Plant Science 172 (2007) 1025–1036
www.elsevier.com/locate/plantsci
Use of suppression subtractive hybridization approach to identify genes
differentially expressed during early banana fruit development
undergoing changes in ethylene responsiveness
D. Mbéguié-A-Mbéguié a,*, O. Hubert b, X. Sabau c, M. Chillet b,
B. Fils-Lycaon d, F.-C. Baurens c
a
CIRAD, UMR 1270 QUALITROP, Capesterre-Belle-Eau, Guadeloupe, F-97130, France
b
CIRAD, UPR 24 Tropical, Capesterre-Belle-Eau, Guadeloupe F-97130, France
c
CIRAD, UMR 1096 PIA, Montpellier F-34098, France
d
INRA, UMR1270 Qualité des fruits et légumes tropicaux, F-97170 Petit-Bourg, France
Received 16 October 2006; received in revised form 19 January 2007; accepted 8 February 2007
Available online 16 February 2007
Abstract
Little is known about the early green developmental stage of banana fruit before the commercial harvesting stage. In this study, we demonstrate
that banana fruit (cv Cavendish) grown under our pedoclimatical conditions undergoes changes in ethylene responsiveness between 40 (immature
fruit unable to respond to ethylene), 60 and 90 DAF (days after flowering; early and late mature fruit able to respond to ethylene, respectively).
Further, we have combined subtractive suppression hybridization (SSH) and macro-array hybridization to construct four different SSH libraries
comprising a total of 3072 clones and identify 876 clones that are differentially expressed during fruit ripening. Some of these positive clones were
partially sequenced to generate ESTs. Sequence analysis revealed that 163 clones on 177 (92%) presented a high similarity with different genes in
the database and were related to various plant mechanisms. Northern blot analysis and real-time quantitative PCR conducted on 24 selected clones
showed that the subtraction worked properly and led to get more insights into the early green developmental stages of banana. These genes will
contribute to increase pools of public EST collections of banana for identification of candidate genes and the providing of molecular markers usable
to improve banana fruit quality throughout conventional breeding or biotechnology approaches.
# 2007 Elsevier Ireland Ltd. All rights reserved.
Keywords: Banana; Ripening; Gene expression; Quality; SSH
1. Introduction
Banana fruits are the staple food of over 400 million people
in the developing world, not only as a popular dessert fruit, but
also as a source of vital carbohydrate [1–3]. At economical
level and although its relatively small (13%) proportion of total
world export production, the value of banana exports well
outranks those of other fruits, such as apples and oranges as
well as vegetables such as tomatoes and potatoes [4–6]. Banana
fruit undergoes a climacteric ripening process with a sharp rise
and fall in the rate of ethylene production before the early
climacteric rise of respiration [4,7]. Banana appears also to be
* Corresponding author. Tel.: +590 590 86 30 21; fax: +590 590 86 80 77.
E-mail address: [email protected] (D. Mbéguié-A-Mbéguié).
0168-9452/$ – see front matter # 2007 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.plantsci.2007.02.007
one of tropical fruits harvested and transported in green under
refrigeration at 13–15 8C before being ripened by treatment
with exogenous ethylene [8,9] for sale. This last point underlies
the importance of the physiological state of fruit at harvesting
point in term of level of ethylene responsiveness. Currently and
in spite of the development of forecast tools for harvesting and
of postharvest technologies [10,11] the harvesting point is not
necessarily the best in regards with the commercial constraints.
Consequently, postharvest problems, accounting for a high
percentage of product loss, are generally observed due to the
very limited shelf life of fruit and an exogenous ethylene
treatment not necessarily adapted. These postharvest problems
include the ‘‘mixed-ripe’’ and/or ‘‘ship-ripe’’ fruit during
transit, wound anthracnose (the main postharvest disease that
develops during storage and fruit ripening), and a too rapid
ripening process [12–15]. The development of appropriate tools
1026
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
usable to optimize objectively the harvesting point is now
limited by the lack of knowledge about the mechanism of
banana ethylene responsiveness that controls the initiation of
fruit ripening. The physiology of banana fruit ripening has been
the subject of many studies at physicochemical, biochemical
and molecular levels. These studies offer the potential for
insights into the basis of fruit ripening [12,16–20]. However
they mainly focus on banana fruit taken at commercially
harvesting point, and thus, can not account for all changes that
occur during early green developmental stages, a critical period
for changes in ethylene responsiveness [15].
We have initiated physico-chemical, biochemical and
molecular investigations of some ripening processes that
influence the main banana quality traits, including the initiation
of ripening processes, polyphenol and sugar metabolism
[20,21]. The aims of the molecular aspect of theses studies
are, (i) to provide a pool of developmental- and ripening-related
genes of banana fruit for further functional genomics studies,
and (ii) to study the patterns of expression of key genes
involved in the above main aspects of banana quality traits in
order to get further insights into banana fruit ripening and
identify the related candidate genes for further banana genetics
studies. As a first step in the molecular part of this project, we
report here the successful use of the subtractive hybridization
method to isolate and identify genes whose expression is
modified during early banana fruit development stages
corresponding to changes in ethylene responsiveness. Macroarray, Northern blot and real-time quantitative PCR approaches
were used to confirm the subtraction procedure and get more
insights into molecular mechanism of early development of
green banana fruit.
2. Material and methods
2.1. Plant material, fruit treatment and storage
Banana fruit (Musa triploid AAA, Cavendish, cv Grande
Naine) were harvested from plants grown at CIRAD-FLHOR,
(altitude 250 m; andosol; rainfall 3500 mm/year), Guadeloupe,
French West Indies. Plants were grown under standard
conditions, but bunches were sheathed by plastic films to
limit rodent and insect attacks and to harmonize the
development of the whole fruits of the bunch. From flowering
stage, which corresponds to the horizontal position of fruit on
the bunch, fruit developmental stages were determined
according to the concept of heat units [22]. In summary,
taking a threshold temperature for fruit growth of 14 8C for the
Cavendish variety, cumulative heat units were determined by
the formula S [(the daily mean of temperatures taken every
2 min)-14] and expressed in degree days (8C/J). According to
this criterion, the fruits used in this study were harvested from at
least three bunches at 400 8C/d, 600 8C/d and 900 8C/d (the
commercial harvesting stage). In regard with the flowering
stage and the plant growth conditions described previously, the
harvesting points 400, 600 and 900 8C/d correspond to
approximately 40, 60 and 90 DAF (days after flowering),
respectively.
At each harvesting stage, only internal fingers of the fourth
hand, considered as comparable [23], were sampled and kept
for 24 h in chambers ventilated with humidified air. Immediately after, ethylene production was measured from three
randomly selected fruits to ensure that there was no production
of ethylene linked to the harvest stress.
The fruit were separated into two groups. The first group was
exposed to 10,000 ppm of acetylene for 24 h at 25 8C in the
dark while the second group (control) was kept on air during all
the treatment. Immediately after acetylene treatments, the
representative samples of control and treated fruit were peeled.
Peel and pulp tissues were separately sliced, frozen in liquid
nitrogen and stored at 80 8C for subsequent analysis. Samples
of three remind treated fruits were taken on a daily basis for
ethylene and firmness measurements.
2.2. Ethylene and firmness measurements
Ethylene production of the whole fruit was measured daily at
a constant room temperature of 23 8C by gas chromatography
(Hewlett Packard GMBH, Waldbronn, Germany) after 1 h of
confinement in a jar [24]. It was expressed in mL kg1 h1. Pulp
firmness was measured using a TA-XT2 penetrometer as
described [25] and was expressed in Newton (N).
2.3. Total RNA extraction and preparation of subtracted
cDNA libraries
Total RNA was extracted separately from frozen peel and
pulp tissues (25 g each) according to the Hot-Borate method
[26] modified as follows. Two phenol:chloroform:iso-amylic
alcohol (25:24:1, v/v/v) and one chloroform:iso-amylic
alcohol (24:1, v/v) extractions were incorporated into the
RNA purification protocol to remove contaminant proteins,
and a salt precipitation step using potassium acetate, leading
to removal of the salt-insoluble material, was avoided. The
yields of total extracted RNA were approximately 51.8–
77.8 mg of RNA per gram of peel tissue and 136–268 mg of
RNA per gram of pulp tissue, according to the developmental
stage of fruit. Using the PolyATtract1 mRNA isolation system
kit (Promega, Lyon, France), the Poly(A)-rich RNA fraction
was purified separately from each RNA extract according to
the manufacturer’s instructions. For the construction of
subtracted libraries, three pools of PolyA+-RNA were made
as follows:
Pool 1: equal amounts of PolyA+ isolated from peel and pulp
of untreated fruit harvested at 40 DAF.
Pool 2: equal amounts of PolyA+ isolated from peel and pulp
of untreated fruit harvested at 60 and 90 DAF.
Pool 3: equal amounts of PolyA+ isolated from peel and pulp
of acetylene-treated fruit harvested at 60 and 90 DAF.
Four subtracted libraries were constructed using the PCRselect cDNA subtraction kit (Clontech, Saint Quentin en
Yvelines, France) and according to the manufacturer’s
instructions.
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
The reciprocal libraries A and B were constructed with
cDNA from pool 1 as tester and cDNA from pool 2 as driver
(library A), and cDNA from pool 2 as tester and cDNA from
pool 1 as driver (library B). These two libraries are putatively
enriched with genes that are up-regulated during the green
development stage up to 40 DAF (library A) and from 60 DAF
and after (library B).
Library C was constructed with cDNA from pool 3 as tester
and cDNA from pool 1 as driver. Library D was constructed
with cDNA from pool 3 as tester and cDNA from pool 2 as
driver. These two libraries were constructed to recover genes
specifically induced by ethylene treatment at mature green
stage.
After separation through a chromaspin 1000 column
(Clontech, Ozyme, Saint Quentin en Yvelines, France), the
subtracted cDNA products from were ligated into the pGEM-T
Easy cloning vector (Promega, Lyon, France) for subsequent
transformation of E. coli strain DH5a high efficiency
(Invitrogen, Cergy Pontoise, France). For each library, 768
putative positive clones were selected on X-GAL-, IPTGsupplemented 2YT-ampicillin medium. For each library, 24
were randomly selected and subjected to PCR using SP6 and T7
primers to estimate the average size of insert. PCR was carried
out in a total volume of 25 ml containing 200 nM of each
primer, 150 nM of dNTPs, 1.5 mM MgCl2, 5U of Taq
polymerase (Eurobio, les Ulis, France). PCR conditions were
as follow: melting of the DNA at 95 8C for 10 min followed by
30 cycles of amplification with denaturation step at 95 8C
for 30 s, annealing at 46 8C for 30 s, and elongation at 72 8C
for 45 s.
1027
2.5. Nucleotide sequencing and data analysis
Each ESTs sequence were obtained from an automatic DNA
sequencer (ABI prism) at the Institut de Génétique Humaine
platform facilities (Genopole Languedoc-Rousillon, Montpellier, France) and through a single sequence run. DNA and
predicted amino acid sequences were compared against
available public DNA and protein databases using the BLAST
programs at NCBI [28].
For macroarray membrane analysis, radioactive intensity of
each element on the array was quantified using BAS 5000 (Fuji)
and captured by using ArrayGauge version 1.21 (Fujifilm). The
local background was subtracted from the value of each spot.
Normalization was performed by adjusting the intensity of each
spot with reference to the total intensity of the internal standard
(rDNA and actine probe) using the formula: Signal = Signal
intensity of each element/Standard intensity 100. Ratios were
calculated by dividing normalized intensity value of one
condition with that of the other.
2.6. Northern blot analysis
Northern blot analyses were performed separately on the
peel and pulp of banana fruit harvested 40, 60 and 90 DAF.
Total RNA (50 mg) was fractionated on a 1.2% (w/v) agarose
gel containing formaldehyde in MOPS buffer [29] and then
transfered onto Hybon N+ membranes (Amersham) following
the manufacturer’s instructions. Blots were hybridized with the
probe corresponding to SSH cDNA fragments and washed as
described for macro array analysis. A picture of the ethidium
bromide-stained gel was used to check for equal loading.
2.4. Screening the subtracted libraries by macro arrays
analysis
2.7. Gene expression by real-time quantitative PCR
Inserts from individual clones from subtractive libraries A
and B were PCR-amplified. Amplified PCR products were
spotted off onto a 11.9 cm 7.8 cm Hybond N+ membrane
(Amersham, Orsay, France) using an automatic Gridder
(Genomic solution). DNA was bound to the nylon by soaking
the membrane in 0.4 M NaOH for 7 min. Membranes were
subsequently neutralised with 1.5 M NaCl in 0.5 M Tris–HCl
pH 7.5 for 7 min and finally washed with a 2 SSC solution.
Dried membranes were cross-linked at 70 mJ per cm2. Wheat
rDNA genes and banana actin cDNA [7,27] were also spotted
onto the membrane as internal controls. First strand cDNA
probes were obtained by retro transcription of 10 mg total RNA
with RevertAid MmuLV (Fermentas) using oligo dT(18)
according to the furnisher’s instructions. Approximately 500 ng
of cDNA were labelled with 40 mCi of [a32P]dCTP using
Megaprime labeling KIT (Amersham). Membranes were prehybridized overnight at 65 8C in a solution containing 7
SSPE, 5 Denhart solution, 0.5% SDS, 0.2 mg mL1 tRNA as
blocking agent. Overnight hybridizations were performed at
65 8C in 2 SSPE, 5 Denhart, 0.5% w/v SDS, 1% w/v dextran
sulfate, 0.2 mg mL1 tRNA. Membranes were then washed at
65 8C for 30 min twice with 2 SSPE, 0.1% SDS, then with 1
SSPE, 0.1% SDS and finally with 0.1 SSPE, 1% SDS.
Real-time quantitative PCR (qPCR) was performed with the
ABI PRISM 6100 Apparatus (Applied Biosystems, Courtaboeuf, France) to analyse the gene expression of 6 cDNA clones
including clone SSh2b11, SSh3d10, SSh2e08, SSh2a02,
SSh3e08 and actin gene [7] used as standard. For each gene,
forward and reverse primers (Table 1) were designed on the
basis of their isolated sequences and using the online Primer3
Software [30]. The cDNA pools used to perform qPCR were
synthesized from total RNA sample (2 mg). The RNA sample
was isolated separately from peel and pulp tissues of treated and
untreated fruit harvested at 40, 60 and 90 DAF. To this end,
random hexamer and AMV reverse transcriptase (Promega,
Lyon, France) was used following the manufacturer’s instructions. Five ml of each cDNA pool 10-fold diluted were used to
perform the qPCR carried out in a total volume of 25 ml
containing 160 nM of each primer, 150 nM of dNTPs, 1.5 mM
MgCl2, 0.2 of SYBR green PCR mix reagent (Applied
Biosystems), 5 U of Taq polymerase (Eurobio, les Ulis,
France). PCR conditions were as follow: melting of the
DNA at 95 8C for 5 min followed by 45 cycles of amplification
with denaturation step at 95 8C for 30 s, annealing at 50 8C for
30 s, and elongation at 72 8C for 45 s. Fluorescence was
analysed using Sequence Detection Software (Applied
1028
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
Table 1
Primers used for gene expression analysis by real-time-quantitative PCR
Target
Primers
Sequences
(50 -30 )
Amplicon
length (bp)
Actin
Act-F
Act-R
GAGAAGATACAGTGTCTGGA
ATTACCATCGAAATATTAAAAG
231
SSh3e08
3e08F
3e08R
CTCATGTGGAGCTCAATCTTCTT
ATAAGTTCACCGATGCCATCTT
178
SSh2b11
2b11F
2b11R
CTGCACGATCCAACAGATCC
GTCCATCAGAAGGTGGAGGTC
176
SSh3d10
3d10F
3d10R
ATATATGCTTGCAGGAGATGGTG
ACGGAGGGTTAGATTTAGACCAA
154
SSh2e08
2e08F
2e08R
CATTGTGGACGTCAATTCTCAG
AACTTAAAGCGTCGCCCATC
113
SSh2a02
2a02F
2a02R
ACAGTATTCGGTCACCCATGTAT
CCGTCATCTACAGAAACTGGAAC
176
acetylene entered the climacteric phase 3 days after being
treated and produced detectable amounts of ethylene
(12 ml kg1 h1), concomitantly with the beginning of the
decrease of pulp firmness. Then after, the rate of ethylene
production increased progressively, reaching a high level of
18 ml kg1 h1, 6 days after treatment. The fruit harvested 90
DAF (commercial harvesting stage) and exposed to exogenous
acetylene took one day to enter the climacteric phase and to
produce the first traces of detectable ethylene (3 ml kg1 h1).
Thereafter, endogenous ethylene production of the fruits
increased to reach a maximum of 11 ml kg1 h1 6 days after
treatment. This augmentation was followed by a decrease, to
reach a low level, nevertheless much higher than before
treatment. This is a characteristic pattern of ethylene
production commonly described in banana fruit [8,13]. These
fruits harvested 60 and 90 DAF and of which ripening can be
initiated by acetylene treatment were considered as early and
late mature green fruit, respectively. It is interesting to observe
Biosystems). PCR reaction was duplicated at least once and for
each sample, a Ct (threshold cycle) value was calculated from
the amplification curves by selecting the optimal DRn
(emission of reporter dye over starting background fluorescence) in the exponential portion of the amplification plot. As
the error bar values were extremely low (less than 3% of the
average value) they are not shown on the graphs. The
amplification efficiency of each gene (75–95% with slopes
of 3.31 to 3.5) was measured using the CT slope method. To this
end, five-log of a 10-fold serial dilution range (1, 101, 102,
103, 104, 105) were generated from a mixture of equal
amounts of each cDNA pools synthesized as described above.
Five microliters of each dilution sample were subjected to
qPCR amplification as described above. To determine relative
fold differences for each sample, the Ct value for each SSh gene
was normalized to the Ct value for actin gene and was
calculated relatively to a calibrator using the formula 2DDCt.
For control fruit, the calibrator was untreated fruit harvested 40
DAF while for acetylene-treated fruit, the calibrator was
control fruit.
3. Results and discussions
3.1. Ethylene production and fruit softening in developing
banana
Based on the heat unit concept [22], green banana fruit were
harvested at three developmental stages namely 40, 60 and 90
DAF, treated with exogenous acetylene (an ethylene analogue)
and then after monitored over 0–11 days for their ethylene
production and pulp firmness (Fig. 1A and B). Neither ethylene
production nor changes in pulp firmness were observed in these
fruits at harvesting time (day 0). Eleven days after treatment
with acetylene, neither endogenous ethylene production nor
changes in softening were observed in fruit harvested 40 DAF,
in accordance with data previously obtained by [15]. These fruit
harvested 40 DAF and that do not produced ethylene 11 days
after acetylene treatment were considered as immature green
fruit. Fruits harvested 60 DAF and exposed to the exogenous
Fig. 1. Physiochemical characterization of green banana fruit harvested at early
developmental stages. The ethylene production (A) and firmness values (B) of
fruits harvested 40, 60 and 90 days after flowering treated with 10,000 ppm of
acetylene were measured up to 11 days after treatments. Standard errors of the
analysis are indicated by the vertical bars (n = 3).
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
1029
that, although fruit harvested 60 and 90 DAF are all mature
green, they do not display the same level of ethylene
responsiveness as shown by their contrast in term of time
course of acetylene response, pattern and level of ethylene
production. Compared to fruit harvested 90 DAF, those
harvested 60 DAF respond later to acetylene treatment.
Additionally, they display a different pattern and produce a
high level of ethylene. In order to get more insights into
molecular mechanism that could explain this contrast observed
between fruits harvested 40, 60 and 90 DAF, we attempted to
isolate genes of which expression is differentially regulated 40,
60 and 90 DAF of green development and in relation with
acetylene treatment.
3.2. Construction and characterization of the subtracted
cDNA libraries
SSH method was used to isolate genes that are differentially
regulated during the green developmental stages of banana fruit
and that show a marked contrast in term of acetylene response.
To this end, three populations of mRNA were prepared from
peel and pulp fruit tissues harvested 40, 60 and 90 DAF, and
acetylene-treated fruit harvested 60 and 90 DAF. To obtain
genes that are up- or down-regulated during green stage
development of banana fruit two reciprocal libraries (namely A
and B) were constructed by subtracting cDNA of mature green
stage from those of immature green stage and conversely (see
material and methods). To obtain genes that are induced by
ethylene at mature green stage, two additional libraries (namely
C and D) were constructed. For each library 768 clones were
isolated and average insert size estimated by PCR carried out on
24 selected clones was approximately 1000 pb. Although the
SSH method contains a RsaI digestion step that usually gives a
small size insert of the recombinant clones [31], the high
average insert size that we obtained is probably due to the size
fractionation step included to the protocol and that removes the
short cDNA fragments.
The subtraction efficiency was checked by macro array
analysis only on libraries A and B because they are reciprocal.
To this end, the duplicate dot blots of these two libraries were
successively hybridized with cDNA probes synthesized from
mRNA extracted from immature green fruits (forward probe)
and from untreated-mature green fruit (reverse probe). The
hybridization signal obtained with forward and reverse probes
was quantified and normalized. Then for each clone, the ratio of
normalized signal obtained after hybridization with forward
and reverse cDNA probes was calculated to assess the
difference of expression. Some clones present in libraries A
and B were plotted according to their respective ratio values
(Fig. 2). Our data revealed that the expression level differed
significantly by a factor comprised between 0.25- and 4-fold.
Some clones of both libraries A and B exhibit an intermediate
ratio suggesting that the subtraction was not total. However,
more than 300 clones isolated from forward library appeared to
be 2-fold or more up-regulated. This amount of clones reaches
600 if a ratio of 1.4-fold is retained. Approximately the same
amount of clones from the reverse library are down-regulated in
Fig. 2. Graphical representation of the differential expression of clones of the
two reciprocal libraries A and B after macroarray analysis. Replica dot blots
were prepared from the SSH libraries A and B and successively hybridized with
cDNA probes synthesized from mRNA extracted from fruit harvested 40 days
after flowering (forward probe) and from untreated-fruit harvested 60 and 90
days after flowering (reverse probe). The hybridization signals obtained with
forward and reverse probes were quantified and normalized against the control
signal. Then for each clone, the ratio of normalized signal obtained after
hybridization with forward and reverse cDNA probe was calculated to assess the
difference of expression. The number of clones present in libraries A and B was
plotted according to their respective ratio values.
the same portion suggesting that the subtraction step was
efficient in both libraries A and B. At this step, all theses clones
do not, however, constitute a set of unigenes. It is probable that
several differentially-regulated clones are redundant since they
could be a part of the same cDNA digested more than one time
with RsaI, an enzyme known to have a common restriction site
or simply, highly expressed genes that have not been
completely suppressed.
3.3. Sequencing and analysis of EST from banana fruit
SSH libraries
To identify a putative set of genes involved in green stage
banana fruit ripening process, and to characterize the estimated
function and the redundancy among the putative positive
clones, 384 individual clones were single run sequenced.
Theses clones were picked out from the four libraries among
those that showed at least a 1.2-fold differential expression after
macro-array analysis. After removing the vector sequence and
eliminating EST clones with a poor sequence quality,
nucleotide sequences of the 177 EST clones were compared
to previously reported sequences in the EMBL/GenBank
databases using the BlastX search analysis algorithm (Table 1).
For 14 EST clones (8%), database searches failed to provide us
with any significant similarity with listed sequences, suggesting
that these clones correspond to unidentified genes and thus
could be novel. Full-length cloning should be necessary to
identify ORFs of these unmatching clones, as these sequences
1030
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
Table 2
cDNA clones isolated from banana fruit through suppression subtractive hybridization (SSH)
Libraries a
Size d
Accession n8
E-value e
Homology to
Transcriptional and translational gene regulation
A
SSh2b03
1
A
SSh2c12
1
A
SSh1c03
1
B
SSh2e08
1
585
283
210
224
DV270716
DV270717
DV270718
DV270719
3.00E–58
1.00E–12
3.00E–07
1.00E-18
RNA binding protein 45 [N. plumbaginifolia]
Putative leucine zipper protein [O. sativa]
Putative multiple stress-responsive zinc-finger protein [O. sativa]
MADS-box transcription factor AG [A. praecox]
Hormonal metabolism
A
SSh2a01
1
227
DV270720
8.00E–14
1
1
1
398
497
289
DV270721
DV270722
Already registered
2.00E–57
2.00E–28
4.00E–37
S-adenosyl-L-methionine:salicylic acid carboxyl
methyltransferase-like protein [A. thaliana]
pirjjS57964 lipoxygenase (EC 1.13.11.12)—[common tobacco]
IAA-amino acid hydrolase [Oryza sativa]
ACC oxidase [Musa accuminata]
1
1
8
60
1
1
1
1
1
1
2
3
2
2
2
380
248
319
920
463
295
531
471
281
171
498
380
553
403
149
DV270723
DV270724
Already registered
Already registered
DV270725
DV270726
DV270727
DV270728
DV270729
DV270730
DV270731
DV270732
DV270733
DV270734
Aready registered
5.00E–16
2.00E–32
6.00E–16
1.00E–118
4.00E–30
4.00E–21
5.00E–38
3.00E–37
1.00E–07
8.00E–09
1.00E–77
5.00E–15
2.00E–28
5.00E–36
2.00E–10
Lipid transfer protein precursor [G. hirsutum]
Catalase [S. maritima subsp. salsa]
Class III acidic chitinase [Musa accuminata]
Class III acidic chitinase [Musa accuminata]
Patatin-like protein [S. bicolor]
Patatin-like protein 1 [N. tabacum]
Putative nematode-resistance protein [H. vulgare]
Putative nematode resistance-like protein [O. sativa]
Putative chitin-inducible gibberellin-responsive protein [O. sativa]
Polyubiquitin [P. sylvestris]
Catalase 2 [Z. aethiopica]
Lipid transfer protein precursor [G. hirsutum]
P-rich protein NtEIG-C29 [N. tabacum]
PR-4 type protein [V. vinifera]
Beta-1,3-glucanase [Musa accuminata]
1
409
DV270735
8.00E–53
SSh1h03
SSh2b05
SSh2d10
SSh2h06
SSh2f04
SSh3c11
SSh3c09
SSh3e08
SSh3e11
SSh3e06
SSh3h03
SSh3h09
2
1
1
1
1
1
2
2
5
2
2
1
348
379
507
384
380
404
730
461
485
228
507
667
DV270736
DV270737
DV270738
DV270740
DV270741
DV270763
already registered
DV270742
DV270743
DV270761
DV270762
DV270744
6.00E–46
1.00E–08
3.00E–43
2.00E–25
4.00E–07
2.00E–29
5.00E–82
2.00E–27
2.00E–16
3.00E–30
3.00E–86
5.00E–62
Putative methylcrotonyl-CoA carboxylase beta chain,
mitochondrial precursor [O. sativa]
Putative oryzain gamma chain precursor [O. sativa]
Long cell-linked locus protein [Z. mays]
Polyubiquitin [Z. mays]
Putative glucose translocator [M. crystallinum]
Legumin-like protein [Z. mays]
Arachidonic acid-induced DEA1 [L. esculentum]
Isoflavonol reductatase [Musa accuminata]
Thioredoxin h [A. thaliana]
Metallothionein-like protein [E. guineensis]
Adenosylhomocysteinase (EC 3.3.1.1) [wheat]
Adenosylhomocysteinase (EC 3.3.1.1) [wheat]
Sulfate transporter-like protein [O. sativa]
Unidentified functions
A
SSh1a07
A
SSh1f02
A
SSh1g01
A
SSh1g10
1
1
1
1
343
464
260
387
DV270746
DV270747
DV270739
DV270745
1.00E–40
4.00E–44
6.00E–13
4.00E–46
Unknown
Unknown
Unknown
Unknown
Novel genes
A
A
A
A
B
B
B
B
C
C
D
D
D
1
1
1
1
1
1
1
1
1
1
1
1
1
248
103
57
168
68
202
51
137
155
72
111
440
86
DV270749
DV270748
DV270754
DV270755
DV270757
DV270750
DV270759
DV270751
DV270758
DV270752
DV270753
DV270756
DV270760
No
No
No
No
No
No
No
No
No
No
No
No
No
A
D
D
Sequence ID b
SSh2a02
SSh3e03
SSh3f09
Disease and stress response genes
A
SSh1g12
A
SSh2a12
A
SSh1d01
A
SSh1d04
A
SSh2d05
A
SSh2c09
A
SSh1c07
A
SSh2b11
A
SSh1c10
B
SSh2g06
B
SSh2f05
B
SSh2f09
C
SSh3d04
C
SSh3d10
D
SSh3e10
Other metabolic genes
A
SSh1b12
A
A
A
B
B
C
C
D
D
D
D
D
a
SSh1g06
SSh1c06
SSh2a01-2
SSh22d10
SSh2f07
SSh2g08
SSh3a03
SSh3a09
SSh3b08
SSh3c02
SSh3e07
SSh2f04-2
SSh3f05
Numberc
protein [O. sativa]
protein [A. thaliana]
l protein [A. thaliana]
protein [O. sativa]
hit
hit
hit
hit
hit
hit
hit
hit
hit
hit
hit
hit
hit
The library from which the clone was isolated appears in the first column.
The clone designation of a representative of each non-redundant group of isolated cDNAs.
The total number of homologous clones isolated.
d
The Insert size in bp of the cDNA insert in suppression subtractive hybridization (SSH) estimated after sequencing. Transcript sizes were estimated from Northern blot analyses of total
RNA from pulp.
e
The E-values indicate the significance of the homology. They were obtained using either the BLASTN or BLASTX search algorithms (see [27]).
b
c
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
might represent the 50 or 30 UTR part of the corresponding
genes. The other 163 EST clones (92%) showed high homology
with plant genes of known and unknown functions registered in
database (Table 1). The most abundant clone encodes for class
III acidic chitinase, a protein known to accumulate dramatically
during the early stages of fruit development, accounting for up
to 40% (w/v) of the total protein amount [32]. Four EST clones
were unclassified since they were homologous to unknown
proteins or cDNA clones from rice or Arabidopsis. In three
instances, BLAST analysis showed that, some cDNA clones
presented a high homology with two cDNA isolated from
different species but encoding for the same function. Among
these clones, they are clones 2d05 and 2c09 that showed 75 and
78% homology with patatin-like proteins of cucumber
(Y12793) and tobacco (AF15827), respectively; clones 2a12
and 2f05 that showed 84% and 89% homology with catalase
protein of Z. aethiopica (AF332973) and S. maritime
(AF390210), respectively; and clones 2b11 and 1c07 both
showing 80% homology with putative nematode resistance-like
protein of rice (NP_915551) and wheat (AY835406), respectively. This could suggest that these EST sequences might
correspond to different banana genes members of a multigenic
family. However, as the EST sequences presented in this study
were obtained through a single sequence run, it also possible
that these most similar sequence pairs may be representative of
the same gene (Table 2).
The presence of novel genes and genes of unknown function;
altogether with genes putatively involved in ripening process in
other plants constitutes a good indicator of the quality of the
libraries.
It is now assumed that initiation of ripening of climacteric
fruits is a complex process that involves changes in the
regulation of genes of ethylene transduction pathway, genes of
plant development and genes encoding for transcriptional and
translational regulation factors [33–36]. Changes in different
plant hormones including ethylene and auxin have been also
reported as associated with initiation of ripening of climacteric
fruits [37,38]. In accordance with this, some of the banana
genes isolated in this study and that are differentially expressed
concomitantly with changes of fruit ability to ripen, are
putatively involved in ethylene and auxin metabolism while
others encode for transcriptional and translational regulation
factors. Are thus pointed out the clones 2a01 encoding for Sadenosyl-L-methionine:salicylic acid carboxyl methyltransferase-like protein; SSh3f09 encoding for ACC oxidase involved
in ethylene biosynthesis pathway [39]; 3e03 encoding for IAAamino acid hydrolase involved in the regulation of free IAA in
the tissues throughout hydrolysis of IAA amide-linked
conjugate into free IAA [40]; 2e08 encoding for a MADSbox transcription factor, one of the important function required
for the initiation of fruit ripening by developmental factors as
recently demonstrated in tomato [41]. The presence of these
genes suggests that the initiation of banana fruit ripening might
be under the mechanism similar to that described in other
climacteric fruits. Peel and pulp are both of them markedly
developed in banana fruit compared to order climacteric fruit
such as tomato. Thus, we believed that these two tissues could
1031
be involved, in different manner, in the initiation of banana fruit
ripening. In order to assess this hypothesis and get more
insights into mechanism related with green banana fruit
development and ripening initiation process, we investigated
the differential expression of sequenced genes in peel and pulp
tissues during the green banana fruit development and after
acetylene treatment. Additionally, for some of the similar
sequence pairs identify in this study (Table 1), the gene
expression analysis experiments could help to rule if they are
representative of the same gene or not.
3.4. Gene expression checked by RNA blot analysis and
real-time PCR
A set of 24 sequenced clones was selected from EST clones
according to their putative function. Their expression was
analyzed by Northern blot (Fig. 3) and/or real-time quantitative
PCR (qPCR) (Fig. 4) as described in Section 2.
Among the 24 clones examined, 19 showed a differential
accumulation of transcripts in Northern blot analysis (Fig. 3).
According to the pattern of their mRNA accumulation, these
clones have been divided into two groups. The first group
includes the clones of which mRNA was accumulated mainly in
pulp tissue and whatever the treatment. Among these, they are
clones 1c03, 2c09, 1h03, 1c07, 2a12, 2f05, 3d10, 1c10, 2a01,
2b11 and 2b03. In this tissue corresponding transcripts were
accumulated abundantly in fruit harvested 40 DAF before
decrease progressively in fruit harvested 60 and 90 DAF.
Clones 1c03, 2c09, 1h03 being the most abundantly expressed
while clones 1c07, 2a12, 2f05, 3d10 and clones 2a01, 2b11 and
2b03 are fairly and less expressed, respectively. No difference
was observed between mRNA levels of treated and untreated
fruit. This result suggests that the expression of these genes is
regulated at transcriptional level independently to ethylene.
Thus, the decreased in mRNA level that we observed during
green development of fruit is only under developmental cues.
The previous EST sequence analysis suggested that the three
similar sequence pairs isolated in this may be representative of
the same gene. As the member of two of these similar sequence
pair, namely clones 2a12 and 2f05 encoding for patatin-like
protein and clones 1c07 and 2b11 encoding for nematoderesistant like protein, display a similar pattern of mRNA
accumulation, we conclude that they correspond probably to
the same gene. The second group is formed by clones 2h06,
3e03, 2a02, 3h03, 3e06, 3c09, 3c11, and 2e08 of which mRNA
accumulated mainly and abundantly in peel and/or pulp tissue
after acetylene treatment and compared to he control fruit.
Clones 2h06 and 3e03 are mainly expressed in peel tissue while
the clone 2a02 is mainly expressed in pulp tissue. For peel
specific clones, namely 2h06 and 3e03, the induction of their
mRNA accumulation was transient 60 DAF and progressive
from 60 to 90 DAF, respectively. In contrast to the clone 2h06,
the gene expression of clone 3e03 can be considered as strictly
ethylene-dependent, since its expression was firstly and
markedly induced by acetylene in fruit harvested at early
mature green stage (60 DAF) and continuous to increase in fruit
harvested late mature green stage (90 DAF). Clone 2a02 was
1032
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
constitutively induced whatever the developmental stage
suggesting that acetylene treatment was not the unique factor
that induces the gene expression of the clone 2a02. For all other
genes belonging to this group namely 3h03, 3e06, 3c09, 3c11
and 2e08 other developmental cues might act together with
ethylene to regulate their expression during the green
developmental stage of banana fruit but differentially according
to the fruit tissues. Indeed, the induction effect of acetylene on
their gene expression varied in different manners from the
immature green stage to the late mature green stage. For
example, for both clones 3h03, 3e06 and 2e08, the effect of
acetylene treatment was constitutive in peel tissue while in
pulp, acetylene treatment down-regulated the gene expression
since the immature green stage to the late mature green stage,
Fig. 3. Phosphor Imager data of RNA gel blot analysis of a set of SSH cDNA clones during early stages of banana fruit development before acetylene treatment
(control) and the ratio between the relative mRNA level in acetylene-treated fruit versus control. Each lane was loaded with 50 mg of total RNA, extracted from the
peel and pulp of fruit harvested 40, 60 and 90 days after flowering and resolved on denaturing agarose gel. After their transfer onto a nylon membrane, the equal
amount of loaded- and transferred-RNA was checked with methyl blue staining. Then the blots were hybridized with the corresponding and radio-labelled cDNA as
described in Section 2. The membranes were exposed to the storm screen (Amersham, Orsay, France) and intensity of each hybridization signal was quantified with
ImageQuant software (Molecular Dynamic, Amersham, Orsay, France). The effect of acetylene on each mRNA accumulation was expressed in terms of the ratio
between the intensity of signals hybridization quantified in acetylene-treated fruit versus control. A, Group 1: cDNAs of which expression was down regulated during
banana green developmental stage and unaffected by acetylene treatment. This group includes the high (clones 1c03, 2c09, 1h03), fairly (1c07, 2a12, 2f05, 3d10,
1c10) and low expressed (2a01, 2b11, 2b03). B, Group 2: cDNA of which expression was affected positively or negatively by acetylene treatment mainly in peel tissue
(clone 2h06, 3e03) in pulp tissue (2a02) and in both tissue (3h03, 3e06, 3c09, 3c11, 2e08).
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
1033
Fig. 3. (Continued ).
Fig. 4. Gene expression of a set of SSH cDNA clones during the early stages of banana fruit development checked by quantitative real-time PCR. Quantification of
gene transcripts was performed by real-time PCR as described in Section 2. DDCt on the y axis refers to the fold difference in each gene expression relative to the fruit
harvested 40 days after flowering for untreated fruit (control) and the control for acetylene-treated fruit.
1034
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
markedly for clone 3h03 than clone 3e06 and 2e08. Acetylene
treatment was induced markedly the 3c11 gene expression in
both peel and pulp tissue while this treatment regulated in
opposite manner the gene expression corresponding to clone
3c09 in peel and pulp tissues. The clone 3c11 was presented an
interesting case. Although the inducible effect of acetylene
treatment on 3c11 gene expression is progressive in both peel
and pulp tissues, this effect was firstly observed at early mature
green and immature green stages in peel and pulp tissues,
respectively. Thus suggesting that, the developmental cues
which act together with ethylene to up-regulate the gene
expression of the clone 3c11 in pulp tissue, were absent and/or
inactive in peel tissue. Additionally, the mRNA accumulation
of 3c11 gene suggested that the transcriptional regulation of
this gene was ethylene-dependant only in peel tissue as the
inducible effect of acetylene was firstly observed in early
mature green fruit. This is not surprising, if one considers that,
in contrast to other fleshy fruit as tomato for example, peel and
pulp of banana fruit are two markedly developed tissues and
that might be subjected to different ripening process [42].
Although the number of clones examined by Northern blot in
this study is limited, the expression of the mainly selected
clones indicates that the subtraction had worked properly but
was however not total as suggested by the macroarray data.
Indeed, out of 11 clones of group one and that are abundantly
expressed in fruit harvested 40 DAF and down-regulated after,
only two clones (2f05 and 3d10) have been isolated from
libraries B and C while the nine others have been isolated from
library A expected to contain genes that are up-regulated during
early developmental fruit up to 40 DAF. For clones belonging to
group two, excepted for the clone 2a02 isolated from library A,
all have been isolated from libraries expected to contain the
genes that are up-regulated from the mature green stage (library
B) and after acetylene treatment (libraries C and D).
The qPCR, a more sensitive and specific analysis method of
gene expression, was performed on a few clones that showed
differential expression according to tissues and also postharvest
treatments in other to validate the Northern blot analysis
(Fig. 4). These clones are: clone 3e08, one of the four clones
that failed to give a signal after Northern blot analysis, and two
differentially-expressed clones of each group, namely clones
2b11 and 3d10 for group one (Fig. 3A) and clones 2a02 and
2e08 for group two (Fig. 3B). Our results showed that, clone
3e08 was expressed in both peel and pulp tissues (Fig. 4A). In
control fruit, the mRNA of this clone showed a same pattern of
accumulation in both peel and pulp tissues. The level of 3e08
mRNA was 2-fold decreased in fruit harvested 60 DAF before
to increase drastically more than 2-fold 90 DAF. In acetylenetreated fruit, the mRNA level increased continuously in peel
tissue while, in pulp tissue, the mRNA level was approximately
2-fold lower than in peel tissue and no marked changes were
observed from 40 to 90 DAF. Compared to control fruit, the
inducible effect (1.5-fold) of acetylene treatment in peel tissue
was firstly observed in fruit harvested 60 DAF while in pulp,
acetylene treatment was 1.5-fold induced and 3-fold decreased
the 3e08 mRNA level in fruit harvest at 60 and 90 DAF,
respectively. Taken together, our qPCR data suggested that
ethylene is required to initiate the gene expression of clone
3e08 but was not the only factor involved in the regulation of
this expression during the late stage of fruit development.
Indeed, mRNA level of clone 3e08 in both tissues was
unaffected in immature green unable to respond to acetylene
treatment (40 DAF), while in mature green fruit (60–90 DAF),
this level was not increased concomitantly with ethylene fruit
responsiveness.
For clone 2b11, the gene expression analysis showed a
different pattern in acetylene treated- and control fruit. In peel
tissue of control fruit, the mRNA level of clone 2b11 transiently
decreased at 60 DAF following by a 2.5-fold increase at 90
DAF while in pulp tissue of this fruit, this level was low and
decreased from 40 to 90 DAF. In both peel and pulp tissues of
treated-fruit, gene expression of clone 2b11 displayed a same
pattern of expression but at lower level in pulp than in peel. The
mRNA level was 3-fold increased transiently in fruit harvested
at 60 DAF before a decrease at 90 DAF. For clone 3d10, the
level of corresponding mRNA in control fruit harvested at 60
DAF was transiently induced in peel and transiently decreased
in pulp. In acetylene-treated fruit, a marked induction (120fold) effect on 3d10 gene expression was observed in peel tissue
of fruit harvested at 90 DAF. In pulp tissue, the 3d10 mRNA
level was 40-fold induced and at a constant level in fruit
harvested at 40 and 60 DAF before 20-fold decrease at 90 DAF.
For clone 2a02, the level of corresponding mRNA increased by
3-fold in peel tissue of control fruit harvested 60 and 90 DAF
and compared to that harvested at 40 DAF. In pulp tissue of this
fruit, the mRNA level was transiently induced more than 2-fold
in fruit harvested 60 DAF before to decrease 90 DAF.
Exogenous acetylene treatment decreased the 2a02 mRNA
level in peel tissue and no difference was observed between the
different harvesting stages. In pulp tissue, the mRNA level was
1.5–2-fold induced at 40 and 90 DAF but down-regulated in
fruit harvested 60 DAF. For clone 2e08, the mRNA level in
control, was constant in fruit harvested at 40 and 60 DAF before
0.5-fold decrease at 90 DAF while in pulp tissue, the mRNA
level transiently decreased in fruit harvested 60 DAF.
Exogenous acetylene treatment was 2-fold decreased the
2e08 mRNA in peel tissue without a marked difference between
the different green stage development. In pulp tissue, the
acetylene treatment transiently induced (1.5-fold) the mRNA
level in fruit harvested 60 DAF and decreased this level in fruit
harvested at 40 and 90 DAF.
The qPCR experiments confirms that the clone 2b11 was
less expressed than clone 3d10 as observed after Northern blot
analysis. For clone 2a02 and 2e08, the qPCR experiments failed
to confirm the result of gene expression obtained after Northern
blot analysis as the level of gene expression of clone 2e08 as
was low compared to that of clone 2a02 in contrast to Northern
blot data. The sequence analysis of clone 2e08 showed that it
corresponds to the coding region of MADS protein encoded by
a large and highly conserved family of genes. Thus the high
expression level observed after Northern blot analysis might be
due to the aspecificity of the clone 2e08 cDNA sequence used as
probe which may allow the detection of other MADS gene
mRNAs also present in the examined tissues. Isolation of full
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
length cDNAs and study of their specific expression using a
specific probe designed within the untranslated regions should
be necessary to check the specific expression of the clone 2e08.
Additionally and for all these genes, the qPCR data suggest that
ethylene was not the only factor involved on their gene
expression in both peel and pulp tissues. Indeed, 2b11, 3d10,
2a02 and 2e08 gene expressions are affected by acetylene in
immature green fruit unable to respond to ethylene while
throughout the mature green stage (60 and 90 DAF), the
changes observed after acetylene treatment on 2b11, 3d10,
2a02 and 2e08 genes expression was not strictly correlated to
the fruit ethylene the responsiveness. Finally, the qPCR data
also confirmed that the subtraction step had worked properly
but was not total. Indeed, the clones 2a02 and 2b11 isolated
from library A appeared to be mainly expressed in fruit
harvested 60 and 90 DAF as were clones 2e08, 3d10 and 3e08
isolated from library B, C and D, respectively.
In conclusion, the data presented in this study provide with a
partial characterization of early green development of banana
fruit. It is now assumed that the growth of banana plant, of which
depends the development of green fruit, is under pedoclimatical
factors including temperature, the rainfall and soil [4]. Banana
fruit (cv Cavendish) grown under pedoclimatical conditions
described in this study (see Section 2) undergoes changes in
ethylene responsiveness between 40 and 60 DAF. The ethylene
responsiveness of fruit increases progressively from 60 to 90
DAF (the commercial harvesting stage) and is associated with
changes in genes expression. Among these genes, there are those
involved in ripening initiation process, namely hormone
metabolism (ethylene and auxin), transcriptional and translation
gene regulation; the mechanisms that have been reported to be
involved in ripening initiation process in tomato. In this study, a
number of isolated genes also show a high homology with those
involved in disease response. This result is in accordance with
recent studies reporting that, between 40 and 90 DAF of the green
development stage, banana fruit growth under the same
pedoclimatcial conditions, also undergoes changes on wound
anthracnose sensitivity, one of important postharvest disease of
banana fruit [15]. Although the results of this study are only
based on a subset of clones and cannot therefore be considered as
fully representative, they indicate that there are many
transcriptionally-regulated genes that accumulate differentially
during the early banana fruit development undergoing changes in
ethylene responsiveness. For banana fruit, the control of the early
developmental stages including those around the harvesting
stage is important in order to optimise the date of harvest and
make it compatible with transit constraints without affecting fruit
quality. Very little is known about the mechanisms that govern
the early development stages of banana fruit. The physicochemical characterization of different banana varieties available
within the collection of CIRAD in Guadeloupe is currently
undergoing and could led to the identification of contrasted
varieties in term of time course of green development stage and
ethylene responsiveness. These studies together with the
approach used here are a crucial step towards understanding
of the early development stages of banana fruit. Subsequently, it
will allow the isolation of genes closely related to these stages.
1035
Although, further studies on functional genomics are required to
determine the relationship between the biological activities of
these genes and physiological mechanisms associated with, these
genes will contribute to increase pools of public EST collections
of banana, one of the weakest public EST collection among those
of the most consumed fruits [34], for (i) a large-scale expression
analysis and identification of candidate genes and/or (ii) the
providing of molecular markers usable to improve banana fruit
quality throughout conventional breeding or biotechnology
approaches.
Acknowledgements
The authors thank Dr. Guy Self and Dr. Pravendra Nath for
critically revising the manuscript and for their helpful
comments and, Dr. Nathalie Vachiery for her helpful during
real-time PCR experiments. This research was supported by the
2000–2006 DOCUP found (‘‘Document Unique de Programmation’’ of Europe, French Government and Guadeloupe
district).
References
[1] F.J. Novak, Musa (bananas and plantains), in: F.A. Hammerschlag, R.E.
Litz (Eds.), Biotechnology of Perennial Fruit Crops, CAB Internationnal,
Walling Ford, 1992, pp. 448–449.
[2] J.H. Crouch, D. Vuysteke, R. Ortiz, Perspective on the application of
biotechnology to assist genetic enhancement of plantain and banana
(Musa spp), J. Biotech. 1 (1998) 11–22.
[3] FAOSTAT data; http://faostat.fao.org; last updated February 2005.
[4] J.C. Robinson, Banana and Plantains, vol. 5, CAB International, University Press, Cambridge, 1996, 238.
[5] P. Arias, C. Dankers, P. Liu, P. Pilkauskas, The World Banana Economy
1985–2002, Food and Agriculture Organization of the United Nations,
Rome, 2003, p. 100.
[6] E. Frison, S. Sharrock, The economic, social and nutritional importance of
banana in the world, in: C. Picq, E. Fouré, E.A. Frison, (Eds.), Bananas and
Food Security, INIBAP ISBN 2-910810-36-42000, pp. 21–35.
[7] X. Liu, S. Shiomi, A. Nakatsuka, Y. Kubo, R. Nakamura, A. Inaba,
Characterization of ethylene biosynthesis associated with ripening in
banana fruit, Plant Physiol. 121 (1999) 1257–1265.
[8] J.B. Golding, D. Shearer, S.G. Wyllie, W.B. McGlasson, Application of 1MCP and propylene to identify ethylene-dependant ripening processes in
mature banana fruit, Postharvest Biol. Technol. 14 (1998) 87–98.
[9] J. Marchal, An overview of post-harvest aspects of banana, Acta Hort. 490
(1998) 501–510.
[10] J. Marchal, The quality of desert Bananas and Plantains, Fruits 48 (1993)
40–44.
[11] A.K. Thompson, J. Burden, Harvesting and fruit care, in: S.R. Gowen
(Ed.), Bananas and Plantains, Chapman & Hall, London, 1995, pp. 481–
492.
[12] G.B. Seymour, Banana, in: G.B. Seymour, J.E. Taylor, G.A. Tucker (Eds.),
Biochemistry of Fruit Ripening, Chapman and Hall, London, 1993, pp.
83–106.
[13] P. John, J. Marchal, Ripening and biochemistry of the fruit, in: S. Gowen
(Ed.), Bananas and Plantains, Chapman and Hall, New York, 1995, p. 434.
[14] L. de Lapeyre de Bellaire, Bio-écologie de Colletotrichum musae (berk
and Curt.) Agent de l’anthracnose des bananes, dans les conditions
tropicales humides de la Guadeloupe. Ph.D., Université Paris XI-Orsay,
1999, pp. 1–100.
[15] M. Chillet, Influence des conditions de croissance du fruit du bananier
(Musa spp. AAA cv ‘Grande naine’) sur sa sensibilité à l’anthracnose de
1036
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
D. Mbéguié-A-Mbéguié et al. / Plant Science 172 (2007) 1025–1036
blessure due à Colletotrichum musae (Berk. And Curt.) Arx. Ph.D.,
Université de Montpellier II, Montpellier, 2003, pp. 1–190.
J. Marriot, Banana physiology and biochemistry of storage and ripening
for optimum quality, CRC Crit. Rev. Food Sci. Nutr. 13 (1980) 41–88.
R. Medina-Suarez, K. Manning, J. Fletcher, J. Aked, C.R. Bird, G.
Seymour, Gene expression in the pulp of ripening bananas. Two-dimensional sodium dodecyl sulfate–polyacrylamide gel electrophoresis of in
vitro translation products and cDNA cloning of 25 different ripeningrelated mRNAs, Plant Physiol. 115 (1997) 453–461.
S.K. Clendennen, G.D. May, Differential gene expression in ripening
banana fruit, Plant Physiol. 115 (1997) 463–469.
R. Drury, S. Hörtensteiner, I. Donnison, C.R. Bird, G.B. Seymour,
Chlorophyll catabolism and gene expression in the peel of ripening banana
fruits, Physiol. Plant. 107 (1999) 32–38.
M. Chillet, C. Galas, R.M. Gomez, O. Hubert, P. Julianus, D. Mbéguié-AMbéguié, B. Fils-Lycaon, Is there a relationship between ethylene production of bananas ripened on the plant and the length of the fruit growth
period prior to ripening onset? Fruit 60 (2005) 83–89.
B. Fils-Lycaon, D. Mbéguié-A-Mbéguié, C. Galas, R.M. Gomez, O.
Hubert, M. Chillet, Banana quality: physico-chemical characterization,
and transcriptome and proteome analysis of fruit during ripening, in: E.B.
Esguerra, M.V. Maunahan, O.K. Bautista (Eds.), Proceeding of the First
International Post Harvest Horticulture Conference, Manille, Philippines,
2001, p. 256.
J. Ganry, J.P. Meyer, Recherche d’une loi d’action de la température sur la
croissance des fruits du bananier 30 (1975) 375–392.
F. Liu, Correlation between banana storage life and minimum treatment time
required for ethylene response, J. Am. Soc. Hort. Sci. 101 (1976) 63–65.
Y. Chambroy, M. Souty, J.M. Audergon, G. Jacquemin, R.M. Gomez,
Researches on the suitability of modified atmosphere packaging for
shelf-life and quality improvement of apricot fruit, Acta Hort. 384
(1995) 633–638.
C. Bugaud, M. Chillet, M.P. Beauté, C. Dubois, Physicochemical analysis
of mountain bananas from the French West Indies, Sci. Hort. 108 (2006)
167–172.
C.Y. Wan, T.A. Wilkins, A modified hot borate method significantly
enhances the yield of high-quality RNA from cotton, Anal. Biochem.
223 (1994) 7–13.
W.L. Gerlach, J.R. Bedbrook, Cloning and characterization of ribosomal
RNA genes from wheat and barley, Nucleic Acids Res. 7 (1979) 1869–
1885.
S.F. Altschul, T.L. Madden, A.A. Schäffer, J. Zhang, Z. Zhang, W. Miller,
D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs, Nucleic Acids Res. 25 (1997) 3389–3402.
[29] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning Tome 1: A
Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York, 1989, 7.1–7.86.
[30] S. Roten, H.J. Skaletsky, Primer3 on the WWW for general users and for
biologist programmers, in: S. Krawetz, S. Misener (Eds.), Bioinformatics
Methods and Protocols: Methods in Molecular Biology, Humana Press,
Totowa, NJ, 2000, pp. 365–386.
[31] C. Tamborindeguy, C. Ben, T. Liboz, L. Gentzbittel, Sequence evaluation
of four specific cDNA libraries for developmental genomics of sunflower,
Mol. Gen. Genomics 271 (2004) 367–375.
[32] W.J. Peumans, P. Proost, R.L. Swennen, E.J. Van Damme, The abundant
class III chitinase homolog in young developing banana fruits behaves as a
transient vegetative storage protein and most probably serves as an
important supply of amino acids for the synthesis of ripening-associated
proteins, Plant Physiol. 130 (2002) 1063–1072.
[33] J.M. Lelièvre, A. Latché, B. Jones, M. Bouzayen, J.C. Pech, Ethylene and
fruit ripening, Physiol. Plant. 101 (1997) 727–739.
[34] H. Zegzouti, B. Jones, P. Frasse, C. Marty, B. Maı̂tre, A. Latché, J.C. Pech,
M. Bouzayen, Ethylene-regulated gene expression in tomato fruit: characterization of novel ethylene-response and ripening-related genes isolated by differential-display, Plant J. 18 (1999) 589–600.
[35] J.J. Giovannoni, Molecular biology of fruit maturation and ripening, Ann.
Rev. Plant Physiol. Plant Mol. Biol. 52 (2001) 725–749.
[36] J.J. Giovannoni, Genetic regulation of fruit development and ripening, The
Plant Cell 16 (2004) s170–s180.
[37] J.G. Buta, D.W. Spaulding, Changes in indole-3-acetic-acid and abscisicacid levels during tomato (Lycopersicon esculentum Mill) fruit development and ripening, J. Plant Growth Regul. 13 (1994) 163–166.
[38] E. Purgatto, J.R.O. do Nascimento, F.M. Lajolo, B.R. Cordenunsi, The
onset of starch degradation during banana ripening is concomitant to
changes in the content of free and conjugated forms of indole-3-acetic
acid, J. Plant Physiol. 159 (2002) 1105–1111.
[39] S.F. Yang, Biosynthesis and action of ethylene, Hort. Sci. 20 (1985) 41–45.
[40] R.A. Rampey, S. LeClere, M. Kowalczyk, K. Ljung, G. Sandberg, B.
Bartel, A family of auxin-conjugate hydrolases that contributes to free
indole-3-acetic acid levels during Arabidopsis germination, Plant Physiol.
135 (2004) 978–988.
[41] J. Vrebalov, D. Ruezinsky, V. Padmanabhan, R. White, D. Medrano, R.
Drake, W. Schuch, J.J. Giovannoni, A MADS-box gene necessary for fruit
ripening at the tomato ripening-inhibitor (rin) locus, Science 296 (2002)
343–346.
[42] M. Dominguez, M. Vendrell, Ethylene biosynthesis in banana fruit:
evolution of EFE activity and ACC levels in peel and pulp during ripening,
J. Hort. Sci. 68 (1993) 63–70.