(CANCER RESEARCH 58. 5406-5410,
December I. 1998]
Attenuation of Telomerase Activity by a Hammerhead Ribozyme Targeting the
Template Region of Telomerase RNA in Endometrial Carcinoma Cells
Yasuhiro Yokoyama,1 Yuichiro Takahashi, Ariyoshi Shinohara, Zenglin Lian, Xiaoyun Wan, Kenji Niwa, and
Teruhiko Tamaya
Department of Obstetrics timi Gvnecologv, Gifu Universit\ School of Medicine. Gifit, Gif»500. Japan
ABSTRACT
some types of RNA sequences, such as telomerase RNA. Ribozymes
may surpass the efficiency of the antisense oligonucleotide in such
cases. In the present study, we designed hammerhead ribozymes
against telomerase RNA and studied the possibility of using the
ribozymes to suppress telomerase activity in cancer cells.
Telomerase activity is found in almost all carcinoma cells but not in
most somatic cells, suggesting that telomerase is an excellent target for
cancer therapy. We designed hammerhead ribozymes against human
telomerase RNA and studied their possible use as a tool for cancer
therapy. Three ribozymes targeting the 3' end of the GUC sequence at
33-35 (the template region), 168-170, and 313-315 from the 5' end of
MATERIALS
AND METHODS
telomera.se RNA were designed. In a cell-free system, these three ham
Cell Culture. Endometrial carcinoma cell lines Ishikawa and AN3CA were
used in this study. Ishikawa cells were a kind gift from Dr. Másalo Nishida
(Tsukuba University School of Medicine, Tsukuba, Japan; Ret'. 15). AN3CA
merhead ribozymes efficiently cleaved the RNA substrate. When these
ribozyme RNAs were introduced into Ishikawa cells, which are endometrial carcinoma cells, only a ribozyme targeting the RNA template region
could diminish the telomerase activity. Next we subcloned the ribozyme
sequence into an expression vector and introduced this into AN3CA cells,
which are endometrial carcinoma cells. The clones that were obtained
showed reduced telomerase activity and telomerase RNA with expression
of the ribozyme. These data suggest that the ribozyme against the RNA
template region is a good tool to repress telomerase activity in cancer cells.
cells were purchased from the American Type Culture Collection. All cell lines
were maintained in Eagle's MEM supplemented with 10% fetal bovine serum
under an atmosphere of 95% ainSVr CO, at 37°C.
In Vitro Cleavage Reaction by Ribozymes. Because hammerhead ri
bozymes recognize a GUC sequence and cleave it most efficiently, attempts
were made to determine whether the GUC sequence is located within telom
erase RNA and which GUC sequence could be eligible. There are 14 GUC
sequences within the approximately 450-base length of the RNA. Considering
INTRODUCTION
the complementarity between the upstream and downstream sequences from
each GUC, we chose three sites (34-36. 168-170, and 313-315 from the 5'
Telomerase is a ribonucleoprotein believed to play a role in cellular
senescence and immortalization (1-3). It synthesizes telomeric DNA
with a template ot" its integral RNA and prevents the telomere from
end of telomerase RNA) as target sites. The target site of the ribozymes is
shown in Fig. 1. The ribozymes were named 36-, 170-, and 315-ribozyme after
the cleavage sites from the 5' end of the RNA.
shortening (4). Telomerase activity has been determined in various
tissues and cells during the past years, and it has been shown that most
cancer cells, germ cell lines, and some somatic cells express telom
erase activity, and that most somatic cells do not (5). Normal somatic
cells lose telomerase activity in the early stage of embryogenesis (6),
and the restoration of telomerase activity is currently considered to
immortalize cells and also to be a significant step in the carcinogenesis of cells. The specificity of telomerase in cancer cells suggests that
it could be a good target for cancer therapy. To date, only an agent that
induces cellular differentiation, such as retinoids, has been reported to
reduce telomerase activity in some carcinoma cell lines (7-9).
Telomerase is composed of a RNA molecule and the associated
proteins (10). Telomerase RNA functions as a template for the exten
sion of the telomeric repeat, and protein components function in
telomere DNA recognition and binding and RNA binding and catal
ysis. Therefore, telomerase RNA is an essential molecule for telom
erase to exert its action (11).
Hammerhead ribozymes are catalytic RNA molecules. They are
being increasingly considered and used as human gene therapeutic
agents for human malignancies (12, 13). The ribozymes used as gene
therapeutic agents are, in most cases, /raii.v-acting hammerhead ri
bozymes based on the model of Haseloff and Gerlach (14). The
hammerhead ribozymes consist of a catalytic core and flanking antisense sequences. The antisense sequence of the ribozymes functions
in the recognition of target sites of the RNA molecules. These se
quences may carry out additional action by the ribozymes in targeting
Received 5/1/98: accepted 10/5/98.
The cosls of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1To whom requests for reprints should be addressed, at Department of Obstetrics and
Gynecology. Gifu University School of Medicine. 40 Tsukasa-machi. Gifu. Gifu 5008076. Japan. Phone: 81-58-267-26.11: Fax: 81-58-265-9006.
The bacteriophage T7 RNA polymerase system was used to produce the
ribozymes. A set of oligomers was designed to make the DNA template. One
primer contained a T7 RNA polymerase promoter sequence followed by the 5'
half of the ribozyme sequence; the other primer contained the antisense
sequence of the ribozyme. Seventeen nucleotides from the 3' end of both
primers were complementary to each other.
The primers used for each ribozyme were as follows: (a) 36-ribozyme,
5'-GGATCCTAATACGACTCACTATAGGTTAGGGTTACTGATGA
and
5'-ATlTTlTGTTTCGTCCTCACGGACTCATCAGTAACCCTAAC;
(b)
170-ribozyme, S'-GGATCCTAATACGACTCACTATAGGCCAGCAGCTCTGATGA
and S'-AAAAAATGTTTCGTCCTCACGGACTCATCAGAGCTGCTGGC; and (c) 315-ribozyme, 5'-GGATCCTAATACGACTCACTATAGGCCCCCGAGACTGATGA
and 5'-GCCGCGGGTTTCGTCCTCACGGACTCATCAGTCTCGGGGGC.
The primers were mixed to form a hemiduplex, and a PCR amplification of
25 cycles was performed at 94°Cfor 1 min, 40°Cfor 1 min, and 72°Cfor 1
min. Unincorporated deoxynucleotide triphosphate was eliminated with a
Sephadex G25 Quick Spin Column (Boehringer Mannheim, Tokyo. Japan).
The transcription ot" RNA from the synthetic DNA template was carried out
using a T7-MEGAshortscript kit (Ambion, Inc.. Austin, TX). The transcription
reaction mixture contained 500 ng of template DNA. 40 mM Tris-HCl (pH 7.5),
6 HIMMgCI2, 10 mM NaCl, 2 mM spermidine, 10 mM DTT, 30 /UMnucleotide
triphosphate, 1 unit//xl recombinant RNase inhibitor, and 1.0 unit//j.l T7 RNA
polymerase in a 20-/J.I volume. The reaction was carried out at 37°Cfor 2 h.
The reaction mixture was treated with RNase-free DNase. followed by phenolchloroform extraction and ammonium acetate ethanol precipitation.
Plasmid pGEM83 was prepared to produce the RNA substrate mimic of
telomerase RNA. pGEM83, in which almost the full length of the cDNA of
telomerase RNA was inserted, was kindly provided by Dr. Bryant Villeponteau
(Geron Corp., Menlo Park, CA). pGEM83 was digested with Sail (Boehringer
Mannheim). The transcription of RNA from plasmid templates was carried out
using MAXscript in viiru transcription kits (Ambion. Inc.). The transcription
reaction mixture contained 1 /j.g of linearized plasmid DNA: 0.5 unit/ml SP6
RNA polymerase; 40 mM Tris-HCl (pH 7.5): 6 mM MgCI2; 10 mM NaCl: 2 mM
spermidine:
10 mM DTT: 0.5 mM ATP, GTP, and UTP: O.I mM CTP; 50 ßCi
5406
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1998 American Association for Cancer Research.
RIBOZYME AGAINST TELOMERASE RNA
Telomerase RNA component
base
~450
Isogene (Nippon Gene. Inc.. Tokyo. Japan). Total RNA (500 ng) from each
transfectant was reverse-transcribed with a random hexamer. followed by PCR
using two primers, 5'-AGCACAGAGCCTCGCCTTT
(from the ß-actin5'
untranslated region) and 5'-TGGATCCCTCGAAGCTT
(from a plasmid
polylinker). The cycling conditions were 94°Cfor 30 s, 47°Cfor 30 s, and
72°Cfor I min for 25 cycles. PCR products were electrophoresed on a 1.5%
agarose gel and mounted on a nylon membrane by capillary transfer. The
membrane containing an amplified 119-bp DNA was hybridized using a
32P-labeled probe that was complementary to the conserved catalytic se
quences of the ribozyme (5'-CCTCACGGACTCATCAG).
The labeling of the
oligomer was carried out by T4 polynucleotide
Japan) and [y-'2P]ATP (DuPont, Inc.).
315ribozyme
Northern Blotting of Telomerase RNA Expression in Transfcctants.
Total RNA was extracted with Isogene (Nippon Gene, Inc.). Total RNA (20
/j.g) was loaded on a 1.0% agarose/formaldehyde
gel. electrophoresed. and
then mounted on a nylon membrane by capillary transfer. Northern blotting
was carried out using the cDNA of telomerase RNA inserted in pGRN83 and
glyceraldehyde-3-phosphate
dehydrogenase cDNA (Clontech Laboratories.
ribozyme
ribozyme
Fig. I. Target sites of three ribozymes. Three ribozymes were designed to largel
different sites in 450-base-long telomerase RNA. The ribozymes were named after the
cleavage site from Ine 5' end of the RNA.
of [a-'2P]CTP
(specific activity, 800 Ci/mmol:
Inc.. Palo Alto, CA).
Telomerase Detection Assay. Cultured cells were washed once with PBS
and scraped into a buffer [10 mM HEPES-KOH (pH 7.5). 1.5 mM MgCK. 10
DuPom. Inc., Wilmington.
DE); and I unit/ml recombinant RNase inhibitor in a 100-jul volume. The
reaction was carried out at 37°Cfor 1 h. The reaction mixture was treated with
RNase-free DNase, followed by phenol-chloroform
mM KCI, and 1 mM DTT]. The cells were washed in the buffer, homogenized
in 200 /U.1of a cell lysis buffer [10 mM Tris-HCl (pH 7.5). 1 mM MgCK. 1 HIM
EGTA. 0.1 mM benzamidine, 5 m.Mß-mercaptoethanol. 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-l-propanesulfonic
acid (WAKO Chemical In
extraction and ammonium
acetate ethanol precipitation. The transcript was 601 bases long.
The ribozyme and substrate RNA (molar ratio. 5:1) were mixed in a 10-^d
reaction volume containing 50 mM Tris-HCl (pH 7.5) and 1 niM EDTA. The
mixture was heated at 95°Cfor 2 min and cooled quickly on ice, and MgCK
was added at a final concentration of 10 mM and then incubated at 37°Cfor 3 h.
dustries, Inc.. Osaka. Japan), and 10% glycerol|. and incubated on ice for 30
min. Cell homogenates were then centrifuged at 12.000 X g for 20 min at 4°C.
The supernatant was recovered and snap-frozen in liquid nitrogen and stored at
—
80°C.The concentration of protein was measured with protein assay dye
The reactions were stopped by the addition of an equal volume of stop solution
(95% formamide. 25 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene
cyanol) and heated at 65°C for 5 min. The reaction mixture was electrophoresed in a 6% polyacrylamide-7
M urea gel in Tris-borate
(Bio-Rad Laboratories,
EDTA buffer.
phate mix, a TRAP primer mix (RP primer, Kl primer, and TSK1 template),
and 2 IU of Taq DNA polymerase in 20 mM Tris-HCl (pH 8.3). 1.5 mM MgCl,,
were seeded in a 6-well plate and incubated for 2 days. The medium was
replaced with serum-free DMEM. Ribozymes were synthesized using the
T7-MEGAshortscript kit (Ambion. Inc.) as described above.
The ribozyme (15 jig) was mixed with 15 ;ul of DOTAP2 (Boehringer
63 mM KCI. 1 mM EGTA, 0.05% Tween 20. and 0.01% BSA were mixed and
incubated at 30°Cfor 30 min. PCR was then performed at 94°Cfor 30 s and
60°Cfor 30 s for 25 cycles. The PCR products were electrophoresed in a 12%
Mannheim) in a total volume of 75 /J.1of HEPES buffer [20 mM (pH 7.4)] and
incubated for 15 min at room temperature. The mixture was suspended in 2.0
ml of DMEM. Cells were exposed to the ribozyme/DOTAP mixture every
12 h.
Cells were harvested at 24 and 48 h after the first exposure to the ribozyme
and submitted to the telomerase detection assay.
Construction of the Ribozyme Expression Vector and Transfection.
Two single-stranded oligodeoxynucleotides
were synthesized such that the
45-bp ribozyme contained flanking Sail and Hindttl restriction sites on both
ends (S'-TCGACGTTAGGGTTACTGATGAGTCCGTGAGGACGAAACAAAAAATGA and S'-AGCTTCATTTTTTGTTTCGTCCTCACGGACTCATCAGTAACCCTAACG).
The oligonucleotides were 5' phosphorylated by
acrylamide gel and autoradiographed.
Telomere Length Estimation. Genomic DNA was isolated from cells with
RapidPrep genomic DNA isolation kits (Pharmacia-Biotech,
Inc.. Uppsala.
Sweden) and digested with Hinfl restriction enzyme (Boehringer Mannheim).
DNA (10 /¿g)was loaded on a 0.6% agarose gel and electrophoresed. It was
mounted on a nylon membrane by capillary transfer and hybridized with
(TTAGGG)6 oligonucleotide that was 5' end-labeled with [7-'2P]ATP.
RESULTS
Three kinds of hammerhead ribozymes were designed to target the
GUC sequences in telomerase RNA, based on the model proposed by
Haselof'f and Gerlach (14). The structure of 36-ribozyme is shown in
T4 polynucleotide kinase (New England Biolabs, Inc., Beverly, MA), an
nealed, and cloned into pHßAPr-1-neo (16). The sequence and orientation of
the ribozyme in the vector were confirmed by DNA sequencing with a
sequence primer (5'-GACCAGTGTTrGCCTTTTA-3')
designed from the se
quences in the 5' untranslated region of ß-actin.The constructed vector was
cells were transfected with 10 /¿gof vector DNA that had been complexed with
50 /j,l of Lipofectin (Life Technologies, Inc.). Three days after transfection,
G418 was added to the medium to a final concentration of 1 mg/ml. The
transfected cells were exposed to G4I8 for 4 weeks.
RT-PCR and Southern Blot Analysis for Ribozyme Expression. Total
RNA was extracted from the transtectants and parental AN3CA cells using
2 The abbreviations used are: DOTAP, N-[l-(2,3-dioleoyloxyl)propyl]-/V,/V./V-trimethylammoniummethyl sulfate; RT-PCR. reverse transcription-PCR: TRF. telomere repeat
fragment; TRAP. Telomerie repeat amplification protocol.
Hercules. CA).
The TRAP assay was performed using a TRAP£Z£telomerase detection kit
(Oncor, Inc.. Gaithersburg, MD). In brief, 2 n\ of tissue extract and 48 jil of
TRAP reaction mixture consisting of 5' end-labeled TS primer (5'-AATCCGTCGAGCAGAGTT)
with [-y-'2P]ATP, 50 JIM deoxynucleotide triphos-
The reaction was analyzed by autoradiography.
Introduction of Ribozymes into Ishikawa Cells. Ishikawa cells (5 x IO4)
designated pHßAPr-l-neo-36RZ.
Lipofection of Ishikawa cells and AN3CA cells with pHßAPr-1-neo-36RZ
or pHßAPr-1-neo was performed according to the protocol recommended by
the manufacturer (Life Technologies, Inc.). In brief, approximately 5 X IO4
kinase (Toyobo. Inc.. Tokyo.
Fig. 2. Ribozymes (44 bases long) were transcribed with T7 RNA
polymerase according to previously published procedures (17). First,
we studied whether the three kinds of ribozymes could cleave the
RNA substrate efficiently in a cell-free system. A '~P-labeled RNA
substrate ol 601 bases in length was made with SP6 RNA polymerase.
This substrate and the ribozymes were mixed at a molar ratio of 1:5,
and a cleavage reaction was then observed. As shown in Fig. 3, all of
the hammerhead ribozymes efficiently cleaved the 601-base telomer
ase RNA substrate (Fig. 3). The 36-ribozyme, 170-ribozyme, and
315-ribozyme cleaved it into 521- and 80-base fragments, 214- and
387-base fragments, and 302- and 299-base fragments, respectively.
The cleaved fragments were the correct sizes, as predicted from the
location of the cleavage site of the ribozyme.
Next we introduced the ribozymes themselves into cndometrial
carcinoma Ishikawa cells. Because ribozymes are considered to be
5407
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1998 American Association for Cancer Research.
RIBOZYME
AGAINST TELOMERASE
3'
Cleavage
GCCAUUUUUUGUCUAACCCUAACUGAG
GUAAAAAACA
AUUGGGAUUG
•
G •
C
GU
Fig. 2. Structure of the 36-ribo/yme. The 20-mer an tisense sequences against the target
region were placed upstream and downstream of the catalytic core of the riho/yme. The
cleavage site is localized in the RNA template region, which is underlined.
31517036
RZ RZ RZ
RNA substrate
601 b
i...
f
RNA
erase activity in transfectants was simply due to the clonal divergence,
we included pooled clones of the vector transfectants and the ribozyme transfectants. As shown in Fig. 5, most clones showed an
apparently reduced telomerase activity compared with that of the
vector transfectant control and parental AN3CA cells. In some clones
(clones 5, 9, and 10), telomerase activity was almost undetectable.
Five of 10 clones (clones 5, 7, 8, 9, and 10) in which the telomerase
activity was diminished to a variable extent were further studied for
expression of the ribozyme and telomerase RNA. To study the ex
pression of the ribozyme, RT-PCR and Southern blot analysis were
performed. Ribozyme expression was found in all of the transfectants
with pHßAPr-1-neo-36RZ and its pooled clone (Fig. 6), implying that
ribozyme RNA was successfully expressed in these clones, although
the expression level differed in the clones.
The expression of telomerase RNA in the transfectants was ana
lyzed by Northern blotting. The telomerase RNA expression of the
vector transfectants was unchanged when compared with that of the
parental AN3CA cells. Transfectants with pHßAPr-l-neo-36RZ and
its pooled clone clearly reduced the level of telomerase RNA (Fig. 6).
The reduction level roughly inversely paralleled the expression level
of the ribozyme. This suggested that the reduced telomerase activity
was associated with the reduction of the telomerase RNA expression
521
C
2448
DOTAR
36RZ
170RZ
315RZ
2448
2448
2448
2448
hrs.
387
302.
299214
is
•*- 80
Fig. 3. In vitro cleavage reaction. The riho/.ymes and substrale RNA were mixed and
incubated for 3 h. All three ribozymes cleaved the RNA substrate, which was 601 bases
long. RZ, ribozyme.
unstable in medium supplemented with fetal bovine serum, a serumfree medium was used. The ribozymes were mixed with cationic
liposome and then introduced into the endometrial carcinoma cells. At
48 h after the first administration of ribozymes, telomerase activity
was diminished most significantly in the cells in which 36-ribozyme
was introduced (Fig. 4). It was thus concluded that 36-ribozyme was
the most promising in the transfection study.
We subcloned the 36-ribozyme sequence into pHßAPr-1-neo and
introduced it into Ishikawa cells. However, no clones resistant to
G418 (1 mg/ml) were obtained. Then we used AN3CA, another
endometrial carcinoma cell line. By introducing pHßAPr-1-neo or
pHßAPr-l-neo-36RZ into AN3CA cells and a subsequent selection
with l mg/ml G418, we obtained approximately 50 or 70 clones of
transfectant with pHßAPr-1-neo or pHßAPr-l-neo-36RZ, respec
tively. Ten clones were arbitrarily chosen from among the pHßAPrl-neo-36RZ transfectant clones, and their telomerase activity was
studied as a first step in the screening. Other pHßAPr-1-neo or
pHßAPr-l-neo-36RZ transfectant clones were collected and used as a
pooled clone. To rule out the possibility that the alteration of telom-
Ã--if.4. Ribo/vme
RNA was introduced into Ishikawa cells. Note that the 36-rihozyme
diminished telomerase activity most efficiently in 48 h. C control: ÃœOTAP.DOTAP
(liposome) only; RZ. ribozyme; AV.internal standard.
0.'
e>e>e>eie>e>e>e>
Fig.
pooled
fectanl;
activity
^p
e>
f
5. Telomerase activity in transfectants and parental AN3CA cells. Vector P., a
clone of vector transfectant; Ribozyme P., a pooled clone of 36-ribozyme transLanes CI-C10. clones 1-10; IS. internal standard. Note that the telomerase
was reduced in all of the ribozyme transfectants including the pooled clone.
5408
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1998 American Association for Cancer Research.
RIBOZYME
AGAINST
«b A
O
Ri bozyme
Tel omerase
RNA
G3PDH
Fig. 6. Ribozyme and telomerase RNA expression. Rihozyme expression was studied
by RT-PCR and Southern blotting. Telomerase RNA and glyceraldehyde-3-phosphate
dehydrogenase were analyzed by Northern blotting. Ribozyme was expressed in all of the
transfectants. Telomerase RNA expression was diminished in all of the transfectants.
Telomerase RNA was expressed in C5, C9. and CIO, whose telomerase activity was
almost undetectable. as shown in Fig. 5. Vector P.. a pooled clone of vector transfectant:
Ribozvme P., a pooled clone of 36-ribozyme transfectant: C5, C9, and CIO, clones with
greatly reduced telomerase activity: C8. a clone with moderately reduced telomerase
activity: C7, a clone with slightly reduced telomerase activity; C3PDH. glyceraldehyde3-phosphate dehydrogenase.
level. However, in the clones in which telomerase activity was almost
undetectable, telomerase RNA was steadily expressed.
The TRF length of clones 5, 9, and 10, in which telomerase activity
was reduced significantly, was analyzed by Southern blot hybridiza
tion. As shown in Fig. 7, the TRF of these clones was apparently
shortened.
DISCUSSION
For the ribozymes to recognize and catalyze the target sites, the
target region must be sufficiently exposed on the outer surface of the
three-dimensional structure of the molecules. In the present study, the
36-ribozyme that targeted the RNA template region reduced the
telomerase activity most efficiently, implying that this region is lo
cated at the outer surface of the telomerase molecule. This finding is
consistent with the experiment using antisense oligonucleotide in
which the targeting of this template region caused the most significant
reduction in the telomerase activity of mouse cells (18).
The template region of telomerase RNA is crucial for enzyme
activity, but a recent investigation has demonstrated that another part
of telomerase RNA is also regulatory for enzyme activity (19). We
chose the GUC sequence as a cleavage site and studied the efficiency
of the ribozymes targeting three different GUC sites. However, ham
merhead ribozymes can cleave the 3' end of some other triplet
TELOMERASE
RNA
RNA is a direct participant in the telomerase molecule as an essential
element. We demonstrated that the reduction of telomerase RNA
expression was associated with the attenuation of telomerase activity.
This did not appear to come from clonal divergence, because the
telomerase activity and telomerase RNA in the pooled clone of
ribozyme transfectant were clearly diminished compared with that of
the parental cells and the vector transfectant. However, in some clones
in which telomerase activity was almost undetectable, telomerase
RNA was still expressed at a steady level. This may suggest that
besides catalysis by the ribozyme, the antisense sequence of the
ribozyme against the RNA may interfere with enzyme activity in situ.
To date, two protein components of human telomerase have been
identified. TP1 is a protein binding to telomerase RNA (26, 27). Its
mRNA can be a target of ribozymes, but it has been reported that its
expression level does not parallel telomerase activity. In addition, its
expression is not limited in the tissues with positive telomerase
activity. hTERT is a catalytic subunit of telomerase (28, 29). It has
been demonstrated that the expression level of this mRNA parallels
telomerase activity. This seems to be a major regulator of telomerase
activity. It means that the mRNA of this protein can be another target
of the hammerhead ribozyme, although the effect of the ribozyme on
telomerase activity would be indirect.
We have chosen endometrial carcinoma cells as a target cancer for
the ribozyme, but many studies have demonstrated that normal endometrium possesses telomerase activity (30, 31). In this context, when
considering the introduction of ribozymes in vivo, endometrial carci
noma may not be a good target cancer for the ribozyme. We have
previously reported that the telomerase activity of the endometrium is
regulated by progestins (30). The secretory endometrium and decidual
endometrium induced by progestins do not express telomerase activity
at a detectable level. This implies that pretreatment with progestins
can totally abolish telomerase activity in the normal endometrium. In
combination with progestin, the ribozyme can selectively target can
cer cells.
In immortal cells, it has been demonstrated that telomerase activity
is associated with the cell cycle (32). The highest telomerase activity
kb
23.1-
9.4—
6.64.4—
sequences such as CUC, GUA, or GUU as efficiently as they do GUC
(20). This implies that there may be many other sites where ribozymes
2.3—
can cleave telomerase RNA more efficiently.
2.0—
It has been shown that the enzyme activity of telomerase is not
associated with the expression level of telomerase RNA in some
tumors and cells (21, 22). However, a rough correlation was found
between a cultured cell line and T lymphocytes (23, 24). Recently, the
crucial role of the RNA component in telomere shortening has been
0.6—
demonstrated in the cells of a telomerase RNA knockout mouse (25).
Despite the complex between them, we reasoned in this experiment
Fig. 7. Southern blot analysis
that the breakdown of telomerase RNA molecules by the ribozymes
telomerase activity were analyzed.
clone of vector Iransfectant.
must lead to the attenuation of telomerase activity, because telomerase
5409
of the TRF. Three clones with greatly attenuated
All clones showed shorter TRFs. Vector P., a pooled
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1998 American Association for Cancer Research.
RIBOZYME
AGAINST
TELOMERASE
is (bund in the S phase of the cell cycle (33, 34), whereas quiescent
cells do not possess telomerase activity at a detectable level. In this
study. AN3CA transfectants with the 36-ribozyme clearly grew more
slowly than did the parental cell line (data not shown). The doubling
time of the transfectant became doubled at the maximum. The transfectant of AN3CA with attenuated telomerase activity passed almost
30 passages and still steadily proliferated. On the other hand, we could
not obtain the 36-ribozyme transfectant with Ishikawa cells. We tried
another expression vector (pcDNA3) in Ishikawa cells but could not
obtain the ribo/.yme transfectant. This may be explained by the
toxicity of the 36-ribozyme for some cell lines.
The 36-ribozyme used in this experiment is a promising agent for
repressing telomerase activity. In this ribozyme, the antisense se
quences flanking the catalytic core spanned 20 nucleotides. It has been
shown that the length of the flanking antisense sequence affects
ribo/.yme kinetics (35). This may suggest that there is room for further
improvement in the efficiency of 36-ribozyme.
ACKNOWLEDGMENTS
We thank Dr. Musato Nishida for the Ishikawa cells. Dr. Larry Kedes.
Stanford University School of Medicine, Palo Alto, CA, for pHßAPr-1-neo.
and Dr. Bryant Villeponteau for pGRN83.
REFERENCES
1. de Lange. T. Aclivalion of lelomerase in a human lumor. Proc. Nail. Acad. Sci. USA.
91: 2882-2885, 1994.
2. Allsopp, R. C.. Chang. E.. Kashefi-Aazam. M.. Rogaev, E. I.. Pialyszek. M. A., Shay,
J. W.. and Harley. C. B. Telomere shortening is associated with cell division in vitro
and in vivo. Exp. Cell Res.. 220; 194-200, 1995.
3. Harley. C. B. Telomere loss: mitolic clock or genetic time bomb? Mutât.Res.. 256.
271-282. 1991.
4. Greider. C. W.. and Blackburn. E. H. A lelomcric sequence in the RNA of Teirahytnt'iut telomerase required for telomere repeat synthesis. Nature (Lond.). 337: 331337, 1989.
5. I mull 'l.i.l V.. and Wright. W. E. Telomeres and telomerase: a simple picture becomes
complex. Cell. X7: 369-375, 1996.
6. Wright. W. E.. Piatyszek. M. A.. Rainey. W. E., Byrd. W.. and Shay. J. W.
Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet.,
18: 173-179. 1996.
7. Sharma. H. W.. Sokoloski. J. A.. Perez, J. A.. Maltese. J. Y., Sartorelli. A. C.. Stein.
C. A.. Nichols, G., Khalcd. Z., Telang, N. T.. and Narayanan. R. Differentiation of
immortal cells inhibits telomerase activity. Proc. Nati. Acad. Sci. USA, 92: 1234312346. 1995.
8. Albanell, J.. Han. W.. Mellado, B.. Gunawardane. R.. Svher. H. I., Dmitrovsky. E.,
and Moore, M. A. Telomerase activity is repressed during differentiation of matura
tion-sensitive but not resistant human tumor cell lines. Cancer Res.. 56: 1503-1508.
19%.
9. Xu. D.. Gruher, A.. Peterson. C.. and Pisa. P. Suppression of telomerase activity in
HL60 cells after treatment with differentiating agents. Leukemia (Baltimore). 10:
1354-1357, 1996.
10. Shore. D. Telomerase and telomere-binding proteins: controlling the endgame.
Trends Biochem. Sci.. 22: 233-235. 1997.
11. Feng. J.. Funk, W. D.. Wang. S. S.. Weinrich. S. L.. Avilion. A. A.. Chiù, C. P..
Adams. R. R.. Chang, E.. Allsopp. R. C. Yu. J.. Le. S.. West. M. D.. Harley, C. B..
Andrews. W. H., Greider, C. W., and Villeponteuu, B. The RNA component of human
telomerase. Science (Washington DC). 269: 1236-1241, 1995.
12. Yokoyama, Y.. Morishita, S.. Takahashi, Y.. Hashimoto. M.. and Tamaya. T. Mod
ulation of c-frnx proto-oncogene in an ovarian carcinoma cell line by a hammerhead
ribozyme. Br. J. Cancer. 76: 977-982. 1997.
RNA
13. Kashani-Sabet. M., Funaio. T.. Tone. T., Jiao, L., Wang, W.. Yoshida, E., Kashfinn.
B. I.. Shitara. T., Wu, A. M.. Moreno, J. G., Traweek. S. T., Ahlering, T. E., and
Scanion. K. J. Reversal of the malignant phenotype by an anti-ras ribozyme. Antisense Res. Dev., 2: 3-15. 1992.
14. Haseloff, J.. and Gerlach, W. L. Simple RNA enzymes with new and highly specific
endonuclease activities. Nature (Lond.), 344: 585-591, 1988.
15. Nishida. M., Kasahara. K.. Kaneko. M.. Iwasaki. H.. and Hayashi. K. Establishment
of a new human endometrial carcinoma cell line, Ishikawa cells, containing estrogen
and progesterone receptor. Acta Obstet. Gynaecol. Jpn.. 37: 1103-1 111. 1985.
16. Gunning. P.. Leavitt, J.. Muscat, G., Ng, S.. and Kedes, L. A human ß-actin
expression vector system directs high-level accumulation of antisense transcripts.
Proc. Nail. Acad. Sci. USA. 04: 4831-4835. 1987.
17. Milligan, J. F.. Groebe, D. R.. Witherell. G. W.. and Uhlenbeck, O. C. Oligoribonucleotidc synthesis using T7 RNA polymerase and synthetic DNA templates. Nu
cleic Acids Res., 15: 8783-8798. 1987.
18. Blasco. M. A.. Funk. W.. Villeponteau. B., and Greider. C. W. Functional charac
terization and developmental regulation of mouse telomerase RNA. Science
(Washington DC). 269: 1267-1270, 1995.
19. Bhattacharyya, A., and Blackburn. E. H. A functional telomerase RNA swap in vivo
reveals the importance of nontemplate RNA domains. Proc. Nati. Acad. Sci. USA. 94:
2823-2827. 1997.
20. Koizumi. M.. Iwai, S.. and Ohtsuka, E. Construction of a series of several selfcleaving RNA duplexes using synthetic 21-mers. FEBS Lett.. 22«:228-230, 1988.
21. Avilion. A. A.. Piatyszek. M. A.. Gupta. J.. Shay. J. W.. Bacchetti, S., and Greider,
C. W. Human telomerase RNA and telomerase activity in immortal cell lines and
tumor tissues. Cancer Res., 56: 645-650. 1996.
22. Blasco. M. A.. Rizen. M.. Greider. C. W.. and Hanahan. D. Differential regulation of
lelomerase activity and telomerase RNA during multi-stage tumorigenesis. Nat.
Genet.. 12: 200-204. 19%.
23. Bodnar. A. G.. Kim, N. W.. Effros. R. B.. and Chiù.C. P. Mechanism of lelomerase
induction during T cell activation. Exp. Cell Res., 228: 58-64, 1996.
24. Broccoli. D.. Godley, L. A.. Donehower, L. A., Varmus, H. E.. and deLange. T.
Telomerase activation in mouse mammary tumors; lack of detectable telomere
shortening and evidence for regulation of telomerase RNA with cell proliferation.
Mol. Cell. Biol., 16: 3765-3772, 1996.
25. Lee. H. W.. Blasco. M. A.. Gottlieb, G. J.. Homer. J. W. N.. Greider. C. W.. and
DePinho, R. A. Essential role of mouse telomerase in highly proliferative organs.
Nature (Lond.). 392: 569-574, 1998.
26. Harrington. L.. McPhail. T.. Mar. V.. Zhou. W.. Oulton. R.. Program. A. E.. Bass.
M. B.. Amida. I., and Robinson, M. O. A mammalian telomerase-associated protein.
Science (Washington DC), 275: 973-977, 1997.
27. Nakayama, J.. Saito, M., Nakaniura. H.. Matsuura. A., and Ishikawa. F. TLPI : a gene
encoding a protein component of mammalian telomerase is a novel member of WD
repeats family. Cell. H/Õ:875-884. 1997.
28. Meyerson. M., Counter, C. M., Eaton. E. N.. Ellisen. L. W., Steiner. P.. Caddie. S. D.,
Ziaugra. L.. Beijersbergen. R. L.. Davidoff. M. J.. Liu. Q.. Bacchetti. S., Haber, D. A.,
and Weinberg. A. hEST2. the putative human telomerase catalytic subunit gene, is
up-regulated in tumor cells and during immortalization. Cell. 90: 785-795. 1997.
29. Nakamura. T. M., Morin, G. B.. Chapman. K. B.. Weinrich, S. L.. Andrews, W. H.,
Lingner. J.. Harley, C. B.. and Cech, T. R. Telomerase catalytic subunit homologs
from fission yeast and human. Science (Washington DC). 277: 955-959, 1997.
30. Yokoyama. Y., Takahashi. Y.. Morishita, S., Hashimoto. M., Niwa. K., and Tamaya,
T. Telomerase activity in the human endometrium throughout the menstrual cycle.
Mol. Hum. Reprod., 4: 173-177, 1997.
31. Kyo, S.. Takakura. M.. Kohama. T.. and Inoue. M. Telomerase activity in human
endomelrium. Cancer Res., 57: 610-614, 1997.
32. Holt, S. E.. Wright, W. E., and Shay. J. W. Regulation of ielomerase activity in
immortal cell lines. Mol. Cell. Biol., 16: 2932-2939. 1996.
33. Kruk. P. A.. Orren, D. K.. and Bohr. V. A. Telomerase activity is elevated in early S
phase in hamster cells. Biochem. Biophys. Res. Commun., 233: 717-722. 1997.
34. Zhu, X.. Kumar. R.. Mandai. M.. Sharma, N.. Sharma. H. W.. Dhingra. U.. Sokoloski,
A. A., Hsiao. R., and Narayanan, R. Cell cycle-dependent modulation of telomerase
activity in tumor cells. Proc. Nati. Acad. Sci. USA, 93: 6091-6095. 1996.
35. Goodchild. J.. and Kohli, V. Ribozymes that cleave an RNA sequence from human
immunodeficiency virus: the effect of flanking sequence on rate. Arch. Biochem.
Biophys.. 284: 386-391, 1991.
5410
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1998 American Association for Cancer Research.
Attenuation of Telomerase Activity by a Hammerhead Ribozyme
Targeting the Template Region of Telomerase RNA in
Endometrial Carcinoma Cells
Yasuhiro Yokoyama, Yuichiro Takahashi, Ariyoshi Shinohara, et al.
Cancer Res 1998;58:5406-5410.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/58/23/5406
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1998 American Association for Cancer Research.