Population Genetics DNA Fingerprint Reminders • Genetic Disease Presentation - Friday • Review - Monday • Final Exam -Thursday, 1:30-3:30 Population Genetics Frequencies Genotype Frequencies P = freq. of AA H = freq. of Aa Q = freq. of aa Allele Frequencies p = freq. of A allele q = freq. of a allele p = P+1/2 H q = Q+1/2 H If Hardy-Weinberg Equilibrium P = p2 H = 2pq Q = q2 q=√Q Hardy-Weinberg Equilibrium • Genotype and allele frequencies remain constant from one generation to the next if the following conditions are met: • random mating • no natural selection • no migration • no mutation • large population size Evolution Population Genetics Equations Natural Selection fitness (from survival) w inital P,H,Q x fitness = rel freq rel freq/total = new P,H,Q p’=P+1/2H, q’=Q+1/2H Migration and Genetic Drift N0=initial genotype numbers Nt=new genotype numbers Calculate P,H,Q p’=P+1/2H , q’=Q+1/2H Inbreeding Random H*H*1/4 Siblings 2H * 1/16 Cousins 2H * 1/64 Mutation p’ = p - µp q’ = q + µp DNA Fingerprint • Shows alleles present in an individual • Used in paternity, crime investigation, medical diagnosis std. pers.1 pers.2 Tandem Repeats • sequences of DNA that repeat Short Tandem Repeats (STR) - 1,2,3 bases repeat 15-100 times GACGACGACGACGAC Variable Number of Tandem Repeats (VNTR) - 10-40 bases repeat 10’s to 1000’s GACTTACAGCGACTTACAGCGACTTACAGC Each Individual has 2 Alleles Person A Chromosome 1a Chromosome 1b GACGACGACGACGAC GACGACGAC 3 Person B Chromosome 1a GACGACGACGAC Chromosome 1b GACGACGACGAC 4 4 5 PCR • technique to amplify selected DNA region GACGACGACGACGAC GACGACGACGACGAC GACGACGAC GACGACGAC Polymerase Chain Reaction (PCR) • Heat DNA to open 3‘ATTGGTTCCGACCGACCGACCGACCGACCGAGGTTATT5’ 5‘TAACCAAGGCTGGCTGGCTGGCTGGCTGGCTCCAATAA3’ Polymerase Chain Reaction (PCR) • Primers attach 3‘ATTGGTTCCGACCGACCGACCGACCGACCGAGGTTATT5’ 5’CCAA GGTT5’ 5‘TAACCAAGGCTGGCTGGCTGGCTGGCTGGCTCCAATAA3’ Polymerase Chain Reaction (PCR) • Taq polymerase builds new DNA from primer to end 3‘ATTGGTTCCGACCGACCGACCGACCGACCGAGGTTATT5’ 5’CCAAGGCTGGCTGGCTGGCTGGCTGGCTCCAATAA3’ 3‘ATTGGTTCCGACCGACCGACCGACCGACCGAGGTT5’ 5‘TAACCAAGGCTGGCTGGCTGGCTGGCTGGCTCCAATAA3’ PCR Fingerprint Gel Electrophoresis smallest + - Stain Ethidium Bromide D1S80 • Tandem Repeat • Chromosome 1 • 16 nucleotides long • repeats 15 - 40x • multiple alleles (26) D1S80 # Repeats Caucasian Hispanic African Amer. Asian 15 0 0.001 0 0 16 0.001 0.01 0.002 0.034 17 0.002 0.009 0.028 0.025 18 0.237 0.224 0.073 0.152 19 0.003 0.005 0.003 0.022 20 0.018 0.013 0.032 0.007 21 0.021 0.028 0.115 0.034 22 0.038 0.024 0.081 0.017 23 0.012 0.009 0.014 0.017 24 0.378 0.315 0.234 0.23 DNA Fingerprinting 19 0.003 20 0.018 21 0.021 22 0.038 23 0.012 • What is probability of a Caucasian having a D1S80 repeat of 19 and 23? • H=2pq • H =2*0.003 * 0.012 = (19,23) 0.000072 • 211.5 million Caucasians in US • 15,228 people DNA Fingerprinting • What is probability of a Caucasian having a D7S820 repeat of 8 and 14? • H=2pq H(8,14) = 2*.151 * 0.002 = 0.000604 • 211.5 million Caucasians in US • 127,746 people DNA Fingerprinting • D1S80 H = 0.000072 • D7S820 H = 0.000604 • Chance of both? • 0.000072*0.000604 = 0.000000043 • 211.5 million caucasians * 0.000000043 • 9.2 people (19,23) (8,14) 13 Loci in DNA Fingerprints DNA Fingerprint • What if person has only 1 band? • Homozygous for locus • P=p • What is the probability a 2 Hispanic person is homozygous for D1S80 allele 20 repeats? P(20,20)=0.013*0.013=0.000169 # Caucasi Hispani Repeats an c 18 0.237 0.224 19 0.003 0.005 20 0.018 0.013 21 0.021 0.028 22 0.038 0.024 Paternity Example Activity 25
© Copyright 2026 Paperzz