042.
Park, P. W., and R. E. Goins. 1994. In situ preparation of fatty acid
methyl esters for analysis of fatty acid composition in foods. J.
Food Sci. 59:1262–1266.
Park, Y., K. J. Albright, W. Liu, J. M. Storkson, M. E. Cook, and
M. W. Pariza. 1997. Effect of conjugated linoleic acid on body
composition in mice. Lipids 32:853–858.
Park, Y., J. M. Storkson, K. J. Albright, W. Liu, and M. W. Pariza.
1999. Evidence that the trans-10, cis-12 isomer of conjugated
linoleic acid induces body composition changes in mice. Lipids
34:235–241.
Park, Y., J. M. Storkson, J. M. Ntambi, M. E. Cook, C. J. Sih, and
M. W. Pariza. 2000. Inhibition of hepatic stearoyl-coA desaturase activity by trans-10,cis-12 conjugated linoleic acid and its
derivatives. Biochim. Biophys. Acta 1486:285–292.
Peirson, S. N., J. N. Butler, and R. G. Foster. 2003. Experimental
validation of novel and conventional approaches to quantitative
real-time PCR data analysis. Nucleic Acids Res. 31:e7371–
e7377.
Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:2002–2007.
Poulos, S. P., M. Sisk, D. B. Hausman, M. J. Azain, and G. J.
Hausman. 2001. Pre- and postnatal dietary conjugated linoleic
acid alters adipose development, body weight gain and body
composition in Sprague-Dawley rats. J. Nutr. 131:2722–2731.
Ramsay, T. G., C. M. Evock-Clover, N. C. Steele, and M. J. Azain.
2001. Dietary conjugated linoleic acid alters fatty acid composition of pig skeletal muscle and fat. J. Anim. Sci. 79:2152–2161.
Risérus, U., L. Berglund, and B. Vessby. 2001. Conjugated linoleic
acid (CLA) reduced abdominal adipose tissue in obese middle-
1149
aged men with signs of the metabolic syndrome: A randomised
controlled trial. Int. J. Obes. Relat. Metab. Disord. 25:1129–
1135.
Smith, S. B., T. S. Hively, G. M. Cortese, J. J. Han, K. Y. Chung, P.
Castenada, C. D. Gilbert, V. L. Adams, and H. J. Mersmann.
2002. Conjugated linoleic acid depresses the δ-9 desaturase index and stearoyl coenzyme A desaturase enzyme activity in porcine subcutaneous adipose tissue. J. Anim. Sci. 80:2110–2115.
Thiel-Cooper, R. L., F. C. Parrish Jr., J. C. Sparks, B. R. Wiegand,
and R. C. Ewan. 2001. Conjugated linoleic acid changes swine
performance and carcass composition. J. Anim. Sci. 79:1821–
1828.
Weber, T. E., B. T. Richert, M. A. Belury, Y. Gu, K. Enright, and
A. P. Schinckel. 2006. Evaluation of the effects of dietary fat,
conjugated linoleic acid, and ractopamine on growth performance, pork quality, and fatty acid profiles in genetically lean
gilts. J. Anim. Sci. 84:720–732.
White, H. M., B. T. Richert, J. S. Radcliffe, A. P. Schinckel, J. R.
Burgess, S. L. Koser, S. S. Donkin, and M. A. Latour. 2009.
Feeding conjugated linoleic acid partially recovers carcass quality in pigs fed dried corn distillers grains with solubles. J.
Anim. Sci. 87:157–166.
Wiegand, B. R., F. C. Parrish Jr., J. E. Swan, S. T. Larsen, and
T. J. Baas. 2001. Conjugated linoleic acid improves feed efficiency, decreases subcutaneous fat, and improves certain aspects of meat quality in stress-genotype pigs. J. Anim. Sci.
79:2187–2195.
Wiegand, B. R., J. C. Sparks, F. C. Parrish Jr., and D. R. Zimmerman. 2002. Duration of feeding conjugated linoleic acid influences growth performance, carcass traits, and meat quality of
finishing barrows. J. Anim. Sci. 80:637–643.
Wood, J. D., G. R. Nute, R. I. Richardson, F. M. Whittington, O.
Southwood, G. Plastow, R. Mansbridge, N. daCosta, and K. C.
Chang. 2004. Effects of breed, diet and muscle on fat deposition
and eating quality in pigs. Meat Sci. 67:651–667.
Zhou, X., D. Li, J. Yin, J. Ni, B. Dong, J. Zhang, and M. Du. 2007.
CLA differently regulates adipogenesis in stromal vascular cells
from porcine subcutaneous adipose and skeletal muscle. J.
Lipid Res. 48:1701–1709.