Protein Engineering vol.16 no.2 pp.135–145, 2003
DOI: 10.1093/proeng/gzg015
Evolution of an organophosphate-degrading enzyme:
a comparison of natural and directed evolution
H.Yang1, P.D.Carr1, S.Yu McLoughlin1, J.W.Liu1,
I.Horne2, X.Qiu2, C.M.J.Jeffries1, R.J.Russell2,
J.G.Oakeshott2 and D.L.Ollis1,3
1Research
School of Chemistry, Australian National University,
GPO Box 414, Canberra, ACT 2601 and 2CSIRO Entomology,
Canberra, ACT 2601, Australia
3To
whom correspondence should be addressed.
E-mail: [email protected]
Organophosphate-degrading enzyme from Agrobacterium
radiobacter P230 (OPDA) is a recently discovered enzyme
that degrades a broad range of organophosphates. It is
very similar to OPH first isolated from Pseudomonas
diminuta MG. Despite a high level of sequence identity,
OPH and OPDA exhibit different substrate specificities.
We report here the structure of OPDA and identify regions
of the protein that are likely to give it a preference for
substrates that have shorter alkyl substituents. Directed
evolution was used to evolve a series of OPH mutants that
had activities similar to those of OPDA. Mutants were
selected for on the basis of their ability to degrade a
number of substrates. The mutations tended to cluster in
particular regions of the protein and in most cases, these
regions were where OPH and OPDA had significant differences in their sequences.
Keywords: Agrobacterium/bioremediation/carboxylated
lysine/directed evolution/organophosphates/
phosphotriesterase
Introduction
Organophosphates form a large family of compounds that have
appeared in the environment in recent evolutionary times.
Although toxic to higher organisms, organophosphates represent
an abundant source of nutrition for bacteria and an enzyme
capable of degrading them has recently been isolated from an
Agrobacterium radiobacter strain (Horne et al., 2002). The
organophosphate degrading enzyme from A.radiobacter
(OPDA) is very similar in sequence to an organophosphate
hydrolase (OPH) from Pseudomonas diminuta MG and Flavobacterium sp. ATCC 27551. This latter enzyme is known as
phosphotriesterase, organophosphorus hydrolase, organophosphate-degrading enzyme or parathion hydrolase. Despite a
high level of sequence similarity, the two enzymes show differences in their substrate specificity that suggests a state of evolutionary flux. In this study we used structural and molecular
techniques to better understand the catalytic properties and the
evolutionary relationship between the two phosphotriesterases.
Much work has been done to characterize the structure and
function of OPH (Raushel, 2002). It has a structure and active
site that are related to other enzymes, yet it acts specifically
on phosphotriesters. OPH folds into a ‘TIM’ barrel, (αβ)8,
with a binuclear metal binding site located at the C-terminal
end of the barrel. It is one of a superfamily of metal-containing
© Oxford University Press
amidohydrolases (Holm and Sander, 1997). Other family
members for which crystal structures are also available include
urease (Jabri et al., 1995), dihydroorotase (Thoden et al.,
2001) and adenosine deaminase (Wilson and Quiocho, 1993).
Like OPH, most of the other enzymes in the superfamily
contain two metals in the active site. The activity of OPH in
the presence of various metals has been examined with highest
activity recorded with Co2⫹. Structures of OPH have been
determined with Zn2⫹, Cd2⫹, Mn2⫹ and Zn2⫹/Cd2⫹ in the
active site (Benning et al., 2001) as well as the apoenzyme
(Benning et al., 1994). The enzyme acts on a broad range of
substrates. Some substrates are turned over at near diffusion
rates whereas others are processed at more modest rates.
Structures of OPH have been obtained with the inhibitors
diethyl 4-methylbenzylphosphonate, diisopropyl methyl phosphonate and triethyl phosphate (Vanhooke et al., 1996). These
inhibitors are substrate analogues and bind in the active site
of the enzyme giving clear indications of how the protein
binds substrate. Pockets to accommodate the phosphate substituents have been identified. Raushel and co-workers (ChenGoodspeed et al., 2001a) have shown that the stereoselectivity
depends on the sizes of three pockets known as the small,
large and leaving group subsites. Furthermore, they show that
stereoselectivity can be enhanced, relaxed or reversed by
simultaneous alterations in the sizes of the three subsites
(Chen-Goodspeed et al., 2001b). The structural and kinetic
studies have allowed a plausible enzyme mechanism to be
proposed; it involves a single in-line displacement attack (SN2)
(Lewis et al., 1988) with the metal-bridging hydroxide ion
acting as the nucleophile (Benning et al., 2000).
The sequences of OPDA and OPH are similar with 90%
identity at the amino acids level (Horne et al., 2002). The
most significant difference between the two proteins is at the
C-terminus where OPDA has an additional 20 residues. The
remaining sequence differences occur throughout the protein
with some found in the active site. These sequence differences
are thought to be responsible for the variation between the
substrate specificities of OPH and OPDA; OPDA exhibits
higher kcat values for substrates with shorter side chains and
can hydrolyse fenthion and phosmet for which OPH has no
activity (Horne et al., 2002).
Given the potential use of phosphotriesterases for the bioremediation of pesticides and nerve agents such as sarin,
soman and VX, much work has been undertaken to understand
the nature of the mechanism and substrate-binding determinants. The utility of these enzymes to facilitate bioremediation
has been demonstrated by experiments in which OPH has
been expressed on the surface of Escherichia coli cells and
immobilized on a non-woven, polypropylene fabric for use in
detoxifying contaminated wastewaters (Mulchandani et al.,
1999). However, further progress in bioremediation may well
depend on the identification of new enzymes or in tailoring
known enzymes to specific requirements. Thus, understanding
135
H.Yang et al.
Table I. Primer sequences
P1
P2
P3
P4
P5
P6
Fig. 1. Substrates used in this study.
how nature modifies enzymes to bring about subtle changes
in substrate specificity and catalytic properties is of some
interest. Towards this end, we report the structure determination
of OPDA and comment on the structural basis for the difference
in substrate specificity of OPH and OPDA. In addition, we
report the results of directed evolution with OPH. Other
workers (Cho et al., 2002) have also applied directed evolution
to OPH; however, the method of selection and the consequent
results differ from those described here. In our experiments,
OPH mutants were selected on their ability to degrade methylparathion, methyl-paraoxon and coumaphos-o-analogue
(Figure 1). The coumaphos-o-analogue contains diethyl substituents wherease the others contain dimethyl substituents.
Our selection has produced mutants that show improved
catalytic efficiency for substrates that contain either diethyl or
dimethyl substituents. To test the ability of the evolved enzymes
to degrade compounds other than those used in the selection
process, the mutant proteins were tested for their ability
to degrade demeton S, a compound that contains diethyl
substituents. It should be noted that the substrates used in the
evolution experiments were all processed more rapidly by
OPDA than OPH. Some of the evolved mutants of OPH had
activities that were similar to those of OPDA. We comment
on the sequence differences between OPH and OPDA and
compare these differences with the sequence changes brought
about by directed evolution. In effect, we compare the changes
brought about by directed and natural evolution.
Materials and methods
Materials
Pesticides were purchased from Chem Service. Molecular
biology reagents and enzymes were bought from either Roche
136
5⬘
5⬘
5⬘
5⬘
5⬘
5⬘
ACCATGATTACGAATTCCGGCGATCGG 3⬘
GTCGACTCTAGAGGATCCAGATGGCGT 3⬘
GGTACCCATATGAGCATGGCCCGACCAATC 3⬘
CGGGATCCGAATTCTTATCACGACGCCCG 3⬘
GGATACCTCATCGGTCTAGACCGCATCCCGCACAGTGCGATTGG 3⬘
CCAATCGCACTGTGCGGGATGCGGTCTAGACCGATGAGGTATCC 3⬘
or Stratagene. Primers (Table I) were obtained from Geneworks.
QIAGEN DNA purification kits were used for all DNA
purifications unless stated otherwise.
Bacterial strains and growth conditions
The E.coli strain DH5α was used for all aspects of the
work described. Cells were grown at 30°C. Cell lines were
maintained on LB agar plates supplemented with 100 µg/ml
ampicillin. Cultures for production of protein for purification
were grown in TB media supplemented with 1 mM CoCl2.6H2O
and 100 µg/ml ampicillin and shaken at 200 rpm. Mutant
libraries were initially grown on LB agar plates containing 1–
4 µM coumaphos-o-analogue (Harcourt et al., 2002), referred
to as indicator plates. Potential positive mutants were grown
in LB medium supplemented with 100 µg/ml ampicillin either
in 96-well plates and shaken at 100 rpm or in test-tubes and
shaken at 200 rpm.
Construction of pCY76
The plasmid pCY76 (par⫹, bla⫹, lacZpo, T7φ10tir⫹) was
constructed to over-express constitutively non-toxic genes in
E.coli. The heat-inducible protein over-expression plasmid
pND706 (Love et al., 1996), underwent digestion using SstI
to liberate a 130 bp fragment containing the φ10 translation
initiation region (T7φ10tir), ribosome binding site (RBS) and
multi-cloning cassette DNA fragment (MCS). The T7φ10tir–
RBS–MCS fragment was blunted with Pfu DNA polymerase
and subsequently sub-cloned into the Pfu DNA polymeraseblunted BamHI/KpnI sites of pMTL22P (Chamber et al., 1998)
to form pCY76.
Expression, purification, crystallization and structure
determination of OPDA
Expression. opdA was obtained using PCR from a 4 kb HindIII
fragment in pBluescript KS⫹ obtained from the Agrobacterium
genome (Horne et al., 2002). The primers P3 and P4 were
used to isolate opdA. The PCR product was restricted with
NdeI and EcoRI, ligated into pCY76, then used to transform
competent cells. The opdA sequence from the subsequent
clone, pSY1, was confirmed via DNA sequencing. The final
opdA used in this study encoded 341 amino acid residues (25–
365; OPH numbers). The putative signal peptide was deleted
(amino acid residues 1–24) and a new start codon added
(amino acid residue 25). In addition, base 1089 (cytosine) was
deleted to create a C-terminus homologous to that of OPH; in
effect, the amino acid residues 366–385 were deleted from
wt OPDA.
Purification. OPDA was purified by a procedure modified
from that described by Grimsley et al. (Grimsley et al., 1997).
No metals were added to the purification buffers. DH5α
pSY1 was grown for 40 h, before cells were harvested and
resuspended in 50 mM HEPES buffer, pH 8.0. Cells were
disrupted with a French Press. The soluble fraction was loaded
on to a DEAE Fractogel column at 1 ml/min. OPDA passed
through the column. The differences between OPH and OPDA
Evolution of a phosphotriesterase
became apparent after the DEAE Fractogel column; OPDA
precipitated during the dialysis against phosphate buffer.
Because of this problem, the pH of the flow-through containing
OPDA was reduced to 7.0 by dialysis against 50 mM HEPES
pH 7.0. OPDA was loaded on to an SP-Sepharose column that
had been equilibrated against the dialysis solution. Bound
OPDA was eluted with ~150 mM NaCl using a linear gradient.
SDS–PAGE analysis of the eluted OPDA showed ⬎95%
purity. OPDA was concentrated via ultrafiltration to 8.3 mg/
ml for crystallization. The protein for crystallization was
stored in 50 mM HEPES pH 7.0, 150 mM NaCl. Protein
concentrations were measured by UV absorption at 280 nm.
The extinction coefficient for OPDA was calculated as 29 280
M–1 cm–1. The yield of OPDA was ~40 mg/l of culture.
Crystals of OPDA. Crystals were formed using vapour diffusion
of hanging drops. Crystals for the in-house dataset were
initiated from a mixture of 5 µl of protein solution with 5 µl
of reservoir solution that consisted of 20% PEG 4000, 0.1 M
sodium citrate and 0.2 M ammonium acetate. Crystals for the
synchrotron dataset were initiated from a mixture of 5 µl of
protein solution which had been dialysed against a solution
containing 1 mM CoCl2.6H2O, 50 mM HEPES and 150 mM
NaCl, with 5 µl of a reservoir solution that consisted of 10%
PEG 4000 and 0.03 M NaH2PO4.
Data collection and structure determination. Crystals were
transferred into a cryobuffer overnight prior to data collection.
The cryobuffer was the same as the crystallization buffer with
the PEG 4000 concentration raised to 30%. Data were collected
from two crystals which were flash cooled to –173°C in a
stream of nitrogen gas. An in-house dataset was collected to
a resolution of 2.5 Å and a synchrotron dataset was collected
to a resolution of 1.8 Å. Data were processed and scaled using
the programs DENZO and SCALEPACK (Otwinowski and
Minor, 1997). The merging statistics are given in Table II.
The point group was determined to be P321 with a Vm
(Mathews, 1968) of 2.9 Å3/Da for a single molecule per
asymmetric unit. Initial phases were obtained from the inhouse dataset by molecular replacement using the program
AMoRe (Navaza, 1994) as implemented in the CCP4 suite of
programs (Collaborative Computational Project Number 4,
1994). The atomic coordinates of a monomer of OPH from
PDB entry 1hzy.pdb (Benning et al., 2001) were used as a
search model. The correct solution from a rotation function
search using X-ray data terms between 25 and 2.3 Å and a
Patterson sphere of 23 Å had a correlation coefficient (cc) of
23.6. The closest incorrect solution had a cc of 10.7. The
translation function identified the space group as P3121 and
the best solution had a cc and R-factor of 71.5 and 0.373,
respectively. The best incorrect solution had a cc and R-factor
of 32.9 and 0.555, respectively. Rigid body refinement in
AMoRE further improved the cc to 75.7 and the R-factor to
0.373. The model displayed good packing geometry when
inspected on a graphics terminal.
Further refinement of a model in which sequence changes
between OPDA and OPH had been incorporated were undertaken using the program CNS (Brunger et al., 1998). A test
set of 5% of the data were excluded from the refinement
calculations for cross-validation purposes. Cycles of torsion
angle dynamics simulated annealing, positional minimization
and individual temperature factor refinement were interspersed
with manual rebuilding and automatic solvent placement. These
were performed using standard CNS refinement protocols.
An initial model was used without metals or water molecules
in the active site and with an unmodified lysine residue at
position 169. Sigmaa (Read, 1986) difference electron density
maps (2mFo–DFc, mFo–DFc) indicated the presence of two
metal ions, one CO2 group and two water molecules in the
active site. The density immediately adjacent to Lys169 was
consistent with covalent modification by carboxylation. This
has also been seen in OPH and other members of the
amidohydrolase superfamily which contain a binuclear metal
centre [urease (Jabri et al., 1985), dihydroorotase (Thoden
et al., 2001)] but not in family members where there is a
single metal present such as adenosine deaminase (Wilson
et al., 1993). However, it was noted that the temperature
factors of the carboxyl moiety refined to significantly higher
values than the atoms coordinated to it, when introduced to
the model at full occupancy. An occupancy of 0.4 produced
B-factors of a similar magnitude to neighbouring atoms (~34
Å2). The identity of the bound metals is not known and
possible candidates include the divalent cations Mg2⫹, Mn2⫹,
Co2⫹, Ni2⫹, Zn2⫹ and Cd2⫹. Reasonable B-factors and difference maps were obtained with both Mg2⫹ with occupancies
of 1.0 and Co2⫹ with occupancies of 0.4. Similar values would
be obtained for any of the other fourth-row ion species listed
above, but Co2⫹ was used because the protein had been
expressed in bacteria that were grown in the presence of 1 mM
Co2⫹. Given that the CO2 group of the carboxylated lysine
and the metal ions have been shown to be mutually stabilizing
(Shim and Raushel, 2000), it is tempting to consider the latter
more likely. This is further supported by the fact that the key
residue Arg254 showed two alternative conformations of its
side chain with occupancies of 0.4 and 0.6. A second dataset
was collected at the BioCARS beamline, BM14D, at the
Advanced Photon Source. The protein had been dialysed
against a solution of 1 mM Co2⫹ prior to crystallization. The
model obtained from the in-house data was used as an initial
model for refinement using the synchrotron data. The same
test reflections were excluded plus a further 5% of data from
the higher resolution shells. Again standard CNS protocols
were used for the refinement. The resulting model refined well
with two Co2⫹ ions in the active site at full occupancy and
only a single conformation of the Arg254 side chain.
Directed evolution of OPH and kinetic analysis of mutant
proteins
Error-prone PCR. The error-prone PCR protocol used was
modified from Chen and Arnold (1993). The PCR reaction
mixture consisted of 200 µM dNTPs, 5U Taq DNA polymerase,
1 µM primers P1 and P2, 10 ng DNA template (pJK33)
(Mulbury and Karns, 1989), 5 mM MgCl2, 0.07 µl β-mercaptoethanol, 5 µl DMSO, 250 µM MnCl2, 10 µl 10⫻ Taq DNA
polymerase buffer and distilled H2O to a final volume of 100
µl. The mutation rate was 1–2 amino acid changes per gene,
determined by sequencing opd from 20 random clones per
round of screening. The EcoRI/BamHI-digested PCR product
was gel extracted, ligated into pUC19 and then used to
transform competent cells. Transformed cells were plated on
to indicator plates.
DNA shuffling. opd mutants were shuffled essentially as
described (Stemmer, 1994). The shuffled genes are described
in the Results section. Primers P1 and P2 were used. The
shuffled genes were cloned into the EcoRI/BamHI sites of
pUC19, then used to transform competent cells. Transformed
cells were plated on indicator plates.
137
H.Yang et al.
Table II. Data collection and refinement statistics
Data collection
Space group
No. of observations
No. of unique reflections
Completeness (%)
⬍I/σ⬎
Rscal
Refinement
Resolution range (Å)
Reflections in working set
Reflections in test set
Unobserved reflections (F 艋 0)
R/Rfree
No. of protein atoms
No. of water molecules
No. of Co2⫹ ions
No. of SO32– ions
R.m.s. deviation from target bonds
Lengths (Å)
Angles (°)
B-factors (Å2)
Mean
Minimum
Maximum
Ramachandran plot (%)
Most favoured region
Additionally allowed
Generously allowed
Disallowed
In-house
(λ ⫽ 1.5418 Å)
Synchrotron
(λ ⫽ 1.2915 Å)
P3121 a ⫽ 109.4, c ⫽ 63.5 Å
219415
15440
99.9 (50.0–2.5 Å shell)
9.5
0.114 (0.259 for 2.66–2.50)
a ⫽ 109.3, c ⫽ 62.8 Å
448718
40278
98.9 (100–1.8 Å shell)
19.3
0.046 (0.167 for 1.86–1.80)
25–2.5
14417 (93.4%)
731 (4.7%)
281 (1.8%)
0.185/0.226
2511
147
2
0
25–1.8
38012 (94.3%)
1,954 (4.8%)
330 (0.8%)
0.191/0.208
2511
226
2
1
0.0065
1.38
0.0048
1.36
32.1
13.8
62.8
19.2
9.5
63.1
86.7
12.5
0.7
0.0
88.2
11.1
0.7
0.0
Site-directed mutagenesis. opd H254R was made using the
QuikChange protocol according to the manufacturer’s directions (Stratagene). The template was pJK33. The primers were
P5 and P6. opd H254R from transformants was sequenced to
confirm the presence of H254R mutation and no others.
Screening. Colonies with significant fluorescence were picked
with a sterile toothpick and grown in 96-well plate format.
The overnight cultures were then assayed for their ability to
degrade three pesticides. This was achieved by adding 10–
30 µl aliquots of each culture to the corresponding wells of
three 96-well plates that contained 80 µl of reaction mixture.
The reaction mixture consisted of either 0.01 mM coumaphoso-analogue dissolved in 100 mM Tris–HCl (pH 7.0) with 8%
methanol, 1.5 mM methyl-paraoxon dissolved in 100 mM
sodium phosphate (pH 8.0) with 10% methanol or 0.4 mM
methyl-parathion dissolved in 100 mM sodium phosphate (pH
8.0) with 10% methanol. The reaction with the coumaphoso-analogue was monitored with a POLARstar fluorimeter
(Harcourt et al., 2002) and the reaction with methyl-parathion
and methyl-paraoxon with a Labsystems Multiskan UV/Vis
spectrophotometer at 400 nm. Activities were taken from the
slopes of the best-fit lines through the data points. Clones
exhibiting the highest activities were retested from single
colonies grown in 96-well plate format, then in test-tubes. The
activities of these cells were confirmed, as before, and glycerol
stocks were prepared.
OPH purification. The methods used to express and purify
OPH and the mutated variants used for kinetic measurements
were modified from those described by Grimsley et al. (1997).
No metals were added to the purification buffers in either the
OPH or OPDA preparations. The soluble cell lysate was passed
138
through a DEAE Fractogel column before OPH was prepared
for cation-exchange chromatography as referenced. OPHcontaining fractions were pooled, concentrated to ~2 mg/ml
via ultrafiltration, then stored at –20°C in the presence of 30%
glycerol. SDS–PAGE analysis of the eluted OPH showed
⬎95% purity. Protein concentrations were measured by UV
absorption at 280 nm. The extinction coefficient for OPH and
the OPH mutant proteins was calculated as 29 160 M–1 cm–1.
Kinetic assays. The kinetic constants for the three substrates
(coumaphos-o-analogue, methyl-paraoxon and methyl-parathion) were determined by varying the concentrations of the
substrate with a constant protein concentration. The protein
was diluted with the corresponding assay buffer in the presence
of 1 mg/ml BSA, which was used to stabilize the diluted
protein. For methyl-parathion, the assay buffer contained 100
mM HEPES pH 8.0, 1 mM CoCl2.6H2O, 1% acetone. For
methyl-paraoxon, the assay mixture contained 100 mM HEPES,
pH 8.0, 1 mM CoCl2.6H2O, 2% methanol. For coumaphos-oanalogue, the assay mixture contained 100 mM Tris–HCl pH
7.0, 1 mM CoCl2.6H2O, 1% methanol. For demeton, the assay
mixture contained 100 mM HEPES pH 8.0, 1 mM DTNB
[5⬘,5⬘-dithiobis(2-nitrobenzoic acid)] and 1% methanol. The
rate of hydrolysis of methyl-paraoxon and methyl-parathion
was measured by monitoring the appearance of p-nitrophenolate at 400 nm (ε400 ⫽ 15 000 M–1 cm–1 at pH 8.0) in a
1 cm cuvette. The rate of hydrolysis of coumaphos-o-analogue
was determined by measuring the production of chlorferon at
348 nm (ε348 ⫽ 9100 M–1 cm–1 at pH 8.0) in a 5 cm cuvette.
The rate of hydrolysis demeton was measured by following
the appearance of 2-nitro-5-thiobenzoate at 412 nm (ε412 ⫽
14 145 M cm–1 at pH 8.0) in a 1 cm cuvette. For methyl-
Evolution of a phosphotriesterase
Fig. 2. (Top) Ribbon diagram showing the overall structure of OPDA. The
views are approximately down (left) and perpendicular (right) to the (αβ)8
barrel; note the views are not exactly orthogonal. Active site residues and
metal ions are shown in black. (Bottom) Cα overlay of OPDA (thick lines)
and OPH (thin lines).Where residues are non-identical their side chains are
drawn as stick bonds.
parathion, methyl-paraoxon and demeton, the kinetic constants
(Vmax and Km) were obtained by fitting the data to the equation
V ⫽ VmaxS/(Km ⫹ S)
(1)
where V is the initial velocity, Vmax is the maximum velocity,
Km is the Michaelis constant and S is the substrate concentration. kcat is calculated according to the equation kcat ⫽ Vmax/
E, where E is the protein concentration used in the assay.
For the substrate coumaphos-o-analogue, substrate inhibition
occurred; the kinetic constants were obtained by fitting the
data to the equation
V ⫽ VmaxS/(Km ⫹ S ⫹ S2/ksi)
(2)
where ksi is the substrate inhibition constant.
Results and discussion
Quality of the structure
The soluble portion of OPDA minus the C-terminal extension
was expressed and purified and its structure obtained using
the OPH structure as a search model. The numbering scheme
used to describe OPDA is that of OPH. The refinement statistics
for both models are given in Table II. The stereochemistry was
checked by the programs PROCHECK (Laskowski et al.,
1993) and WHATCHECK (Hooft et al., 1996). The
Ramachandran plot showed that all residues were in the
most favoured region or additionally allowed regions with
the exception of Glu159 and Ser61, which fell in the generously allowed region. Glu159 has been an outlier in the
Ramachandran plots of all known phosphotriesterase structures.
All stereochemical parameters were inside normal ranges or
better than expected in the tests performed by PROCHECK.
The overall G-factor was ⫹0.4 for both models.
Overall structure
As can be seen in Figure 2, the overall structure of OPDA is
very similar to that of OPH. Both molecules form a dimer with
the subunits related by essentially the same crystallographic
twofold axis. Overlaying all main chain atoms for residues
35–361 results in an r.m.s. displacement of 0.38 Å. The TIM
barrel region overlays exceedingly well (r.m.s. displacement
0.27 Å). Some small rigid body movements of secondary
structural elements are seen away from the barrel but these
are still only of the order of 1 Å. The secondary structure is
essentially the same as that of OPH and consists of 10 βstrands, 14 α-helices and four 310 helical turns. The active site
sits at the C-terminal end of the barrel and comprises residues
from secondary structural elements disparate in sequence space.
There are a number of helices on the bottom of the barrel. In
OPH, one of these helices forms one side of a binding pocket
for phenylethanol. The structures of the two opda models were
overlayed. The structures showed excellent agreement; r.m.s.
displacement over all protein atoms was 0.2 Å. However, there
were differences in the conformation of the side chains in
certain key active site residues that occurred with the change
in metal ion occupancies and the associated conformational
change of Arg254. Significant shifts (~1 Å) occurred for the
residues Tyr257, Phe272, Leu271, Leu303 and Ser203. The
first three of these are located in the large binding pocket subsite and Leu303 is located in the small binding pocket subsite. The synchrotron dataset also showed additional ⫹fofc
density in the active site. The density was consistent with a
HEPES molecule binding in multiple conformations. The
sulfonate moiety appears well ordered at full occupancy but
the rest of the density is broken and consonant with multiple
conformers. A single sulfite ion was located from the HIC-UP
database of hetero-compounds and included in the refined
model.
Active site and metal ligation
The model derived from the in-house data shows that the two
Co2⫹ ions, α and β, are coordinated in a similar manner to
the Zn2⫹ ions in the OPH active site. The α metal forms bonds
with His55, His57 and Asp301 and is more buried than the β
that forms coordinate bonds to His201 and His230. In addition,
the two metals are linked by a bridging hydroxide ion and
side-chain oxygens of the carboxylated Lys169. The α metal
has trigonal bipyramidal coordination whereas β exhibits
distorted trigonal bipyramidal coordination (Figure 3). In the
model derived from the synchrotron data the sulfite ion binds
with one of its oxygen atoms replacing the bridging hydroxide
ion seen in the other model. Figure 3 also shows the position
of both conformers of the neighbouring residues which change
between the two datasets. A superposition of the substrate
analogue trimethyl phosphate taken from 1eyw.pdb is also
shown.
The substrate binding pockets observed in the OPH structure
are similar to those found in OPDA. The leaving group subsite
is formed by Trp131, Phe132, Phe306 and Tyr309. These
residues appear to be similarly placed in both proteins. The
alkyl substituents of the substrate are accommodated by two
pockets that are referred to as the ‘small’ and ‘large’ subsite.
The small subsite is formed by residues Gly60, Ile106, Leu303
and Ser308. These residues are conserved in the two proteins
as is the size and shape of the pocket. The large subsite is
formed by the side chains from Arg254, Tyr257, Leu271 and
Met317. The residue Arg254 shows static disorder of the side
139
H.Yang et al.
Fig. 3. (Top) Mono diagrams of the active site residues; unbonded atoms
are Co2⫹ ions (large) plus three water molecules. (Left) Metal ligation with
bond lengths ⬍2.6 Å. (Right) Other potential hydrogen bonds ⬍3.4 Å have
been added. (Below) Stereo view of active site in the same orientation; also
shown are the large sub-site residues which exhibit a conformational change
in models derived from the in-house (thin lines) and synchrotron (thick
lines) datasets. A molecule of the inhibitor trimethyl phosphate has been
overlayed and is shown as a ball and stick model located in the putative
phosphate binding position. A ⫹ indicates the Co2⫹ ion positions.
chain in the model derived from in-house data. One orientation
that has been modelled with an occupancy of 0.4 is 3.3 Å
from the catalytically active water molecule (or hydroxide ion)
which is bridging the two metal ions. The other orientation is
stabilized by a 2.5 Å hydrogen bond to the OD1 atom of
Asp301 and is close to the ring of the Tyr257 side chain
allowing an interaction between the π-electrons of the ring
and the charge of the guanidinium group of the arginine. OPH
differs at positions 254 and 257; the equivalent residues are
His254 and His257. The result of these two sequence differences is an overall reduction in the size of this pocket. The
reduction in the size of this subpocket and the different side
chains could account for some of the differences in the
substrate specificity of the two enzymes. For example, OPDA
processes methyl-parathion much more efficiently than the
diethyl equivalent while the two compounds are processed in
a similar manner by OPH (Horne et al., 2002). To gain a
better idea of how substrates would bind in the active site,
OPDA was superimposed on the structures of OPH with bound
inhibitors. It was noted that Arg254 was well positioned to
bind to the phosphate oxygen, O3, when the structure of a
substrate analogue, triethyl phosphate, was rotated into the
OPDA active site based on a least-squares minimization of
active site residues from structure 1eyw.pdb. The NH2 atom
of Arg254 is 3.8 Å from O3 of triethyl phosphate and 3.3 Å
from the catalytic hydroxide (W500). The close proximity of
the Arg254 side-chain to the catalytic water molecule and the
oxygen of the model substrate suggests an important role for
this residue. More significant was the observation that Tyr257
of OPDA made a close contact with atoms of the benzyl group
of the diethyl 4-methylbenzylphosphonate inhibitor bound to
OPH (1dmp.pdb), when similarly rotated. Clearly, groups that
140
fit comfortably in the active site of OPH encounter steric
difficulties when interacting with OPDA.
Structural consequences of sequence differences between
OPH and OPDA.
There are about 30 sequence differences between OPH and
OPDA (Figure 4). The largest group consists of 19 residues that
are spread over the solvent-exposed surface of the molecule. In
addition, two regions of the molecule with a significant number
of sequence differences were identified. One has already been
mentioned; the large pocket of the active site. The other is
the region of the protein that is responsible for binding
phenylethanol in OPH. This compound resembles one of the
reaction products of OPH and might be expected to bind in
the active site and function as an inhibitor. Contrary to this
expectation, phenylethanol binds to OPH on the exterior of
the molecule on the opposite face and removed from the active
site cavity. In OPH this site is formed by residues Met293,
Lys294, Glu295 and Thr352 that become Lys293, Asp294,
Arg295 and Ala352 in OPDA. Apart from the sequence
changes, the water structure in this region differs in the two
proteins. Given these significant differences, it is unlikely that
phenylethanol would bind to OPDA at the same location.
Directed evolution of the opd gene
The object of the directed evolution experiments was to find
a series of mutations in OPH that would give it similar activity
to OPDA. The starting point of the evolution was a form of
the OPH protein that had five additional residues from βgalactosidase fused to the N-terminus. The gene for OPH was
subjected to one cycle of random mutagenesis followed by
two cycles of gene shuffling. As part of each cycle, mutants
were selected in two stages. In the first stage, the activity of
mutants towards coumaphos-o-analogue was monitored on
agar plates, whereas in the second stage the activities of
mutants towards three substrates, coumaphos-o-analogue,
methyl-paraoxon and methyl-parathion, were measured more
carefully with a 96-well plate reader.
Error-prone PCR was used to create a library that was
initially screened on plates containing 4 µM of the coumaphoso-analogue. The library gave rise to about 20 000 colonies of
which about 80% showed little activity. About 1600 colonies
from each library displayed fluorescence that was equal to or
better than that of the wild-type enzyme. A 96-well plate
reader was then used to measure the ability of these clones to
degrade the three substrates. A total of 48 potential positive
clones were then used in the first round of DNA shuffling.
About 10 000 clones were screened on the LB medium plates
containing 2 µM coumaphos-o-analogue. On the basis of their
fluorescence signal, the activities of 800 clones towards three
substrates were measured with a plate reader. Of these, 62
clones were re-screened as potential positive variants and, of
these, 30 clones with higher activity than wild-type were
selected for another round of shuffling. The sequences of the
genes of three proteins with enhanced activity were determined.
All three contained the change of H254R along with other
changes. A further round of DNA shuffling was carried out
with the best 30 clones from the first cycle of shuffling. In
this cycle of shuffling, 10 000 clones screened on the LB
medium plate containing 2 µM coumaphos-o-analogue. The
activities of 800 clones towards the three substrates were
measured. Of these, 51 clones were re-screened as potential
positive variants and, from these, 20 clones were used to
prepare protein for kinetic characterization.
Evolution of a phosphotriesterase
Fig. 4. Sequence alignment OPDA/OPH; non-identical residues are boxed. The first and last residues visible in the X-ray structures are marked with an
asterisk.
Kinetic characterization of evolved OPH proteins
The evolved variants of OPH were purified and their kinetic
constants measured with three substrates (Table III). One
mutant was selected from the first generation (1G) and 11
from the third generation (3G). The sequence changes in all
these mutants along with the relevant kinetic data for OPH
and OPDA are also given in Table III. All the proteins
displayed substrate inhibition with coumaphos-o-analogue and
Ksi was also measured. The kinetic constants previously
reported for OPH vary considerably owing to the method of
protein purification and the assay conditions. The values for
kcat/Km given in the present work are lower than the highest
reported, probably owing to the differences in assay conditions.
However, the same assay conditions were used throughout this
work and give a good indicator of the relative activities of
OPH and OPDA.
The kinetic parameters for OPH and OPDA show some
trends for all the substrates used in this study. The Km values
are all lower for OPDA and the values for kcat are all higher
so that the specificity constant, kcat/Km, is significantly higher
for OPDA. For methyl-parathion the difference between the
two enzymes is most pronounced with the kcat/Km for OPDA
being a factor of 29 greater than that for OPH. For the
coumaphos-o-analogue the factor is only 4. For the mutant
proteins, the kinetic parameters obtained with coumaphos-oanalogue show the clearest trends. 1G3 has kcat and Km values
above those of OPDA. In this enzyme, there is a histidine at
position 254 as in OPH. The other 11 enzymes have an arginine
at position 254 and all have Km and kcat values below that of
OPDA. For these 11 enzymes, the enhanced activity has been
achieved through a drop in Km that appears to have been
achieved at the expense of kcat. The same trends appear to be
generally true for the substrate methyl-paraoxon; however, the
drop in Km is less pronounced and, in most cases, the kcat
values have increased, rather than decreased, as was the case
with coumaphos-o-analogue. For mutants, 3G33 and 3G39,
the Km values for methyl-paraoxon are very similar to those
for OPH and its enhanced activity is achieved through elevation
of kcat. For methyl-parathion, there is a small difference
between the Km for OPH and OPDA. In this case mutants of
OPH have achieved enhanced activity through increases in kcat
and small drops in Km.
All of the mutants from the third generation contain the
H254R mutation. However, this mutation only appears to have
a significant effect on the kinetic parameters obtained with the
coumaphos-o-analogue. The mutation would tend to be retained
because the coumaphos-o-analogue is the only substrate used
in the first stage of screening. To survive the screening
process all mutations must have enhanced activity towards
the coumaphos-o-analogue. With this substrate, the H254R
mutation causes a substantial drop in Km along with a drop in
kcat. The drop in Km is desirable and appears to have been
retained by the third generation mutants, while the drop in kcat
is undesirable and appears to be compensated for by additional
mutations.
Apart from the substrates used for selection, the mutant
proteins were tested for their ability to degrade demeton S.
As is evident in Table III, this compound is degraded more
rapidly by OPDA than OPH, but neither enzyme degrades it
with great efficiency. The catalytic properties of the mutant
enzymes show a similar trend to those obtained with the other
substrates. The Km values for all the enzymes are high and
have not been improved by the directed evolution and enhanced
activity has been gained by an increase in kcat. The best enzyme
(3G32) has a kcat/Km that is similar to that of OPDA. The fact
that demeton was not used in the selection process but was
degraded with improved efficiency by the mutant enzymes
suggests that the selection process maintained the broad
specificity of the OPH.
Sequence changes in terms of structure; natural and directed
evolution
Directed evolution has been used to evolve OPH into a series
of mutant enzymes that have catalytic properties that are
similar to those of OPDA. The residues that are altered in the
directed evolution experiments are given in Table IV, as are
the corresponding residues in OPDA. Three of the mutations,
including the most common (H254R), produce the amino acid
that is found in the OPDA sequence while one mutation gives
rise to an amino acid not found in either OPH or OPDA. The
mutations resulting from directed evolution appear to be
clustered at specific sites in the protein, as listed in Table IV
and are best discussed in terms of their location in the protein.
We have already noted that within the active site, the large
pocket differs significantly on going from OPH to OPDA. One
of the changes, H254R, was obtained by directed evolution.
It was noted that in OPDA, Arg254 appeared well placed to
contact and stabilize a phosphate oxygen of the substrate and
undergoes a conformational change related to metal site
occupancy. The presence of Tyr257 in OPDA reduces the size
141
H.Yang et al.
Table III. Kinetics data
Compound
Protein name
kcat (s–1)
Km (mM)
kcat/km (s–1 mM–1)
Ksi (mM)
Coumaphos-o-analogue
Wt (OPH)
Wt (OPDA)
1G3
3G5
3G6
3G9
3G20
3G22
3G24
3G25
3G32
3G33
3G39
3G44
H254R
Wt (OPH)
Wt (OPDA)
1G3
3G5
3G6
3G9
3G20
3G22
3G24
3G25
3G32
3G33
3G39
3G44
H254R
Wt (OPH)
Wt (OPDA)
1G3
3G5
3G6
3G9
3G20
3G22
3G24
3G25
3G32
3G33
3G39
3G44
H254R
Wt (OPH)
Wt(OPDA)
1G3
3G5
3G6
3G9
3G20
3G22
3G24
3G25
3G32
3G33
3G39
3G44
1.3e2
2.0e2
5.2e2
1.8e1
2.6e1
2.8e1
1.2e1
2.8e1
6.5e1
3.4e1
5.3e1
1.3e2
6.1e1
8.5e1
5.6e0
8.2e2
2.5e3
2.7e3
5.0e2
9.2e2
7.1e2
2.2e2
6.8e2
2.4e3
1.2e3
2.6e3
1.2e3
2.8e3
1.4e3
1.5e2
8.2e1
1.2e3
2.2e2
1.1e2
2.4e2
2.2e2
7.4e1
1.6e2
3.3e2
2.8e2
4.8e2
4.1e2
5.6e2
3.1e2
2.8e1
4.0e–2
1.9e0
3.3e–1
1.1e0
1.3e0
8.8e–1
5.0e–1
7.7e–1
1.6e0
2.0e1
3.1e0
2.0e0
1.2e0
9.6e–1
7.2e–2
2.7e–2
5.3e–2
5.0e–3
7.0e–3
1.1e–2
1.1e–2
1.3e–2
9.0e–3
7.0e–3
7.0e–3
2.4e–2
6.0e–3
1.2e–2
4.0e–3
8.9e–1
2.3e–1
7.4e–1
2.0e–1
1.9e–1
1.8e–1
1.4e–1
1.8e–1
4.6e–1
1.9e–1
2.6e–1
2.0e–1
6.2e–1
6.0e–1
5.8e–1
2.0e–1
1.0e–1
3.1e–1
8.9e–2
1.1e–1
1.0e–1
6.0e–2
6.3e–2
1.2e–1
6.7e–2
9.1e–2
6.0e–2
1.9e–1
1.5e–1
1.1e–1
3.4e0
2.2e0
2.9e0
2.8e0
3.6e0
3.4e0
3.5e0
3.3e0
6.7e0
3.5e0
3.8e0
3.2e0
3.2e0
4.1e0
1.8e3
7.2e3
9.9e3
3.6e3
3.7e3
2.5e3
1.1e3
2.1e3
7.2e3
4.9e3
7.5e3
5.3e3
1.0e4
7.1e3
1.4e3
9.3e2
1.1e4
3.6e3
2.5e3
4.9e3
4.1e3
1.7e3
3.9e3
5.1e3
6.2e3
1.0e4
5.8e3
4.6e3
2.3e3
2.6e2
4.1e2
1.2e4
7.2e2
1.2e3
2.2e3
2.2e3
1.2e3
2.5e3
2.7e3
4.1e3
5.3e3
6.8e3
2.9e3
2.1e3
2.5e2
1.2e–2
8.6e–1
1.1e–1
3.8e–1
3.7e–1
2.6e–1
1.4e–1
2.3e–1
2.4e–1
5.6e–1
8.2e–1
6.3e–1
3.7e–1
2.3e–1
9.4e–2
7.7e–2
1.2e–1
1.2e–1
7.0e–2
7.6e–2
7.4e–2
5.6e–2
3.7e–2
7.2e–2
6.2e–2
3.0e–2
7.3e–2
4.4e–2
1.9e–1
Methyl-paraoxon
Methyl-parathion
Demeton
Errors for Km and kcat were obtained from the fitting procedure. In all cases, the error was less than 20%.
Sequence analysis:
1G3: I274T
3G5: Q211L, H254R, T352A
3G6: K285R, H254R, I274T, K294N
3G9: H254R, N265D
3G20: Q211L, H254R, N265D
3G22: K185R, H254R
3G24: K285R, D208G, H254R
3G25: H254R, T352A
3G32: Q211L, H254R
3G33: H254R, G348C
3G39: D208G, H254R, K294N
3G44: D208G, H254R, I274T
142
Evolution of a phosphotriesterase
Fig. 5. Cα plot of OPH structure showing position of residues mutated in the directed evolution experiments. These are colour coded by position: cyan, large
sub-pocket of substrate binding site; red, external surface of two outer helices remote from the active site; green, high B-factor loop connecting two residues
forming the large sub-site; orange, phenylethanol binding site. A molecule of phenylethanol is shown in its binding position in magenta.
Table IV. Mutations obtained with directed evolution
Mutation
Found in clone
Residue in
OPDA
Location
H254R
3G5, 3G6, 3G9, 3G20, 3G22
3G24, 3G25, 3G33, 3G39
3G5, 3G20, 3G32
3G3, 3G44, 3S6
3G5, 3G25
3G6, 3G24
3G6, 3G39
3G9, 3G20
3G22
3G24, 3G39
3G33
Ra
1
Q
Ta
Aa
K
Db
N
K
D
G
2
3
4
4
4
3
2
2
Q211L
I274T
T352A
K285R
K294N
N265D
K185R
D208G
G348C
Location 1: in the large pocket of the active site.
Location 2: external surface of two outer helices remote from the active site.
Location 3: high B-factor loop connecting two residues forming the large
sub-site.
Location 4: phenylethanol binding site.
aDirected evolution gives same residue as in OPDA.
bResidues differ in OPH, OPDA and that produced by directed evolution.
of the pocket that was available for the alkyl group of the
substrate. An H257Y change was observed by Cho et al. in
their directed evolution experiments (Cho et al., 2002), but
was not found in the present study. This is consistent with the
screening criteria used in the two sets of experiments. In the
former case, the screening conditions selected for mutants with
a preference for substrates that had a smaller alkyl chain
whereas in our case the multiple selection criteria ensured that
mutants were active on substrates with both ethyl and methyl
substituents.
The second set of mutations, I274T and N265D (Figure 5),
are found in an exposed loop that follows strand 7 that supports
the large sub-site residues His254 and His257. These mutations
give a more hydrophilic sequence that is more appropriate for
an exposed peptide. One of the mutations, I274T, is found in
the OPDA sequence, yet the structure of the peptide in the
vicinity of residue 274 is very similar in OPH and OPDA. On
the basis of structural evidence alone, neither mutation would
be considered as a good candidate to change the activity of the
protein. However, as shown in Table III, there is experimental
evidence that one of these mutations, I274T (clone 3G3), does
have an effect on activity in the absence of other changes.
The loop on which it is situated has the highest B-factors of
any peptide in both OPH and OPDA, suggesting that it
may be mobile. In OPH, the structure of this loop changes
dramatically and becomes partially disordered when metals
are removed (Benning et al., 1995), again supporting the idea
that the loop is mobile. These mutations are likely to affect
the dynamics and stability of the protein and may not alter
the average structure of the protein as determined by crystallography. These mutations may exert an effect on enzymatic
activity of the protein through the dynamics of a surface loop.
This effect may involve Leu271 or Phe272, whose side
chains protrude into the large pocket of the active site. The
conformation of these side chains showed movement when
compared between the in-house and synchrotron data models.
We have already noted that site-specific changes made at
position 272 change the substrate specificity of OPDA.
The third set of mutations, T352A, K294N and G348C
(Figure 5), occur in the phenylethanol binding site. One of the
mutations, T352A, results in the same sequence change that
is found on going from OPH to OPDA. The residue at position
348 is conserved in both proteins and is positioned such that
the substitution G348C will close off the phenylethanol binding
site in OPH. The residue at position 294 is different in OPH
and OPDA. The K294N effectively shortens the side chain of
this amino acid and allows it to form a hydrogen bond with a
water molecule in the phenylethanol binding site, as is found
in OPDA. At the phenylethanol binding site, the most striking
difference between OPH and OPDA is the water structure
(Figure 6). In OPDA, there are two water molecules that form
a network of hydrogen bonds in OPDA. The equivalent
residues in OPH could not form the same hydrogen bonds,
but appear to be stabilized by the presence of phenylethanol.
Natural evolution along with directed evolution have identified
the phenylethanol binding site as a point where improvements
can be made. Natural evolution, on going from OPH to OPDA,
has introduced a series of residues that stabilize water molecules
143
H.Yang et al.
Fig. 6. Close-up of phenylethanol (PEL) binding site. (Left) Hydrophobic
pocket in OPH formed by Met293, Gly348 and the aliphatic carbon chain of
Lys294. (Right) Same site in OPDA; note the charged side chain of Asp294
facilitates a hydrogen-bonded network of water molecules to occupy the
previous PEL binding pocket.
while the effects of directed evolution may be to do the same
(with K294N) or to occupy the crevice with the bulky side
chain of a cysteine residue (with G348C). In either case the
void of the crevice is occupied and the structure of the binding
cleft would be stabilized. How this stabilization affects the
structure of the active site is not clear. There is a link to the
active site through strand 8 that contains Asp301, already
mentioned as a key element in the active site. The position of
this residue is very similar in both OPH and OPDA and the
effect of the mutations made by directed evolution would
be small.
Apart from the three mutations listed in the previous
paragraph, the K285R change occurs close to the phenylethanol
binding site. The larger side chain produced by the mutation
of a lysine to an arginine would allow hydrogen bonds to form
between the guanidinium of the arginine and the amide oxygen
of residue 339. This hydrogen bond would connect and stabilize
the two peptides forming the binding site.
The fourth set of mutations consist of Q211L, D208G and
K185R (Figure 5). These cluster at the external surface between
two outer helices which, like the phenylethanol binding site,
is somewhat remote from the active site. Two of these
mutations, K185R and Q211L, were first detected during
the initial random mutagenesis and gave rise to discernible
improvements in activity. The sequence and structure of OPH
and OPDA are very similar in the region around the mutations.
Gln211 forms a hydrogen bond with the backbone of Ala176.
This interaction would be lost in the Q211L conversion.
Asp208 forms hydrogen bonds with the backbone of Gly174
and, again, this interaction would be lost in the D208G
conversion. The conversion of K185R allows the formation of
hydrogen bonds to Glu219 or Glu181. The first two mutations
cause a loss in the interactions that stabilize the structure while
the third potentially adds a stabilizing interaction.
Conclusion
Given the structures and sequences of OPH and OPDA, one
would predict that the most direct way of evolving OPH into
OPDA would be to alter the residues in the large pocket of
the active site. Of the numerous differences between OPH and
OPDA in this pocket, only H254R is observed among the
directed mutants. This mutant is found in all the most active
mutants that were produced after two rounds of shuffling. In
OPDA, Arg254 is well placed to interact with the substrate
and may have a significant effect on the catalytic properties
of the enzyme. This residue is shown to be capable of adopting
more than one conformation and the conformational change
is associated with movements of the side chains of several
residues which form the large sub-site of the substrate binding
pocket. Other mutations in the large pocket probably do not
144
occur because the large pocket in OPH is better suited than
OPDA to bind the diethyl substituents of the coumaphos-oanalogue. In other words, the selection process has identified
the one mutation in the large pocket that improves the catalytic
properties of OPH while maintaining its capacity to degrade
efficiently substrates with larger alkyl substituents. Despite its
prevalence among the directed mutants, the H254R mutation
was not found as a single mutation in any clone with high
activity. It was noted in the section dealing with directed
evolution that the H254R change when combined with other
mutations is capable of producing discernible effects on
activity, particularly with the coumaphos-o-analogue.
We noted in the previous section that mutations are found
in several locations that are remote from the active site. It is
difficult to rationalize these changes mechanistically apart from
concluding that they synergistically create small structural
changes, which affect the dynamics and/or stability of the
protein in a way that enhances substrate binding or subsequent
catalytic turnover.
One of the aims of this study was to compare the effects of
natural and directed evolution on the evolution of OPH into
OPDA. In terms of amino acid sequence changes, there were
some similarity in the two processes. In both cases, the H254R
change was observed. While this was not unexpected, the
I274T and the T352A changes were not anticipated. In terms
of structure, the locations of mutations are very similar for
both natural and directed evolution. In both natural and directed
evolution, mutations appeared to be found in three sites.
Whereas the changes to the active site can be rationalized, the
effects of mutations on a surface loop and the phenylethanol
binding site are more difficult to understand. The fact that
mutations in these regions were found in both natural and
directed evolution argues that these regions have a physical
significance that warrants further investigation. While the
similarity between natural and directed evolution was surprising, it should be noted that directed evolution did find ways
of enhancing activity that did not occur in natural evolution.
These mutations, such as D208G, are again remote from the
active site. The observation that mutations outside the active
site appear to enhance enzyme activity underscores the fact that
enzyme activity depends on many factors and that evolutionary
objectives can be achieved in many ways.
Acknowledgements
Harry Tong and the support staff at the BioCARS beamline are thanked for
their support during data collection at the Advance Photon Source. This work,
including the use of the BioCARS sector, was supported by the Australian
Synchrotron Research Program, which is funded by the Commonwealth of
Australia under the Major National Research Facilities Program. Use of the
APS was supported by the US Department of Energy, Basic Energy Sciences
and Office of Energy Research, under contract No. W-31-109-Eng-38. The
ANU Supercomputing Facility are thanked for a grant of time on their
machines.
References
Benning,M.M., Kuo,J.M., Raushel,F.M. and Holden,H.M. (1994) Biochemistry,
33, 15001–15007.
Benning,M.M., Kuo,J.M., Raushel,F.M. and Holden,H.M. (1995) Biochemistry,
34, 7973–7978.
Benning,M.M., Hong,S.B., Raushel,F.M. and Holden,H.M. (2000) J. Biol.
Chem., 275, 30556–30560.
Benning,M.M., Shim,H., Raushel,F.M. and Holden,H.M. (2001) Biochemistry,
40, 2712–2722.
Brunger,A.T. et al. (1998) Acta Crystallogr., D54, 905–921.
Evolution of a phosphotriesterase
Chambers,S.P., Prior,S.E., Barstow,D.A. and Minton,N.P. (1988) Gene, 68,
139–149.
Chen,K. and Arnold,F.H. (1993) Proc. Natl Acad. Sci. USA, 90, 5618–5622.
Chen-Goodspeed,M., Sogorb,M.A., Wu,F., Hong,S.B. and Raushel,F.M.
(2001a) Biochemistry, 40, 1325–1331.
Chen-Goodspeed,M., Sogorb,M.A., Wu,F. and Raushel,F.M. (2001b)
Biochemistry, 40, 1332–1339.
Cho,C.M-H., Mulchandani,A. and Chen,W. (2002) Appl. Environ. Microbiol.,
68, 2026–2030.
Collaborative Computational Project Number 4 (1994) Acta Crystallogr., D50,
760–763.
Dumas,D.P., Caldwell,S.R., Wild,J.R. and Raushel,F.M. (1989) J. Biol. Chem.,
264, 19659–19665.
Grimsley,J.K., Scholtz,J.M. Pace C.N. and Wild,J.R. (1997) Biochemistry, 36,
14366–14374.
Harcourt,R.L., Horne,I., Sutherland,T.D., Hammock,B.D., Russell,R.J. and
Oakeshott,J.G. (2002) Lett. Appl. Microbiol., 34, 263–268.
Holm,L. and Sander,C. (1997) Proteins: Struct. Funct. Genet., 28, 72–82.
Hooft,R.W.W., Vriend,G., Sander,C. and Abola,E.E. (1996) Nature, 381, 272.
Horne,I., Sutherland,T.D., Harcourt,R.L., Russell,R.J. and Oakeshott. J.G.
(2002) Appl. Environ. Microbiol., 68, 3371–3376.
Jabri,E., Carr,M.B., Hausinger,R.P. and Karplus,P.A. (1995) Science, 268,
998–1004.
Laskowski,R.A., MacArthur,M.W., Moss,D.W. and Thornton,J.M. (1993)
J. Appl. Crystallogr., 26, 283–291.
Lewis,V.E., Dornarski,W.J., Wild,J.R. and Raushel,F.M. (1988) Biochemistry,
27, 1591–1597.
Love,C.A., Lilley,P.E. and Dixon,N.E. (1996), Gene, 176, 49–53.
Mathews,B.W. (1968) J. Mol. Biol., 33, 491–497.
Mulbry,W.W. and Karns,J.S. (1988) J. Bacteriol., 171, 6740–6746.
Mulchandani,A., Kaneva,I. and Chen,W. (1999) Biotechnol. Bioeng., 63,
216–223.
Navaza,J. (1994) Acta Crystallogr., A50, 157–163.
Otwinowski,Z. and Minor,W., (1997) Methods Enzymol., 276, 307–326.
Raushel,F.M. (2002) Curr. Opin. Microbiol., 5, 288–295.
Read,R.J. (1986) Acta Crystallogr., A42, 140–149.
Shim,H. and Raushel,F.M. (2000) Biochemistry, 39, 7357–7364.
Stemmer W.P.C. (1994) Proc. Natl Acad. Sci. USA, 91, 10747–10751.
Thoden,J.B., Phillips,G.N.,Jr., Neal,T.M., Raushel,F.M. and Holden,H.M.
(2001) Biochemistry, 40, 6989–6997.
Vanhooke,J.L., Benning,M.M., Raushel,F.M. and Holden,H.M. (1996)
Biochemistry, 35, 6020–6025.
Wilson,D.K. and Quiocho,F.A. (1993) Biochemistry, 32, 1689–1694.
Received August 9, 2002; revised November 26, 2002; accepted December
3, 2002
145