From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Blood First Edition Paper, prepublished online February 25, 2010; DOI 10.1182/blood-2009-10-250118
Global lymphoid tissue remodeling during a viral infection is orchestrated by a B cell-lymphotoxindependent pathway
Varsha Kumar1, Elke Scandella2, Renzo Danuser1, Lucas Onder2, Maximilian Nitschké3, Yoshinori Fukui4,5,
Cornelia Halin3, Burkhard Ludewig2 and Jens V. Stein1
1
Theodor Kocher Institute, University of Bern, 3012 Bern, Switzerland; 2Institute of Immunobiology, Kantonal
Hospital St. Gallen, 9007 St. Gallen, Switzerland; 3Institute of Pharmaceutical Sciences, Swiss Federal
4
Institute of Technology, ETH Zurich, 8093 Zurich, Switzerland, Division of Immunogenetics, Department of
Immunobiology and Neuroscience, Medical Institute of Bioregulation, Kyushu University, Fukuoka 812-8582,
Japan; 5Japan Science and Technology, CREST, Tokyo 102-0075, Japan
Correspondence:
Jens V. Stein, Theodor Kocher Institute, University of Bern, Freiestr. 1, 3012 Bern, Switzerland. email:
[email protected], Tel. +41 31 631 5390, Fax +41 31 631 3799
Running title: Mesoscopic imaging of lymphoid tissue remodeling
Abbreviations: HEV, high endothelial venule; LMCV, lymphocytic choriomeningitis virus; LT, lymphotoxin;
PLN, peripheral lymph node; SLO, secondary lymphoid organ; DC, dendritic cell; APC, antigen-presenting
cell; OPT, optical projection tomography
1
Copyright © 2010 American Society of Hematology
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Abstract
Adaptive immune responses are characterized by substantial restructuring of secondary lymphoid organs.
The molecular and cellular factors responsible for virus-induced lymphoid remodeling are not well known to
date. Here we applied Optical Projection Tomography (OPT), a mesoscopic imaging technique, for a global
analysis of the entire 3D structure of mouse peripheral lymph nodes (PLNs), focusing on B cell areas and
high endothelial venule (HEV) networks. Structural homeostasis of PLNs was characterized by a strict
correlation between total PLN volume, B cell volume, B cell follicle number and HEV length. Following
infection with lymphocytic choriomeningitis virus (LCMV), we observed a substantial, lymphotoxin (LT) βreceptor-dependent reorganization of the PLN microarchitecture, in which an initial B cell influx was followed
by three-fold increases in PLN volume and HEV network length on day 8 post infection. Adoptive transfer
experiments revealed that virus-induced PLN and HEV network remodeling required LTα1β2-expressing B
cells, while inhibiting VEGF-A signaling pathways had no significant effect on PLN expansion. In summary,
LCMV-induced PLN growth depends on a VEGF-A-independent, LT- and B cell-dependent morphogenic
pathway, as revealed by an in-depth mesoscopic analysis of the global PLN structure.
2
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Introduction
Peripheral lymph nodes (PLNs) are strategically positioned at the junctions of the blood and lymphatic
vascular systems to efficiently contain and present microbes or derived peptides to passing lymphocytes for
a rapid initiation of adaptive immune responses
1-4
. The PLN parenchyma is filled with mobile lymphocytes
organized in separate T and B cell microenvironments in the paracortex and follicles, respectively. PLNs
contain antigen presenting cells (APCs), in particular dendritic cells (DCs) in the T cell area, which are
embedded in a network of fibroblastic stromal cells (FRCs) and high endothelial venules (HEVs), the main
port of entry for circulating lymphocytes
4-7
.
When live microbes or microbial products invade a host, draining PLNs undergo substantial morphological
changes to allow for increased recruitment of naïve cells. Macroscopically, this is manifested in PLN swelling
and an increase in the lymph and blood vasculature
8-15
. In parallel, immunohistological analysis of the
distribution of APC, lymphocyte subsets and stromal markers points to a substantial microenvironmental
reorganization in draining PLNs
12,16
. These changes are in part due to a temporary shutdown of lymphocyte
egress, recruitment of new lymphocytes and activated DC, as well as retention and clonal expansion of Agspecific lymphocytes
4,17
. Expression levels of homeostatic chemokines, such as CCL19 and CCL21,
decrease in inflamed lymphoid tissue, either through IFN-γ-dependent mechanisms or through destruction of
the stromal network producing these chemotactic factors. As an example, infection with the model pathogen
lymphocytic choriomeningitis virus (LCMV) results in 10-fold-reduced CCL19 and CCL21 mRNA levels,
precipitating the loss of lymphoid organization
17,18
.
The inflammation-induced PLN expansion is an almost unparalleled process of tissue remodeling regarding
its rapidity and the extent of size increase in adult organisms. The increase in blood vasculature implies a
role for the proangiogenic factor VEGF-A during PLN expansion. Accordingly, in DTH responses or
adjuvans-mediated PLN remodeling, VEGF-A regulates lymph and blood vessel angiogenesis in B celldependent and -independent manners 12,14,15. Activated DCs also contribute to HEV expansion in a VEGF-Adependent manner
14
. FRCs contribute to PLN growth through secretion of VEGF-A after stimulation of their
lymphotoxin β receptor (LTβR)
19
. LTβR is furthermore expressed by HEV and lymphatic vessels and is
involved in regulation of the HEV phenotype in steady state and inflammation
13,20
. The precise contribution
of these morphogenic cells and factors to PLN growth is likely to vary according to the inflammatory stimuli
used. For example, since LCMV infection leads to a downregulation of FRC and DC numbers in draining
PLNs
17
, these cells are unlikely to decisively contribute to during global lymphoid tissue reorganization in
this viral model. It is furthermore unknown whether B cells, or other blood-borne cells, are involved in LCMVinduced tissue remodeling, as observed in non-infectious models
12
. Thus, the roles for VEGF-A and the
3
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
LTβR ligand LTα1β2 on B cells, or other B cell-derived factors, during lymphoid remodeling in viral infections
were not fully analyzed to date.
A thorough analysis of tissue restructuring during inflammation relies on a precise quantification of lymphoid
architecture. Traditionally, the spatial and quantitative relationship between vascular structures and lymphoid
compartments has been quantified using two-dimensional (2D) tissue sectioning
12-16,21
. A limitation of this
approach is the asymmetric distribution of vascular structures and T and B cell areas in PLN cortex and
medulla, which results in high variability of observable structures in 2D sections according to the dissection
plane. Furthermore, only a limited number of tissue sections is typically analyzed, making global statements
on lymphoid restructuring less precise. A complete 3D overview of the internal PLN structure, including
lymphocyte subcompartments and vascular networks, is therefore required to analyze with high precision the
molecular mechanisms underlying homeostatic regulation and inflammation-induced changes thereof.
Mesoscopic imaging is ideally suited to probe objects of 0.5 to 15 mm diameter, which are too large for
conventional microscopic imaging, i.e. confocal or 2photon microscopy (2PM). A number of mesoscopic
imaging techniques, including selective plane illumination microscopy (SPIM), ultramicroscopy and optical
projection tomography (OPT), have been developed in recent years and successfully applied to embryos and
adult organs of small vertebrates
22-27
.
We hypothesized that mesoscopic imaging could provide a comprehensive quantification of entire PLN
structure in homeostasis and inflammation induced by the model pathogen LCMV. Here, we have applied
OPT to whole-mount fluorescently labeled murine PLN to obtain quantitative structural 3D information on
PLN. We provide evidence that growth of the PLN and HEV network during LCMV infection depends on
LTα1β 2 signals provided to a large extent by B cells, while blocking VEGF-A signaling does not have a
significant effect on tissue remodeling.
4
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Methods
Mice
Six to eight week old C57BL/6 and FVB mice were purchased from Charles River Laboratories and Harlan
Laboratories. B cell-deficient JHT mice
28
and LTβ-/- mice
29
were obtained from the Institut für
Labortierkunde, University of Zurich. DOCK2-/- mice 30 were bred at the specific pathogen-free mouse facility
at the animal facility of the Department of Clinical Research, University of Bern. Experiments with LCMV
infection were carried out in the animal facility of the Institute for Immunobiology, St. Gallen. All animal
experiments were carried out in accordance with federal and kantonal legislation on animal protection and
were approved by the institutional review board of the University of Bern.
Antibodies
For a complete listing of mAbs used in this study, refer to Supplemental Data.
Viral Infection
LCMV WE strain, obtained from Rolf M. Zinkernagel (University of Zürich, Switzerland), was propagated on
L929 cells at a low MOI and quantified as previously described
31
. Mice were infected with 200 pfu LCMV
WE strain intravenously and analyzed at the indicated time points post infection. For infection with vesicular
stomatitis virus (VSV, Indiana strain, provided by Rolf Zinkernagel), 2 x 106 pfu were injected i.v. as
17
described .
Quantitative PCR
Quantitative PCR of cDNA isolated from control and LCMV-infected PLNs was carried out with mouse
VEGF-A and VEGFR2 primers using LightCycler FastStart DNA master SYBR Green I kit (Roche
Diagnostics) on a LightCycler 1.5 (Roche Diagnostics) as described
17
. The primer sequences for VEGF-A
were: 5’ primer CAGGCTGCTGTAACGATGAA, 3’ primer TTTCTTGCGCTTTCGTTTTT and VEGR2: 5’
primer GGCGGTGGTGACAGTATCTT, 3’ primer GTCACTGACAGAGGCGATGA.
In vivo antibody and inhibitor treatment
For depletion of B cells, C57BL/6 mice received i.p. injections of anti-CD20 antibody or isotype control
antibody (250 µg/mouse; provided by Biogen Idec) on day -10 before infection. For blocking of VEGF
signaling, we injected neutralizing anti-mouse VEGF-A mAb at a dose of 2 x 100 µg/mouse on day 0 and 3
p.i., from Reliatech (clone MAB0705) or Biolegend (2G11). Similar doses were previously used to block
5
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
VEGF-A in mice
15
. Anti-VEGFR2 (clone DC101; BioXcell) was injected on day 0 and 3 p.i. (2 x 500
µg/mouse). For blockade of LTβR signaling, naïve mice or LCMV-infected mice received i.p. injections of
soluble LTβR-Ig or control Ig (100 µg/mouse; provided by Biogen Idec) on day 0 and day 3 p.i. The
VEGFR/PDGFR inhibitor sunitinib (Selleckchem) was used at 35 mg/kg in citrate buffered water and
administered daily by oral gavage for 7 days.
A contact hypersensitivity (CHS) response towards oxazolone was induced in the ear skin of 8-week-old
female FVB mice as described 32. For more details, refer to Supplemental Data.
Adoptive B cell transfers
Single cell suspensions from spleens of LTβ-/- mice and C57BL/6 control mice were subjected to magnetic
cell selection using anti-B220 MACS-beads (Miltenyi Biotec). Purity of the cell preparations was analyzed by
flow cytometry. B cell preparations (>95% B220+) were washed twice with ice-cold BSS and resuspended in
BSS at a concentration of 4 × 107 cells/ml. JHT recipient mice were injected i.v. with 1.5 -2 × 107 cells in 500
μl BSS on day 2 before and the day of infection with LCMV.
Whole mount staining for secondary lymphoid organs and preparation for OPT
Fifteen min prior to killing, control and LCMV-infected mice received an i.v. injection of fluorescently labeled
MECA-79 or MECA-89 (12-15 µg) to label the HEV network. Afterwards, PLN, MLN and PP were carefully
excised and surrounding tissue was removed using a stereomicroscope. Cleaned organs were fixed o.n. in
0.4% paraformaldehyde (Electron Microscopy Sciences) in PBS under slow shaking at 4ºC. After three
washing steps in washing buffer (PBS/0.1% Triton X100/0.05% sodium azide) for 1 h each, PLN were
º
incubated with 0.0025% collagenase for 30 min at 37 C. Collagenase activity was stopped by addition of cold
FCS, followed by three washes with cold PBS for 1 h each. PLN were then incubated with AlexaFluor 488conjugated anti-B220 (0.67 µg/ml) in washing buffer for 10 days at 4°C with gentle rotation. Stained PLN
were washed in PBS, mounted in 1.5% ultrapure low melting agarose (Invitrogen), transferred to methanol
for 4-6 h before transfer to BABB (benzyl alcohol and benzyl benzoate in a 1:2 ratio) for at least 24 h. This
step “clears” the tissue by strongly reducing light scattering and absorption 25. For verification of whole mount
staining procedure efficiency, whole mount stained PLN were frozen as above and 8 µm cryostat sections
were directly observed under the fluorescence microscope after colabeling with MECA-79 or anti-IgM mAbs.
OPT scanning and software-based 3D reconstruction and quantification
6
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
OPT scanning was performed on BABB-immersed PLN according to manufacturer’s instructions (Bioptonics,
UK) using following filter sets: exciter 425/40, emitter LP475 for autofluorescent signal, exciter 480/20,
emitter LP515 for green fluorescent signal and exciter 545/30, emitter 617/75 for red fluorescent signal. Raw
data were reconstructed into 3D voxel data sets using manufacturer’s software (NRecon). Reconstructed
virtual XYZ-data sets were exported as TIFF or bmp files and analyzed using IMARIS (Bitplane, Switzerland)
for isosurface rendering of total PLN volume and B cell follicles. IMARIS reconstructions were carefully
adjusted to fit original NRecon reconstructions. B cell follicles were visually inspected in the 3D
reconstructions and considered an individual follicle based on the near-spherical shape in xyz dimensions.
To differentiate between follicles with “connecting” channels and superlarge, fused follicles, particular weight
was given on the intranodal expansion of the follicle. The total HEV length and thickness, branching points
and individual/average segment lengths were analyzed using the Filament tracer module (Bitplane,
Switzerland).
Statistical Analysis
Student’s t-test, one-way ANOVA and linear regression were used to determine statistically significant
differences (GraphPad Software, San Diego, CA). P values of less than 0.05 were considered statistically
significant.
7
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Results
Mesoscopic analysis of homeostatic lymphoid tissue
To carry out OPT-based mesoscopic imaging of internal PLN structures, we developed suitable whole-mount
staining protocols (Figure 1A and S1). From labeled PLNs, we obtained virtual reconstructions, which were
analyzed using software programs commonly used in confocal image analysis. From these data, we were
able to obtain quantifiable information on total PLN volume, B cell follicle number and shape, and total HEV
vasculature (Figure 1B).
Based on total volume, mouse PLNs were classified as small (popliteal LN), medium (cervical and axillary
LN) and large (inguinal LN) (Figure 2A). B cell follicles were found polarized in the PLN cortex, with numbers
of individual B cell follicles per PLN ranging from less than 10 to more than 30 (Figure 2B and Video S1).
While 25-60% of B cell follicles per PLN were clearly separated from another, 40-70% of follicles appeared
linked via narrow “connecting channels”, joining up to 6 individual follicles. A third type of follicles (5-20%)
was atypically shaped with no clearly identifiable spherical outline, and appeared to have arisen from fusion
of adjacent follicles (Figure S2A). The ratio between the number of B cell follicles per PLN and the total PLN
volume remained remarkably constant, indicating that larger PLNs contain a higher number of, rather than
larger, B cell follicles (Figure 2B). This was confirmed when we analyzed the size distribution of B cell
follicles in small, medium and large PLN. Irrespective of total PLN volume, approximately 50% of individual B
6
3
6
3
cell follicles were between 5-15 x 10 µm , with the remaining 50% being between 1-5 and 15-25 x 10 µm ,
respectively (Figure 2C). A similar consistent ratio was also maintained between total PLN volume and total
volume of B cells (i.e., the sum of all B cell follicle volumes per PLN), with B cell follicles typically occupying
10% of total PLN volume (Figure S2B and S2C). Assuming a comparable B cell density in different B cell
follicles, a medium-sized B cell follicle of 10 x 106 µm3 (~ 225 x 225 x 200 µm) contains approximately 7 x
104 B cells.
In 3D reconstructions of PLNs, we could as well analyze the dense HEV network, which occupied most of
the paracortex, albeit without overlapping with B cell follicles, and continued in close proximity to the
medullar region (Video S1). As with B cell follicle numbers, we observed a constant ratio between total PLN
volume and HEV length (Figure 2D). The combined length of the HEV network in a single inguinal LN was
typically around 10 cm, underlining the extensive network structure and its function as continuous port of
entry for large numbers of lymphocytes. The total number of branching points of HEV per PLN was
proportional to the total HEV length (unpublished data), indicative of comparable network structure
throughout all PLN sizes.
8
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
We next investigated the requirements for the proper formation of HEV and B cell follicles. The HEV network
was comparable in length in absence of B cells or when T cells were less abundant (in JHT, CCL19 and
CCL21-deficient plt/plt and CCR7
-/-
PLNs; unpublished data). Formation of spherical-shaped follicles
required active migration of B cells, as PLNs isolated from mice lacking the promigratory Rac guanine
exchange factor DOCK2
30
lacked discernible B cell follicles (Figure S3A and Video S2). Mesoscopic
analysis of Peyer’s patches (PP) and mesenteric lymph nodes (MLNs) revealed an overall organization
comparable to PLNs, with polarized B cell follicles and dense HEV networks occupying the interfollicular
space (Figure S3B and Videos S3 and S4). MLNs contain both PNAd+ and MAdCAM-1+ HEV, each subset
+
constituting approximately half of the total vascular network length (Figure S3C). While most PNAd vessels
were located in the cortical area, MAdCAM-1+ HEV occupied the medullar and lateral regions of MLNs
(Video S5). A subset of HEV (10-12%) was found to express both vascular addressins and localized to the
cortical region, presumably to facilitate entry of blood borne B cells into adjacent follicles.
In summary, OPT-based mesoscopic imaging provides a comprehensive overview over the internal
organization of PLNs and other secondary lymphoid organs (SLOs). Our data support a model where the
individual B cell follicle sizes are controlled by homeostatic mechanisms independent of total PLN size.
Furthermore, we observed a gradual increase in average B cell follicle size in MLN and PP, which reflects
the increased abundance of B cells in these organs.
PLN remodeling during viral infection
LCMV is a noncytopathic virus with strong tropism for SLOs, such as spleen and PLNs, where it causes a
gradual loss of T and B cell zone integrity with maximal disruption between days 8 and 12 p.i.
17,18
. To
evaluate the kinetics of LCMV-specific morphological changes in the B cell compartment and HEVs of PLNs,
mice were infected i.v. with 200 pfu LCMV. On day 0, 2, 5, 8, 12 and 24 p.i., we isolated inguinal, popliteal
and axillary PLNs from infected mice after labeling HEV and B cells as above. OPT reconstructions showed
remarkable remodeling of PLN size and internal structure during the course of infection. In all subsequent
Figures, inguinal PLNs are depicted although comparable results were obtained with popliteal and axillary
PLNs (Figure S5 and unpublished data). After a delay of 2 days, LCMV-infected PLNs started to expand
three-fold in size until day 8 p.i. before contracting until day 24 p.i. (Figure 3A and Figure S4). B cell follicles
became enlarged over day 2 and 5 p.i. before breaking up into small clusters on day 8 p.i. (Figure 3A and
3B; Videos S6-S8), paralleled by an increase in absolute B cell numbers
17
. As a result, the ratio of total B
cell volume to PLN volume transiently increased on day 2 p.i., where B cells occupied 15% instead of 10% of
the total PLN volume. “Superlarge” follicles with volumes of more than 25 x 106 µm3 appeared from day 2 p.i.
9
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
onwards, which most likely formed through fusion of several follicles (Figure 3A and 3C). The percentage of
large and super-large follicles increased on day 5 p.i. with a concomitant decrease in the smaller and
medium sized follicles (Figure 3C). In contrast, on day 8 p.i., most B cell accumulations lost the typical
spherical shape of B cell follicles and were smaller than on day 0, with some remaining superlarge B cell
follicles. Between days 5 and 8 p.i., these B cell clusters lost their polarized localization and became
distributed throughout the HEV-rich paracortex (Figure 3A and Videos S7 and S8). Thus, LCMV infection of
PLNs was accompanied by loss of polarized medium-sized B cell follicles, which likely reflects decreased
CXCL13 expression at the peak of an LCMV infection 17,18.
In contrast to the B cell volume, the total inguinal PLN volume and HEV length were not increased on day 2
p.i. (Figure 3B). On day 5 and 8 p.i., PLN volume, B cell volume and total MECA-79+ HEV length steadily
augmented until reaching a remarkably constant three-fold increase in all three parameters (Figure 3B). The
increased HEV network also supported increased recruitment of naïve lymphocytes (unpublished data). We
did not observe appearance of MAdCAM-1+ vessels in control or LCMV-infected PLNs (unpublished data).
B cells mediate PLN and HEV network expansion during LCMV infection
The early B cell increase during LCMV infection prompted us to investigate the involvement of these cells in
the subsequent enlargement of draining PLN. Since B cells do not contribute efficiently to the initial
clearance of the virus from SLOs following low dose infection
33,34
, B cell-deficient JHT mice were used here
to determine the role of B cells for LCMV-mediated PLN and HEV network expansion (Figure 4A). PLN
expansion during LCMV infection was markedly diminished in the absence of B cells in comparison to control
PLN on day 8 p.i. (Figure 4B and 4C). Similarly, the increase in total HEV length was also reduced compared
to WT PLN, albeit not completely abolished (Figure 4D). Comparable results were obtained when we
depleted B cells in WT mice using anti-mouse-CD20 mAb and performed an OPT analysis of LCMV-infected
PLN on day 0 and 8 p.i. as above (Figure 4A). Similar to JHT mice, the growth of B cell-depleted PLN and
the HEV network on day 8 p.i. was clearly lower than in control PLN (Figure 4B-D).
To further explore the function of B cells, we carried out reconstitution experiments in which 1.5-2 x 107 WT
B cells were adoptively transferred into JHT mice on day -2 and 0 of LCMV infection (Figure 4A). We then
performed an OPT analysis of draining PLNs on days 0 and 8 p.i. as above. Flow cytometry and
immunohistological analysis in reconstituted PLN on day 8 p.i. showed that transferred B cells were unevenly
distributed and represented less than 5% of total lymphocytes in JHT PLN, compared to >50% in WT PLN
(Figure 4B and S6). Despite the low B cell number and their altered distribution, the adoptively transferred B
cells were sufficient to completely restore the increase in total PLN volume, HEV length on day 8 p.i. to
10
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
levels of WT PLN, although the cellular composition shifted to increased T cell numbers (Figure 4B and S6).
When only 4 x 106 B cells were adoptively transferred into JHT mice, the LCMV-induced PLN size and HEV
network increase was reduced but still 1.25- to 1.5-fold higher as compared to LCMV-infected JHT PLNs in
absence of B cells (unpublished data). Taken together, while lack of B cells does not affect the HEV network
in non-inflamed PLNs, our data point out a central role for a threshold level of B cells to stimulate full PLN
and HEV network growth during LCMV infection. Our data furthermore show that even very low numbers of
B cells have a detectable effect on PLN remodelling, and that B cell-independent mechanisms leading to
PLN remodelling exist.
Blocking VEGF-A signaling does not inhibit LCMV-induced PLN remodeling
Since activated B cells have been previously shown to secrete VEGF-A and induce PLN remodeling
12
, we
assessed the role for VEGF-A for PLN and HEV network growth. Analysis by quantitative PCR from LCMVinfected PLNs did not uncover increased expression of VEGF-A or its main receptor VEGFR-2 (Figure 5A),
while we readily detected increased VEGF-C and LYVE-1 expression during LCMV infection, in line with
increased lymphatic endothelium growth (unpublished data). We next performed LCMV infections in
presence of blocking Abs against VEGFR-2 or VEGF-A, or in presence of the VEGFR/PDGFR inhibitor
sunitinib 35 (Figure 5B). In neither case did we observe a significant inhibition of PLN size increase and HEV
network expansion on day 8 p.i. (Figure 5C and 5D), whereas sunitinib readily decreased ear swelling in a
DTH model (Figure S7). Taken together, under the conditions employed here, we could not find evidence for
a central role of VEGF-A during LCMV-induced PLN expansion.
LTβ on B cells regulates LCMV-induced PLN remodeling
LT is an important morphogenic factor for PLN homeostasis and inflammation-induced hypercellularity 20. To
address the role of LT for PLN remodeling during LCMV infections, WT mice received LTβR-Ig, a general
inhibitor of LTβR signaling, on days 0 and 3 following LCMV infection (Figure 6A). Blocking LTβR signaling
caused a significant reduction in LCMV-induced PLN size and HEV length increase, as compared to mice
treated with control Ig (Figure 6B-D). 3D reconstructions of LCMV-infected PLN in LTβR-Ig treated mice
showed an increase in B cell follicle sizes on day 8 p.i., resulting in massive fusion of these follicles and
appearance of super-large follicles (Video S9). The absolute B cell volume on day 8 p.i. was similar to the
one observed in mice that had received control Ig (unpublished data), resulting in a higher percentage of B
cell volume to PLN volume (Figure 6E). This was corrobated by flow cytometry-based analysis of absolute B
11
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
cell numbers from LTβR-Ig treated PLN compared to the control Ig treated PLN (Figure 6F). These
observations suggest that LTβR-Ig treatment does not disrupt initial B cell accumulation in LCMV-infected
PLN, but impairs subsequent PLN and HEV network growth.
B cells are an important source of the membrane bound LTα1β2, a ligand for LTβR
36
. Since our results
support a function for B cells and LTβR signaling in remodeling the PLN architecture during LCMV infection,
we examined whether B cell-expressed LT was involved in this process. JHT recipient mice were
reconstituted with LTβ-/- B cells on day -2 and 0 prior of LCMV infection and analyzed by OPT on day 0 and 8
p.i. (Figure 6A). While WT B cells were able to restore the expansion of PLN volume and HEV length, we
observed a significant reduction in the total PLN volume in LTβ-/- B cell-reconstituted JHT mice, comparable
to the one observed in LTβR-Ig treated mice (Figure 6B and 6C). The total HEV length in LTβ-/- B cellreconstituted JHT mice was also shorter compared to WT B cell-reconstituted PLN, although LTβR-Ig treated
mice were more compromised in the growth of the HEV network (Figure 6D). In conclusion, LTβ on B cells is
critically involved in LCMV-induced PLN expansion after an initial, LTβ-independent B cell accumulation in
inflamed PLNs.
The endothelial surface available for lymphocyte recruitment can be accounted for through increased
individual segment length, vasodilatation and/or increased branching. We exploited the optical information
provided by OPT to directly examine these options. In the resting state, most HEV (61 ± 6 %; mean ± SD)
were between 20 and 100 µm length, 31 ± 3 % between 100 and 200 µm and 8 ± 3 % more than 200 µm.
On day 2 p.i. with LCMV, the proportion of segments shorter than 100 µm was increased compared to all
other time points measured, while these PLN contained less segments longer than 200 µm than on day 5
and 8 p.i. (Figure 6G). This is indicative of new branch formation from existing venules. In contrast, we
observed a significant increase on day 8 p.i. in HEV segments longer than 200 µm (p<0.01; Figure 6G).
The most striking defect in absence of B cells and LT signaling was a strong reduction of virus-induced
increase of HEV segments (Figure 6H). In JHT mice, this could be completely restored by transfer of B cells,
while LTβ -/- B cells were able to support an increase of the HEV segment number to levels found on day 5
p.i. of wild type PLN (Figure 6H and unpublished data). Lack of B cells or LT signaling had a lesser effect on
HEV diameter increase (Figure 6I) and did not impair the appearance of HEV segments > 200 µm
(unpublished data). In summary, these data support a scenario where B cell-induced HEV growth occurs in a
first phase through increased branching and, at least in part, through elongation and circumferential growth
of pre-existing vascular segments at later time points (Figure S8).
12
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Discussion
Here, we deliver a detailed analysis of the global microstructure of murine PLNs under homeostatic
conditions in naïve animals and inflammation-induced remodeling using quantitative mesoscopic imaging.
Our data suggest a conserved homeostatic regulation of the basic internal PLN architecture. During LCMV
infection, a threshold level of B cells was sufficient to induce vigorous PLN expansion, to a large extent
through their surface expression of LTα1β2. In contrast, we could not find evidence for a role of VEGF-A
during PLN remodeling.
Recent advances in microscopy have allowed important insights into the functioning of the immune system.
In particular, twophoton microscopy has proven an invaluable tool in directly visualizing lymphocyte
dynamics during migration and interactions with APCs or other target cells in lymphoid and extralymphoid
tissue
3,37-41
. However, it is often desirable in experimental biology to obtain a global, comprehensive
overview over structures too large for conventional microscopy, yet too small for meaningful analysis by
large-structure imaging techniques such as Magnetic resonance imaging (MRI). Mesoscopic imaging
approaches such as SPIM and OPT have been developed to fill this “imaging gap” and thus permit
qualitative and quantitative examination of anatomical structures in objects between 0.5 to 15 mm diameter,
such as embryos and most mouse organs
42
. A detailed mesoscopic analysis of the PLN architecture in
antigen naïve animals revealed that irrespective of the PLN size, a constant ratio between PLN volume, B
cell volume, number of B cell follicles, and HEV length is maintained. It has been shown that B cell follicle
formation depends on a positive feedback loop between LTα1β2-expressing B cells and LTβR-expressing
FDC, in which LTβR signaling initiates secretion of CXCL13, which in turn attracts additional B cells to
growing follicles
43
. The global PLN imaging approach applied in this study supports the notion that this
6
3
process is intrinsically self-limiting, as follicles are typically size-restricted to less than 25 x 10 µm in
homeostasis. How the homeostatic size is regulated on a molecular and cellular level is unclear at the
moment, but could be related to the number of B cells present in a given lymphoid organ. Thus, the average
follicle size in B cell-rich PPs is larger than in B cell-poor PLNs.
An acute infection with LCMV is efficiently controlled by the cytotoxic T-cell (CTL) response of the host
and B cells are not required for the initial control of low dose LCMV infection
33,34
44,45
,
. Hence, altered viral
replication in B cell-deficient mice can be excluded as a reason for the different PLN restructuring observed
in JHT mice. Here, we found that LCMV-induced growth of the HEV network, but not their MECA-79+phenotype, depended to a large extent on LTα1β 2 expression by B cells. As general inhibition of LT signaling
induced a more efficient reduction of PLN expansion, other LT-expressing cell types such as activated T
13
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
cells, or lymphoid tissue inducer cells, which accumulate in SLOs during LCMV infection
17
, might as well
contribute to PLN remodeling during viral infection. Our data furthermore show that besides LT signaling,
additional mechanisms control PLN growth. Monocyte subsets have been recently implicated in tumor
angiogenesis
46,47
. Similarly, we observed monocyte recruitment into LCMV-infected PLNs (unpublished
data). It will be interesting to investigate a possible role for monocytes during PLN remodelling and a
potential cross-talk with B cells.
B cells were also found to be required in non-viral inflammation-induced PLN expansion. In particular, the B
cell-secreted pro-angiogenic factor VEGF-A acts as a central mediator for lymph angiogenesis and PLN
12
growth . This may help to create a positive feedback loop through recruitment of increased numbers of DCs
from the periphery, which in turn secrete angiogenic factors
14
48
and have been implicated in PLN remodeling
. In addition to the direct effect of B cell-secreted VEGF-A, LTα1β2 binding to LTβR induces VEGF-A
secretion by FRCs
19
. However, under the conditions employed here, we were unable to uncover a major
role for VEGF-A - VEGFR2 signaling during LCMV-induced PLN growth. The lack of increased VEGF-A or
VEGFR2 expression and the inefficiency of anti-VEGF treatment during the course of an LCVM infection
argue for a minor role of this pathway in this infection model. The molecular mechanism by which LT
signaling leads to PLN expansion during LCMV infections remains therefore unclear to date. In preliminary
experiments using twophoton microscopy, we observed prolonged B cell dwelling time around HEV of
inflamed PLNs (unpublished data). We therefore favor a model in which direct molecular interactions
between LTα1β2+ B cells and LTβR+ high endothelial cells during inflammation-induced recruitment of bloodborne B cells are blocked by the LTβR-Ig, although future experiments need to address whether B cell
behavior in and around HEV is related to LT signaling. Alternatively, LT signaling may contribute to the
production of additional proangiogenic factors, such as FGF2
49,50
.
The molecular and cellular requirements for lymphoid tissue restructuring are likely to differ depending on the
type of immune response. For example, while B cells are indispensable for PLN expansion in adjuvans- and
LCMV-induced immune challenges, VEGF-A produced at peripheral sites induces B cell-independent
lymphangiogenesis and PLN expansion
12,15
. These different requirements may be linked to the source of
morphogenic factors, i.e., afferent lymph- versus lymphoid tissue-derived. Along the same line, our
preliminary results indicate a different PLN remodeling pattern during infection with the cytopathic vesicular
stomatitis virus. In this model, B cell follicles increase in size but without a concomitant increase in PLN size
or HEV network length (Figure S9), indicating that lymphoid tissue restructuring differs even between viral
infections. Finally, the molecular and cellular mechanisms leading to the restoration of a normal PLN
14
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
architecture have only started to become investigated. Both LTα and LTβR mRNA levels peak during an
LCMV infection on day 4 p.i., before rapidly decreasing to baseline levels by day 8 to 25
17
. A future
challenge will be to identify the roles for B cells, LT and other factors during expansion and contraction of
lymphoid tissue and thus to establish “rules of morphogenesis” directing the restructuring of lymphoid tissue
and their interdependence with the outcome of immune response.
In summary, we identify LT on B cells and non-B cells as a major morphogenic factor governing PLN growth
during LCMV infections. Furthermore, we provide evidence that mesoscopic imaging is a promising
approach to describe in detail lymphoid microarchitecture in homeostasis and inflammation-induced
changes. Clearly, many issues remain to be addressed, such as the precise mechanisms of vascular and
lymph angiogenesis and the contribution of PLN stroma during early remodeling. We expect that mesoscopic
imaging will contribute to a better understanding of the rules underlying morphological changes in
homeostasis and inflammation.
15
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Acknowledgements
We thank Prof. Britta Engelhardt for continuous support, and Drs. James Sharpe, Ulrich H. von Andrian,
Tobias Junt, Mark Coles and Urban Deutsch for critical reading of the manuscript and helpful suggestions.
We are grateful to Dr. Jeff Browning and Biogen Idec for their generous gift of anti-CD20 mAb and control
and LTβR-Ig fusion protein.
16
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Authorship contributions
V.K, E.S., R.D, L.O. and M.N. performed experiments; Y.F. provided important material; V.K, E.S., C.H., B.L.
and J.V.S. designed the research and wrote the manuscript.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Jens V. Stein, University of Bern, Theodor Kocher Institute, Freiestr. 1, 3012 Bern,
Switzerland. email: [email protected]
17
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
References
1.
von Andrian UH, Mempel TR. Homing and cellular traffic in lymph nodes. Nat Rev Immunol. 2003;3
(11):867-878.
2.
Cyster JG. Chemokines, sphingosine-1-phosphate, and cell migration in secondary lymphoid
organs. Annu Rev Immunol. 2005;23127-159.
3.
Bajenoff M, Egen JG, Qi H, Huang AY, Castellino F, Germain RN. Highways, byways and
breadcrumbs: directing lymphocyte traffic in the lymph node. Trends Immunol. 2007;28 (8):346-352.
4.
Junt T, Scandella E, Ludewig B. Form follows function: lymphoid tissue microarchitecture in
antimicrobial immune defence. Nat Rev Immunol. 2008;8 (10):764-775.
5.
Bajenoff M, Egen JG, Koo LY, et al. Stromal cell networks regulate lymphocyte entry, migration, and
territoriality in lymph nodes. Immunity. 2006;25 (6):989-1001.
6.
Sixt M, Kanazawa N, Selg M, et al. The conduit system transports soluble antigens from the afferent
lymph to resident dendritic cells in the T cell area of the lymph node. Immunity. 2005;22 (1):19-29.
7.
Lammermann T, Sixt M. The microanatomy of T-cell responses. Immunol Rev. 2008;22126-43.
8.
Herman PG, Yamamoto I, Mellins HZ. Blood microcirculation in the lymph node during the primary
immune response. J Exp Med. 1972;136 (4):697-714.
9.
Anderson ND, Anderson AO, Wyllie RG. Microvascular changes in lymph nodes draining skin
allografts. Am J Pathol. 1975;81 (1):131-160.
10.
Steeber DA, Erickson CM, Hodde KC, Albrecht RM. Vascular changes in popliteal lymph nodes due
to antigen challenge in normal and lethally irradiated mice. Scanning Microsc. 1987;1 (2):831-839.
11.
Soderberg KA, Payne GW, Sato A, Medzhitov R, Segal SS, Iwasaki A. Innate control of adaptive
immunity via remodeling of lymph node feed arteriole. Proc Natl Acad Sci U S A. 2005;102 (45):1631516320.
12.
Angeli V, Ginhoux F, Llodra J, et al. B cell-driven lymphangiogenesis in inflamed lymph nodes
enhances dendritic cell mobilization. Immunity. 2006;24 (2):203-215.
13.
Liao S, Ruddle NH. Synchrony of high endothelial venules and lymphatic vessels revealed by
immunization. J Immunol. 2006;177 (5):3369-3379.
14.
Webster B, Ekland EH, Agle LM, Chyou S, Ruggieri R, Lu TT. Regulation of lymph node vascular
growth by dendritic cells. J Exp Med. 2006;203 (8):1903-1913.
15.
Halin C, Tobler NE, Vigl B, Brown LF, Detmar M. VEGF-A produced by chronically inflamed tissue
induces lymphangiogenesis in draining lymph nodes. Blood. 2007;110 (9):3158-3167.
16.
Katakai T, Hara T, Sugai M, Gonda H, Shimizu A. Lymph node fibroblastic reticular cells construct
the stromal reticulum via contact with lymphocytes. J Exp Med. 2004;200 (6):783-795.
17.
Scandella E, Bolinger B, Lattmann E, et al. Restoration of lymphoid organ integrity through the
interaction of lymphoid tissue-inducer cells with stroma of the T cell zone. Nat Immunol. 2008;9 (6):667-675.
18.
Mueller SN, Hosiawa-Meagher KA, Konieczny BT, et al. Regulation of homeostatic chemokine
expression and cell trafficking during immune responses. Science. 2007;317 (5838):670-674.
19.
Chyou S, Ekland EH, Carpenter AC, et al. Fibroblast-type reticular stromal cells regulate the lymph
node vasculature. J Immunol. 2008;181 (6):3887-3896.
20.
Browning JL, Allaire N, Ngam-Ek A, et al. Lymphotoxin-beta receptor signaling is required for the
homeostatic control of HEV differentiation and function. Immunity. 2005;23 (5):539-550.
18
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
21.
Halin C, Detmar M. An unexpected connection: lymph node lymphangiogenesis and dendritic cell
migration. Immunity. 2006;24 (2):129-131.
22.
Verveer PJ, Swoger J, Pampaloni F, Greger K, Marcello M, Stelzer EH. High-resolution threedimensional imaging of large specimens with light sheet-based microscopy. Nat Methods. 2007;4 (4):311313.
23.
Huisken J, Swoger J, Del Bene F, Wittbrodt J, Stelzer EH. Optical sectioning deep inside live
embryos by selective plane illumination microscopy. Science. 2004;305 (5686):1007-1009.
24.
Alanentalo T, Asayesh A, Morrison H, et al. Tomographic molecular imaging and 3D quantification
within adult mouse organs. Nat Methods. 2007;4 (1):31-33.
25.
Sharpe J, Ahlgren U, Perry P, et al. Optical projection tomography as a tool for 3D microscopy and
gene expression studies. Science. 2002;296 (5567):541-545.
26.
Dodt HU, Leischner U, Schierloh A, et al. Ultramicroscopy: three-dimensional visualization of
neuronal networks in the whole mouse brain. Nat Methods. 2007;4 (4):331-336.
27.
Keller PJ, Schmidt AD, Wittbrodt J, Stelzer EH. Reconstruction of zebrafish early embryonic
development by scanned light sheet microscopy. Science. 2008;322 (5904):1065-1069.
28.
Gu H, Zou YR, Rajewsky K. Independent control of immunoglobulin switch recombination at
individual switch regions evidenced through Cre-loxP-mediated gene targeting. Cell. 1993;73 (6):1155-1164.
29.
Koni PA, Sacca R, Lawton P, Browning JL, Ruddle NH, Flavell RA. Distinct roles in lymphoid
organogenesis for lymphotoxins alpha and beta revealed in lymphotoxin beta-deficient mice. Immunity.
1997;6 (4):491-500.
30.
Fukui Y, Hashimoto O, Sanui T, et al. Haematopoietic cell-specific CDM family protein DOCK2 is
essential for lymphocyte migration. Nature. 2001;412 (6849):826-831.
31.
Ludewig B, Ehl S, Karrer U, Odermatt B, Hengartner H, Zinkernagel RM. Dendritic cells efficiently
induce protective antiviral immunity. J Virol. 1998;72 (5):3812-3818.
32.
Kunstfeld R, Hirakawa S, Hong YK, et al. Induction of cutaneous delayed-type hypersensitivity
reactions in VEGF-A transgenic mice results in chronic skin inflammation associated with persistent
lymphatic hyperplasia. Blood. 2004;104 (4):1048-1057.
33.
Brundler MA, Aichele P, Bachmann M, Kitamura D, Rajewsky K, Zinkernagel RM. Immunity to
viruses in B cell-deficient mice: influence of antibodies on virus persistence and on T cell memory. Eur J
Immunol. 1996;26 (9):2257-2262.
34.
2174.
Asano MS, Ahmed R. CD8 T cell memory in B cell-deficient mice. J Exp Med. 1996;183 (5):2165-
35.
Mendel DB, Laird AD, Xin X, et al. In vivo antitumor activity of SU11248, a novel tyrosine kinase
inhibitor targeting vascular endothelial growth factor and platelet-derived growth factor receptors:
determination of a pharmacokinetic/pharmacodynamic relationship. Clin Cancer Res. 2003;9 (1):327-337.
36.
Gommerman JL, Browning JL. Lymphotoxin/light, lymphoid microenvironments and autoimmune
disease. Nat Rev Immunol. 2003;3 (8):642-655.
37.
Boissonnas A, Fetler L, Zeelenberg IS, Hugues S, Amigorena S. In vivo imaging of cytotoxic T cell
infiltration and elimination of a solid tumor. J Exp Med. 2007;204 (2):345-356.
38.
Bousso P, Robey EA. Dynamic behavior of T cells and thymocytes in lymphoid organs as revealed
by two-photon microscopy. Immunity. 2004;21 (3):349-355.
39.
Cahalan MD, Parker I, Wei SH, Miller MJ. Two-photon tissue imaging: seeing the immune system in
a fresh light. Nat Rev Immunol. 2002;2 (11):872-880.
19
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
40.
Robey EA, Bousso P. Visualizing thymocyte motility using 2-photon microscopy. Immunol Rev.
2003;19551-57.
41.
Sumen C, Mempel TR, Mazo IB, von Andrian UH. Intravital microscopy: visualizing immunity in
context. Immunity. 2004;21 (3):315-329.
42.
Sharpe J. Optical projection tomography. Annu Rev Biomed Eng. 2004;6209-228.
43.
Ansel KM, Ngo VN, Hyman PL, et al. A chemokine-driven positive feedback loop organizes lymphoid
follicles. Nature. 2000;406 (6793):309-314.
44.
Muller S, Hunziker L, Enzler S, et al. Role of an intact splenic microarchitecture in early lymphocytic
choriomeningitis virus production. J Virol. 2002;76 (5):2375-2383.
45.
Kagi D, Vignaux F, Ledermann B, et al. Fas and perforin pathways as major mechanisms of T cellmediated cytotoxicity. Science. 1994;265 (5171):528-530.
46.
Kubota Y, Takubo K, Shimizu T, et al. M-CSF inhibition selectively targets pathological angiogenesis
and lymphangiogenesis. J Exp Med. 2009;206 (5):1089-1102.
47.
De Palma M, Venneri MA, Galli R, et al. Tie2 identifies a hematopoietic lineage of proangiogenic
monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors.
Cancer Cell. 2005;8 (3):211-226.
48.
Sozzani S, Rusnati M, Riboldi E, Mitola S, Presta M. Dendritic cell-endothelial cell cross-talk in
angiogenesis. Trends Immunol. 2007;28 (9):385-392.
49.
Cross MJ, Claesson-Welsh L. FGF and VEGF function in angiogenesis: signalling pathways,
biological responses and therapeutic inhibition. Trends Pharmacol Sci. 2001;22 (4):201-207.
50.
Presta M, Dell'Era P, Mitola S, Moroni E, Ronca R, Rusnati M. Fibroblast growth factor/fibroblast
growth factor receptor system in angiogenesis. Cytokine Growth Factor Rev. 2005;16 (2):159-178.
20
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Figure Legends
Figure 1. Mesoscopic examination of naive PLN volume, B cell follicle structure and HEV network. A.
Workflow of OPT analysis of PLN architecture. PLN labeled with B220-Alexa488 and MECA-79-Alexa594
mAbs were dehydrated, cleared in BABB and imaged in an OPT scanner as described in Material and
Methods (top panel). In some experiments, MECA-79-Alexa568 was used with similar results. After OPT
image acquisition, samples can be further analyzed using high-resolution laser scanning microscopy (LSM)
or rehydrated for flow cytometry analysis (lower panel). As seen in the left panel (OPT), the current
resolution clearly identifies HEV but not individual endothelial cells as seen using high-resolution LSM. Scale
bar in LSM = 40 µm. B. Schematic representation of primary OPT images (left panel; shown is one of 400
raw images before 3D reconstruction), 3D reconstruction (middle panel) and quantification of fluorescently
labeled structures (right panel). Prior to OPT imaging, PLN were whole-mount labeled with B220-Alexa488
(for B cell follicles) and MECA-79-Alexa594 (anti-PNAd for HEV) mAbs and processed as described in
Material and Methods. The length of the long axis of the inguinal PLN shown is 2.4 mm.
Figure 2. Homeostatic PLN structure. A. Classification of PLN into small (Pop: popliteal), medium (Cer + Ax:
cervical and axillary) and large (Ing: inguinal). Each symbol represents one PLN. B. Correlation between
PLN volume and number of B cell follicles. Each square represents one PLN. C. Normalized size distribution
6
3
6
3
6
of individual B cell follicles. White bars: 1-5 x 10 µm , grey bars: 5-15 x 10 µm , dark grey bars: 15-25 x 10
µm3; black bars: >25 x 106 µm3. D. Correlation between PLN volume and total HEV length. Each square
represents one PLN.
Figure 3. Structural changes in inguinal PLN volume, HEV network and B cell follicle size and distribution
+
during LCMV infection. A. Representative OPT images of B220 areas (green) and HEVs (red) showing an
initial increase in the B cell follicle size on day (D) 2 p.i. followed by incremental loss of regular follicle
organization by day 8 p.i. (D8). Arrows: superlarge follicles (>25 x 106 µm3); asterisk: small B cell clusters (<5
6
3
x 10 µm ). Scale bar = 400 µm. B. Top panels. Absolute volume, B cell volume and HEV length of inguinal
PLN during LCMV infection. Each dot represents one PLN. Bottom panels. Fold-increase as compared to
day 0. Data are shown as mean ± SEM. * = p<0.05, *** = p<0.001, n.s. = not significant (One-way ANOVA).
C. Change in B cell follicle size distribution during LCMV infection. B cell follicle sizes were classified as in
Figure 2C. Pooled from a total of 6-12 inguinal, popliteal and axillary PLNs from 3-7 mice for each time point.
21
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Figure 4. B cell requirement for LCMV-triggered PLN expansion. A. Experimental layout for B cell depletion
in WT mice (αCD20 mAb; 250 µg/mouse on day -10) vs. B cell reconstitution and LCMV infection in JHT
mice. A total of 2 x 15-20 x 106 B cells were injected per JHT recipient on day -2 and 0. B. Representative
OPT images of day 8 (D8)-LCMV-infected inguinal PLNs of WT, WT + αCD20, JHT and JHT + WT B cells.
Scale bar = 400 µm. C. Inguinal LN volume on day 0 (D0, white bar) and day 8 (D8, black bar) p.i. of WT
mice, or WT mice + αCD20 mAb or JHT mice reconstituted with WT B cells on day -2 and day 0 p.i. *** =
p<0.001 as compared to day 8 LCMV WT (One-way ANOVA). D. Total HEV network length on day 0 and
day 8 p.i. as in A. All day 8 values in A and B were significantly higher than on corresponding day 0
(Student’s t-test). *** = p<0.001 as compared to day 8 LCMV WT (one-way ANOVA). Numbers indicate fold
increase over day 0. No significant difference was found in A and B between day 8 “WT” and “JHT + WT B
cells”, nor between “JHT” and “WT + αCD20” (One-way ANOVA). Pooled from 3-8 PLNs from 2-6 mice in 2
independent experiments. Data are shown as mean ± SEM.
Figure 5. VEGF-A expression and inhibition during LCMV-induced PLN remodeling. A. qPCR analysis of
VEGF-A and VEGFR2 expression in LCMV-infected PLNs. Two PLNs from 2 mice per time point were
analyzed in duplicates. B. Experimental layout for VEGF signaling blocking and LCMV infection in WT mice.
Mice received two injections on day 0 and 3 p.i. of Abs as described in Material and Methods, or daily
gavage of the VEGFR/PDGFR-inhibitor sunitinib. C. Inguinal LN volume on day 0 (D0) or day 8 (D8) p.i. after
treatment of mice with control Ig or anti-VEGFR2, anti-VEGF-A Abs or sunitinib. Pooled from 1-2
independent experiments with 3-5 mice per treatment. D. Total HEV length on day 0 (D0) or day 8 (D8) p.i.
as in C. No significant difference was found in C and D between day 8 control Ig and Ab- or inhibitor-treated
values (One-way ANOVA).
Figure 6. LT signaling during LCMV-induced PLN remodeling. A. Experimental layout for LT blocking in WT
mice and B cell reconstitution in JHT mice, followed by LCMV infection. WT mice received two injections on
day 0 and 3 p.i. of 100 µg control or LTβR-Ig. JHT mice were reconstituted with WT or LTβ-/- B cells as
described in Figure 4A. B. Representative OPT images of inguinal LN isolated from day 8 (D8) LCMVinfected WT, WT + LTβR-Ig, JHT + WT B cells and JHT + LTβ-/- B cells mice. Scale bar = 400 µm. C.
Inguinal LN volume on day 0 (D0) or day 8 (D8) p.i. after treatment of mice with control Ig or LTβRIg, or in
JHT mice reconstituted with WT or LTβ-/- B cells. D. Total HEV length on day 0 (D0) or day 8 (D8) p.i. as in
C. All day 8 values in C and D were significantly higher than on corresponding day 0 (Student’s t-test). * =
22
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
p<0.05, ** = p<0.01, *** = p<0.001 comparing day 8 LCMV “WT + control Ig” vs. “WT + LTβRIg” and “JHT +
-/-
WT B cells” vs. “JHT + LTβ B cells”, respectively. No significant difference was found in C and D between
day 8 “WT + control Ig” and “JHT + WT B cells”, nor between “WT + LTβRIg” and “JHT + LTβ
-/-
B cells”
(One-way ANOVA). E. Percentage of B cell volume over total PLN volume in WT mice on day 0 (D0) or day
8 (D8) p.i. after treatment of mice with control Ig or LTβRIg. *** = p<0.001. F. Absolute B cell number per
inguinal LN in mice treated with control Ig or LTβRIg on day 8 p.i.. n.s. = not significant. Pooled from 3-9
PLNs from 2-8 mice in 2 independent experiments. Data are shown as mean ± SEM. G. Average HEV
segment length on day 0, 2, 5 and 8 p.i. White bars: 20-100 µm; grey bars: 100-200 µm; black bars: >200
µm. On day 2, the proportion of segments less than 100 µm is significantly increased, while the proportion of
segments >200 µm is increased on day 8 p.i. Pooled from a total of 4-5 inguinal LNs from 2-3 mice for each
time point. H. Total HEV segment number in WT and JHT mice infected with LCMV. Black columns
represent day 8 p.i.. I. Percentage of HEV with diameter > 50 µm during LCMV infection. Black columns
represent day 8 p.i.. Data are shown as mean ± SEM. * = p<0.05, *** = p<0.001 compared to “D0” (One-way
ANOVA).
23
From www.bloodjournal.org by guest on June 16, 2017. For personal use on
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
Prepublished online February 25, 2010;
doi:10.1182/blood-2009-10-250118
Global lymphoid tissue remodeling during a viral infection is orchestrated
by a B cell-lymphotoxin-dependent pathway
Varsha Kumar, Elke Scandella, Renzo Danuser, Lucas Onder, Maximilian Nitschké, Yoshinori Fukui,
Cornelia Halin, Burkhard Ludewig and Jens V. Stein
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Advance online articles have been peer reviewed and accepted for publication but have not yet
appeared in the paper journal (edited, typeset versions may be posted when available prior to
final publication). Advance online articles are citable and establish publication priority; they are
indexed by PubMed from initial publication. Citations to Advance online articles must include
digital object identifier (DOIs) and date of initial publication.
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.