CO-ORDINATED EXPRESSION OF CRTB, At-VTE3, AND VTE4 TO ENHANCE
PRO-VITAMIN A AND VITAMIN E IN TRANSGENIC SOYBEAN
_______________________________________
A Thesis
presented to the Faculty of the Graduate School
at the University of Missouri-Columbia
_______________________________________________________
In Partial Fulfillment
of the Requirements for the Degree
Master of Science
_____________________________________________________
By
DUNG THU PHAM
Dr. Zhanyuan J. Zhang, Thesis Supervisor
JULY 2013
The undersigned, appointed by the dean of the Graduate School,
have examined the Thesis entitled
CO-ORDINATED EXPRESSION OF CRTB, At-VTE3, AND VTE4 TO ENHANCE
PRO-VITAMIN A AND VITAMIN E IN TRANSGENIC SOYBEAN
Presented by Dung Thu Pham
A candidate for the degree of
MASTER OF SCIENCE
And hereby certify that, in their opinion, it is worthy of acceptance.
Dr. Zhanyuan J. Zhang
Dr. Kristin D. Bilyeu
Dr. Henry T. Nguyen
ACKNOWLEDGEMENTS
I would like to address my special thanks to my supervisor Dr. Zhanyuan Jon Zhang for
his guidance and encouragement during the entire course of this research. I would like to
thank Dr. Kristin Bilyeu and Dr. Henry Nguyen for their collaboration, distribution, and
contribution. Also, I would like to thank all current and past members in Dr. Zhang
Zhanyuan J. Zhang’s lab for their direct and indirect assistance during my studies:
Xiaoyan Yin, Yinxia He, Wan Neng for helping me design construct, soybean tissue
culture, and take care transformed plants in green house, SoYon Park, Ulku Baykal,
Hyeyong Lee, Phat Do, Sha Lu, and Michelle Folta who shared their knowledge, lab
techniques to help me during my research. My special thanks also are for Christine Cole
(Dr. Kristin’s lab) for helping me with tocopherol and fatty acid analysis, Tristan Lipkie
(Purdue University) for carotenoid analysis. I am grateful to my parents and my brother
for their love, understanding and encouragement. At last, many thanks to all friends that I
was fortunate to meet in Columbia MO for help and friendship.
ii
TABLE OF CONTENTS
ACKNOWLEDGEMENTS ................................................................................................ ii
LIST OF FIGURES ........................................................................................................... iv
LIST OF TABLES ...............................................................................................................v
ABSTRACT ....................................................................................................................... vi
CHAPTER I: INTRODUCTION AND LITERATURE REVIEW .....................................1
Values of soybeans ......................................................................................................... 1
Soy products ................................................................................................................... 3
Vitamin A ....................................................................................................................... 4
Vitamin E ....................................................................................................................... 7
Previous approaches of enhancing pro-vitamin A in plants ........................................ 12
Previous approaches of enhancing vitamin E in plants ................................................ 14
Soybean oil ................................................................................................................... 16
Strategies to express multiple genes in plants .............................................................. 17
Literature cited ............................................................................................................. 27
CHAPTER 2: CO-ORDINATED EXPRESSION OF CRTB, At-VTE3, and VTE4 TO
ENHANCE PRO-VITAMIN A AND VITAMIN E VIA FMDV 2A SEQUENCE IN
SOYBEAN SEEDS ...........................................................................................................35
Introduction .................................................................................................................. 35
Materials and methods ................................................................................................. 38
Results .......................................................................................................................... 44
Discussion .................................................................................................................... 49
Figure legend ............................................................................................................... 54
Literature cited ............................................................................................................. 79
iii
LIST OF FIGURES
CHAPTER 1
Figure legend .................................................................................................................... 22
Figure 1.1A ....................................................................................................................... 24
Figure 1.1B ....................................................................................................................... 25
Figure 1.1C ....................................................................................................................... 26
CHAPTER2
Figure legend .................................................................................................................... 54
Figure 2.1A ....................................................................................................................... 58
Figure 2.1B ....................................................................................................................... 59
Figure 2.1C ....................................................................................................................... 60
Figure 2.1D ....................................................................................................................... 61
Figure 2.1E ........................................................................................................................ 62
Figure 2.2A ....................................................................................................................... 63
Figure 2.2B ....................................................................................................................... 64
Figure 2.2C ....................................................................................................................... 65
Figure 2.3A ....................................................................................................................... 66
Figure 2.3B ....................................................................................................................... 67
Figure 2.4A ....................................................................................................................... 68
Figure 2.4B ....................................................................................................................... 69
Figure 2.4C ....................................................................................................................... 70
Figure 2.5 .......................................................................................................................... 71
iv
LIST OF TABLES
Table 2.1A: Primers for PCR. ........................................................................................... 72
Table 2.1B: Primers for qRT-PCR.................................................................................... 73
Table 2.2A: Soybean yield and segregation of T1 seeds of four regenerated plants ........ 74
Table 2.2B: Transgenic integration and inheritance in T1 plants. .................................... 75
Table 2.3A: Total content and compositions of carotenoids of transgenic soybean seeds
of HYX-7-1 (golden seeds), empty vector pZY101transgenic and wild type Maverick
plants. ................................................................................................................................ 76
Table 2.3B: Tocopherol analysis of mature seeds of HYX-7-1 (golden seed, HYX-7-1G),
empty vector pZY101 and wild type Maverick plants...................................................... 77
Table 2.4: Fatty acid analysis of mature seeds of HYX-7-1 (golden seeds), empty vector
pZY101 and wild type Maverick plants............................................................................ 78
v
ABSTRACT
Although soybean is an excellent general nutritional source, it is not very rich in
particular vitamins. The main goal of this study is to enhance both pro-vitamin A
(carotenoids) and vitamin E (tocopherols) content in soybean seeds. We have genetically
engineered the carotenoid and the tocopherol biosynthetic pathways in soybean seeds by
ectopically expressing three genes: Erwinia uredovora phytoene synthase (crtB) to
increase carotenoid content, Arabidopsis 2-methyl-6-phytylbenzoquinol methyl
transferase (At-VTE3) and soybean γ-tocopherol methyl transpherase (VTE4) to increase
α-tocopherol using the self-cleavage activity of FMDV 2A sequence to join two adjacent
proteins. This 2A-polyprotein construct was introduced to soybean via Agrobacteriummediated cotyledonary node transformation method. One inheritable transgenic event
displayed “golden”- colored seeds. The presence and expression of the three genes were
detected in golden soybean event HYX-7-1 by qRT-PCR analyses. HPLC analysis of
individual golden soybean lines revealed that the seeds accumulated as high as 128µg/g
of total carotenoids, approximately 25- fold higher than wild type and 45-fold higher than
empty vector control seeds. Of total carotenoids, 98% was pro-vitamin A (β-carotene and
β-carotene equivalents). By contrast, golden seeds showed a decrease of tochopherol and
a significant change of fatty acid profile. Transgenic golden soybean lines also displayed
a delay in germination with a decreased rate (50%) and dwarf phenotype at early
developmental stage, but showed normal development later.
vi
CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW
Soybean [Glycine max (L). Merrill] is one of the most important crops worldwide with
high quality and inexpensive protein and oil (Hartman et al., 2011). Whether for oil,
protein or other functional components, soybeans play a necessary role in human diet.
Although China is the country that originally domesticated soybean, China has steadily
decreased in soybean production and ranked fourth in world’s production. At present the
USA ranks at the top in soybean production with 83.2 metric tons in 2011. The USA,
Brazil and Argentina are now among the biggest soybean-producing countries. These
three countries harvested 81% of the world soybean production in 2011 (Chen et al.,
2012).
Values of soybeans
Soybean is one of the most important crops in the world with food, nutritional,
industrial, and pharmaceutical uses (Yamada et al., 2012).
Nutritional values
Soybean seeds contain approximately 40% protein, 35% carbohydrate, 20%
edible oil and 5% ash (Pednekar et al., 2010; Hartman et al., 2011). It is one of the few
plants providing complete protein (Henkel, 2000; Chen et al., 2012), and is, therefore,
used as substitute for animal protein and other dairy products (Fukushima, 2001;
Azadbakht et al., 2003; Hartman et al., 2011). In addition, supplement of soybean protein
avoids lysine deficiency of cereals (Pednekar et al., 2010). Furthermore, soybeans with
1
high protein have a great potential in solving the protein malnutrition in the world
especially in developing countries where consumption of protein is below the recommend
level. Young (1991) indicated that soybean protein can meet the protein needs for both
children and adults as a sole protein source when consumed at 0.6g/kg body wt.
Oil is extracted from soybean seeds, then refined and blended for different
applications, and most of them used as dietary oil. Soybean oil is low in saturated fatty
acids but high in polyunsaturated fatty acid (Bennett et al., 2003; Hartman et al., 2011).
Because the high content of polyunsaturated fatty acids can reduce cholesterol (Kinsell et
al., 1954; Grundy and Denke, 1990; Bennett et al., 2003), consumption of soybean oil
dramatically increased.
Pharmaceutical value
There are many health benefits from intake of soybean or soy products. They can
be used as dietary supplements or substitution of animal protein for diabetic patients
(Azadbakht et al., 2003; Villegas et al., 2008); use in weight loss (Chen et al., 2003);
reducing risk of certain types of cancer (MacDonald et al., 2005; Messina et al., 2006;
Hamilton-Reeves et al., 2007; Nagata et al., 2007); reducing total cholesterol content
(Kinsell et al., 1954; Grundy and Denke, 1990; Young, 1991; Fukushima, 2001;
Azadbakht et al., 2003). Consumption of as little as 25g of soybean protein per day as a
diet, in addition to the low intake in cholesterol and saturated fatty acid, may reduce risk
of heart disease and renal disease (Azadbakht et al., 2003; Hartman et al., 2011).
Moreover, the trend of using soybean oil instead of animal fats increases greatly because
of reducing risk of cardiovascular when compared to using animal fats (Hartman et al.,
2011). In addition, soybeans are also rich in calcium, which benefits bone health, and
2
isoflavones, which have received special attention and becomes interesting topics for
many scientists. Finally, soybean isoflavones are believed to play a great role in the
contribution to health benefits (Chen et al., 2012) such as reducing risk of cardiovascular
(Zyriax and Windler, 2000); preventing different cancers and having positive effects on
bone health (Chen et al., 2012).
Soy products
85% of the world's soybean crop is processed into soybean meal and vegetable
oil (http://www.soystats.com). 98% of soybean meal is used in livestock and aquaculture
feed because of its high level and good quality of protein (Hartman et al., 2011) which
makes soybeans a complete protein source containing essential amino acids that the
human body can’t synthesize. Over the past 2000 years, soybean has been consumed in
East Asia as traditional soy foods, such as nimame (cooked whole soy), edamame (green
fresh soy), soymilk, tofu, kori-tofu (freeze-denatured and dry tofu), abura-age (deep-fatfried tofu), sufu or tofu-yo (fermented tofu), soy sauce, miso, natto, tempeh, etc
(Fukushima, 2001). In recent years, consumption of these foods has widely expanded to
outside Asia. With improving technology and advanced processes, new products of soy
protein have also been developed such as soy flour, soy protein concentrates, soy protein
isolates, and their texturized products that enhance variety of foods that are familiar to
consumers but contain soybean for nutritional purpose, including baked goods, snack
bars, noodles, and infant formula (Hartman et al., 2011).
In addition to protein, oil is also one of the most valuable products from soybeans.
And, among legumes, soybeans are also classified as an oilseed. About 95% soybean oil
is used as edible oil, of which 70% of is consumed by humans in the U.S. (in Tarva and
3
Kim 2007). After oil extraction, the remaining material can be processed in variety ways
to produce further meal for swine, poultry feed, soy concentrate, soy protein isolate, or
other industrial products (Galloway et al., 2008).
Vitamin A
Vitamin A is a lipid soluble vitamin and is dissolved in the lipid fraction of foods.
It is essential for normal function of vision, growth and development, maintenance of
epithelial cellular integrity, immune function, reproduction and spermatogenesis
(Duerbeck and Dowling, 2012). Vitamin A is found in a wide range of foods, either as
preformed vitamin A in animal products, such as meats, fish, fish oil, milk, egg yolks,
liver, or as pro-vitamin A carotenoids, mainly β-carotene in plant products, such as green
or yellow vegetables and fruits.
Vitamin A, in fact, is not a single compound, but it is a general name for a whole
group of related nutrients. There are two major forms of vitamin A: retinoids (preformed
vitamin A) and carotenoids (pro-vitamin A). While retinoids (retinol, retinal, retinoic
acids and retinyl esters) are associated with foods of animal origin, carotenoids (carotenes
and xanthophylls) can be found in plant foods. They play important role in contributing
to good health for animals and humans.
Carotenoid biosynthetic pathway in plants and equivalent steps in bacteria
Carotenoid synthesis begins with the condensation of IPP (isopentenyl
diphosphate) and DMAPP (dimethylallyl diphosphate) synthesized in the plastids to
generate GGPP/GGDP (genarylgenaryl diphosphate) with the catalysis of GGPP/GGDP
synthase (GGPPS/GGDPS). The first committed step of carotenoid biosynthetic pathway
is the condensation of two GGPP to generate phytoene, the first colorless carotenoid by
4
the enzyme phytoene synthase (PSY in plants and CrtB in bacteria). Then phytoene is
converted into lycopene by the action of two desaturases (PDS, phytoene desaturase, and
zeta –carotene desaturase, ZDS). This pathway gives rise to poly-cis compounds that are
converted to poly-trans forms by the action of carotenoid isomerase CrtISO and ZISO in
non-green tissue, whereas in green tissue the reaction occurs spontaneously in the
presence of light and chlorophyll. However, in bacteria, function of single enzyme CrtI
equals to the functions of these four plant enzymes in desaturation and isomerization
reactions. Therefore, CrtI is usually used in metabolic engineering approaches.
Lycopene is the substrate of two competing cyclases downstream in the pathway.
Linear molecule lycopene can be cyclized at both ends by lycopene β-cyclase alone
(LCYB in plant, CrtY in bacteria) to generate β-carotene, whereas it can be cyclized at
two ends by LCYE and LCYB to form α-carotene. Both these molecules can be
converted to downstream products via carotene hydroxylation. In the β-carotene pathway,
β-carotene converts to β-cryptoxanthin then zeaxanthin. Furthermore, zeaxanthin can
further enter the xanthophyll cyclase. In the α-carotene pathway, conversion yields lutein
(Figure 1.1A).
Vitamin A deficiency in the World
Vitamin A deficiency (VAD) is a common health problem in the world that is
mostly known as the main cause of blindness. An estimated 500,000 children worldwide
go blind every year from vitamin A deficiency (Ramakrishnan and Darnton-Hill, 2002).
Nearly all the cases of VAD are in developing countries whose populations use single
staple crop for their sustenance. The highest prevalence is found in Southeast Asia and
Africa, and, the most affected are the infants, young children and pregnant women.
5
Vitamin A deficiency occurs in children and adults who do not consume adequate yellow
and green vegetables, fruits which are rich in β-carotene, or animal-based vitamin A
(retinol) products such as butter, cheese, eggs, liver. In addition, other factors may cause
deficiency of vitamin A such as low fat diet, chronic exposure to oxidants such as
cigarette smoke, chronic diarrhea genetic inheritance 2 (Duerbeck and Dowling, 2012);
http://www.whfoods.com/genpage.php?tname=nutrient&dbid=106). In addition to eye
symptoms, VAD also decreases functions of immune and inflammatory systems, leading
to increased risks in infectious diseases such as measles, diarrhea and can cause high
morbidity and mortality, especially among children (Zimmermann and Qaim, 2004).
Efforts to combat VAD
During the last decade, many strategies have been deployed to reduce VAD in developing
countries. Food fortification, supplementation and dietary education programs have been
applied (Zimmermann and Qaim, 2004). Dietary supplement in the form of vitamin
tablets or suspension and many other foodstuffs that fortified with vitamin A (such as
fats, oils, margarine and cereal) have been highly successful in high income countries
(Dutra-de-Oliveira et al., 1998; Farre et al., 2010). Few other vitamin A fortification
programs currently exist in lower income countries. Many approaches to enrich major
staple foods with β-carotene through plant breeding or genetic engineering have been
carried out for some crop species, such as maize, sweet potato, canola, tomato, and rice
known as “Golden Rice” (Giuliano et al., 2000; Ye et al., 2000; Diretto et al., 2007;
Wurbs et al., 2007; Aluru et al., 2008). Supplementation is the most widely used to
control VAD in most high risk countries. The Recommend Dietary Allowance (RDA) for
vitamin A is 2700 IU for non-pregnant and pregnant women and 5000 IU for men
6
(Duerbeck and Dowling, 2012). Moreover, improving the intake of vitamin A through
dietary education should be used to enhance nutritional status of a population. Therefore,
dietary education program is really necessary to change dietary habits, as well as
providing better access to vitamin A or pro-vitamin A-rich foods.
Vitamin E
Similar to vitamin A, vitamin E is a lipid-soluble vitamin and synthesized by
photosynthetic organisms, has antioxidant properties and plays important role in human
and animal nutrition (Mayne and Parker, 1988; Hercberg et al., 1999; Bramley et al.,
2000; Tavva et al., 2007). Daily intake of appropriate amount of vitamin E results in
decreased risk of cardiovascular disease, certain cancers, degenerative diseases, prevent
loss of memory and eye disorders or maintenance of immune system (Bramley et al.,
2000; Constantinou et al., 2008; Farbstein et al., 2010).
Source of vitamin E
Vegetable oil is the best natural source of vitamin E, together with other natural
sources including green leafy vegetables,wheat germ, some nuts, eggs, and others.
Furthermore, vitamin E supplements (providing mostly α-tocopherol) are also common
source for humans for prevention and therapy of vitamin E deficiency (Traber and Sies,
1996; Bramley et al., 2000).
Vitamin E is not a single compound, but a general name of a whole family of
different components including tocopherols and tocotrienols (generally called
tocochromanols). They are amphipathic molecules consisting of a polar chromanol head
group and a lipophilic tail. Tocopherol differs from tocotrienol only in lipophilic tail
which is derived from phytyl-diphosphate for tocopherol and genarylgenaryl diphosphate
7
with three double bonds at carbon positions 3’, 7’ and 11’ for tocotrienol (Bramley et al.,
2000; Munne-Bosch and Alegre, 2002; Cahoon et al., 2003). There are four natural forms
of tocopherol and four corresponding natural forms of tocotrienol: α-, β-, γ- and δtocopherol/tocotrienol which are different in number and position of methyl groups on
the chromanol ring that cause different “vitamin E activity/biological activity”. Although
all tocopherols and tocotrienols are potent antioxidants in vitro, α-tocopherol is generally
regarded as having the highest nutritional value in term of “vitamin E activity” because it
is the most readily absorbed and retained by human and other mammalian cells
preferentially to other tocopherols and tocotrienols. This is also a reason that αtocopherol is labeled on vitamin E supplements (Traber and Sies, 1996; Stoppani, 2004;
Dörmann, 2007). Many studies have also demonstrated that the antioxidant of αtocopherol was used in various aspects of human health, including heart disease, cancer,
inflammatory responses (Winklhofer-Roob et al., 2003). Moreover, α-tocopherol is the
most common form in nature compare to the others, and natural α-tocopherol is believed
to have advantages than chemically synthesized α-tocopherol (Eitenmiller, 1997; Traber
et al., 1998). Vitamin E activities of α-, β-, γ-, δ-tocopherols, α-, β-tocotrienol and
synthetic α-tocopheryl acetate are 100%, 50%, 10%, 3% 30%, 5% and 74% equivalent
that of α-tocopherol activity (Kamal-Eldin and Appelqvist, 1996; Shintani and
DellaPenna, 1998; Bramley et al., 2000).
Tocochromanols in plants
Tocochromanols are found in most plant species, green algae and cyanobacteria
(Dörmann, 2007). They play a number of important functions such as protection of
chloroplast from photooxidative damage, or preventing oxidative damage to lipid
8
components in the period of seed storage and seed germination (Tavva et al., 2007), and
may have additional role in photosynthesis (Munne-Bosch and Alegre, 2002). While
tocopherols are widely found in dicot species, tocotrienols are the major form of vitamin
E in seed of most monocot and rarely found in dicots (Cahoon et al., 2003; Dörmann,
2007). In plant, tocopherols occur in leaves, stems, flower petals, but the highest
concentration is found in seeds. While α-tocopherol with the highest vitamin E activity
(10 folds higher than γ-tocopherol) is predominant in leaves of most plants, the major
tocopherol in seed is γ-tocopherol, (Bramley et al., 2000; Van Eenennaam et al., 2003;
Tavva et al., 2007; Dwiyanti et al., 2011). α-tocopherol is especially rich in germ oil,
safflower oil, sunflower oil, whereas soybean oil store predominantly γ-tocopherol
(Traber and Sies, 1996).
Vitamin E deficiency
Vitamin E deficiency due to poor nutrition is rare, but still occurs, especially in
developing countries (Dror and Allen, 2011). It may occur in premature infants with
hemolytic anemia, in low-birth-weight babies or when vitamin E transferred from
mother to fetus is not sufficient (Koletzko et al., 1995). Similar to vitamin A, digestion of
vitamin E requires fat to absorb it. Thus, people having problems of malabsorption,
metabolism, delivery from diets to tissue are more likely to become deficient than people
without such problem (Traber and Sies, 1996). Having vitamin E deficiency, humans
may meet symtoms such as blood disorder, poor reflexes, loss of balance, poor muscle
coordination with shaky movements (ataxia), sight problem with difficulty seeing at
night, decreased immune response (Kowdley et al., 1992; Antinoro, 2000; Monsen,
2000).
9
Naturally biosynthetic vitaminE (natural vitamin E) versus chemically synthetic
vitamin E (synthetic vitamin E)
Natural vitamin E is commonly known as d-α-tocopherol or RRR-α-tocopherol
and other less common forms of d-α-tocopheryl acetate, d-α-tocopheryl succinate. In
contrast, synthetic forms of vitamin E are labeled with dl-α-tocopherol or all-rac-αtocopherol. While natural α-tocopherol consists of one stereoisomer, synthetic αtocopherol contains eight different stereoisomers in equal amounts. Only one of eight
stereoisomers (about 12.5% of synthetic molecule) is identical to d-α-tocopherol (natural
form), the remaining seven stereoisomers have different molecular configurations due to
the manufacturing process and their biological activity is only 50-74% of that of the
natural α-tocopherol (Clemente and Cahoon, 2009). Moreover, synthetic dl- α-tocopherol
has bioavaiability only half that of natural α-tocopherol (Burton et al., 1998; Bramley et
al., 2000), and natural source d-α-tocopherol is believed to have more advantages than
chemically synthesized α-tocopherol (Eitenmiller, 1997; Traber et al., 1998). Both natural
source d-α-tocopherol and synthetic dl- α-tocopherol are absorbed well in the body.
However, after absorption, discrimination between natural and synthetic vitamin E occurs
in the liver. A hepatic α-tocopherol transfer protein (α-TTP) in the liver recognized only
the naturally occuring forms and transfer them to cell when needed. As a result, synthetic
vitamin E are preferentially excreted, and natural vitamin E is retained significantly
longer in body tissues (Traber et al., 1998; Niki and Traber, 2012). In addition, natural
source vitamin E is thought to be transferred from pregnant women to their babies three
times more efficiently than synthetic vitamin E. Many studies also presented that other
components of natural vitamin E have their own specific physiological benefits. For
10
example, γ-tocopherol inhibits growth of cancer, prevents inflammation or improves
kidney functions; and α-tocotrienol play role in neuroprotection (Jiang et al., 2001;
Stoppani, 2004). In fact, most of the vitamin E on the market is synthesized by chemical
reaction (Dwiyanti et al., 2011).Therefore, finding a way to improve natural tocopherol
intake in human and animal diets is a current interest (Tavva et al., 2007).
Tocopherol biosynthetic pathway in plants (Figure 1.1B)
Tocopherols are synthesized from precursors derived from two pathways: the
head group derived from homogentistic acid (HGA) in Shikimate pathway and lipophilic
tail derived from phytyl diphosphate in MEP (Methylerythritol phosphate) pathway to
produce 2-methyl-6-phytylbenzoquinol. Then, enzyme 2-methyl-6-phytylbenzoquinol
methyltransferase (VTE3) converts 2-methyl-6-phytylbenzoquinol to 2,3dimethyl5phytylbenzoquinol, while tocopherol cyclase (VTE1) will convert it to δtocopherol. VTE1 also use 2,3-dimethyl-5phytylbenzoquinol as a substrate to convert to
γ-tocopherols. Finally, γ-tocopherol methyltransferase (VTE4) is found to use δ-and γtocopherols as substrates to produce β- and α- tocopherols, respectively. Biosynthetic
pathway of tocotrienols differs from that of tocopherols in using
genarylgenaryldiphosphate (GGPP/GGDP) instead of phytyldiphosphate (PDP) as the
side chain (Bramley et al., 2000; Van Eenennaam et al., 2003). Tocopherol biosynthesis
takes place in the plastids (Li et al., 2011), therefore, it is highly correlated to other
metabolic pathways in the plastid compartment including biosynthesis of carotenoids,
chlorophylls, gibberellins, phylloquinone (Figure 1.1C) (DellaPenna and Pogson, 2006).
11
Previous approaches of enhancing pro-vitamin A in plants
Because of high nutritional and commercial values as well as grave effects of
VAD, vitamin A becomes an interesting topic for many scientists in the world. Research
on metabolic engineering of carotenoid biosynthetic pathway to enhance vitamin A for
consumers has been achieved recently in many plants. The best known metabolic
engineering of pro-vitamin A is “Golden rice”. Ye and his coworkers transferred gene
encoding daffodil phytoene synthase (psy), Erwinia uredovora phytoene desaturase
(crtI) into rice endosperm in single transformation under the control of the endosperm –
specific glutelin (Gt1) and the constitutive CaMV (cauliflower mosaic virus) 35S
promoter, respectively via Agrobacterium-mediated transformation result in “Golden
rice1”. Carotenoid content of Golden rice 1 events was significantly high, up to 1.6µg
carotenoids (0.8µg β-carotene) per gram of dry rice. Furthermore, that of a new version
of Golden rice (“Golden rice 2”) was developed up to 35µg β-carotene per gram of dry
rice by using phytoene synthase (psy) from maize instead of daffodil as previous version
(Ye et al., 2000; Al-Babili and Beyer, 2005; Tang et al., 2009). These transgenic crops
contribute in part to enhancing pro-vitamin A intake and combat the VAD problem for
people, especially in developing countries that use rice as a major food in their diet.
Expression of plant phytoene synthase was also studied on tomato. However, this
expression of tomato phytoene synthase reduced ripe level of transgenic tomato due to
gene silencing with the endogenous genes and make dwarfism phenotype that is
considered as redirection of GGDP from gibberellin pathway (Fray et al., 1995). Then,
the use of Erwinia uredovora phytoene desaturase (crtI) gene on tomato was
approached that resulted in normal morphological phenotype compare to the control.
12
Therefore, using bacterial crtI may have prevented gene silencing that was observed in
earlier studies using the tomato phytoene synthase gene. The crtI transgenic tomato
showed an increase in β-carotene, lutein but a decrease in lycopene, total carotenoids, γcarotene and δ-carotene(Römer et al., 2000). Transgenic wheat has been also generated
by expressing the maize psy driven by an endosperm-specific 1Dx5 promoter in the elite
wheat, together with the Erwinia uredovora crtI under the control of constitutive CaMV
35S promoter. The total carotenoids content was increased up to 10.8-fold as compared
with the non-transgenic cultivar (Cong et al., 2009). Bacterial carotenoids enzymes were
also applied for various crops such as potato, wheat, maize, canola, soybean and even
flaxseed and tobacco. Linseed flax is an industrially important oil crop containing large
amounts of α-linolenic acid (18:3) and lignin in its seed oil. Transgenic flax was
generated by overexpressing of Erwinia uredovora phytoene synthase (crtB), resulted in
total carotenoid amounts were 65.4–156.3μg/g fresh weight, which corresponded to 7.8to 18.6-fold increase, compared with those of untransformed controls. The seeds showed
orange-colored phenotype with newly accumulation of phytoene, α-carotene, β- carotene
(Fujisawa et al., 2008). In addition to flax plants, canola was also engineered to express
crtB. Transgenic canola seeds showed orange color and carotenoid content rise up to 50fold increase with the predominant carotenoids are α-carotene and β-carotene
(Shewmaker et al., 1999). An approach of seed specific expression of endogenous
Arabidopsis psy resulted in 43-fold increase in β-carotene and other carotenoid forms
(Lindgren et al., 2003). Potato is one of the most common staple crops in the world
(ranking after wheat, rice, and maize) and is a source of lutein and violaxanthin which are
non-provitamin A activity. Three genes from Erwinia uredovora: phytoene synthase
13
(crtB), phytoene desaturase (crtI) and lycopene beta-cyclase (crtY) under tuber-specific
and constitutive promoter were transferred to potato. While constitutive expression of the
crtY and/or crtI interferes with the establishment of transgenesis and with the
accumulation of leaf carotenoids, expression of all three genes under control of tuber
specific promoter resulted in tubers with a dark yellow phenotype without any adverse
leaf phenotypes. Furthermore, carotenoid amount of these tubers increase approximately
20-fold, to 114 µg/g dry weight and β-carotene 3600-fold, to 47 µg/g dry weight (Diretto
et al., 2007). Recently, Kim and coworkers successfully transferred recombinant PAC
(Phytoene synthase -2A-Carotene desaturase) gene in a Korean soybean. They tested
either β-conglycinin or CaMV-35S promoter. While PAC gene that driven by βconglycinin was expressed strongly in the seeds, it showed high level in leaves under the
control of CaMV-35S promoter. Analysis of T2 generation of β-conglycinin –PAC plants
showed that seeds increase 62-fold higher than non-transgenic seeds, accumulated
146µg/g of total carotenoids, of which 112µg/g was β-carotene. In contrast, there was no
significant difference in carotenoid components in leaves between transgenic and nontransgenic plants (Kim et al., 2012)
Previous approaches of enhancing vitamin E in plants
In 1998, Shintani and DellaPenna reported that Arabidopsis increased αtocopherol by seed-specific overexpression of γ-tocopherol methytransferase (VTE4) that
made γ-tocopherol completely convert to α-tocopherol and vitamin E increased nine-fold
(Shintani and DellaPenna, 1998). Moreover, when overexpression of Homogentisate
phytyltransferase (VTE2) and VTE4 resulted in tocochromanol increase together with
complete conversion of all γ-tocopherol to α-tocopherol and 12-fold increase in vitamin E
14
activity (Collakova and DellaPenna, 2003). Van Eenennaam and his coworkers reported
that by over-expression of Arabidopsis thaliana VTE4 (At-VTE4), transgenic soybean
seeds showed that almost γ-tocopherol and δ-tocopherol completely converted to αtocopherol, and β-tocopherol that make 7-fold increase and 10-fold increase in total
tocopherol in soybean seeds, respectively. Moreover, they also mentioned that
overexpression of At-VTE4 together with At- VTE3 (2methyl-6-phytylbenzoquinol
methyltransferase) resulted in eight-fold increase in α-tocopherol and fivefold increase in
vitamin E activity in transgenic compared to non-transgenic soybean seeds (Van
Eenennaam et al., 2003). Tavva and coworkers reported the transgenic soybean with
10.4-fold increase of α-tocopherol and 14.9-fold increase of β-tocopherol in T2 seeds by
seed specific expression of VTE4 from Perilla frutescens (Tavva et al., 2007). Cahoon
also increased total tocotrienols plus total tocopherols in Arabidopsis thaliana leaves by
ten to fifteen- fold and six-fold in corn seeds (Cahoon et al. 2003) via overexpression of
barley HGGT (homogentesic acid genarylgenaryl transferase) which catalyzes the
committed step of tocopherol/tocotrienol biosynthesis compare to previous studies of 4.4fold and 2-fold increase in leaves (Collakova and DellaPenna, 2003) and seeds (Soll and
Schultz, 1979), respectively. Collakova and Della Penna also mentioned that
Homogentisate phytyltransferase (HPT) is limiting in different Arabidopsis tissues
(leaves and seeds), overexpressing this gene resulted in ten-fold increase in HPT activity
and 4.4-fold increase in total tocopherols in leaves and 40% higher in seeds compare to
wild type because of higher amount of γ-tocopherol. Moreover, crossing these HPT lines
with lines overexpressing γ-tocopherol methyltransferase resulted in seeds increase of 12-
15
fold in vitamin E activity because of increase α-tocopherol (Collakova and DellaPenna,
2003).
Soybean oil
Soybean tocopherols: Soybean seeds contain average 60-70% γ-tocopherol, 2025% δ-tocopherol, and less than 10% α-tocopherol of total tocopherols (Almonor et al.,
1998; Van Eenennaam et al., 2003). γ- and δ-tocopherol that occur principally in soybean
seeds, have been reported to greatest degree of oxidative stability to vegetable oil for
frying applications , although their vitamin E activities are only 10% and 3% of that of αtocopherol (Huang et al., 1995; Warner et al., 2003). Recently, many studies on
tocopherol enhancement in soybean seeds have focused on strategies to convert different
forms to α-tocopherol. Although tocopherols are only accounted for a small percentage of
the oil extracted from soybean seeds, they are critical for their oxidative stability in food
process and play important role in high temperature performance of soybean oil in
biodiesel and bio-based lubricants (Warner et al., 2003; Krahl et al., 2005; Warner,
2005).
In summary, various efforts have been made previously to enhance either provitamin A or vitamin E, but not both. Therefore, it would be advantageous to increase
both in soybean seeds to improve soybean seed nutritional values and combat vitamin A
and E deficiency.
16
Strategies to express multiple genes in plants
Conventional stacking methods/crossing/iterative processes
Iterative process is an early introduced strategy that starts with introduction of
desired genes into different cassettes and transfers each cassette into different
independent plants by plant transformation. Subsequently, these different transgenic lines
will be crossed to yield progeny that carry all of the genes of interest. This approach has
been successfully used to generate plants that carry and express polyhydroxybutyrate
biosynthetic pathway, comprising three genes (Nawrath et al., 1994) or tobacco
transgenic plant that generate and assemble of functional antibodies by co-expression of
four genes of a secretory immunoglobulin A (Ma et al., 1995). Another strategy is
sequential transformation, which means available transgenic plants are transformed with
additional transgenes (Lapierre et al., 1999; Jobling et al., 2002; Qi et al., 2004).
However, these methods are labor intensive and time consuming involving multiple
construction of expression cassettes, separate transformations of each gene, and several
crosses with multiple verifications per cross. Moreover, the level of expression of
transgenes is highly variable and influenced by many factors including the use of
promoters with different strengths or gene silencing induced the use homologous
promoters. Segregation of subsequent generations, if these genes are unlinked, is also a
potential problem (Ma and Mitra, 2002; Naqvi et al., 2010).
Co-transformation
Two or more transgenes will be introduced simultaneously. Advantages of this
method are transgenic plants can carry multiple transgenes in one generation and
17
preventing subsequent segregation (Naqvi et al., 2010). It could be divided into two broad
approaches:
Co-transformation of linked genes: assembly of multiple genes on the same
plasmid (Twyman et al., 2002; Karunanandaa et al., 2005).
Co-transformation of unlinked genes: desired genes that are carried on separate
plasmids and transferred into the same cell. This method is advantageous in that
selectable marker need not attach each foreign gene.
There is an equal efficiency between linked and unlinked co-transformation of
two transgenes. However, when the number of transgenes increases, linked cotransformation becomes much less efficient because of vector instability, lack of unique
restriction sites in cloning process, trouble in cloning multiple transgene expressions into
a single construct, and the fact that larger input DNA sequences are more likely to
fragments. In contrast, unlinked co-transformation shows to be much better. Particle
bombardment with multiple input plasmids can achieve transgenic plants carrying all the
genes with high efficiency (Ye et al., 2000; Cong et al., 2009; Jing et al., 2009; Naqvi et
al., 2009). Cahoon et al. produced transgenic soybean seeds with highly increased total
tocopherol and tocotrienol by co-transformation of two plasmids containing two genes of
barley HGGT and soybean VTE4 (Cahoon et al., 2003). Although, this method has been
used with some success, it also has potential drawbacks such as gene silencing caused by
different expression cassettes being driven by same promoter.
Self-processing polyprotein
The best strategy to overcome the above problems is the expression of multiple
genes in the form of a self-processing polyproteins as Picornavirus and Potyviruses. In
18
these viruses, the genome often encodes a single, long open reading frame. Expression of
the viral genome results in production of polyproteins which are processed into discrete
proteins by proteinase encoded within the polyprotein itself (Ryan and Flint, 1997).
Advantages of self-cleaving 2A systems
Food-and-mouth disease virus (FMDV) contains a sequence 2A of just 20 amino
acids with its unique capability to mediate cleavage at its own Carboxyl- terminus of the
2A region.
This 2A self-cleaving system can be employed to express multiple genes using a
single construct in coordinated expression of transgenes with just one transformation
(especially for two genes (Halpin et al., 1999)). Co-expression of multiple genes using
2A element has been used for variety of applications on animals especially on mice
(Trichas et al., 2008; Carey et al., 2009; Casales et al., 2010) and plants (Halpin et al.,
1999; Ma and Mitra, 2002).
Single construct with a single set of promoter and terminator sequence can avoid
silencing and minimize transgene expression instability.
2A is a short amino acid sequence (just 20 amino acids), and is energetically
efficient so plants don’t utilize much energy to synthesize (Halpin et al., 1999).
Efficiency in targeting constituent proteins in polyproteins with their own
targeting information to different subcellular has been reported (Halpin et al., 1999;
Lorens et al., 2004; Provost et al., 2007).
Its self-cleaving activity is independent with any cellular factors. Thus it can be
effective in all tissues and cells at all developmental stages that make it be more
19
advantageous in particular application where crossing is not applied for some tree species
(Halpin et al., 1999).
Recognition site in its sequence is for ubiquitous ribosome-associated eukaryotic
protease. However, 2A polyproteins do not cleave in E.coli (Donnelly et al., 1997).
Expression of multiple genes in the cassette has been shown to be at equal levels.
(Halpin et al., 1999; Trichas et al., 2008).
Mechanism of “self-cleavage” 2A system
In fact, the “self-cleavage” mechanism is still not completely known. However,
recent studies demonstrated that mechanism of “self-cleavage” of 2A sequence is
“ribosomal skipping”. Ribosome pauses near the end of the 2A coding sequence at the
junction of Glycine (G) and Proline (P) disrupting the formation of single peptide bond
and release of the nascent upstream protein, while allowing continued translation of the
downstream protein (Donnelly et al., 1997; Doronina et al., 2008). It means that, after
cleavage, 2A remains attached to the C-terminus of the upstream protein while single
Proline residue remains attached to the N-terminus of the downstream protein (Halpin et
al., 1999; Doronina et al., 2008). There is generally no problem in additional Proline of
following protein (de Felipe et al., 2006), however longer extension (2A remaining) at Ctermius of the upstream protein might have unpredictable effects (Fisicaro et al., 2011).
Although FMDV 2A region functions properly within different contexts,
efficiency of cleavage varies when flanking contexts change. Moreover, multiple copies
of 2A in a single open reading frame function properly and independently and can be
used for co-ordinate expression of multiple genes (Ma and Mitra, 2002).
20
The goal of this research is to ascertain the utility of the coordinated gene
expression by 2A system while simultaneously increase pro-vitamin A and E contents in
soybean seeds.
21
Figure legend
Figure 1.1A: Carotenoid biosynthesis pathway in plants and corresponding steps in
bacteria. CRTB, bacterial phytoene synthase; CRTE, bacterial geranylgeranyl
diphosphate synthase; CRTI, bacterial phytoene desaturase/isomerase; CRTISO,
carotenoid isomerase; CRTY, bacterial lycopene cyclase; CRTZ, bacterial β-carotene
hydroxylase; CYP97C, carotene ɛ-ring hydroxylase; DMAPP, dimethylallyl diphosphate;
GGPP/GGDP, geranylgeranyl diphosphate; GGPPS/GGDPS, GGPP synthase/GGDP
synthase; HYDB, β-carotene hydroxylase [non-heme di-iron hydroxylases, β-carotene
hydroxylase (BCH) and heme-containing cytochrome P450 β-ring hydroxylases,
CYP97A and CYP97B]; IPP, isopentenyl diphosphate; IPPI, isopentenyl diphosphate
isomerase; LYCB, lycopene β-cyclase; LYCE, lycopene ɛ-cyclase; PDS, phytoene
desaturase; PSY, phytoene synthase; VDE, violaxanthin de-epoxidase; ZDS, ζ-carotene
desaturase; ZEP, zeaxanthin epoxidase; Z-ISO, ζ-carotene isomerase. (Farré et al., 2011).
Figure 1.1B: Tocopherol and tocotrienol structures and biosynthesis.
(a) Detailed chemical structures of tocopherol and tocotrienol. The canonical structures
are shown, with R-group modifications illustrated in the gridded box at top right.
(b) Final steps of the tocopherol biosynthetic pathway. MEP: methylerythritol phosphate;
VTE1: tocopherol cyclase; VTE2: homogentisic acid prenyltransferase; VTE3: 2-methyl6-phytylbenzoquinol (MPBQ) methyltransferase; VTE4, γ-tocopherol methyltransferase.
Figure 1.1C: Overview of carotenoid and tocopherol biosyntheses in plants. The 2-Cmethyl- d-erythritol-4-phosphate (MEP) pathway provides isopetenylpyrophosphate
(IPP) for synthesis of the central intermediate geranylgeranyl diphosphate (GGDP).
22
GGDP can be used for synthesis of phytoene, chlorophylls, and tocotrienols or reduced to
phytyl-diphosphate (PDP) used for phylloquinone, chlorophyll, and tocopherol synthesis.
Phytol released from chlorophyll degradation is also used for tocopherol synthesis (not
shown, see text). The pathway shown by orange arrows provides the carotenoids found in
leaves of most plant species. Other carotenoids and carotenoid leavage/modification
products are produced in certain species and/or particular tissues, and when known, the
primary substrate for cleavage is given in parentheses. The pathway shown by green
arrows is the synthesis of tocopherols from homogentisate, a product of the shikimate
pathway. For clarity, only tocopherols are shown, but when GGDP is condensed with
homogentisate, the corresponding tocotrienols are produced by the same pathway. ABA,
abscisic acid; MPBQ, methyl-6-phytyl-1, 4-benzoquinone.
23
Figure 1.1A
24
(a)
B
(b)
Figure 1.1B
25
Figure 1.1C
26
LITERATURE CITED
http://www.soystats.com/2012/Default-frames.htm
Al-Babili, S. and P. Beyer. 2005. Golden Rice – five years on the road – five years to go?
Trends in Plant Science 10: 565-573.
Almonor, G.O., R.F. Wilson and G.P. Fenner. 1998. Temperature effects on tocopherol
composition in soybeans with genetically improved oil quality. Journal of the American
Oil Chemists' Society 75: 591-596.
Aluru, M., Y. Xu, R. Guo, Z. Wang, S. Li, W. White, et al. 2008. Generation of
transgenic maize with enhanced provitamin A content. Journal of Experimental Botany
59: 3551-3562.
Antinoro, L. 2000. Has The Vitamin E Bubble Burst? EN Evaluates Whether To
Supplement. (Cover story). Environmental Nutrition 23: 1.
Azadbakht, L., R. Shakerhosseini, S. Atabak, M. Jamshidian, Y. Mehrabi and A. EsmaillZadeh. 2003. Beneficiary effect of dietary soy protein on lowering plasma levels of lipid
and improving kidney function in type II diabetes with nephropathy. European Journal of
Clinical Nutrition 57: 1292.
Bennett, J.O., H.B. Krishnan, W.J. Wiebold and A.H. Krishnan. 2003. Positional effect
on protein and oil content and composition of soybeans. Journal of Agricultural and Food
Chemistry 51: 6882-6886.
Bramley, P.M., W. Schuch, H.E. Roxborough, K.H. Wagner, P.J.A. Sheehy, A. Kafatos,
et al. 2000. Vitamin E. Journal of the Science of Food and Agriculture 80: 913-938.
Burton, G.W., H. Kayden, L. Hughes, K.U. Ingold, M.G. Traber, R.V. Acuff, et al. 1998.
Human plasma and tissue alpha-tocopherol concentrations in response to
supplementation with deuterated natural and synthetic vitamin E. American Journal of
Clinical Nutrition 67: 669-684.
Cahoon, E.B., S.E. Hall, K.G. Ripp, S.G. Thaya, W.D. Hitz and S.J. Coughlan. 2003.
Metabolic redesign of vitamin E biosynthesis in plants for tocotrienol production and
increased antioxidant content. Nature Biotechnology 21: 1082.
Carey, B.W., S. Markoulaki, J. Hanna, K. Saha, Q. Gao, M. Mitalipova, et al. 2009.
Reprogramming of murine and human somatic cells using a single polycistronic vector.
Proceedings of the National Academy of Sciences of the United States of America 106:
157-162.
Casales, E., A. Aranda, J.I. Quetglas, M. Ruiz-Guillen, J.R. Rodriguez-Madoz, J. Prieto,
et al. 2010. A novel system for the production of high levels of functional human
27
therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector. New
Biotechnology 27: 138-148.
Chen, K.-I., M.-H. Erh, N.-W. Su, W.-H. Liu, C.-C. Chou and K.-C. Cheng. 2012.
Soyfoods and soybean products: from traditional use to modern applications. Applied
Microbiology & Biotechnology 96: 9-22.
Chen, Y.-M., S.C. Ho, S.S.H. Lam, S.S.S. Ho and J.L.F. Woo. 2003. Soy isoflavones
have a favorable effect on bone loss in Chinese postmenopausal women with lower bone
mass: a double-blind, randomized, controlled trial. The Journal Of Clinical
Endocrinology and Metabolism 88: 4740-4747.
Clemente, T.E. and E.B. Cahoon. 2009. Soybean oil: genetic approaches for modification
of functionality and total content. Plant Physiology 151: 1030-1040.
Collakova, E. and D. DellaPenna. 2003. Homogentisate phytyltransferase activity is
limiting for tocopherol biosynthesis in Arabidopsis. Plant Physiology 131: 632-642.
Cong, L., G. Yang, G. He, H. Liu, C. Wang and L. Chen. 2009. Expression of phytoene
synthase1 and Carotene Desaturase crtI Genes Result in an Increase in the Total
Carotenoids Content in Transgenic Elite Wheat (Triticum aestivum L.) [electronic
resource]. Journal of Agricultural and Food Chemistry 57: 8652-8660.
Constantinou, C., A. Papas and A.I. Constantinou. 2008. Vitamin E and cancer: An
insight into the anticancer activities of vitamin E isomers and analogs. International
Journal Of Cancer. Journal International Du Cancer 123: 739-752.
de Felipe, P., G.A. Luke, L.E. Hughes, D. Gani, C. Halpin and M.D. Ryan. 2006. E unum
pluribus: multiple proteins from a self-processing polyprotein. Trends in Biotechnology
24: 68-75.
DellaPenna, D. and B.J. Pogson. 2006. Vitamin Synthesis in Plants: Tocopherols and
Carotenoids. Annual Review of Plant Biology 57: 711-738.
Diretto, G., S. Al-Babili, R. Tavazza, V. Papacchioli, P. Beyer and G. Giuliano. 2007.
Metabolic engineering of potato carotenoid content through tuber-specific overexpression
of a bacterial mini-pathway. PLoS ONE 2: e350-e350.
Donnelly, M.L.L., M.D. Ryan, S. Monaghan and D. Gani. 1997. The cleavage activities
of aphthovirus and cardiovirus 2A proteins. Journal of General Virology 78: 13-21.
Dörmann, P. 2007. Functional diversity of tocochromanols in plants. Planta 225: 269276.
Doronina, V.A., C. Wu, P. de Felipe, M.S. Sachs, M.D. Ryan and J.D. Brown. 2008. Sitespecific release of nascent chains from ribosomes at a sense codon. Molecular And
Cellular Biology 28: 4227-4239.
28
Dror, D.K. and L.H. Allen. 2011. Vitamin E deficiency in developing countries. Food
And Nutrition Bulletin 32: 124-143.
Duerbeck, N.B. and D.D. Dowling. 2012. Vitamin A: too much of a good thing?
Obstetrical & Gynecological Survey 67: 122-128.
Dutra-de-Oliveira, J.E., R.M. Fávaro, M.V. Junqueira-Franco, C.G. Carvalho, A.A.
Jordão Júnior and H. Vannucchi. 1998. Effect of heat treatment on the biological value of
beta-carotene added to soybean cooking oil in rats. International Journal Of Food
Sciences And Nutrition 49: 205-210.
Dwiyanti, M.S., T. Yamada, M. Sato, J. Abe and K. Kitamura. 2011. Genetic variation of
γ-tocopherol methyltransferase gene contributes to elevated α-tocopherol content in
soybean seeds. BMC Plant Biology 11: 152-152.
Eitenmiller, R.R. 1997. Vitamin E content of fats and oils--nutritional implications. Food
Technology 51: 78-81.
Farbstein, D., A. Kozak-Blickstein and A.P. Levy. 2010. Antioxidant Vitamins and Their
Use in Preventing Cardiovascular Disease. Molecules 15: 8098-8110.
Farré, G., C. Bai, R.M. Twyman, T. Capell, P. Christou and C. Zhu. 2011. Nutritious
crops producing multiple carotenoids – a metabolic balancing act. Trends in Plant
Science 16: 532-540.
Farre, G., K. Ramessar, R.M. Twyman, T. Capell and P. Christou. 2010. The
humanitarian impact of plant biotechnology: recent breakthroughs vs bottlenecks for
adoption. Current Opinion In Plant Biology 13: 219-225.
Fisicaro, N., S.L. Londrigan, J.L. Brady, E. Salvaris, M.B. Nottle, P.J. O'Connell, et al.
2011. Versatile co-expression of graft-protective proteins using 2A-linked cassettes.
Xenotransplantation 18: 121-130.
Fray, R.G., P. Hedden, P.M. Bramley, D. Grierson, A. Wallace, P.D. Fraser, et al. 1995.
Constitutive expression of a fruit phytoene synthase gene in transgenic tomatoes causes
dwarfism by redirecting metabolites from the gibberellin pathway. Plant Journal 8: 693701.
Fujisawa, M., M. Watanabe, S.-K. Choi, M. Teramoto, K. Ohyama and N. Misawa. 2008.
Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering
with introduction of bacterial phytoene synthase gene crtB. Journal of Bioscience &
Bioengineering 105: 636-641.
Fukushima, D. 2001. Recent progress in research and technology on soybeans.
Kikkoman Corp., Noda, Chiba 278-0037, Japan. E-mail [email protected]. p. 8-16.
29
Galloway, R., P.J. White and L.A. Johnson. 2008. Soybeans : chemistry, production,
processing, and utilization / editors, Lawrence A. Johnson, Pamela J. White, Richard
Galloway. Urbana, IL : AOCS Press, c2008.
Giuliano, G., R. Aquilani and S. Dharmapuri. 2000. Metabolic engineering of plant
carotenoids. Trends in Plant Science 5: 406-409.
Grundy, S.M. and M.A. Denke. 1990. Dietary influences on serum lipids and
lipoproteins. Journal Of Lipid Research 31: 1149-1172.
Halpin, C., A. El Amrani, M.D. Ryan, S.E. Cooke and A. Barakate. 1999. Self-processing
2A-polyproteins -- a system for co-ordinate expression of multiple proteins in transgenic
plants. Plant Journal 17: 453-459.
Hamilton-Reeves, J.M., S.A. Rebello, W. Thomas, J.W. Slaton and M.S. Kurzer. 2007.
Soy protein isolate increases urinary estrogens and the ratio of 2:16α -hydroxyestrone in
men at high risk of prostate cancer. Journal of Nutrition 137: 2258-2263.
Hartman, G.L., E.D. West and T.K. Herman. 2011. Crops that feed the World 2.
Soybean—worldwide production, use, and constraints caused by pathogens and pests.
Food Security 3: 5-17.
Henkel, J. 2000. Soy: health claims for soy protein, questions about other components.
FDA Consumer 34: 7p.
Hercberg, S., P. Galan and P. Preziosi. 1999. Antioxidant Vitamins and Cardiovascular
Disease: Dr Jekyll or Mr Hyde? American Journal of Public Health 89: 289-291.
Huang, S.W., J.B. German and E.N. Frankel. 1995. Effects of individual tocopherols and
tocopherol mixtures on the oxidative stability of corn oil triglycerides. Journal of
Agricultural and Food Chemistry 43: 2345-2350.
Jiang, Q., S. Christen, M.K. Shigenaga and B.N. Ames. 2001. Gamma-tocopherol, the
major form of vitamin E in the US diet, deserves more attention. American Journal of
Clinical Nutrition 74: 714-722.
Jing, J., W. Gang, W. Jiehua and W. Ping. 2009. Functional analysis of multiple
carotenogenic genes from Lycium barbarum and Gentiana lutea L. for their effects on βcarotene production in transgenic tobacco. Biotechnology Letters 31: 305-312.
Jobling, S.A., R.J. Westcott, A. Tayal, R. Jeffcoat and G.P. Schwall. 2002. Production of
a freeze-thaw-stable potato starch by antisense inhibition of three starch synthase genes.
Nature Biotechnology 20: 295-299.
Kamal-Eldin, A. and L.A. Appelqvist. 1996. The chemistry and antioxidant properties of
tocopherols and tocotrienols. Lipids 31: 671-701.
30
Karunanandaa, B., Q. Qi, M. Hao, S.R. Baszis, P.K. Jensen, Y.-H.H. Wong, et al. 2005.
Metabolically engineered oilseed crops with enhanced seed tocopherol. Metabolic
Engineering 7: 384-400.
Kim, M.-J., Y.-S. Chung, S.-H. Ha, J.K. Kim, H.J. Kim, J.H. Pak, et al. 2012. Genetic
modification of the soybean to enhance the β-carotene content through seed-specific
expression. PloS ONE 7: e48287.
Kinsell, L.W., G.D. Michaels, G.C. Cochrane, J.W. Partridge, J.P. Jahn and H.E. Balch.
1954. Effect of vegetable fat on hypercholesterolemia and hyperphospholipidemia:
observations on diabetic and nondiabetic subjects given diets high in vegetable fat and
protein. Diabetes 3: 113-119.
Koletzko, B., T. Decsi and G. Sawatzki. 1995. Vitamin E status of low birthweight
infants fed formula enriched with long-chain polyunsaturated fatty acids. International
Journal for Vitamin and Nutrition Research 65: 101-104.
Kowdley, K.V., J.B. Mason, S.N. Meydani, S. Cornwall and R.J. Grand. 1992. Vitamin E
deficiency and impaired cellular immunity related to intestinal fat malabsorption.
Gastroenterology 102: 2139-2142.
Krahl, J., J.H. Van Gerpen and G. Knothe. 2005. The biodiesel handbook / editors,
Gerhard Knothe, Jon Van Gerpen, Jurgen Krahl. Champaign, Ill. : AOCS Press, c2005.
Lapierre, C., W. Boerjan, J.C. Leple, V.d. Nadai, V. Ferret, G. Pilate, et al. 1999.
Structural alterations of lignins in transgenic poplars with depressed cinnamyl alcohol
dehydrogenase or caffeic acid O-methyltransferase activity have an opposite impact on
the efficiency of industrial kraft pulping. Plant Physiology 119: 153-163.
Li, Y., G. Wang, R. Hou, Y. Zhou, R. Gong, X. Sun, et al. 2011. Engineering tocopherol
biosynthetic pathway in lettuce. Biologia Plantarum 55: 453-460.
Lindgren, L.O., K.G. Stålberg and A.-S. Höglund. 2003. Seed-specific overexpression of
an endogenous Arabidopsis phytoene synthase gene results in delayed germination and
increased levels of carotenoids, chlorophyll, and abscisic acid. Plant Physiology 132:
779-785.
Lorens, J.B., D.M. Pearsall, S.E. Swift, B. Peelle, R. Armstrong, S.D. Demo, et al. 2004.
Stable, stoichiometric delivery of diverse protein functions. Journal of Biochemical &
Biophysical Methods 58: 101.
Ma, C.L. and A. Mitra. 2002. Expressing multiple genes in a single open reading frame
with the 2A region of foot-and-mouth disease virus as a linker. Molecular Breeding 9:
191-199.
Ma, J.K., A. Hiatt, M. Hein, N.D. Vine, F. Wang, P. Stabila, et al. 1995. Generation and
assembly of secretory antibodies in plants. Science (New York, N.Y.) 268: 716-719.
31
MacDonald, R.S., G. JuYuan, J. Copeland, J.D. Browning Jr, D. Sleper, G.E.
Rottinghaus, et al. 2005. Environmental Influences on Isoflavones and Saponins in
Soybeans and Their Role in Colon Cancer. Journal of Nutrition 135: 1239-1242.
Mayne, S.T. and R.S. Parker. 1988. HPLC analysis of vitamin E by conversion to alphatocopheryl acetate in samples containing canthaxanthin of other coeluting compounds.
Journal of Agricultural and Food Chemistry 36: 483-485.
Messina, M., J.W. Lampe and O. Kucuk. 2006. An Overview of the Health Effects of
Isoflavones with an Emphasis on Prostate Cancer Risk and Prostate-Specific Antigen
Levels. Journal of AOAC International 89: 1121-1134.
Monsen, E.R. 2000. Commentary. Dietary reference intakes for the antioxidant nutrients:
vitamin C, vitamin E, selenium, and carotenoids [corrected] [published erratum appears
in J AM DIET ASSOC 2000 Sep; 100(9): 1008]. Journal of the American Dietetic
Association 100: 637-640.
Munne-Bosch, S. and L. Alegre. 2002. The function of tocopherols and tocotrienols in
plants. Critical Reviews in Plant Sciences 21: 31-57.
Nagata, Y., T. Sonoda, M. Mon, N. Miyanaga, K. Okumura, K. Goto, et al. 2007. Dietary
Isoflavones May Protect against Prostate Cancer in Japanese Men. Journal of Nutrition
137: 1974-1979.
Naqvi, S., G. Farré, G. Sanahuja, T. Capell, C. Zhu and P. Christou. 2010. When more is
better: multigene engineering in plants. Trends in Plant Science 15: 48-56.
Naqvi, S., C. Zhu, G. Farre, K. Ramessar, L. Bassie, J. Breitenbach, et al. 2009.
Transgenic multivitamin corn through biofortification of endosperm with three vitamins
representing three distinct metabolic pathways. Proceedings of the National Academy of
Sciences of the United States of America 106: 7762-7767.
Nawrath, C., C. Somerville and Y. Poirier. 1994. Targeting of the polyhydroxybutyrate
biosynthetic pathway to the plastids of Arabidopsis thaliana results in high levels of
polymer accumulation. Proceedings of the National Academy of Sciences of the United
States of America 91: 12760-12764.
Niki, E. and M.G. Traber. 2012. A History of Vitamin E. Annals of Nutrition &
Metabolism 61: 207-212.
Pednekar, M., A.K. Das, V. Rajalakshmi and A. Sharma. 2010. Radiation processing and
functional properties of soybean (Glycine max). Radiation Physics and Chemistry 79:
490-494.
Provost, E., J. Rhee and S.D. Leach. 2007. Viral 2A peptides allow expression of
multiple proteins from a single ORF in transgenic zebrafish embryos. Genesis (New
York, N.Y.: 2000) 45: 625-629.
32
Qi, B., T. Fraser, S. Mugford, G. Dobson, O. Sayanova, J. Butler, et al. 2004. Production
of very long chain polyunsaturated omega-3 and omega-6 fatty acids in plants. Nature
Biotechnology 22: 739-745.
Ramakrishnan, U. and I. Darnton-Hill. 2002. Assessment and Control of Vitamin A
Deficiency Disorders. Journal of Nutrition 132: 2947S.
Römer, S., P.D. Fraser, J.W. Kiano, C.A. Shipton, N. Misawa, W. Schuch, et al. 2000.
Elevation of the provitamin A content of transgenic tomato plants. Nature Biotechnology
18: 666.
Ryan, M.D. and M. Flint. 1997. Virus-encoded proteinases of the picornavirus supergroup. The Journal Of General Virology 78 ( Pt 4): 699-723.
Shewmaker, C.K., J.A. Sheehy, M. Daley, S. Colburn and D.Y. Ke. 1999. Seed-specific
overexpression of phytoene synthase: increase in carotenoids and other metabolic effects.
Plant Journal 20: 401-412.
Shintani, D. and D. DellaPenna. 1998. Elevating the vitamin E content of plants through
metabolic engineering. Science 282: 2098.
Soll, J. and G. Schultz. 1979. Comparison of geranylgeranyl and phytyl substituted
methylquinols in the tocopherol synthesis of spinach chloroplasts. Biochemical And
Biophysical Research Communications 91: 715-720.
Stoppani, J. 2004. VITAMIN E STACKED! Joe Weider's Muscle & Fitness 65: 180.
Tang, G., J. Qin, G.G. Dolnikowski, R.M. Russell and M.A. Grusak. 2009. Golden Rice
is an effective source of vitamin A. American Journal of Clinical Nutrition 89: 17761783.
Tavva, V.S., Y.-H. Kim, I.A. Kagan, R.D. Dinkins, K.-H. Kim and G.B. Collins. 2007.
Increased alpha-tocopherol content in soybean seed overexpressing the Perilla frutescens
gamma-tocopherol methyltransferase gene. Plant Cell Reports 26: 61-70.
Traber, M.G., D. Rader, R.V. Acuff, R. Ramakrishnan, H.B. Brewer and H.J. Kayden.
1998. Vitamin E dose-response studies in humans with use of deuterated RRR-alphatocopherol. American Journal of Clinical Nutrition 68: 847-853.
Traber, M.G. and H. Sies. 1996. Vitamin E in humans: demand and delivery. Annual
Review of Nutrition 16: 321-347.
Trichas, G., J. Begbie and S. Srinivas. 2008. Use of the viral 2A peptide for bicistronic
expression in transgenic mice. BMC Biology 6: 1-13.
Twyman, R.M., A. Kohli, E. Stoger and P. Christou. 2002. Foreign DNA: integration and
expression in transgenic plants. Genetic Engineering 24: 107-136.
33
Van Eenennaam, A.L., K. Lincoln, T.P. Durrett, H.E. Valentin, C.K. Shewmaker, G.M.
Thorne, et al. 2003. Engineering vitamin E content: from Arabidopsis mutant to soy oil.
The Plant Cell 15: 3007-3019.
Villegas, R., Y.T. Gao, G. Yang, H.L. Li, T.A. Elasy, W. Zheng, et al. 2008. Legume and
soy food intake and the incidence of type 2 diabetes in the Shanghai Women's Health
Study. American Journal of Clinical Nutrition 87: 162-167.
Warner, K. 2005. Effects on the flavor and oxidative stability of stripped soybean and
sunflower oils with added pure tocopherols. Journal of Agricultural and Food Chemistry
53: 9906-9910.
Warner, K., W.E. Neff and F.J. Eller. 2003. Enhancing quality and oxidative stability of
aged fried food with gamma-tocopherol. Journal of Agricultural and Food Chemistry 51:
623-627.
Winklhofer-Roob, B.M., E. Rock, J. Ribalta, D.H. Shmerling and J.M. Roob. 2003.
Effects of vitamin E and carotenoid status on oxidative stress in health and disease.
Evidence obtained from human intervention studies. Molecular Aspects of Medicine 24:
391.
Wurbs, D., S. Ruf and R. Bock. 2007. Contained metabolic engineering in tomatoes by
expression of carotenoid biosynthesis genes from the plastid genome. Plant Journal 49:
276-288.
Yamada, T., K. Takagi and M. Ishimoto. 2012. Recent advances in soybean
transformation and their application to molecular breeding and genomic analysis.
Breeding Science 61: 480-494.
Ye, X., S. Al-Babili, A. Kloti, J. Zhang, P. Lucca, P. Beyer, et al. 2000. Engineering the
Provitamin A (Beta-Carotene) Biosynthetic Pathway into (Carotenoid-Free) Rice E.
Science 287: 303.
Young, V.R. 1991. Soy protein in relation to human protein and amino acid nutrition.
Journal of the American Dietetic Association 91: 828-835.
Zimmermann, R. and M. Qaim. 2004. Potential Health Benefits of Golden Rice: A
Philippine Case Study. Food Policy 29: 147-168.
Zyriax, B.C. and E. Windler. 2000. Dietary fat in the prevention of cardiovascular disease
- A review. European Journal of Lipid Science and Technology 102: 355-365.
34
CHAPTER 2
CO-ORDINATED EXPRESSION OF CRTB, AT-VTE3, AND VTE4
TO ENHANCE PRO-VITAMIN A AND VITAMIN E VIA FMDV 2A
SEQUENCE IN SOYBEAN SEEDS
INTRODUCTION
Soybean [Glycine max (Merr.) ] is one of the most valuable crops in the world not
only as a staple food in some countries, especially Asian countries, providing a good
source of protein for human diet, but also as an oil seed crop, feed for livestock,
aquaculture, and biofuel feedstock. To date, soybean has become an important
commercial crop with growing acreage and food products (Hartman et al., 2011).
Therefore, functional and nutritional improvements of the soybean seeds for food
stability and human health have gained more attention (Sattler et al., 2004). Both
carotenoids and tocopherols are well-known antioxidants and intake of elevated levels of
carotenoids and tocopherols in human diet is believed to reduce several diseases (Shintani
and DellaPenna, 1998; Winklhofer-Roob et al., 2003). However, these two healthbeneficial vitamins are only synthesized in photosynthetic organisms.
Engineering carotenoid biosynthetic pathway has been applied on various crops.
The “Golden rice” is the best known transgenic crop that was engineered to achieve high
level of β-carotene with 0.8µg/g β-carotene in “Golden rice 1” and 35µg/g β-carotene in
“Golden rice 2” of dry rice seeds (Ye et al., 2000; Al-Babili and Beyer, 2005; Tang et al.,
35
2009). While two distinct cassettes containing genes encoding daffodil phytoene synthase
(psy) and Erwinia uredovora phytoene desaturase (crtI) were introduced to rice in
“Golden rice 1” project; maize phytoene synthase employed to replace daffodil gene and
caused a dramatic increase of β-carotene in seeds in “Golden rice 2”. Recently, “New
Golden rice” has been reported to increase total carotenoid which was achieved through
simultaneously expressing bicistronic gene psy-2A-crtI (PAC) involving 2A sequence,
and 2A expression system was demonstrated to be a hopeful tool for multi-gene
expression in crop biotechnology (Ha et al., 2010). Transgenic soybean using the same
PAC gene system was also reported with total carotenoid amount of 146 µg/g (62-fold
higher than non-transgenic seeds) in which 77% of carotenoids was β-carotene (112µg/g)
(Kim et al., 2012). On the other hand, by expression of only bacterial Erwinia uredovora
phytoene synthase (crtB), canola seeds also showed distinct orange color and a total
carotenoid increment up to 50-fold increase with α- carotene (400µg/g fresh weight) and
β-carotene (700µg/g fresh weight) as predominant carotenoid forms (Shewmaker et al.,
1999). Transgenic flax plants showed 7.8 to 18.6-fold carotenoid increase (156.3μg/g
fresh weight ) as compared to non-transgenic plant (Fujisawa et al., 2008). Carotenoid
enhancement was also reported on various other crops as tobacco, potato, wheat, and
maize (Diretto et al., 2007; Aluru et al., 2008; Fujisawa et al., 2008; Cong et al., 2009;
Jing et al., 2009).
Several groups reported metabolic engineering of tocopherol biosynthetic
pathway in Arabidopsis by overexpressing various enzymes (Shintani and DellaPenna,
1998; Savidge et al., 2002; Collakova and DellaPenna, 2003). They showed that
overexpression of HPT (Homogentisate phytyltransferase) and At-VTE4 (γ-tocopherol
36
methyltransferase) each increased total tocopherol and α-tocopherol contents,
respectively in Arabidopsis seeds. While γ-tocopherol is a biosynthetic precursor of αtocopherol and is predominant form in soybean seeds, it has a low (only 1/10) biological
activity of α-tocopherol. Furthermore, α-tocopherol may be the only type of vitamin E
that human blood can maintain and transfer to cells when needed (Traber and Sies, 1996).
Consequently, manipulating the tocopherol biosynthetic pathway in soybean seeds to
convert the less active tocopherols to α-tocopherol could have significant health benefits
(Tavva et al., 2007). In 2003, Van Eenennaam et al. reported that by overexpressing
AtVTE3 (2-methyl-6-phytylbenzoquinol methyl transferase) or AtVTE4 (γ-tocopherolmethyltransferase) alone or both altered tocopherol compositions but did not significantly
alter total level of tocopherols. While ectopic AtVTE3 increased γ- and α-tocopherol
levels and reduced δ- and β-tocopherols; overexpressing AtVTE4 alone resulted in almost
complete γ- tocopherol conversion to α- tocopherol in soybean seeds. Moreover,
overexpression of both AtVTE3 and AtVTE4 shifted α-tocopherol from only 10% to 90%
in soybean seeds (Van Eenennaam et al., 2003).
Although many successes were reported in improvement of carotenoids and
tocopherols in various plant species, no research has been done to enhance both
carotenoids and tocopherols simultaneously in any plants. Thus, the main objective of
this research is to evaluate the capability to increase and alter the carotenoid and
tocopherol compositions in soybean seeds by seed specific, coordinated overexpression
of key genes in carotenoid and tocopherol pathways using 2A sequence.
37
MATERIALS AND METHODS
Plant material and growth conditions
Soybean seeds of elite genotype “Maverick” (2010) was generous gifts from the Missouri
Foundation Seeds, MO and used for all experiments. All soybean plants including wild
type (WT) and transgenic plants were grown in greenhouse rooms inside the Sears Plant
Growth Facility complex at 26/240C day/night temperatures with combined supplemental
metal halide and high sodium pressure lights. They were grown in 3 gallon pods (Nursery
supply nurses, # 149637) filled with mix soil and fertilizer (Osmocote®14-14-14). All
soils used were professional growing mix (SunGro, USA). Plants were watered every day
for 4 months and one additional month without watering for drying and harvesting the
dry seeds. Especially, regenerated plants from soybean transformation were first grown in
Jiffy pot (Jiffy, cat. # 141451) containing moistened mix soil at 240C under 18:6 (light:
dark) photoperiod for at least one week, and watered as needed. When plantlets have at
least three healthy trifoliates were scored for Liberty® resistance prior to potting in 3
gallon pods grown in green house
Binary constructs and bacterial strain
An entire expression cassette for a cooridinated expression of polyproteins was
synthesized (GenScript, USA). This single cassette included a soybean Glycinin gene
promoter (seed-specific) (Flores et al., 2008), the full-length cDNAs of Erwinia
uredovora phytoene synthase (crtB), Arabidopsis thaliana 2-methyl-6-phytylbenzoquinol
methyl transferase (At-VTE3), Glycine max γ-tocopherol-methyltransferase (VTE4), and
soybean vegetative storage protein gene terminator (Tvsp) (Rhee and Staswick, 1992) to
38
generate a single transcriptional unit. The nucleotide sequences encoding crtB as well as
At-VTE3 and VTE4 were from GenBank NCBI (Accession No D90087, NM_116206 and
NM_001249796, respectivly). Each of these genes was fused at 5’ end with soybean
Rubisco small subunit transit peptide (Acession VOO458 J01307) and the three cDNAs
were separated by 2 copies of 2A sequence (Ryan and Drew, 1994; Halpin et al., 1999) to
create a single open reading frame encoding the polyprotein (crtB-2A-AtVTE3-2AVTE4) (Fig. 2A). Two EcoRI sites were created to flank this cassette and the resultant
sequence was synthesized and cloned into the plasmid pUC57. The entire cassette
flanked by the EcoRI sites was consequently then excised from pUC57 and cloned into
binary plant transformation vector pZY101 (Zeng et al., 2004).The resulting construct
was mobilized into Agrobacterium tumefaciens strain AGL1 and the integrity of the
binary vector within the Agrobacterium cells was confirmed by plasmid rescue and
restriction digests.
Agrobacterium mediated transformation of soybean cotyledonary-node
The soybean transformation procedure followed our lab protocol with minor
modifications from previous ones (Zhang et al., 1999; Zeng et al., 2004; Wright et al.,
2010). These modifications included the deploying “dip-wounding” during the explant
preparation (Barampuram and Zhang, 2011) as well as using glufosinate concentrations at
0, 10, and 4mg/L during first and second shoot induction and shoot enlongation stages,
respectively.
Transgene integration and segregation analysis
All regenerated plants recovered under the herbicide glufosinate selection were
subjected to leaf-painting assay with 200mg/L Liberty® (Zhang et al., 1999) three times
39
to confirm the presence of transgene. Leaf tissue that did not exhibit necrosis at 5 days
post application was scored as herbicide tolerance.
All leaf-painting tolerant T0 plants were analyzed by polymerase chain reaction
(PCR) for a quick screen of the presence of transgenes. To do this, genomic DNA
samples from young healthy leaf were extracted using REDExtract-N-AmpTM Plant PCR
kits (Sigma-Aldrich). Sequences and positions of primers using in PCR were described in
Table 2.1A and Figure 2.1A. The primer pairs for bar gene were forward primer (bar-F)
and reverse primer (bar-R) to amplify bar gene partial sequence yielding DNA fragment
of 268bp. To detect gene of interest (GOI), fragment from 5’end of crtB and 3’end of
VTE4 (crtB-2A-AtVTE3-2A-VTE4), 2 primer sets BE3-F/BE3-R and E3E4-F/ E3E4-R
were used. The BE3-F/BE3-R primer pair amplified the region from 5’end of crtB gene
to 3’end of VTE3 gene yielding 2000bp product whereas E3E4-F/ E3E4-R primer pairs
amplified the region from 5’ end of VTE3 gene to 3’ end of VTE4 yielding 2000bp
product. These two primer pairs were tested on putative transgenic plants for integration
of GOI from 5’ end of crtB gene and 3’end of VTE4 that overlap VTE3 region. The PCR
reaction conditions were as the follow: for GOI: 940C for 3 min hot start, 35 cycles of
940C for 30 sec denature, 580C for 30 sec annealing, 720C for 2 min extension, and 720C
for 10 min final extension. For bar gene, all conditions were the same as for GOI except
that the each cycle extension time was reduced to 30 sec. The amplified DNA products
were then run on 0.8% agarose gel for size analysis. Progeny segregation analysis was
also performed on T1 plants from seeds of putative transgenic T0 events by leaf-painting
assay and PCR analysis for screening the presence of bar gene and GOI as T0 analysis.
40
Quantitative real time PCR (qRT-PCR)
Immature seeds of a transformed plant were collected and immediately frozen in 800C freezer before use. Then, each frozen seed was ground in liquid nitrogen, and total
RNA was extracted using Trizol reagent (Invitrogen) following manufacturer’s
instructions. DNase treated RNA samples were prepared using “DNase I, RNase-free”
(Thermo Scientific, USA). First strand cDNA was synthesized using iScriptTM Reverse
Transcription Supermix for RT-PCR (Bio-Rad). qRT-PCR was performed in 96-well
plates with CFX-96TM Real-Time system (Bio-Rad, USA). Each reaction contained 20ng
of cDNA, 10µM of each primer, and 10µl SsoFastTM Evagreen Supermix (Bio-Rad) and
total reaction volume was adjusted to 20 µl with DNase, RNase–free water (Qiagen). The
PCR conditions were 950C for 3 min, 35 cycles of 950C for 10 sec denaturation, 550C for
20 sec annealing and 720C for 20 sec extension, followed 10 sec at 950C; a melting curve
was generated by increasing temperature from 650C to 950C to examine amplification
specificity. Three primer pairs were used to detect transcript levels of three different
genes in the cassette crtB-2A-AtVTE3-2A-VTE4: crtB gene (primer crtB-F/crtB-R), AtVTE3 gene (primer VTE3-F/VTE3-R), and VTE4 gene (VTE4-F/VTE4-R). The reference
gene used in this study was cons7, one of the genes indicated as having the most stable
and consistent expression level across different soybean tissues including leaf and seed
(Libault et al ., 2008). Sequences of these primers were described in Table 2.1B.
Carotenoid extraction and HPLC (High performance liquid chromatography)
analysis
Carotenoid extraction (Kim et al., 2012) and HPLC analysis (Kean et al., 2008)
were used to examine the amount of carotenoid of individual seeds from the T1
41
generation of regenerated plants from soybean transformation. Seeds used for analysis
were: six replications from transformed seeds using the empty binary vector pZY101,
three replications from the binary vector containing expression cassette, and three
replications from wild type Maverick seeds. To avoid carotenoid degradation, entire
carotenoid extraction as well as carotenoid analysis steps were done in specific dim light
condition as far from strong direct light as possible (Kean et al., 2008). Briefly, single
dried seed was ground into a fine powder by liquid nitrogen in mortar and pestle (0.1g),
mixed with 3ml of ethanol containing 0.1% ascorbic acid (w/v), vortexed for 20 seconds
and placed in water bath at 850C for 5 min. Potassium hydroxide (120µl, 80% w/v) was
added in the carotenoid extract to saponify in the 850C water bath for 10min and then
placed immediately on ice after 1.5ml cold deionized water was added. Carotenoids were
extracted twice with 1.5ml hexane followed by centrifugation at 1,200g. Collected
aliquots of the extracts were dried under a stream of nitrogen. Dried carotenoid extracted
samples were then subjected to HPLC analysis. Carotenoids were re-dissolved in 50:50
(v/v) dichloromethane/methanol and separated on C30 YMC column (Waters Corp.,
Milford) with a Hewlett-Packard 1090A HPLC equipped with a model 79880A diode
array detector. Chromatograms were generated at 450nm with standards and solvents as
described by Kean et al. (Kean et al., 2008).
Tocopherol extraction and HPLC analysis
Tocopherol extraction and quantification of soybean seeds were performed based
on the procedure previously described (Dwiyanti et al., 2011) with minor modifications
(Kristin Bilyeu, unpublished). Tocopherols were analyzed from single dried mature seed.
Each seed was grounded using liquid nitrogen and 50 mg of seed powder was transferred
42
into a glass tube (VWR #89003-568) with PTFE screw cap (VWR #89003-568) and then
mixed with 1ml extraction solvent [80% EtOH with 1.5µg/ml tocol internal standard
(Matreya, #1797)]. The samples were sonicated (Brasonic® ultrasonic cleaner, SigmaAldrich) at room temperature for 15 minutes. After the sonication, the samples were
incubated at 40C for 30min and then centrifuged at 2,500 rpm for 10min. 0.5µl of the
supernatant was transferred into HPLC vial (Agilent #5182-0716). The analysis was
performed in Agilent C18 column with a consistent temperature at 400C. The assay was
done in a mobile phase of Acetonitrile with 90% methanol(v/v), flow rate 1ml/min, and
injection volume 25µl. Tocopherols were detected by fluorescence with excitation at
292nm and emission at 330nm (Yang et al., 2011).
Fatty acid analysis
Oil extraction and gas chromatography for fatty acid methyl esters followed the
previous study (Beuselinck et al., 2006) with minor modifications. Single seed was
bashed in an envelope by hammer. Crushed sample was extracted overnight in 1ml of
chloroform-hexane-methanol (8:5:2, v/v/v). Then, 150µl extracted solvent was
transferred to 1.5ml vial and mixed with 75µl methylating reagent (0.5 M methanolic
sodium methoxide–petroleum ether–ethyl ether, 1:5:2, v/v/v) then diluted in hexane to
1ml. An Agilent (Palo Alto, CA) series 6890 capillary gas chromatography was used with
a flame ionization detector (2758C), and AT-Silar capillary column (Alltech Associates,
Deerfield, IL). Standard fatty acid mixtures (Animal and Vegetable Oil ReferenceMixture
6, AOACS) were used as controls.
43
RESULTS
Transgene integration and expression analysis of soybean events
A total of 4 putative plants were regenerated from transformation experiments
using binary construct carrying crtB-2A-AtVTE3-2A-VTE4 (GOI) and 3 independent
empty vector control events (pZY101-1, pZY101-2, and pZY101-3) were developed from
a separate transformation experiment (600 explants in total). Of these plants, 3 of 4
putative GOI and all pZY101 plants were confirmed to carry the transgene bar as
indicted by three times leaf-painting tolerance. These events were further anlyzed by
PCR using genomic DNA extracts and primer pairs specific to bar gene and GOI,
separately. Our first round PCR screen was conducted on the bar gene with primer pair
bar-F/bar-R, and second round screen was on GOI (crtB-2A-AtVTE3-2A-VTE4) with
primer pairs BE3-F/BER-R and E3E4-F/E3E4-R. PCR results showed that 3 out of 4
events contained the bar gene (HYX-7-1, HYX-7-3, and HYX-7-4 (Figure 2.1B), which
was consistent with leaf-painting result. The PCR further confirmed that all three events
each carried a complete GOI cassette (crtB-2A-AtVTE3-2A-VTE4) since the two sets of
primers (BE3-F/BE3-R and E3E4-F/ E3E4-R) together covering the entire cassette
yielded expected bands (Figure 2.1C).
Molecular analysis of T1 generation
Seedlings of T1 plants from three T0 events (HYX-7-1, HYX-7-3, and HYX-7-4)
were grown in greenhouse and were subjected to leaf-painting and PCR analysis to
confirm transgene inheritance and segregation by confirming the presence of bar gene
and GOI. Leaf-painting and PCR results agreed, showing that bar gene was present only
in T1 plants of HYX-7-1 event whereas none of the other two events showed Liberty
44
herbicide tolerant or presence of the bar (Figure 2.1D). The presence of GOI in HYX-7-1
progeny plants but not in HYX-7-3 and HYX-7-4 progeny was also verified (Figure
2.1E). These results were summarized in Table 2.2B. Thus, only golden soybean HYX-71 event was further analyzed molecularly and biochemically.
Seed phenotype of transformed soybean plants
Of the three GOI events, one, i.e., HYX7-1, displayed “Golden soybean” seed
phenotype as shown by orange color in the seed, indicating a drastic increase in
carotenoid content (Figure 2.2A and B). Therefore, we expected at least crtB encoding
phytoene synthase was expressed in the “Golden soybean” seeds. Because these seeds
were derived from the first generation and therefore were still segregating, HYX-7-1
plant displayed a mixture of transgenic golden and null seeds (golden: null, 3:1 ratio).
Observation of transgenic golden soybean seeds of HYX-7-1G showed different intensity
of color from medium orange to dark orange, suggesting that there might be different
carotenoid contents in individual seeds. Quite surprisingly, however, seeds of other
regenerated plants (HYX-7-3; HYX-7-4) showed null phenotype that was similar to wild
type (Maverick) and pZY101 (Table 2.2A). Seedlings of T1 plants from these T0 events
(HYX-7-1, HYX-7-3, and HYX-7-4) were grown. However, the “golden seed” event
HYX-7-1 showed many seedless pods that indicated a decrease in seed yield for next
generation of golden seeds (Figure 2.2C)
Quantitative real time PCR (qRT-PCR) to determine transgene expression level
To analyze the expression levels of the three transgenes in crtB-2A-AtVTE3-2AVTE4 construct, qRT-PCR analyses were performed using total RNAs extracted from
single mid-mature T1 seed of transgenic soybean event HYX-7-1 (golden seeds HYX-745
1G) along with single mid-mature seed from wild type Maverick (WT) and empty vector
pZY101 transgenic plants. We collected and analyzed soybean mid-mature seeds because
the glycinin promoter driving our transgene cassette has peak activity during this seed
developmental stage (Flores et al., 2008). Because HYX-7-1 transgenic event displayed
distinct “golden” seed phenotype, transgenic seeds were readily chosen by visual
inspection. Each individual golden seed was then ground in liquid nitrogen and its total
RNA was analyzed in qRT-PCR. The result showed that HYX-7-1 expressed all three
genes strongly. Conversely, as we expected, WT and pZY101 controls expressed
endogenous soybean VTE4 gene homolog at 10-fold and 3-fold lower level than golden
seeds, respectively (Figure 2.3A). This result also suggested that soybean seeds expressed
VTE4 even though the expression level is relatively low and there hasn’t been previous
study on the presence and expression of this gene.
To confirm the above results, we examined more golden as well as WT and
pZY101 control seeds, showing the same results. Notably, although individual golden
seeds (4 seeds) of HYX-7-1 expressed all three genes strongly, they also showed
variation in expression level of these genes among individual seeds (Figure 2.3B).
Carotenoid and tocopherol contents in transgenic soybean seeds
Carotenoid analysis by HPLC
The drastic change and different intensities in seed color and much higher levels of
transgene expression in golden soybean seeds than controls prompted us to conduct seed
carotenoid analysis using HPLC. These analyses were performed to determine the total
amount and compositions of carotenoids of individual dry seeds from each plant of HYX7-1 (3 replications), WT (3 replications) and pZY101 controls (6 replications) with all
46
samples being measured as fresh weight. Several peaks in the HPLC chromatogram of
transgenic plant HYX-7-1 indicated that carotene contents had changed drastically
compared to WT, and most of these changes are in β-carotene components (Figure 2.4A).
The different carotenoids measured by HPLC included 9 or 9'-cis-lutein, all-trans-lutein,
zeaxanthin, 13- or 13'-cis-lutein, α-cryptoxanthin, β-crytpoxanthin, 15-cis-β-carotene, 13cis-β-carotene, α-carotene, all-trans-β-carotene, 9-cis-β-carotene. Golden seeds of HYX7-1 showed an increase in total carotenoid (sum of all carotenoid measured) as well as
pro-vitamin A (sum of β-crytpoxanthin, 15-cis-β-carotene, 13-cis-β-carotene, α-carotene,
all-trans-β-carotene, 9-cis-β-carotene) compared to WT and pZY101 (Figure 2.4B and
Table 2.3A). HYX-7-1 event produced very high levels of total carotenoid (highest
amount of 128 µg/g), which was 25-fold higher than in WT (highest amount of 5.03µg/g)
and 45-fold higher than in empty vector pZY101 seeds (highest amount of 2.85 µg/g).
The pro-vitamin A content of golden seeds of HYX-7-1 also significantly increased,
accounting for more than 98% of total carotenoid, as compared with 2-3% in WT or 316% in pZY101. Hence, the use of bacterial phytoene synthase crtB in the 2A-containing
construct driven by Glycinin promoter enabled accumulation of high β-carotenoids in
soybean seeds. This result also suggested that the α-branch in the soybean seed was
almost completely changed to the β-branch through the ectopic crtB. Surprisingly, there
was a large variation in carotenoid amount among individual seeds of same event,
ranging from 23.54µg/g -128.20µg/g fresh weight in HYX-7-1, from 1.8µg/g - 5µg/g in
WT, and 0.4µg/g - 2.8µg/g in pZY101 controls (Figure 2.4B Table 2.3A). This result
indicated a possible correlation between the levels of crtB gene and various intensities of
the golden color in distinct seeds which could stem from different carotenoid contents.
47
Notably, among individual components of the carotenoids in WT, lutein (95% - 98% of
total carotenoid) was found to be far more abundant than the other carotenoids. By
contrast, the lutein together with zeaxanthin decreased in golden seeds coupled with a
dramatic increase in all-trans-β carotene, 13-cis-β carotene, α-carotene, 15-cis-β carotene,
9-cis-β carotene, and β-cryptoxanthin (pro-vitamin A activity).
Tocopherol analysis by HPLC
Next, we wanted to know how much the coordinated expression of the two genes
encoding for 2methyl-6-phytylbenzoquinol methyltransferase (At-VTE3) and γtocopherolmethyltransferase (VTE4) affected tocopherol content in transgenic seeds. To
accomplish this, dry individual seeds in six replications of each HYX-7-1 (golden
soybean), pZY101, and three replications of WT were analyzed by HPLC. The result
showed that there was a decrease in total tocopherol in golden soybean seeds of HYX-7-1
(ranging from 0.106µg/mg-0.173µg/mg) compared to WT (ranging from 0.176µg/mg0.229µg/mg) and pZY101 controls (0.176 µg/mg-0.221 µg/mg). More specifically, the
golden soybean seeds showed a decrease in γ-tocopherol (0.07µg/mg-0.12µg/mg) and δtocopherol (0.03µg/mg), but no significant change, even though some golden seeds
showed increase in α-tocopherol (0.006µg/mg-0.023µg/mg) compared to WT (with γtocopherol, δ-tocopherol, and α-tocopherol being 0.12-0.14µg/mg, 0.05-0.06µg/mg, and
0.006-0.011µg/mg, respectively) (Figure 2.4C and Table 2.3B). Meanwhile, the golden
seeds generally showed decrease in all tocopherol compositions, when compared to
pZY101 controls (γ-tocopherol, δ-tocopherol, and α-tocopherol were 0.09-0.19µg/mg,
0.03-0.05µg/mg, and 0.015-0.023µg/mg, respectively). Of note, pZY101 showed
48
decrease in δ-tocopherol but increase in α-tocopherol, and no change in γ- tocopherol
compared to WT.
Fatty acid analysis
It was tempting for us to find out if coordinated expression of the three proteins
from the crtB-2A-AtVTE3-2A-VTE4 and the changes in tocopherol and carotenoid could
cause any change in another components in the transgenic seeds. Although tocopherols
are considered to contribute both the nutritional value and oxidative stability of soybean
oil, how the changes in tocopherols correlate to the content and compositions of fatty
acids in soybean remains unknown. To investigate this, three single seeds of each HYX7-1 (golden seeds), pZY101, and WT were analyzed the profiles of fatty acids by gas
chromatography (GC). The result showed that there was a change in fatty acid profile in
golden soybean seeds with decrease in oleic acid, linoleic acids, and palmitic acid, but
increase in linolenic acid (2-2.5 fold higher) compared to WT and pZY101 (Figure 2.5
and Table 2.4).
DISCUSSION
We observed an increase in carotenoids and a decrease in tocopherol (Table 2.3A and B)
in transgenic golden soybean seeds. In our study, the seed specific overexpression of
Erwinia uredovora psy (crtB) led to much increased accumulation of carotenoids mainly
in β-carotene and β-carotene equivalents that increased pro-vitamin A content to more
than 98%. It is important to generate high pro-vitamin A soybean to combat VAD in
developing countries using metabolic engineering approaches. Furthermore, this result
confirmed that the source of phytoene synthase (psy) gene has significant impact on the
level of carotenoid accumulation. This gene was overexpressed before in “Golden Rice
49
1” and “Golden Rice2” (Paine et al., 2005). Our present result further indicated that
overexpressing only one bacterial gene phytoene synthase could increase high amount of
β-carotene (pro-vitamin A). The same strategy of using only psy and similar high levels
of pro-vitamin A accumulation were implicated in transgenic canola (Shewmaker et al.,
1999) and flax plants (Fujisawa et al., 2008). On the other hand, two or more transgenes
in carotenoid pathway were introduced to other plant species to increase β-carotene
(Shewmaker et al., 1999; Ye et al., 2000; Diretto et al., 2007; Aluru et al., 2008; Fujisawa
et al., 2008; Cong et al., 2009; Jing et al., 2009; Ha et al., 2010; Kim et al., 2012). We
also noticed that T1 seeds of golden soybean event HYX-7-1 showed only 50%
germination rate with one week delay as compared to T1 seeds of WT and pZY101
controls. Delayed germination in transgenic seeds that were genetically engineered to
increase β-carotene has been previously reported in Arabidopsis (Lindgren et al., 2003).
Because β-carotene are also precursor of abscissic acid (ABA), higher amount of ABA
resulting from higher β-carotene could inhibit seed germination by inhibiting seed uptake
water and affecting a transition from germination to post-germination growth (Manz et
al., 2005). At the first three week growth, T1 seedling plants of golden soybean (HYX-71) showed dwarf phenotype with small and wrinkled leaves but after three weeks, there
was not any significant phenotypic difference compared to the other T1 plants (data not
shown). Dwarf phenotype was also described in transgenic tobacco and tomato plants
expressing phytoene synthase (Fray et al., 1995; Jing et al., 2009). These above
phenomena implied a likely competition for GGDP (geranylgeranyl diphosphate)
between gibberellic acid (GA) and carotenoid pathways. The transgenic plants showed
the negative correlation of carotenoid level and germination, positive correlation of
50
carotenoid level and ABA was also discussed by Lindgren (Lindgren et al., 2003).
Therefore, overexpressing phytoene synthase enabled to evaluate the importance of
regulating the flux through the isoprenoid pathway for normal hormone-controlled
growth. It is also a probable explanation for tocopherol reduction in golden soybean seed
that the source of GGDP for tocopherol as well as GA, chlorophyll, phylloquinone is
limited, since this is shifted toward carotenoid pathway by phytoene synthase. When T1
golden soybean plants (HYX7-1) developed pods, many pods were seedless leading to a
significant yield loss in T2 seeds (Fig 2.2C).
Although all three genes crtB, At-VTE3, VTE4 were integrated and expressed in
T1 seeds from the transgenic plant (HYX-7-1), only carotenoid showed significant
increased whereas tocopherol decreased. This result is consistent with the transgenic
canola seeds overexpressing crtB that increased total carotenoids predominantly as α-, βcarotenoid but reduced tocopherols (Shewmaker et al., 1999). We hypothesize that the
decrease of tocopherol in golden seeds is a competition of the same GGDP pool between
two pathways of carotenoids and tocopherols. Moreover, in the previous report,
Collakova and DellaPenna (2003) mentioned that homogentisate phytyltransferase
catalyzes the committed step in tocopherol biosynthesis, and overexpressing of this gene
resulted in total tocopherol increase 40% higher than wildtype in Arabidopsis seeds.
Consistent with this, co-expression of three key plastid-localized enzyme genes, i.e.,
Arabidopsis homogentisate phytyltransferase AtVTE2, AtVTE3, and AtVTE4 in
tocopherol pathway along with crtB in carotenoid pathway could not only shift
biosynthesis toward the accumulation of more nutritious α-tocopherol and β-carotene, but
also increase total contents of both tocopherols and carotenoids. Moreover, the order of
51
these genes should be rearranged in the 2A construct so that three genes encoding for
enzymes in tocopherol biosynthesis (AtVTE2, AtVTE3, and AtVTE4) would be placed
upstream of crtB. This would enhance the chance of a higher protein level of the AtVTE2,
AtVTE3, and AtVTE4, if a reduced protein translation of the promoter-distal open-reading
frame(s) does occur.
Several previous studies showed a correlation between fatty acid and tocopherol
contents. They indicated that changes in the fatty acids of soybean oil can alter its
tocopherol content and compositions (McCord et al., 2004; Scherder et al., 2006;
Baumgartner et al., 2010). In our study, golden soybean seeds HYX-7-1 showed a
significant change in the fatty acid compositions including increase in stearic acid and
especially, a remarkable increase in linolenic acid, but a decrease in oleic acid, linoleic
acid and palmitic acid as well as all tocopherol compositions. This result was contrast to
previous observations. For example, McCord and Wang illustrated that the reduced
linolenic contents is correlated with decreased total tocopherol, including particularly αand γ-tocopherol (McCord et al., 2004; Scherder et al., 2006). The disagreement between
these previous reports and our study is still unclear. By contrast, reduced palmitic acid
content was shown to correlate to an average increase in total tocopherol, but average
decrease in seed yield. Results from our present study agreed with Mounts (Mounts et al.,
1996) who genetically modified soybean with reduced palmitic acid and stearic acid as
well as less total tocopherol. Finally, both Salvin (Slavin et al., 2009) and our study
implied that a tocopherol content change in soybeans could potentially altered fatty acid
profile and vice versa.
52
Lastly, we want to emphasize that we were unable to analyze the protein levels of
the three transgenes as well as the cleavage-efficiency of 2A in construct (crtB-2AAtVTE3-2A-VTE4) due to the unavailability of antibodies against these individual
proteins. Clearly, it is important to estimate how the cleavage efficiency would affect
tocopherol and carotenoid contents in transgenic soybean seeds and therefore deserves
future study.
53
Figure legend
Figure 2.1A: Schematic diagram of cassette (2A-construct) for coordinated expression of
open-reading frames (ORFs without start and stop codon) of three genes to increase
carotenoid and tocopherol contents. The three genes are crtB (phytoene synthase), AtVTE3 (Arabidopsis thaliana 2-methyl-6-phytylbenzoquinol methyl transferase), and VTE4
(Glycine max γ-tocopherol-methyltransferase). Each ORF is fused with TP (soybean
Rubisco small subunit transit peptide) at 5’ end and seperated from adjacent ORFs by
FMDV 2A sequence. The cassette was driven by Glycinin gene promoter and Tvsp
terminator to create a single open reading frame (with one start and stop codon) encoding
polyprotein (crtB-2A-AtVTE3-2A-VTE4). Restriction site of EcoRI was created to flank
the construct which was carried within cloning plasmid pUC57. The arrows show the
location of designed primer sets used in PCR analysis (1) BE3-F, (1’) BE3-R, (2) E3E4F, (2’) E3E4-R.
Figure 2.1B: PCR analysis of bar gene from T0 plants using primer set of bar-F/bar-R
with empty vector pZY101 as positive control and Maverick as negative control. The
100bp DNA size markers were from NewEngland Biolab.
Figure 2.1C: PCR analysis of gene of interest (GOI) from T0 plants using primer set of
BE3-F/BE3-R (first six lanes from left marker) and E3E4-F/E3E4-R (last six lanes from
the middle marker). The 1kb DNA size markers were from Thermo Scientific.
Figure 2.1D: Representative PCR analysis of bar gene from T1 soybean lines using
primer set of bar gene (bar-F/bar-R) with T1 leave of HYX-7-1 event (HYX-7-1-1) as
54
positive control and Maverick (wild type) as negative control. The 100bp DNA size
markers were from NewEngland Biolab.
Figure 2.1E: PCR analysis of gene of interest (GOI) from T1 plants using primer set of
BE3-F/BE3-R (first eight lanes from left marker) and E3E4-F/E3E4-R (last eight lanes
from the right edge of gel) with HYX-7-1 event (HYX-7-1-1) as positive and Maverick
(wild type) as negative controls. The 1kb DNA size markers were from Thermo
Scientific.
Figure 2.2: Seed phenotypes of HYX-7-1 and Maverick plants.
A: Maverick (WT) and HYX-7-1 transgenic soybean seeds at mid-mature stage. (a) Seed
pods. (b) Cross-sections of seeds.
B: WT and HYX-7-1 transgenic soybean seeds at different development stage. (a) midmature stage of cross-section seeds. (b) full-mature stage of whole seeds.
C: Pod phenotype of T1 plants (a) WT, (b) transgenic HYX-7-1(HYX-7-1-11). The arrow
indicates seedless-pods of transgenic HYX-7-1-11 plant.
Figure 2.3: Quantitative real-time PCR (qRT-PCR).
A: qRT-PCR of mid-mature seeds. qRT-PCR was carried out with RNA extraction from
single mid-mature seeds of transgenic HYX-7-1G (golden seed), empty vector pZY101
and WT (Maverick) controls using three target genes of crtB, At-VTE3, VTE4. The cons7
gene was used as the normalization control. WT and pZY101 were not tested for target
genes crtB and At-VTE3, and their value was set as zero.
55
B: qRT-PCR of individual golden seeds. qRT-PCR was carried out with RNA extraction
from immature seeds of transgenic HYX-7-1 (four individual golden seeds, HYX-7-1G),
wild type Maverick (two individual seeds), and empty vector pZY101 (one seed) using
three target genes of crtB, At-VTE3, VTE4. The cons7 gene was used as the normalization
control. Maverick and pZY101 have not been tested for target genes crtB and At-VTE3,
and their value was set as zero.
Figure 2.4: Biochemical analysis of seed compositions.
A: Representative HPLC chromatograms of individual seeds of HYX-7-1 and wild type
Maverick. Chromatograms were generated at 450nm. The peaks are a) 9 or 9’-cis-lutein;
b) 9’ or 9-cis-lutein; c) all-trans-lutein; d) zeaxanthin; e) 13-or 13’-cis-lutein; f) β-apo-8’carotenal; g) α-cryptoxanthin; h) β- cryptoxanthin; i) 15-cis- β-carotene; j) 13-cis- βcarotene; k) α-carotene; l) all-trans- β-carotene; and m) 9-cis- β-carotene.
B: Total carotenoid and pro-vitamin A content of individual seeds of WT (Maverick) (3
replications), empty vector pZY101 (6 replications), and golden seeds of transgenic
HYX-7-1 (3 replications) using HPLC analysis. Total carotenoid levels were calculated
as the sum of twelve carotenoid subtype levels i.e. 9 or 9’-cis-lutein, 9’ or 9-cis-lutein,
all-trans-lutein, zeaxanthin, 13-or 13’-cis-lutein, α-cryptoxanthin, β- cryptoxanthin, 15cis- β-carotene, 13-cis- β-carotene, α-carotene, all-trans- β-carotene, and 9-cis- βcarotene. The provitamin A includes β- cryptoxanthin, 15-cis- β-carotene, 13-cis- βcarotene, α-carotene, all-trans- β-carotene, and 9-cis- β-carotene.
56
C: α-, µ-, and δ-tocopherol content of individual soybean seeds of wild type Maverick (3
replications), empty vector pZY101 (6 replications), and HYX-7-1 (3 replications) using
HPLC analysis.
Figure 2.5
Five fatty acid compositions in seeds of WT (Maverick), empty vector pZY101, and
HYX-7-1. The measurements shown are from 3 replications of each plant. The values are
percentage of each fatty acid components in total fatty acid content (total fatty acid is
calculated as sum of five major fatty acids analyzed).
57
Figure 2.1A
58
Figure 2.1B
59
Figure 2.1C
60
Figure 2.1D
61
Figure 2.1E
62
(a)
WT
HYX-7-1
(b)
W
Figure 2.2A
63
WT
HYX-7-1
(a)
(b)
HYX-7-1
Maverick
Figure 2.2B
64
(a) Maverick
(b) HYX-7-1-11
Figure 2.2C
65
HYX-7-1G
Maverick
Figure 2.3A
66
pZY101
HYX-7-1G
Maverick
Figure 2.3B
67
pZY101
HYX-7-1G
Maverick
Figure 2.4A
68
Figure 2.4B
69
Figure 2.4C
70
α-, γ-, δ- tocopherol amount in soybean seeds
(µg/mg fresh weight)
Five fatty acid compositions in soybean seeds (%)
Maverick
pZY101
HYX-7-1
Figure 2.5
71
Table 2.1A: Primers for PCR
No.
Name of primer
Sequence
BE3-F
ATGAATAATCCGTCGTTACTCAATCATGCG
BE3-R
TTGAAACCGGCATTCTTGAACCACTCAATG
E3E4-F
ATTGGACCGAGGATATGAGAGACGAC-3
E3E4-R
TCAGGTTTTCGACATGTAATGATGGCAAAC
1
Amplified products (bp)
2000
2
2000
bar-F
CAGCAGGTGGGTGTAGAGCGT
bar-R
CACCATCGTCAACCACTACATCG
3
72
268
Table 2.1B: Primers for qRT-PCR
No.
Name of primer
for qRT PCR
1
crtB-F
TTATTGACGATCAGACGCTGG
2
crtB-R
CTTCCTGAAAAGCCGCAAAC
3
AtVTE3-F
GAGCCGTTGAAAGAATGCAAG
4
AtVTE3-R
CCCTGTACGCTTCCCTTATTC
5
VTE4-F
CATGGAGAGTGGAGAGCATATG
6
VTE4-R
TGTAAGGATTGTTCGTCAGGG
7
cons7-F
ATGAATGACGGTTCCCATGTA
8
cons7-R
GGCATTAAGGCAGCTCACTCT
Sequence (5' to 3')
These primer sets yield amplified products of 150-200bp
73
Table 2.2A: Soybean yield and segregation of T1 seeds of four regenerated plants
Regenerated plants
Seed yield (#
seed)
Segregation
Golden/Null number
HYX-7-1
248
189 /59
HYX-7-2
290
0/290
HYX-7-3
444
0/290
HYX-7-4
268
0/290
74
Table 2.2B: Transgenic integration and inheritance in T1 plants.
Transformed
plants (T1)
Total
progeny
HYX-7-1(G)
Leafpainting
Presence of bar gene
Presence of GOI
R
S
Detected
Not
detected
Detected
Not
detected
12
12
0
12
0
12
0
HYX-7-3
12
0
12
0
12
0
12
HYX-7-4
12
0
12
0
12
0
12
R and S: Resistance and Sensitive to herbicide Liberty®, respectively in leaf painting.
75
Table 2.3A: Total content and compositions of carotenoids of transgenic soybean seeds of
HYX-7-1 (golden seeds), empty vector pZY101transgenic and wild type Maverick plants.
Samples
Maverick
pZY101
HYX-7-1(G)
9 or 9'-cis-lutein
0.29±0.20
0.19±0.11
0.15±0.1
9' or 9-cis-lutein
0.17±0.12
0.13±0.07
0.12±0.09
all-trans-lutein
2.33±1.35
1.34±0.74
1.1±0.72
zeaxanthin
0.07±0.07
0.02±0.02
*
13- or 13'-cis-lutein
0.05±0.03
0.03±0.01
*
α-cryptoxanthin
*
*
*
β-crytpoxanthin
*
0.01± 0.00
0.83±0.54
15-cis-β-carotene
*
0.01±0.00
2.64±1.67
13-cis-β-carotene
0.02±0.01
0.01±0.01
18.08±11.49
α-carotene
*
0.02±0.01
5.59±3.83
all-trans-β-carotene
0.04±0.02
0.06±0.02
58.12±37.29
9-cis-β-carotene
0.01±0.01
0.02±0.01
1.90±1.19
pro-vitamin A
0.07±0.01
0.12±0.04
87.16±55.88
total carotenoids
2.98±1.78
1.82±0.96
88.53±56.74
Data (µg/g fresh weight) are the means and standard deviations of three replications of WT Maverick, three
replications of golden seeds of HYX-7-1, and six replications of empty vector pZY101 transgenic plant. Total
carotenoid levels are calculated as the sum of twelve carotenoid subtype levels i.e. 9 or 9’-cis-lutein, 9’ or 9-cis-lutein,
all-trans-lutein, zeaxanthin, 13-or 13’-cis-lutein, α-cryptoxanthin, β- cryptoxanthin, 15-cis- β-carotene, 13-cis- βcarotene, α-carotene, all-trans- β-carotene, and 9-cis- β-carotene. The provitamin A includes β- cryptoxanthin, 15-cisβ-carotene, 13-cis- β-carotene, α-carotene, all-trans- β-carotene, and 9-cis- β-carotene.
76
Table 2.3B: Tocopherol analysis of mature seeds of HYX-7-1 (golden seed, HYX-7-1G),
empty vector pZY101 and wild type Maverick plants.
Samples
Tocopherol content (µg/mg)
Total
tocopherol
δ-tocopherol
γ-tocopherol
α-tocopherol
Maverick
0.05±0.01
0.13±0.01
0.01±0.00
0.19±0.02
pZY101
0.03±0.01
0.13±0.04
0.02±0.00
0.19±0.04
HYX-7-1G
0.03±0.00
0.09±0.02
0.01±0.01
0.14±0.02
Data (µg/g fresh weight) are the means and standard deviations of 6 replications of golden seeds of HYX-7-1,
6 replications of empty vector pZY101 transgenic plants, 3 replications of WT (Maverick). Total tocopherol
levels are calculated as the sum of three δ-, γ-, and α-tocopherol.
77
Table 2.4: Fatty acid analysis of mature seeds of HYX-7-1 (golden seeds), empty vector
pZY101 and wild type Maverick plants.
Fatty acid content (%)
Samples
Linolenic
acid (18:3)
Palmitic acid
(16:0)
Stearic acid
(18:0)
Oleic acid
(18:1)
Linoleic acid
(18:2)
Maverick
13.10±0.96
3.00±0.17
19.60±0.96
55.83±1.19
8.53±0.42
pZY101
12.53±0.12
4.17±0.06
16.17±0.60
57.93±0.64
9.30±0.66
HYX-7-1G
10.70±0.98
3.70±0.26
13.50±2.48
51.10±3.44
21.00±6.52
Data (percentage of each fatty acid) are the means and standard deviations of 3 replications of golden seeds of
HYX-7-1, empty vector pZY101 transgenic plants, and WT (Maverick). Total amount of five fatty acids is
measured as 100%).
78
LITERATURE CITED
Al-Babili, S. and P. Beyer. 2005. Golden Rice – five years on the road – five years to go?
Trends in Plant Science 10: 565-573.
Aluru, M., Y. Xu, R. Guo, Z. Wang, S. Li, W. White, et al. 2008. Generation of
transgenic maize with enhanced provitamin A content. Journal of Experimental Botany
59: 3551-3562.
Barampuram, S. and Z.J. Zhang. 2011. Recent advances in plant transformation. Methods
In Molecular Biology (Clifton, N.J.) 701: 1-35.
Baumgartner, R.M., G. Wang, T. Wang and W.R. Fehr. 2010. Tocopherol Content of
Soybean Lines with Mid-oleate and 1%-Linolenate [electronic resource]. Crop Science
50: 770-774.
Beuselinck, P.R., D.A. Sleper and K.D. Bilyeu. 2006. An Assessment of Phenotype
Selection for Linolenic Acid Using Genetic Markers. Crop Science 46: 747-750.
Collakova, E. and D. DellaPenna. 2003. Homogentisate phytyltransferase activity is
limiting for tocopherol biosynthesis in Arabidopsis. Plant Physiology 131: 632-642.
Cong, L., G. Yang, G. He, H. Liu, C. Wang and L. Chen. 2009. Expression of phytoene
synthase1 and Carotene Desaturase crtI Genes Result in an Increase in the Total
Carotenoids Content in Transgenic Elite Wheat (Triticum aestivum L.) [electronic
resource]. Journal of Agricultural and Food Chemistry 57: 8652-8660.
Diretto, G., S. Al-Babili, R. Tavazza, V. Papacchioli, P. Beyer and G. Giuliano. 2007.
Metabolic engineering of potato carotenoid content through tuber-specific overexpression
of a bacterial mini-pathway. PLoS ONE 2: e350-e350.
Dwiyanti, M.S., T. Yamada, M. Sato, J. Abe and K. Kitamura. 2011. Genetic variation of
γ-tocopherol methyltransferase gene contributes to elevated α-tocopherol content in
soybean seeds. BMC Plant Biology 11: 152-152.
Flores, T., O. Karpova, X. Su, P. Zeng, K. Bilyeu, D.A. Sleper, et al. 2008. Silencing of
GmFAD3 gene by siRNA leads to low [alpha]-linolenic acids (18:3) of fad3-mutant
phenotype in soybean [Glycine max (Merr.)]. Transgenic Research 17: 839.
Fray, R.G., P. Hedden, P.M. Bramley, D. Grierson, A. Wallace, P.D. Fraser, et al. 1995.
Constitutive expression of a fruit phytoene synthase gene in transgenic tomatoes causes
dwarfism by redirecting metabolites from the gibberellin pathway. Plant Journal 8: 693701.
Fujisawa, M., M. Watanabe, S.-K. Choi, M. Teramoto, K. Ohyama and N. Misawa. 2008.
Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering
79
with introduction of bacterial phytoene synthase gene crtB. Journal of Bioscience &
Bioengineering 105: 636-641.
Ha, S.H., Y.S. Liang, H. Jung, M.J. Ahn, S.C. Suh, S.J. Kweon, et al. 2010. Application
of two bicistronic systems involving 2A and IRES sequences to the biosynthesis of
carotenoids in rice endosperm. Plant Biotechnology Journal 8: 928-938.
Halpin, C., A. El Amrani, M.D. Ryan, S.E. Cooke and A. Barakate. 1999. Self-processing
2A-polyproteins -- a system for co-ordinate expression of multiple proteins in transgenic
plants. Plant Journal 17: 453-459.
Hartman, G.L., E.D. West and T.K. Herman. 2011. Crops that feed the World 2.
Soybean—worldwide production, use, and constraints caused by pathogens and pests.
Food Security 3: 5-17.
Jing, J., W. Gang, W. Jiehua and W. Ping. 2009. Functional analysis of multiple
carotenogenic genes from Lycium barbarum and Gentiana lutea L. for their effects on βcarotene production in transgenic tobacco. Biotechnology Letters 31: 305-312.
Kean, E.G., M.G. Ferruzzi and B.R. Hamaker. 2008. Carotenoid Bioaccessibility from
Whole Grain and Degermed Maize Meal Products [electronic resource]. Journal of
Agricultural and Food Chemistry 56: 9918-9926.
Kim, M.-J., Y.-S. Chung, S.-H. Ha, J.K. Kim, H.J. Kim, J.H. Pak, et al. 2012. Genetic
modification of the soybean to enhance the β-carotene content through seed-specific
expression. PloS ONE 7: e48287.
Lindgren, L.O., K.G. Stålberg and A.-S. Höglund. 2003. Seed-specific overexpression of
an endogenous Arabidopsis phytoene synthase gene results in delayed germination and
increased levels of carotenoids, chlorophyll, and abscisic acid. Plant Physiology 132:
779-785.
Libault M., Thibivilliers S., Bilgin D.D., Radwan O., Benitez M., Clough S.J., Stacey G.
2008. Identification of Four Soybean Reference Genes for Gene Expression
Normalization. Plant Gen. 1:44-54.
Manz, B., K. Müller, B. Kucera, F. Volke and G. Leubner-Metzger. 2005. Water Uptake
and Distribution in Germinating Tobacco Seeds Investigated in Vivo by Nuclear
Magnetic Resonance Imaging. Plant Physiology 138: 1538-1551.
McCord, K.L., S.R. Cianzio, S.R. Schnebly, G.A. Welke, W.R. Fehr and T. Wang. 2004.
Tocopherol content of soybean lines with reduced linolenate in the seed oil. Crop Science
44: 772-776.
Mounts, T.L., K.A. Rennick and S.L. Abidi. 1996. Effect of genetic modification on the
content and composition of bioactive constituents in soybean oil. Journal of the American
Oil Chemists' Society 73: 581-586.
80
Paine, J.A., C.A. Shipton, S. Chaggar, R.M. Howells, M.J. Kennedy, G. Vernon, et al.
2005. Improving the nutritional value of Golden Rice through increased pro-vitamin A
content. Nature Biotechnology 23: 482-487.
Rhee, Y. and P.E. Staswick. 1992. Nucleotide Sequence of a Soybean Vegetative Storage
Protein vspB Gene. Plant Physiology 98: 794-795.
Ryan, M.D. and J. Drew. 1994. Foot-and-mouth disease virus 2A oligopeptide mediated
cleavage of an artificial polyprotein. The EMBO Journal 13: 928-933.
Savidge, B., J.D. Weiss, Y.-H.H. Wong, M.W. Lassner, T.A. Mitsky, C.K. Shewmaker,
et al. 2002. Isolation and characterization of homogentisate phytyltransferase genes from
Synechocystis sp. PCC 6803 and Arabidopsis. Plant Physiology 129: 321-332.
Scherder, C.W., T. Wang, G.A. Welke and W.R. Fehr. 2006. Tocopherol Content and
Agronomic Performance of Soybean Lines with Reduced Palmitate [electronic resource].
Crop Science 46: 1286-1290.
Shewmaker, C.K., J.A. Sheehy, M. Daley, S. Colburn and D.Y. Ke. 1999. Seed-specific
overexpression of phytoene synthase: increase in carotenoids and other metabolic effects.
Plant Journal 20: 401-412.
Shintani, D. and D. DellaPenna. 1998. Elevating the vitamin E content of plants through
metabolic engineering. Science 282: 2098.
Slavin, M., L. Yu and W. Kenworthy. 2009. Antioxidant Properties, Phytochemical
Composition, and Antiproliferative Activity of Maryland-Grown Soybeans with Colored
Seed Coats [electronic resource]. Journal of Agricultural and Food Chemistry 57: 11174–
11185-11174–11185.
Tang, G., J. Qin, G.G. Dolnikowski, R.M. Russell and M.A. Grusak. 2009. Golden Rice
is an effective source of vitamin A. American Journal of Clinical Nutrition 89: 17761783.
Tavva, V.S., Y.-H. Kim, I.A. Kagan, R.D. Dinkins, K.-H. Kim and G.B. Collins. 2007.
Increased alpha-tocopherol content in soybean seed overexpressing the Perilla frutescens
gamma-tocopherol methyltransferase gene. Plant Cell Reports 26: 61-70.
Traber, M.G. and H. Sies. 1996. Vitamin E in humans: demand and delivery. Annual
Review of Nutrition 16: 321-347.
Van Eenennaam, A.L., K. Lincoln, T.P. Durrett, H.E. Valentin, C.K. Shewmaker, G.M.
Thorne, et al. 2003. Engineering vitamin E content: from Arabidopsis mutant to soy oil.
The Plant Cell 15: 3007-3019.
Winklhofer-Roob, B.M., E. Rock, J. Ribalta, D.H. Shmerling and J.M. Roob. 2003.
Effects of vitamin E and carotenoid status on oxidative stress in health and disease.
81
Evidence obtained from human intervention studies. Molecular Aspects of Medicine 24:
391.
Wright, T.R., G. Shan, T.A. Waish, J.M. Lira, C. Cui, P. Song, et al. 2010. Robust crop
resistance to broadleaf and grass herbicides provided by aryloxyalkanoate dioxygenase
transgenes. Proceedings of the National Academy of Sciences of the United States of
America 107: 20240-20245.
Yang, W., R.E. Cahoon, S.C. Hunter, C. Zhang, J. Han, T. Borgschulte, et al. 2011.
Vitamin E biosynthesis: functional characterization of the monocot homogentisate
geranylgeranyl transferase. Plant Journal 65: 206-217.
Ye, X., S. Al-Babili, A. Kloti, J. Zhang, P. Lucca, P. Beyer, et al. 2000. Engineering the
Provitamin A (Beta-Carotene) Biosynthetic Pathway into (Carotenoid-Free) Rice E.
Science 287: 303.
Zeng, P., J.C. Polacco, Z. Zhang and D.A. Vadnais. 2004. Refined glufosinate selection
in Agrobacterium-mediated transformation of soybean (Glycine max (L.) Merrill). Plant
Cell Reports 22: 478-482.
Zhang, Z., T.E. Clemente, P. Staswick and A. Xing. 1999. The use of glufosinate as a
selective agent in Agrobacterium-mediated transformation of soybean. Plant Cell, Tissue
and Organ Culture 56: 37-46.
82