Epigenetic Consequences of Autosomal Asynapsis in
Carriers of Robertsonian Translocations
Shawn Fayer
Department of Human Genetics
McGill University, Montreal, Canada
June, 2014
A thesis submitted to McGill University in partial fulfilment of the requirements
of the degree of
Master of Science (MSc)
©Shawn Fayer, 2014
1
Table of Contents
Abstract ......................................................................................................................... 4
Résumé .......................................................................................................................... 5
Acknowledgements ........................................................................................................ 8
Contributions of Authors ................................................................................................ 9
Chapter 1: Literature review and Introduction ...............................................................10
Overview of Spermatogenesis and Male Mammalian Meiosis ...................................10
Meosis introduction: ..............................................................................................10
Events of Prophase I: .............................................................................................11
Epigenetics of Spermatogenesis ................................................................................15
Epigenetics introduction: .......................................................................................15
Epigenetic Reprogramming in Spermatogenesis: ...................................................17
Histone Variants:...................................................................................................21
Meiotic Sex Chromosome Inactivation ......................................................................27
Robertsonian Translocations .........................................................................................30
Introduction to Translocations: ..............................................................................30
Meiotic Silencing of Unsynapsed Chromatin .............................................................32
Post Meiotic Sex Chromatin Repression: ...............................................................33
Chapter 2: Dynamics of Response to Asynapsis and Meiotic Silencing in Spermatocytes
from Robertsonian Translocation Carriers .....................................................................36
Abstract: ...................................................................................................................36
Introduction: .............................................................................................................37
Scientific Questions: .................................................................................................40
Hypothesis: ...............................................................................................................40
Objectives: ................................................................................................................40
Materials and Methods: .............................................................................................40
Results: .....................................................................................................................42
Dynamic γH2A.X localization to trivalents in spermatocytes from Robertsonian
translocation carriers: ............................................................................................43
H3.3 localizes to metaphase I/anaphase I spermatocytes: .......................................45
Conclusion: ...............................................................................................................46
Discussion: ...............................................................................................................47
Figure Legends: ........................................................................................................50
2
Chapter 3: Chromatin Immunoprecipitation (ChIP) on Robertsonian translocation carrier
testes confirms γH2A.X enrichment at the Dnmt3a locus ..............................................62
Abstract: ...................................................................................................................62
Introduction: .............................................................................................................63
Scientific Questions: .................................................................................................65
Hypothesis: ...............................................................................................................66
Objectives: ................................................................................................................66
Materials and Methods: .............................................................................................66
Results ......................................................................................................................68
Conclusions: .............................................................................................................72
Discussion: ...............................................................................................................72
Figure legends:..........................................................................................................76
Chapter 4: Meiotic silencing does not affect gene expression in embryos sired by
heterozygous Robertsonian translocation carriers ..........................................................82
Abstract: ...................................................................................................................82
Introduction: .............................................................................................................84
Scientific questions: ..................................................................................................87
Hypothesis: ...............................................................................................................87
Objectives: ................................................................................................................88
Materials and Methods: .............................................................................................88
Results: .....................................................................................................................90
Fertility testing of translocation carriers: ................................................................90
Expression analysis to test the possibility that meiotic silencing affects embryonic
development:.........................................................................................................91
Conclusions: .............................................................................................................95
Discussion: ...............................................................................................................96
Figure legends:..........................................................................................................99
References .................................................................................................................. 108
3
Abstract
Failure of homologous synapsis during meiotic prophase triggers transcriptional
repression termed meiotic silencing of unsynapsed chromatin (MSUC). In
spermatogenesis the X and Y chromosomes incompletely synapse and are thus,
silenced by MSUC, while the consequences of asynapsis of autosomes are not
fully understood.
To establish the dynamics of autosomal asynapsis and the proportion of
spermatocytes with meiotic silencing of unsynapsed autosomes, we examined two
marks of unsynapsed chromatin, histone variants γH2A.X and H3.3, in the
spermatocytes of Robertsonian (Rb) translocation carrier mice using
immunolocalization with fluorescent antibodies and chromatin
immunoprecipitation (ChIP) assays. We also tested the hypothesis that MSUC
marks were transmitted to embryos by exploring the expression levels of
pericentromeric genes.
Histone variant H3.3S31 was enriched at autosomal regions in 12% of
metaphase I/anaphase I spermatocytes of single Robertsonian translocation
carriers, and 31% of spermatocytes from carriers of 3 translocations compared to
the 100% of nuclei with H3.3S31 enrichment at sex chromosomes, an observation
that suggests that only a small proportion of spermatocytes carry autosomal
MSUC marks.
ChIP experiments with γH2A.X and H3.3 on testes from the same
translocation carrier mouse strains confirmed the enrichment of γH2A.X and H3.3
4
at the Dnmt3a gene, located on the pericentromeric region of chromosome 12
which is associated with the Rb (8.12) translocation in translocation carriers.
Finally, we assessed gene expression levels of Dnmt3a and other genes
associated with translocations in embryos sired by translocation carriers to test if
MSUC marks or effects thereof, are transmitted to the offspring. We were unable
to detect any decrease in expression. We therefore conclude that asynapsis at the
pericentromeric region of translocation trivalents is variable across the pachytene
stage and results in stable silencing in a proportion of translocation carrier
spermatocytes. This silencing spreads to the Dnmt3a locus in spermatocytes, but
is not passed on to post-implantation embryos sired by translocation carriers, at
least not in the expected proportions.
Résumé
L’échec de l’appariement homologue pendant la prophase méiotique
provoque une forme de répression transcriptionnelle appelée « inactivation
méiotique de la chromatine non-appariée » (meiotic silencing of unsynapsed
chromatin – MSUC). Lors de la spermatogénèse, les chromosomes X et Y
s’apparient de manière incomplète et sont donc réprimés par MSUC, alors que les
conséquences du non-appariement des autosomes demeurent obscures.
Notre objectif était donc de mieux comprendre la dynamique du nonappariement autosomique et de déterminer la proportion de spermatocytes
caractérisés par une inactivation méiotique des autosomes. À l’aide d’expériences
de localisation par immunofluorescence et d’immunoprécipitation de la
5
chromatine (ChIP), nous avons examiné deux marques de chromatine nonappariée, les histones γH2A.X et H3.3, dans les spermatocytes de souris porteuses
de la translocation de Robertsonian (Rb). Nous avons également vérifié
l’hypothèse selon laquelle les marques de MSUC sont transmises à l’embryon, et
ce en explorant les niveaux d’expression de gènes péricentromériques.
Nos résultats démontrent que la forme d’histone H3.3S31 est enrichie dans
les régions autosomiques lors de la métaphase I/anaphase I chez 12% des
spermatocytes de porteurs d’une translocation de Robertsonian unique. Ceci est
également le cas dans 31% des spermatocytes de porteurs de 3 translocations,
alors que 100% des noyaux démontrent un enrichissement de H3.3S31 sur les
chromosomes sexuels. Cette observation suggère que seule une faible proportion
de spermatocytes sont porteurs de marques de MSUC autosomiques.
Nous avons ensuite réalisé des expériences de ChIP contre γH2A.X et
H3.3 dans les testicules des mêmes souches de souris porteuses de la
translocation, ce qui a confirmé que γH2A.X et H3.3 sont enrichies au locus du
gène Dnmt3a. Celui-ci est localisé dans la région péricentromérique du
chromosome 12, qui est associée avec la translocation Rb (8.12) chez les porteurs
de la translocation.
Enfin, afin de déterminer si les marques de MSUC ou leurs effets sont
transmis à la prochaine génération, nous avons évalué les niveaux d’expression
génique de Dnmt3a et d’autres gènes associés avec la translocation dans les
embryons engendrés par des porteurs de la translocation. Nous n’avons pu
détecter aucune diminution de l’expression de ces gènes. Ainsi, ces données nous
6
permettent de conclure que le non-appariement dans la région péricentromérique
est variable pendant la phase pachytène chez les porteurs trivalents de la
translocation. Ceci mène à une répression stable dans une partie des
spermatocytes de porteurs de la translocation. Cette inactivation se propage
jusqu’au locus Dnmt3a dans les spermatocytes, mais n’est pas transmise aux
embryons générés par les porteurs de la translocation après l’implantation, ou du
moins pas dans les proportions attendues.
7
Acknowledgements
I would like to extend my sincerest gratitude to my supervisor, Dr. Anna
Naumova for her constant support throughout my master’s project. Dr. Naumova has
been an extremely strong motivator and an ever present leader in the lab. Surely, without
her leadership this project would not have been possible.
I would also like to acknowledge the contributions from my advisory committee
members, Dr. Guillaume Bourque and Dr. Jacquetta Trasler for their thoughtful advice
and input on this project.
Additionally, I need to thank Florencia Pratto of Dr. Camerini-Otero's lab for
technical assistance with ChIP experiments, Dr. Teruko Taketo for slide preparations for
H3.3 immunostaining, Aabida Saferali for collection of F2 embryos, and Naumova lab
members Pamela Stroud and Nasser Fotouhi for day to day technical assistance and
training. Furthermore, I am grateful for all members of the Naumova lab for their
positivity and always being able to put a smile on my face.
I also acknowledge all of my professors for stimulating thought and discussion in
the classroom and all of my classmates for constant support and encouragement.
Finally, I thank my family from the bottom of my heart. Without your support
throughout my studies I never would have been able to realize any of my academic
dreams.
8
Contributions of Authors
Results from Chapter 2 of the thesis have been published in PLOS ONE
with the citation:
Naumova, A. K., Fayer, S., Leung, J., Boateng, K. A., Camerini-Otero, R. D., &
Taketo, T. (2013). Dynamics of response to asynapsis and meiotic silencing
in spermatocytes from robertsonian translocation carriers.PloS One, 8(9),
e75970.
Contributions of the authors in experiments discussed in this thesis are as
follows: Conceived and designed the experiments: AKN RDCO KB TT.
Performed the experiments: AKN SF TT. Analyzed the data: AKN SF.
Contributed reagents/materials/analysis tools: AKN KB RDCO TT.
All experimental work and analysis from chapter 3 were conducted by the
candidate.
In chapter 4, RB5 and control F2 embryo collection for expression
analysis were carried out by previous Naumova lab member, Aabida Saferali. All
other experimental work and analysis was conducted by the candidate.
9
Chapter 1: Literature review and Introduction
Overview of Spermatogenesis and Male Mammalian Meiosis
Meosis introduction:
Male mammalian meiosis is the process of developing diploid,
preleptotene spermatocytes into haploid spermatids within spermatogenesis. In
mice this process takes about 14 days (Kofman-Alfaro et al. 1970), a majority of
spermatogenesis, indicative of the massive chromatin remodeling required for its
completion. The result is 4 haploid spermatids per each diploid preleptotene
spermatocyte. Meiosis is broken down into two meiotic cycles, meiosis I and
meiosis II. At the onset of meiosis I, the primary spermatocytes are tetraploid and,
without any additional DNA replication, the two meiotic divisions occur, yielding
the haploid spermatids. Each division is further broken down into the prophase,
metaphase, anaphase, and telophase stages (Reviewed by Handel et al. 1997). The
longest of which is prophase, where homologous chromosomes must pair,
synapse and recombine (Kofman-Alfaro et al. 1970). Based on molecular
markers, five stages of prophase I are described: leptotene, zygotene, pachytene,
diplotene and diakinesis. Prophase I is of particular interest because of the
changes that occur in chromatin such as, DNA double strand breaks, homologous
chromosome paring, synapsis, recombination, and DNA repair, as well as meiotic
silencing that occurs during the pachytene stage (Turner et al. 2004, 2005).
10
Events of Prophase I:
The prophase of meiosis I is the longest stage of meiosis with a duration of
10 days in the mouse (Goetz et al. 1984). Preleptotene primary spermatocytes, the
product of the second mitotic division of spermatogonia, are primed to enter
prophase. Upon initiation of the leptotene stage, the spermatocyte genome is full
of hundreds of DNA double stranded breaks (DSBs) (Burgoyne et al. 2009,
Mahadevaiah et al. 2001). The DSBs precede recombination and synapsis and are
initiated by the Spo11 protein. These DNA lesions are necessary for
recombination and homologous recognition. As the chromosome pairs synapse
the double stranded breaks are repaired (Mahadevaiah et al. 2001). The formation
of the synaptonemal complex, a proteinaceous structure that holds homologous
chromosomes in tight association, distinguishes the transition from the zygotene
to the pachytene stage (Mahadevaiah et al. 2001). The pachytene stage is the
longest stage of prophase I. Beyond the pachytene stage, prophase spermatocytes
enter the diplotene stage as the synaptonemal complex begins to break down and
chromosomes start to desynapse (Burgoyne et al. 2009). Diakinesis follows and
the spermatocyte enters metaphase I.
DNA DSBs in meiosis have been a highly studied phenomena due to their
role in recombination and homologous synapsis in prophase I. It was first reported
that DSBs precede recombination and synapsis by Mahadevaiah et al. in 2001.
This led to the notion that double stranded breaks are necessary for homologous
synapsis. The first indication that the Spo11 protein was necessary for synapsis
was in a study of Spo11 mutant yeast which did not synapse or undergo
11
recombination at wild type levels (Giroux et al. 1989). The same group was able
to later isolate the protein necessary for DSB production in meiosis in S.
cerevisiae and identified it as the Spo11 protein (Keeney et al. 1997). The Spo11
protein is part of a topoisomerase-like protein family, and DSBs initiated in
prophase I are through a transesterification reaction (Roeder 1997). An interesting
insight into the repair process of Spo11 initiated DSBs is that topoisomerase
induced DNA lesions can be directly reversed and DNA repair may occur without
the necessity of a recombination event (Keeney et al. 1997). This suggests that not
all DSBs initiated in prophase need be necessary for recombination and may serve
solely for the purpose of homologous recognition.
In mice, a Spo11 homolog has been identified and successfully knocked
out. This was done through gene targeting in embryonic stem cells and the
development of Spo11−/− mutant mice to adulthood revealed that the Spo11 gene is
not required for mouse development. Spo11 mutant mice had no noticeable
morphological abnormalities and developed normally except that knockouts were
infertile. Upon investigation of mouse testes cell spreads, it was discovered that
knockout spermatocytes arrested prior to the pachytene stage. These zygotene-like
arrested spermatocytes showed little to no synapsis. Further, the pre-pachytene
arrest could be partially rescued by radiation induced DNA lesions. These results
revealed that Spo11 is necessary for synapsis by creating DNA DSBs in mice
(Romanienko et al. 2000).
Other genes necessary for proper homologous synapsis in meiosis are the
RecA homologs, Dmc1 and Rad51. RecA is an E. coli protein that functions in
12
recombination by catalyzing strand exchange between homologous DNA
molecules (Stasiak et al. 1994). Dmc1 is a RecA homolog that is specifically
expressed during meiosis in mice. For this reason it was successfully knocked out
through gene targeting in mice and Dmc1−/− mutants are viable and can develop
normally. As with the Spo11 knockout, mice homozygous for the Dmc1
knockout, were infertile and their spermatocytes arrested in the zygotene stage
(Yoshida et al. 1998). Rad51, however, has not been successfully knocked out due
to its DNA repair role in somatic cells. Since this function is necessary for cell
proliferation, Rad51−/− mutants die in early embryonic development (Tsuzuki et al.
1996).
Other DNA repair proteins that function both in somatic cells and in
meiosis include the RAD9-RAD1-HUS1 (9-1-1) complex proteins. Like Rad51
these proteins have known functions in DNA repair, but their role in meiosis was
not completely understood because of the inability to generate a viable knockout
for any of the genes involved in the complex because of their essential role in
somatic cells. The 9-1-1 complex forms a heterotrimeric ring structure that clamps
DNA When Hus1 is knocked out in mouse cells, there is a mitotic arrest in Sphase, revealing its role as part of an S-phase checkpoint (Weiss et al. 2002). It
has been suggested that the 9-1-1 complex clamp, through ATR signaling, acts as
a scaffold for other DNA repair proteins, such as Rad51 when initiating DNA
repair (Pandita et al. 2006). This role, indeed, prevented a knockout model with a
targeted deletion of any of the 9-1-1 complex genes, until one group developed a
conditional knockout system for the Hus1 gene in mouse testis. A Stra8-CRE and
13
Spo11-CRE model were used to recombine out a portion of a lox-flanked portion
of the Hus1 gene. CRE expression in the Stra8 system initiates in the
spermatogonia, whereas CRE expression in the Spo11 system does not begin until
after the initiation of meiosis. This system revealed that Hus1 expression is
necessary for normal fertility and spermatogenesis as well as normal synapsis and
DSB repair (Lyndaker et al. 2013).
These studies together on leptotene and zygotene repair machinery and
synapsis initiation reveal that these events are tightly coupled in spermatogenesis.
Although synapsis can occur without full DSB repair, spermatocytes usually do
not survive past the zygotene/pachytene transition without this repair (Lyndaker et
al. 2013, Yoshida et al. 1998,) Further, only when spermatocytes can fully
synapse are they considered pachytene stage spermatocytes.
The pachytene stage is described as the stage where homologous synapsis
has occurred with the formation of the synaptonemal complex (SC) (Heyting
1996). The SC is a protein structure which binds and holds homologous
chromosomes in close approximation. The basic structure of the SC is a protein
core filament made up of axial elements which line the area between the two
chromosomes and are connected by transverse filaments (von Wettstein et al.
1984) As the SC completes its formation, axial elements of the two chromosomes
are called lateral elements (LE) as a third core structure is formed within knows as
the central elements (CE), which span the chromosomes. Transverse filaments
now span the core region and bind lateral elements to the central elements
(Heyting 1996). Since the first studies of the SC through electron microscopy, a
14
dedicated effort has been made to both identify proteins involved in the SC and to
uncover the function and physiology of each.
Axial elements and transverse filaments with Scp1(Schmekel and
Daneholt 1998). AE become LE that line the chromosomes in the SC. It is thought
that double stranded breaks are essential to allow DNA strands to protrude out
from AE to recognize homologous strands for synapsis. It was first thought that
the SC had to be formed in order for recombination to occur (von Wettstein et al.
1984), but the previously mentioned, more recent studies on DSBs and synapsis
undermine this assumption (Mahadevaiah et al. 2001). It is now accepted that
DSBs are repaired after synapsis or concurrently with synapsis, defining entry
into the pachytene stage. As spermatocytes progress into the diplotene stage, LEs
disassociate with each other and chromosomes become unsynapsed and shortly
thereafter the SC breaks down as spermatocytes enter diakinesis and metaphase
(Solari et al. 1970).
Epigenetics of Spermatogenesis
Epigenetics introduction:
Epigenetics is defined as features independent of the DNA sequence that
determine when and where a gene is expressed and are heritable through cell
division (Naumova and Greenwood, 2013). These features, or epigenetic marks,
may be in the form of DNA methylation at cytosine positions, histone
modifications, histone variants and nucleosome assembly, or higher order
chromatin structure. Epigenetics plays an important role in the development and
differentiation of mammalian gametes. For example, methylation patterns differ
15
between mature sperm and oocytes and are in contrast with their surrounding
somatic cell environment. The CpG content of mature sperm is 90% methylated
whereas it is only 40% methylated in mature oocytes (Kobayashi et al. 2012).
This is just one indicator of the importance of epigenetics in determining the fate
of a cell.
Chromatin structure and nucleosome assembly are important factors in
epigenetics and the epigenetic reprogramming that occurs in spermatogenesis.
The functional unit of chromatin, the nucleosome, wraps 146 base pairs of DNA
in an octamer made up of a H3-H4 tetramer and two H2A, H2B dimers (Luger et
al. 1997, Jenuwein et al. 2001). These histones are termed canonical histones and
are dependent upon DNA replication for their deposition in chromatin. For
dynamic cellular processes such as, rapid epigenetic reprogramming, independent
of the cell cycle and DNA replication, histone post translational modifications
(PTMs) and histone variants to replace canonical histones may be incorporated
for various functional purposes (Ahmad et al. 2002, Hajkova et al. 2002, Hajkova
et al. 2008). Histone variants differ slightly from their canonical counterparts in
amino acid structure. For example, histone variant H3.3 varies from canonical
forms H3.1 and H3.2 by five and four amino acids, respectively (Franklin et al.
1977). H3.3 functions in transcriptionally active regions and silenced regions,
depending on the cellular process in which it is incorporated (Szenker et al. 2011).
H2A variant H2A.X is equipped with a conserved carboxy-terminal serine residue
that becomes phosphorylated in the presence of DNA double strand breaks
(DSBs) (Redon et al. 2002) and a variant H2A.Z has a carboxy-terminal acidic
16
patch which confers an open chromatin state when incorporated into nucleosomes
of active or silenced genomic regions (Redon et al. 2002, Guillemette et al 2005,
Jensen et al. 2011).
Epigenetic Reprogramming in Spermatogenesis:
Spermatogenesis is the process in which male germ cells develop. Fisrt, a
series of mitotic divisions of type-A spermatogonia into type-B spermatogonia
occurs. Type-B spermatogonia then mitotically divide into preleptotene
spermatocytes which enter into prophase I of meiosis. Meiosis I is a long phase in
spermatogenesis that occurs over a duration of 14 days in mice (Kofman-Alfaro et
al. 1970), and yields two diploid secondary spermatocytes per each primary
spermatocyte. Prophase I is of particular interest because of the changes that
occur in chromatin such as, DNA double strand breaks, homologous chromosome
paring, synapsis, DNA repair, and recombination, as well as meiotic silencing that
occurs during the pachytene stage (Turner et al. 2007). Next, meiosis II occurs,
where secondary spermatocytes divide into haploid spermatids, a yield of four
spermatids per one type-B spermatogonia. Spermatids then develop and elongate,
and are released into the lumen of the seminiferous tubule as mature spermatozoa
(Cheng 2008).
From the primordial germ cell (PGC) stage to mature spermatozoa, there
are multiple levels of epigenetic reprogramming. Briefly, this process begins in
embryonic development when PGC precursors in the developing gut become fate
determined and begin to migrate towards the genital ridge at embryonic day 7.5
(E7.5) in mice (Clark et al. 1975). After migration and an extensive epigenetic
17
reprogramming, PGCs are considered germ cells at about E12.5, but mitotically
arrest and do not initiate meiosis until puberty (Western et al. 2008). Additional
epigenetic reprogramming events occur during meiosis and post-meiotically in
spermatogenesis. This reprogramming is necessary to set paternal specific
methylation patterns as well as maintain genomic stability in the condensed sperm
nucleus (Davis et al. 2000, Jenkins et al. 2012).
The first wave of epigenetic reprogramming in mammalian
spermatogenesis occurs in PGCs. A complex web of genome wide DNA
demethylation, changes in histone modifications, and canonical histone turnover
with histone variants occurs in these cells. This process is necessary to reset germ
cells into a pluripotent-like state (Hajkova et al. 2002). Demethylation is initiated
in migrating PGCs at E7.5 and only 30% of initial PGC methylation remains by
E9.5 (Seisenberger et al. 2012). This process of loss of methylation is coupled
with the loss of the repressive histone mark of dimethylated lysine 9 of histone H3
(H3K9me2), increase of the repressive mark H3K27me3, and increase of active
H3K4me2/3 and H3 acetylated at lysine 9 (H3K9ac) (Hajkova et al. 2008). By
E12.5 methylation erasure is complete and global hypomethylation is at the
lowest level achieved in germ cells (Borgel et al. 2010). Imprinted or
differentially methylated regions (DMRs) lose all or most of their methylation at
this stage of embryonic development (Borgel et al. 2010). Demethylation at this
point is associated with the loss of linker histone H1 and repressive
heterochromatin marks H3K27me3 and H3K9me3. This may contribute to
demethylation by loosening the chromatin state in PGCs and making the genome
18
more permissive to demethylation (Hajkova et al. 2008). Histone variant H2A.Z,
which may function to insulate DNA from methylation, also enriches PGCs by
E10.5 and is lost by E12.5 when demethylation is complete (Hajkova et al. 2008).
The next stage of premeiotic epigenetic reprogramming in
spermatogenesis occurs from E14.5 as methylation marks are reestablished and
nearly completed by birth in prospermatogonia (Davis et al. 2000, Kato et al.
2007). Spermatogonia, which begin appearing by postnatal day 6, are mitotically
dividing cells that do not enter meiosis until puberty where they are considered
preleptotene spermatocytes. One key characteristic of spermatogonia is a
hyperacetylation of core histones H2A, H2B, and H4 (Hazzouri et al. 2000). H3 is
modified by methylation at lysine 4 (H3K4) in mono-, di-, or tri-methylation
forms (Godmann et al. 2007).
After puberty, mitotically dividing type B spermatogonia produce
preleptotene spermatocytes which enter meiosis. Meiosis is a process with many
rapidly occurring stages, which require many epigenetic events to occur. The
shifting of a diploid cell into a haploid spermatid requires massive and
coordinated epigenetic reprogramming in terms of chromatin organization. Much
of this reprogramming involves the deposition of histone H2A and H3 variants
(Reviewed by Kimmins et al. 2005). In short, H3 is largely replaced by variant
H3.3 by prophase I and is usually associated with an active chromatin state in
somatic cells, and was initially thought to be indicative of the transcription
program of spermatocytes (Bramblage et al. 1997, Sassone-Corsi 2002).
Interestingly though, H3.3 enriches transcriptionally silent regions of the genome
19
during meiotic prophase I (Santenard, 2009, Szenker et al., 2011). H2A variant
H2A.X is also deposited throughout the spermatocyte genome and is
phosphorylated (γH2A.X) in the presence of DNA double strand breaks and
results in a transcriptionally silent state (Mahadevaiah et al. 2001, Redon et al.
2002, Santenard et al. 2009) One hallmark of male meiosis is the formation of the
sex body, or a specialized chromatin compartment where the unsynapsed,
transcriptionally silenced X and Y chromosomes reside (Solari 1974, McKee et
al. 1993).
Finally, postmeiotic reprogramming occurs in elongating spermatids as
their haploid genome is packaged into the nucleus of mature spermatozoa. As
round spermatids elongate and condense, a second spermatogenesis-associated,
genome wide enrichment of γH2A.X occurs in response to DNA damage
(reviewed by Caron et al. 2005). DNA breakage occurs to facilitate the process of
removal of supercoiled nucleosomes with protamines in order to package the
nucleus in the highly condensed spermatozoa (Leduc et al. 2008). Transition
proteins replace most of the histone content of chromatin at this stage and
protamines then replace transition proteins (Kimmins et al. 2005). The tight
condensation of the spermatozoa nucleus helps to facilitate motility and protect
against DNA damage (Jenkins et al. 2012).
Interestingly, 5-15% of histones are retained in human sperm (Wykes et
al. 2003) and about 1% in mouse sperm (Brykczynska et al. 2010). These retained
histones in sperm have been shown to poise genes for activation or repression
when incorporated into the genome of the early embryo (Hammoud et al. 2009,
20
Orsi et al. 2009, Santenard et al. 2010) Indeed, sperm of infertile men show
alterations in the retention of H3K4me2/3 and H3K27me3 at imprinted genes
(Hammoud et al. 2011). Additionally, genes essential to embryonic development
are enriched in H3K27me3 in mature sperm (Bernstein et al. 2006).
Histone Variants:
The various levels of epigenetic regulation of DNA transcription is the
central theme of epigenetic reprogramming. The emphasis in this review is the
contribution of histones in this process. Nucleosome assembly with canonical
core histones, H2A, H2B, H3, and H4 is restricted to S-phase, or while DNA is
replicating (Mello et al. 2001). As cells differentiate, histones may become
modified, changing chromatin structure and DNA binding at specific loci. These
modifications occur at N-terminal histone tail domains, where histones may
become methylated, acetylated, or phosphorylated (Jenuwein et al. 2001).
Regulation in the context of histone modification requires the recruitment of
specific histone modifying enzymes (Marmorstein 2001).
While histone post translational modifications serve many diverse
functions, incorporation of histone variants is another method in a cell’s arsenal
for nucleosome modulation and transcriptional regulation. Variant histones slowly
accumulate in nucleosomes by replacing canonical forms as a cell differentiates
(Pina et al. 1987). Other than regulation of transcription, histone variants are also
incorporated in a host of other DNA replication independent processes including
DNA repair, meiotic recombination, chromosome segregation, meiotic sex
21
chromosome inactivation, and sperm chromatin condensation where modifying
enzymes may not be available (Ahmad et al. 2002, Talbert et al. 2010).
Histone H2A has 4 main conserved variants, H2A.X, H2A.Z, H2A.Bbd,
and marcroH2A, which all vary from canonical H2A structure at the carboxyterminal amino acid sequence level (Redon et al. 2002). H2A.X and H2A.Z have
been extensively studied; H2A.X for its role at sites of DNA double strand breaks
(DSBs) and H2A.Z for its role in active chromatin. macroH2A marks areas of
transcriptional repression, mainly the inactive X chromosome in mammalian
females (Costanzi et al. 1998) and the function of H2A.Bbd remains unclear
(Doyen et al. 2006). For the purpose of this review, H2A.X will be the focus of
H2A variants as it plays a major role in the silencing of regions with DSBs during
spermatogenesis.
H2A.X harbors a serine residue 4 amino acids from the carboxy-terminus,
at position 139 in mammals, and makes up between 2-10% of H2A histones
(Rogakou et al. 1998). This serine (S) is always followed by a glutamine (Q) and
makes up what is known as the conserved H2A.X SQ motif (Mannironi et al.
1989). Upon induction of DNA DSBs, the SQ motif becomes rapidly
phosphorylated, yielding γH2A.X (Rogakou et al. 1998). The H2A.X form is
found most often in testes tissue. Furthermore, about 20% of the H2A.X found in
testes is found in its phosphorylated γH2A.X form, demonstrating the extent to
which DSBs are present during spermatogenesis (Mahadevaiah et al. 2001). DSB
induction during meiosis is a programmed cellular process as homologous
chromosomes pair and synapse. Outside of this process, DSBs formed upon
22
ionizing radiation exposure in vitro, also causes H2A.X phosphorylation
(Rogakou et al. 1998, Rogakou et al. 1999).
Phosphorylation of H2A.X serves to recruit DNA repair proteins to sites
of DNA damage (Paull et al. 2000). This phosphorylation occurs after an initial
localization of breast cancer 1 protein (BRCA1) to the DSB. BRCA1 localization
recruits a class of protein kinase, the PI-3 family protein kinases to the site of the
damage. These proteins include DNA-dependent protein kinase (DNA-PK),
kinase ataxia–telangiectasia mutated (ATM), and kinase ataxia-telangiectasia and
Rad3-related protein (ATR), which all function to phosphorylate H2A.X (Paull et
al. 2000). However, within spermatocytes, ATR is the major factor acting to
phosphorylate H2A.X after DSB formation (Turner et al. 2004). After its
phosphorylation, γH2A.X binds to the Mre11, Rad50 and Nbs1 (MRN) complex
to facilitate non-homologous end joining repair (Bassing et al. 2004), as well as,
associates with Rad51, facilitating homologous recombination repair (Paull et al.
2000).
The incorporation of H2A.X into nucleosomes is not well understood.
However, in vitro experiments have been conducted which help explain canonical
H2A exchange for H2A.X in mammalian cells. A protein complex factor made up
of the proteins Spt16 and structure specific recognition protein 1 (SSRP1) known
as: facilitates chromatin transcription (FACT), associates with H2A.X. FACT
facilitates histone exchange of H2A and H2A.X in nucleosomes. This complex
can both exchange H2A for H2A.X and the reciprocal exchange. Interestingly, in
the presence of phosphorylation of H2A.X in nucleosomes, FACT more
23
efficiently exchanges the variant histone for H2A (Heo et al. 2008). This finding
is significant because γH2A.X is shed from nucleosomes after repair of DSBs and
FACT mediated exchange gleans insight to a potential mechanism for this
shedding. It is unclear, however, if γH2A.X is dephosphorylated before exchange,
or if dephosphorylation occurs after exchange when H2A.X is not incorporated in
the nucleosome (Svetlova et al. 2010).
Histone variant H3.3, another highly conserved variant, plays less of a
clear role than H2A variants. H3.3 varies at five amino acid positions from its
canonical form in mammals (Franklin et al. 1977). H3.3 is incorporated into
nucleosomes in a replication independent pathway by the histone regulator A
(HIRA) complex or the death domain-associated protein alphathalassemia/mental retardation X-linked syndrome protein (DAXX-ATRX)
complex (Ahmad et al. 2002, Tagami et al. 2004, Drane et al. 2010). This type of
incorporation opens H3.3 to various functions within the cell. For example, H3.3
marks areas of actively transcribed genes and is localized at the induction of
transcription (Ahmad et al. 2002, Schwartz et al. 2005). H3.3 is also deposited
genome-wide during epigenetic reprogramming in the early embryo. This
deposition is occurs as the male pronucleus decondenses and maternal histones
replace protamines, before replication occurs (Orsi et al. 2009). Also, H3.3 is
deposited into sex chromatin during male meiosis. Together with inactive post
translational modifications, H3.3 contributes to meiotic sex chromosome
inactivation (MSCI) (van der Heijden et al. 2007).
24
H3.3 deposition in nucleosomes is restricted to distinct assembly processes
from canonical H3. These include HIRA and DAXX-ATRX complex mediated
deposition, whereas canonical H3 nucleosome assembly relies on the chromatin
assembly factor 1(CAF-1) complex. This difference in assembly pathways is
explained by the slight change in amino acid sequence between the two histones.
DAXX-ATRX, for example, has been shown to specifically bind an alpha-helix
unique to H3.3, indicating that its amino acid signature is essential to this specific
mode of incorporation into chromatin (Lewis et al. 2010). It is unclear, however,
if these amino acid positions are, alone, important for changes in chromatin
compaction and organization (Szenker et al. 2011).
Attaching green fluorescent protein (GFP) to histones has been critical in
elucidating the roles of different histones in vivo. For example, H3.3 replication
independent nucleosome assembly was revealed through this method. When cells
were exposed to the DNA replication inhibitor aphidicolin, H3-GFP assembly
was completely blocked whereas H3.3-GFP nucleosome assembly was able to
continue. This, both confirms the dependence of canonical H3 on DNA
replication for incorporation in nucleosomes, and the ability for H3.3 to be
incorporated outside of this process (Ahmad et al. 2001, Ahmad et al. 2002).
H3.3-GFP also colocalized with active rDNA fluorescence in situ hybridization
and areas of euchromatin, showing its role in active transcription (Ahmad et al.
2002).
The opposite function of H3.3 is apparent in mammalian spermatogenesis.
As MSCI occurs in prophase of meiosis I, H3.3 enriches the X and Y
25
chromosomes, where it remains throughout spermatogenesis. Further, canonical
forms H3.1 and H3.2, which are assembled into sex chromosome nucleosomes
during pre-meiotic S-phase are actively evicted in prophase I. This shows a role of
H3.3 in a transcriptionally silenced compartment as well as a role in nucleosome
remodeling and epigenetic reprogramming in spermatogenesis (van der Heijden et
al. 2007).
Though these functional roles of H3.3 have been uncovered, there is still
much to learn about this variant. The function in repressive chromatin has only
very recently been established, and it is still not fully understood how H3.3
functions in other unsynapsed regions in prophase of meiosis. It is also not fully
understood if the amino acid sequence differences in H3.3 relative to H3 cause
alterations in chromatin compaction when the variant is incorporated, without the
influence of post translational modifications.
The purpose of this section is to give necessary background and
definitions for the complex processes that will be discussed hereafter. Although
the timing and function of all epigenetic reprogramming and nucleosome
remodeling is not fully understood, these phenomena are occurring throughout
meiosis. Fortunately, in spermatogenesis, the formation of the sex body gives us a
model to study unsynapsed chromosomes and to the response with autosomal
asynapsis. MSCI is a highly studied process, but the same is not true for
autosomal asynapsis in meiosis and consequent MSUC.
26
Meiotic Sex Chromosome Inactivation
Meiotic silencing of unsynapsed chromatin (MSUC) is a transcriptional
silencing that occurs when homologous chromosome pairs fail to synapse during
prophase (Turner et al. 2004, Schimenti et al. 2005). A specific and well-studied
instance of MSUC is meiotic sex chromosome inactivation (MSCI), where the X
and Y chromosomes are silenced in the meiotic stages of spermatogenesis (Turner
2007). MSCI is attained by a large scale chromatin remodeling of the sex
chromosomes after the early stages of prophase, as all homologs pair and synapse.
The X and Y chromosomes only partially synapse, since they share limited
homology at a region termed the pseudo-autosomal region (PAR) (Burgoyne et al.
1982). The remaining majority of the X and Y chromosomes do not synapse
during meiosis and are subject to MSCI during the subsequent meiotic divisions
(Turner 2007).
MSCI is the result of the formation of a specialized chromatin state around
the sex chromosomes known as the sex body (Solari 1974, McKee et al. 1993),
which includes phosphorylated histone H2AX (γH2A.X), histone variant H3.3
and other epigenetic marks associated with the inactivate chromatin, such as
dimethylation of histone H3 (H3K9me2) (Khalil et al. 2004, Turner et al. 2004,
Schimenti 2005, Szenker et al., 2011). The large scale chromatin remodeling that
causes the sex body formation is initiated by the DNA double strand break (DSB)
repair pathway. Since DSB repair is coupled with synapsis in the pachytene stage,
much of their repair is mediated by a homologous recombination pathway (van
den Bosch et al. 2002). In the case of the sex body, however, this repair pathway
27
is initiated, but the nonhomologous regions of the X and Y do not synapse and
retain DSBs, resulting in a cascade of molecular events that lead to MSCI.
The first protein to localize to the unsynapsed regions of the X and Y
chromosomes is breast cancer 1 (BRCA1) DNA repair protein, which enriches
areas of DNA DSBs. Kinase ataxia telangiectasia and Rad3-related protein
(ATR) is then recruited by the presence of BRCA1 and phosphorylates histone
H2A.X (γH2A.X) which silences the unsynapsed chromatin (Mahadevaiah et al.
2001, Turner et al. 2004, Burgoyne et al. 2009). Both BRCA1 and H2A.X are
essential for sex body formation and MSCI (Fernandez-Capetillo et al. 2003,
Turner et al. 2004).
Post translational modifications occur in sex body chromatin after its
formation. Ubiquitination of histone H2A occurs as it is associated with silent
chromatin state as well as loss of acetylation of H3 and H4 and demethylation of
H3 (H3K9me2) (Baarends et al. 1999, Khalil et al 2004). Histone variant H3.3
also associates with the sex body after its formation in the mid-pachytene stage, as
well as, other silent regions in spermatocytes such as, centromeric and telomeric
regions (van der Heijden et al. 2007, Szenker et al., 2011). RNA polymerase II is
not localized to the nucleus of spermatocytes until the mid-pachytene stage, but
does not associate with the sex body, further demonstrating its silenced state
(Page et al. 2012).
To determine if sex body formation and MSCI are simply due to the fact
that the X and Y are mostly unsynapsed, or if their silencing is due to another
unique property of the sex chromosomes, several studies were conducted. First, a
28
mouse strain with a mutant form of Brca1, lacking exon 11, was developed,
where response to DNA DSBs is severely impaired (Xu et al. 2003, Turner et al.
2004). Spermatogenesis in these mice ultimately failed in the pachytene stage as a
result of defective MSCI. Instead of H2A.X phosphorylation occurring at the
unsynapsed X and Y chromosomes during the pachytene stage, γH2A.X was
distributed throughout the genome. This aberrant γH2A.X localization was due to
lack of ATR recruitment to sites of DSBs. This finding shows that the sex body
specific wave of H2A.X phosphorylation that occurs at the pachytene stage is due
to the DNA DSB response pathway initiated by BRCA1 localization to sites of
DSBs. Without functioning BRCA1, γH2A.X localization to the sex body does
not occur (Turner et al. 2004).
To determine if providing a synaptic partner for sex chromosomes would
result in disruption of MSCI, Turner and colleagues conducted experiments with
male mice that harbor an extra Y chromosome (XYY). Immunofluorescence of
pachytene spermatocyte nuclear spreads revealed synapsed Y chromosome
bivalents which lacked markers of MSCI (Turner et al. 2006). Further, the fully
synapsed Y bivalents expressed Uty gene, a Y chromosome gene which is
expressed early in spermatogenesis, but normally silenced by MSCI. Pachytene
stage expression was shown with Uty RNA fluorescence in situ hybridization
(FISH) followed up by Uty DNA FISH (Turner et al. 2006). This finding proved
that the Y chromosome itself is not silenced due to a specific property of sex
chromosomes during spermatogenesis other than the fact that sex chromosomes
are mostly unsynapsed and thus, retain many DNA DSBs. These findings,
29
collectively, show that MSCI is a manifestation of MSUC that occurs specifically
at the sex body because of retained DSBs.
Robertsonian Translocations
Introduction to Translocations:
One of the most common chromosomal abnormalities in the human
population are chromosomal translocations (Lub et al., 1970, Nielsen et al., 1991),
which are rearrangements that involve the breakage and fusion of two
chromosomes. These fusions can occur between homologous or non-homologous
chromosomes. Robertsonian (Rb) translocations are translocations where the
breakpoint for fusion of two different chromosomes is at the centromere. The
result is the joining of the large “q” arms of two acrocentric chromosomes to form
one metacentric chromosome and the loss of each chromosome’s “p” arm. Rb
translocations are referred to as constitutional rearrangements as they are heritable
from a carrier parent’s gametes to their offspring (Shaffer et al. 2000).
In the human population, Rb translocations occur at a frequency of about
0.12% to 0.20% in newborns (Nielsen et al.1991, Ogilvie et al. 2002). Among
subfertile and infertile individuals, however, estimates increase this frequency to
as high as 4% (Frydman et al. 2001). Robertsonian translocations can occur
between all acrocentric chromosomes, but Rb (13,14) and Rb (14,21) are the most
common, making up 85% of these translocations observed in the human
population (Shaffer et al. 2000). When these individuals reproduce, aneuploidies
may occur in some cases, as a result of meiotic segregation errors (Koveleva,
30
2005) that can result in infertility, embryonic death, and disorders such as, Down
syndrome (trisomy 21) (reviewed in Egozcue et al. 2000). For these reasons,
translocations have been an important topic of research in developmental biology.
In fact, Robertsonian translocations have been utilized in mouse studies as
a model for developing aneuploidies in gametes (reviewed in Gearhart et al.
1986). This model causes meiotic segregation errors through generation of doubly
heterozygous individuals. In short, an individual homozygous for a certain
translocation is crossed with a mouse homozygous for another translocation
containing one common chromosome between the two different translocations.
The result is offspring with gametes that are heterozygous for two translocations
with one chromosome in common. Both copies of the common chromosome are
fused to different chromosomes, which may cause meiotic segregation errors
during gametogenesis (reviewed by Gearhart et al. 1986). Aneuploidies in these
gametes are very common and have been used to develop aneuploidy models for
all mouse chromosomes. In mice, all monosomies fail to implant and die by
embryonic day 4.5 (E4.5), and mouse embryos with trisomy of any chromosome
are nonviable (reviewed by Gearhart et al. 1986).
Other than aneuploidy models, Robertsonian translocations have been
used to assess if meiotic silencing and meiotic arrest are occurring in gametes of
mice heterozygous for many (8) translocations (Manterola et al. 2009). Even if
gametes from these mice had normal chromosomal complements, when the
translocated chromosomes pair with their wild type homologs in prophase I,
synapsis errors may occur. The resulting structure is a translocation trivalent
31
where wild type chromosomes synapse fully or partially with their translocated
homologs. When these trivalents are unsynapsed they may recruit markers of
meiotic silencing which may cause silencing of unsynapsed autosomal genes
(Turner et al. 2005, Manterola et al. 2009, Burgoyne et al. 2009). Thus,
translocations in heterozygosis have become a model for developing autosomal
asynapsis in the gametes of carrier mice. Indeed, infertility of heterozygous
carriers of Robertsonian translocations is also associated with meiotic arrest and
failure of gametogenesis (Mahadevaiah et al., 1990, de Boer et al., 1986,
Manterola et al. 2009).
Meiotic Silencing of Unsynapsed Chromatin
Meiotic silencing of unsynapsed chromatin (MSUC) is a transcriptional
silencing that occurs when homologous chromosome pairs fail to synapse during
prophase (Turner et al. 2004, Schimenti et al. 2005). As with MSCI, MSUC is
initiated at the pachytene stage and transcriptionally silences regions of asynapsis
though the same epigenetic mechanisms (Turner et al. 2007). Studies have been
conducted to address the question if a response similar to MSCI would occur at
sites of autosomal asynapsis. To achieve this, two different translocation mouse
models were utilized. In one study by Turner and colleagues, mice carrying a
translocation of chromosomes X and 16 display frequent chromosome 16 synaptic
errors in prophase. The unsynapsed regions of chromosome 16 were positive for
BRCA1, ATR, and γH2A.X localization in immunofluorescence experiments.
RNA FISH for autosomal genes along the unsynapsed region of chromosome 16
was also conducted and revealed that unsynapsed autosomal regions which were
32
positive for MSCI markers were also transcriptionally repressed (Turner et al.
2005). This finding was confirmed using a fully autosomal translocation of
chromosomes 1 and 13. This study observed autosomal asynapsis in carriers of
the translocation during prophase which were positive for uH2A, another marker
of meiotic silencing (Baarends et al. 2005). Together, these studies confirm that
autosomal asynapsis in the pachytene stage causes transcriptional silencing with a
similar mechanism to MSCI.
Meiotic silencing of unsynapsed chromatin (MSUC) the term coined by
Schimenti 2005, occurs at the pachytene stage of meiotic prophase I and
transcriptionally silences any unsynapsed chromosomal regions. First observed in
autosomal asynapsis by (Turner et al. 2005, Baarends et al. 2005). These studies
describe a similar epigenetic response to autosomal asynapsis as observed in the
sex body and MSCI.
Post Meiotic Sex Chromatin Repression:
Throughout meiosis II and after the meiotic phase of spermatogenesis, the
sex chromosomes are maintained in a transcriptionally repressed compartment
known as post meiotic sex chromatin (PMSC) (Namekawa et al. 2006). Analysis
of meiosis II spermatocytes and haploid spermatids with Cot-1 RNA FISH, a
marker of new transcription, along with chromosome X and Y DNA FISH in
round spermatids reveal the X and Y in a transcriptionally silent compartment.
Additionally, heterochromatin protein 1 β (HP1β), a mark of silent chromatin,
localized to the sex body after the pachytene stage and remained localized to sex
chromosomes until protamine replacement in elongating spermatids (Namekawa
33
et al. 2006). This finding is consistent with the retention of heterochromatic
marks, such as H3K9me2, in spermatids at sex chromosomes (Khalil et al. 2004).
Ubiquitinated H2A and histone variant H3.3 remain in sex chromatin in post
meiotic stages, contributing to their repression (Baarends et al. 2004, Szenker et
al. 2011). Although some X linked genes are reactivated despite their
heterochromatic state in round spermatids, microarray analysis shows that 87% of
X linked genes are repressed in spermatids (Namekawa et al. 2006).
This finding of repressed PMSC, together with the finding that
unsynapsed autosomes behave similarly to the sex body during meiosis, prompted
the question: what happens to silenced regions of unsynapsed autosomes in post
meiotic stages? To address this question Turner et al. investigated spermatogenic
cells where a segment of chromosome 7 was inserted into an X chromosome. This
autosomal segment was always unsynapsed and silenced in the pachytene stage,
as determined by synaptonemal complex (SC) immunofluorescence and RNA
FISH for two chromosome 7 genes within the segment that are normally
expressed in spermatids, Blm and Zfp29. Both genes showed significant
expression repression from the segment that was unsynapsed in the pachytene
stage. RNA FISH analysis revealed that Blm and Zfp29 were silenced in 98% and
71% of nuclei, respectively from the inserted segment (Turner et al. 2006). This
finding demonstrations that autosomal segments that are unsynapsed in the
pachytene stage also undergo post meiotic transcriptional repression.
Retained autosomal silencing of unsynapsed regions in the pachytene
stage offers insight to the potential for transmission of silenced state to the next
34
generation. Indeed if H3.3 is retained in post meiotic transcriptional repression
and has been implicated in histone retention in mature sperm (van der Heijden et
al. 2007, Ooi et al. 2007, Orsi et al. 2009, Szenker et al. 2011). H3.3 retention in
mature sperm functions to recruit a heterochromatic state in early embryogenesis,
with the incorporation of H3K27me3 at sites of its retention (Santenard et al.
2010). These findings give insight on the possibility of autosomal asynapsis in
spermatogenesis causing transmitted gene repression effects in offspring in a
chromatin context.
Given this background, we set out to refine the understanding of
autosomal MSUC in spermatogenesis in a mouse model which is heterozygous
for Robertsonian translocations. We plan to do this through defining the dynamics
of specific markers of MSUC during meiosis through immunofluorescence
experiments with antibodies for γH2A.X and H3.3 on spermatocyte chromatin
spreads. Next, ChIP with these markers will give a gene context to the dynamics
of their enrichment. Finally gene expression analysis of embryos sired from
translocation carriers will determine if effects of MSUC in spermatogenesis are
passed on to the next generation in translocation carriers.
35
Chapter 2: Dynamics of Response to Asynapsis and Meiotic
Silencing in Spermatocytes from Robertsonian Translocation
Carriers
Abstract:
Failure of homologous synapsis during meiotic prophase triggers
transcriptional repression, while asynapsis of autosomes resulting from autosomal
translocations shows high variation in outcomes ranging from meiotic arrest to
normal spermatogenesis. Such a variation may result from a less robust response
to autosomal asynapsis; variable proportion of spermatocytes with meiotic
silencing of unsynapsed autosomal regions; and/or the difference in functions of
affected autosomal genes. To establish the dynamics of autosomal asynapsis and
the proportion of spermatocytes with meiotic silencing of unsynapsed autosomes,
we examined the localization of several markers of unsynapsed chromatin in the
spermatocytes of Robertsonian translocation carrier mice. The localization of
γH2A.X and H3.3S31 at unsynapsed autosomes is different from that observed in
the X,Y body. Histone variant H3.3S31, a mark of unsynapsed chromatin, was
enriched at autosomal regions in 12% of metaphase I/anaphase I spermatocytes of
single Robertsonian translocation carriers, and 31% of spermatocytes from
carriers of 3 translocations compared to the 100% of nuclei with H3.3S31
enrichment at sex chromosomes. Our data suggests that stable meiotic silencing
of unsynapsed autosomal regions occurs in a small proportion of spermatocytes of
Robertsonian translocation carriers. We therefore conclude that meiotic silencing
of the X and Y in spermatocytes may have evolved to ensure stability of
36
silencing, whereas autosomal asynapsis is an error-prone process with a less
predictable outcome.
Introduction:
One of the most common chromosomal abnormalities in the human
population are balanced chromosomal translocations (Lub et al., 1970, Nielsen et
al., 1991), which are rearrangements that involve the breakage and fusion of
nonhomologous chromosomes. Robertsonian translocations are translocations
where the breakpoint for fusion of two different chromosomes is at the
centromere. The result is the joining of the large “q” arms of two acrocentric
chromosomes to form one metacentric chromosome and the loss of each
chromosome’s “p” arm. In the human population, Robertsonian translocations
occur at a frequency of about 0.12% to 0.20% in newborns (Nielsen et al.1991,
Ogilvie et al. 2002). Among subfertile and infertile individuals, however, it is
estimated that this frequency is increased to 4% (Frydman et al. 2001). When
these individuals reproduce, aneuploidies may occur in some cases, as a result of
meiotic segregation errors (Kovaleva 2005) that can result in embryonic death and
disorders such as, Down syndrome. Infertility of heterozygous carriers of
Robertsonian translocations is also associated with meiotic arrest and failure of
gametogenesis (Mahadevaiah et al. 1990, de Boer et al. 1986). In heterozygosis,
Robertsonian translocations form trivalent structures in meiosis consisting of the
two acrocentric chromosomes and the translocated chromosome. The acrocentric
chromosomes may incompletely synapse at nonhomologous regions of the
trivalents in gametogenesis which results in silencing of these unsynapsed regions
37
(Turner et al. 2005, Schimenti et al. 2005, Burgoyne et al. 2009, Manterola et al.
2009).
During meiotic prophase I, homologous chromosomes pair, synapse and
recombine. In mice, a heterozygous carrier of a balanced Robertsonian
translocation of chromosomes 8 and 12, for example, has a normal complement of
chromosomes except that one set of chromosomes 8 and 12 are fused together.
Since a Robertsonian translocation results in the loss of each chromosome’s “p”
arm, the synapsis between this translocated chromosome and its acrocentric
homologs is incomplete. This incomplete synapsis occurs at the centromeric
region of the translocation trivalent (Fig. 2.1). This results in the potential for
autosomal asynapsis in prophase, and its consequent meiotic silencing (Manterola
et al., 2009). It has been hypothesized that the severity in the outcome of this
transcriptional silencing depends upon the genes involved in a particular
translocation (Turner et al., 2005, Burgoyne et al., 2009). For example, if genes
essential to spermatogenesis are silenced, spermatogenic arrest should occur.
Transcriptional silencing in meiosis due to asynapsis is termed meiotic
silencing of unsynapsed chromatin (MSUC) (Schimenti et al. 2005). It is a normal
process that occurs in male meiosis as a result of the inability of X and Y
chromosomes to fully synapse (Solari, 1974, Handel, 2004). The X and Y form a
silenced compartment, the sex body, and include phosphorylated histone H2A.X
(γH2A.X), histone variant H3.3, ubiquitinated H2A (uH2A), breast cancer 1
protein (BRCA1),DNA dependent protein kinase ataxia–telangiectasia mutated
(ATM), and kinase ataxia-telangiectasia and Rad3-related protein (ATR)
38
(Fernandez-Capetillo et al. 2003, Turner et al. 2004, 2005, Baarends et al. 2005,
Szenker et al., 2011). It is hypothesized that balanced Robertsonian
translocations, which contain unsynapsed trivalents in a proportion of
spermatocytes, undergo the same process and associate with same epigenetic
marks of transcriptional silencing (Turner et al. 2005, Baarends et al. 2005,
Manterola et al. 2009), however little is known about asynapsis in Robertsonian
translocations relative to that of the sex body.
For our study, we focus on γH2A.X and H3.3 localization as they are
distinct histone marks associated with MSUC, and in theory, could both localize
to the same nucleosome. γH2A.X is a specific marker for DNA DSBs and gives
rise to the resultant chromatin conformational change that silences areas of
asynapsis in meiosis (Fernandez-Capetillo et al. 2003). H3.3 also shows specific
localization to the sex body after initiation of MSUC and remains localized to the
silenced sex chromosomes after meiosis and for the remainder of
spermatogenesis. For these reasons, these two markers are the best candidates for
our analysis of MSUC at unsynapsed autosomal regions.
Since most of what is known of MSUC has been learned through studies
of asynapsis of the X and Y chromosomes in mammalian males, we sought to
determine if asynapsis in Robertsonian translocation trivalents causes the same
epigenetic response. It is unclear whether the same markers of MSCI are recruited
in autosomal asynapsis and whether the dynamics of the recruitment are the same.
Our data will indicate if the recruitment, timing, dynamics and stability of several
markers differ in autosomal asynapsis compared with the X and Y chromosomes.
39
Scientific Questions:
1. Do markers of MSUC localize to unsynapsed translocation trivalents in
spermatocytes from Robertsonian translocation carriers?
2. In what stage(s) of meiotic prophase I does localization of markers
associated with MSUC take place?
3. What proportion of translocation carrier spermatocytes have localization
of MSUC markers to unsynapsed autosomal regions as compared to the
sex body?
Hypothesis:
Stable association between epigenetic marks of MSUC and unsynapsed
trivalents occurs in a proportion of spermatocytes and results in a variation of
outcomes in spermatogenesis.
Objectives:
A. Establish if markers of asynapsis associate with unsynapsed autosomal
regions.
B. Establish the dynamics of asynapsis markers across different stages of
primary spermatocytes.
C. Determine the proportion of spermatocyte nuclei with asynapsis and
localization of γH2A.X and H3.3.
Materials and Methods:
Mice and crosses:
40
Mouse strains CBy.RBF-Rb(8.12)5Bnr/J (carries a single Rb(8.12)
translocation on a BALB/cBy genetic background); and RBF/Dnj (carries three
translocations: Rb(1.3), Rb(8.12), and Rb(9.14)) were purchased from the Jackson
Laboratory. The congenic strain B6.SPRET7MOLF12 was generated and
maintained in our laboratory (Croteau, 2001, 2005). Crosses between different
strains are being conducted to generate heterozygous males for analysis of
synapsis and localization of markers of meiotic silencing.
Germ cell nuclei for immunofluorescence experiments were prepared from
testes of 2 to 4 months old male mice as described by Peters and colleagues
(Peters et al. 1997). For the H3.3S31 immunostaining and FISH experiments,
spermatogenic cells were squeezed out of seminiferous tubules into MEM
according to Moens and spun down onto histology slides after hypotonic
treatment in 0.5% NaCl for 5-10 min (Dobson et al. 1994). These slides were
prepared by our collaborator Dr. Taketo.
Staging of spermatocytes was done based on the configuration of the XY
bivalent and DAPI staining as earlier described by Saferali et al. (Saferali et al.
2010) (Fig. 2.2). Briefly, in early pachytene nuclei, the configuration of the sex
chromosomal axes is fluid; synapsis may vary from minimal to maximal; DAPI
staining is diffuse and the XY bivalent is often in the middle of the nucleus. In
mid pachytene nuclei, the synapsed regions of the XY bivalents become shorter
while the unsynapsed axes become more stiff and curved; DAPI staining is more
intense around centromeres. In late pachytene nuclei, the X chromosome axis
shows coils; the sex body is often on the periphery of the nucleus, and areas of
41
intense DAPI staining around centromeric regions are more localized.
Furthermore, in late pachytene spermatocytes, DAPI staining highlights the sex
body as a separate structure with a more intense spot within the domain
corresponding to the X (but not Y) centromere. By the end of late pachytene the X
and Y may not be synapsed anymore. In early diplotene, DAPI shows further
condensation around centromeres, and dissociation of some, but not all autosomal
bivalents.
Immunolocalization of proteins was conducted using the following
antibodies: mouse anti-γH2A.X (1:1000) (Millipore); rabbit anti-SYCP3 (1:400)
(Abcam, ab 15093); rabbit anti-histone H3.3S31 (1:200) (Abcam, ab 92628); and
secondary donkey anti-mouse and anti-rabbit AlexaFluor antibodies (1:500)
(Invitrogen, Carlsbad, CA, USA).
Results:
Double immunostaining with antibodies for γH2A.X and SYCP3 or H3.3
was conducted to determine when MSUC occurs and what proportion of
spermatocytes carry stable silencing at translocations. Staging was done with
anti-SYCP3 and DAPI staining to visualize configuration of prophase
chromosomes and sex body conformation (Fig. 2.2).
We expect that any unsynapsed trivalent will have similar γH2A.X
staining to the sex body and remain enriched through prophase I as long as the
translocation is unsynapsed. The sex body will have γH2A.X enrichment
42
throughout the post-zygotene stages of prophase I until diakinesis (Turner et al.,
2005). H3.3 should enrich the sex body by the mid-pachytene stage and remain in
the silenced X and Y throughout spermatogenesis (Szenker et al. 2011). We
expect that any stably unsynapsed trivalent will also have H3.3 enrichment
throughout spermatogenesis. Since the H3.3 antibody we used had yet to be tested
in spermatocytes for immunofluorescence, we had to verify that enrichment we
observed was in fact at the sex body and trivalents with fluorescence in situ
hybridization (FISH) experiments with probes for the Y chromosome and
chromosomes 8 and 12.
Dynamic γH2A.X localization to trivalents in spermatocytes from
Robertsonian translocation carriers:
We observed γH2A.X staining in the nucleus of spermatocytes during
prophase I of meiosis from the leptotene stage to diakinesis, as well as in
elongating spermatids. γH2A.X enrichment was observed throughout the nucleus
during the leptotene and zygotene stages, but by the pachytene stage, exclusively
localized to the sex body and a proportion of translocation trivalents. The γH2A.X
signal was lost in the nucleus after diakinesis, but reappeared as a second genome
wide enrichment in elongating spermatids (Fig. 2.3). For our counting and
analysis, we focused on the pachytene stage as γH2A.X sex body dynamics are
well described (reviewed by Solari,1974 and Turner, 2007) and synaptonemal
complex (SC) staining clearly displays synapsed chromosomes. SC staining also
reveals if the translocation trivalents are synapsed at this stage.
43
Upon analysis of pachytene stage γH2A.X staining, we observed
enrichment at the sex body in 100% of nuclei and at trivalents in a proportion of
spermatocytes. The proportion of spermatocytes with enrichment at trivalents
varies across the pachytene stage. The γH2A.X enriched trivalents were usually
unsynapsed and were most likely to occur during the early-pachytene and less so
during the late-pachytene stage (Fig. 2.4). In single translocation carrier nuclei
(n=172, from 5 mice) γH2A.X enrichment at trivalents was observed in 67% of
early pachytene nuclei and was reduced to 4% of late pachytene nuclei (Fig. 2.5).
This reduction is statistically significant as determined by Fisher’s exact test
(p=0). Trivalents were also more likely to have achieved non-homologous
synapsis by the late pachytene stage as compared to the early-pachytene.
Additionally, γH2A.X localization analysis was conducted at the diplotene
stage. Since homologs are desynapsing and generally entangled at this stage, it
was difficult to determine if autosomal γH2A.X enrichment was occurring at
trivalents. Furthermore, it was impossible to reliably distinguish an autosomal
region that is desynapsing from a region that never synapsed with this approach.
For these reasons, analysis was conducted by counting any autosomal γH2A.X
foci that were distinct from the sex body in diplotene spermatocytes. In single
translocation carriers (96 nuclei from 3 mice were counted), we observed 14% of
diplotene nuclei with autosomal γH2A.X enrichment. The number of nuclei with
autosomal enrichment increased to 28% in carriers of three translocations (94
nuclei from 3 mice were counted) (Fig. 2.6). In comparison, wild type controls
(118 nuclei from 3 mice were counted) showed 4% of spermatocytes with
44
autosomal enrichment. There is a larger proportion of diplotene spermatocytes
with γH2A.X enrichment in translocation carriers compared to controls (p=0.028
for single translocation carriers, p=0 for three translocation carriers), as
determined by Fisher’s exact test. Also, the increase from 14% in single
translocation carriers to 28% in three translocation carriers is also significant
(p=0.037).
H3.3 localizes to metaphase I/anaphase I spermatocytes:
H3.3 enriches transcriptionally silent regions of the genome, such as the
sex body, beginning at the mid pachytene stage of meiotic prophase I and
remaining throughout spermatogenesis (van der Heijden et al. 2007, Santenard et
al. 2009, Szenker et al., 2011). The H3.3 antibody we used was specific to the
phosphorylated form at serine 31. As such, H3.3S31 immunostaining was
observed at the sex body of spermatocytes in metaphase I /anaphase I (wild type
n=99 from 3 mice; single translocation carriers n=106 from 3 mice; three
translocation carriers n=175 from 3 mice) (Fig. 2.7). In about 12% of
spermatocytes there was an additional H3.3 enriched region which was assumed
to be the Rb (8.12) translocation and verified with FISH for chromosomes 8 and
12 (Fig. 2.7). In spermatocytes from carriers of three translocations, the
percentage with additional H3.3 enrichment increased to 31% (Fig. 2.7). In single
translocation carrier spermatocytes, a range of 1 to 3 spots were observed. In
some cases the X and Y had separated, and in this case it would not count as an
extra spot. Spermatocytes from three translocation carriers had anywhere from 1
to 6 spots of increased enrichment. In both crosses, only presence of autosomal
45
enrichment was counted. Whether there were 1 or 4 spots, only the presence of
autosomal enrichment was counted and the total percentage reflects the proportion
of spermatocytes with additional spots of H3.3 enrichment. In comparison, we
observed only 3% of wild type spermatocytes with autosomal enrichment of H3.3
as defined as an extra spot of intense enrichment distinct from the X and Y. These
differences are statistically significant; from wild type to single translocation
(Fisher’s exact test p=0.01) and single translocation to three translocations
(Fishers exact test p=0.0005).These data were published in PLOS ONE
(Naumova et al., 2013).
Conclusion:
We conclude that the dynamics of asynapsis and localization of MSUC
marks differs in unsynapsed translocations and the sex body. The proportion of
nuclei with unsynapsed trivalents enriched with γH2AX decreases across the
lengthy pachytene stage as the proportion of trivalents achieving non-homologous
synapsis increases. γH2A.X and H3.3 immunostaining shows that with an
increased number of translocations within a nucleus, there is an increase in
proportion of spermatocytes with enrichment at autosomes representing stably
unsynapsed trivalents. These described dynamics may serve to explain, in part,
why translocation carriers have varied outcomes in spermatogenesis. Further
studies, however, need to be conducted to determine if other translocations elicit a
similar response and if this response is specific to translocations, or may be
generalized to any autosomal asynapsis.
46
Discussion:
Through our immunostaining experiments with γH2A.X and H3.3 we suggest that
the dynamics of asynapsis and subsequent MSUC at autosomes differs from that
at the sex body. This difference is described by a variation in the proportion of
spermatocytes with localization of MSUC marks to trivalents across the
pachytene stage.
It is suggested in the literature that a pachytene checkpoint is acting in
meiosis and spermatocytes with the presence of persistent autosomal asynapsis
will arrest at the pachytene stage (Roeder et al. 2000). Based on this conclusion, it
may be hypothesized that the reduction of the γH2A.X signal across the
pachytene stage that we observe may be due to a pachytene checkpoint. In theory,
this checkpoint would not be met by spermatocytes with autosomal asynapsis, and
would arrest in the pachytene stage. However, we have observed spermatocytes
with γH2A.X enrichment at unsynapsed trivalents in the diplotene stage, as well
as, H3.3 enrichment at trivalents in metaphase I/anaphase I. These data suggest
that stable autosomal asynapsis may occur beyond the pachytene stage and that
unsynapsed translocation trivalents are not subject to a pachytene checkpoint.
Another study also observes a lack of substantial pachytene loss in translocation
carriers (Manterola et al. 2009), strengthening the argument that a pachytene
checkpoint is not operating in these mice.
Furthermore, substantial and global autosomal asynapsis has been linked
to failure of MSCI and spermatocyte arrest in the pachytene stage (Mahadevaiah
et al. 2008). However, this same study reports that asynapsis of a single extra
47
chromosome does not impair MSCI and do not cause pachytene arrest. Other
studies with asynapsis limited from a segment of an autosome to eight
heterozygous Robertsonian translocations also report proper MSCI and sex body
formation, as well as, lack of a pachytene checkpoint response (Turner et al. 2005,
Baarends et al. 2005, Manterola et al. 2009). These reports suggest that
spermatocytes from single and three translocation carriers may survive beyond the
pachytene stage with unsynapsed translocation trivalents. It is suggested that these
unsynapsed regions would be subject to post-meiotic transcriptional repression
(Turner et al. 2007).
Additionally, if genes included in unsynapsed regions are silenced by
MSUC and essential to spermatogenesis, it may be hypothesized that
spermatogenic arrest would occur. This could result in the loss of spermatocytes
throughout spermatogenesis. Our data suggest that this is not the case since we
observe MSUC marks at autosomes at the diplotene stage and metaphase
I/anaphase I. Additionally, we have not observed a reduction in testes weight in
mice that are heterozygous for translocations, which would be expected if a great
proportion (i.e. 67% with asynapsis and γH2A.X enrichment in the early
pachytene stage from single translocation carriers) of spermatocytes were being
lost. Rather, it appears that most trivalents achieve a non-homologous synapsis
and these spermatocytes survive to maturity. Our data indicate that those
spermatocytes that do not achieve non-homologous synapsis, remain stably
unsynapsed and retain MSUC markers and consequent epigenetic silencing.
48
Histone variant H3.3, for example, is an MSUC marker of particular
interest if stably retained by unsynapsed trivalents. H3.3 escapes histone
replacement with protamines during the elongation stage of spermatogenesis (Ooi
et al., 2007, Orsi et al., 2009). Upon fertilization, H3.3 marks recruit
heterochromatin in the zygote (Santenard et al., 2010). Based on these findings,
we hypothesize, that an H3.3 that was recruited to unsynapsed regions during
spermatogenesis remains localized to these regions in mature spermatozoa. If
such a spermatozoan fertilizes an oocyte, one would expect H3.3 from the
paternal chromosome will recruit heterochromatic histone mark H3K27me3
leading to silencing of the same genes as were silenced in meiosis in the
developing embryo.
49
Figure Legends:
Figure 2.1: Three different karyotypes representing two chromosome pairs during
prophase of meiosis I. A. A representation of a wild type karyotype where the
homologous pairs have synapsed in the pachytene stage of prophase I. B. A
homozygous karyotype for a Robertsonian translocation of the two chromosomes.
When the individual is homozygous for a translocation, there is no problem with
synapsis and transcription may occur. C. A heterozygous karyotype for a
Robertsonian translocation of the two chromosomes. This is a representation of a
translocation trivalent and its potential for incomplete synapsis that occurs in the
pachytene stage. As the wild type chromosomes, pictured on the right, synapse
with the translocated chromosomes on the left, the “p” arms of the wild type
chromosomes cannot readily synapse. Since the “p” arms are lost in the
translocation, these segments on the wild type chromosomes do not have
homologous segments with which to synapse. The result is an unsynapsed, forklike, structure near the centromere.
Figure 2.2: A schematic of the staging of spermatocytes using DAPI and SYCP3
staining in single translocation carrier nuclei as described in (Saferali et al. 2010).
The first column represents DAPI staining, the middle is SYCP3 staining only
and the right column is the merged image of the two. Row 1 (EP): an early
pachytene (EP) spermatocyte with SYCP3 staining showing full synapsis of all
homologs except the X and Y, which show fluid sex chromosome axes. DAPI
staining is diffuse with limited intense localization to centromeric regions. Row 2
(MP): a mid-pachytene (MP) spermatocyte with more localized DAPI staining to
50
centromeres and a shortened synapsed portion of the sex chromosomes with
appear more stiff and curved. Row 3 (LP): a late pachytene spermatocyte with a
coiled X chromosome axis and sex body localization to the periphery of the
nucleus. DAPI staining shows a separate, intensely stained compartment
corresponding to the sex body. Row 4 (D): A diplotene (D) spermatocyte with
further DAPI localization and intensity at the centromeres and SYCP3 staining
shows dissociation of chromosomes.
Figure 2.3: A schematic of the dynamics of γH2A.X during spermatogenesis.
Pictures were generated from immunofluorescence experiments with testes cell
spreads using rabbit anti-synaptomenal complex (SC) and mouse anti-γH2A.X
antibodies as well as DAPI to visualize the nucleus. SC is represented in red,
γH2A.X in green and DAPI in blue. The left column are nuclear spreads from
wild type mice, the middle are from single translocation carriers, and the right
from carriers of three translocations. Row 1 are spermatogonia and can only be
visualized with the DAPI staining in this experiment. Row 2 nuclei are from
leptotene spermatocytes. This is the first stage of prophase I and γH2A.X begins
to localize to DNA double strand breaks which are occurring genome-wide, and
can be visualized as a diffuse green cloud. Also, the synaptonemal complex
begins to form and appears as small red spots across the nuclei. Row 3 shows
nuclei from the zygotene stage. In all three pictures a genome-wide γH2A.X
enrichment on all chromosomes can be visualized by a bright green cloud that
nearly fill the nucleus. Also, the synaptonemal complex is becoming more
structured across all chromosomes. Row 4 are pachytene nuclei where
51
homologous synapsis has been completed. SC staining shows all chromosome
pairs as individual red lines. The sex body can be observed in all three nuclei as a
bright green spot as the X and Y chromosomes are fully enriched in γH2A.X at
the perimeter of the nucleus. In the second column, the single translocation carrier
nucleus, shows an unsynapsed trivalent where γH2A.X associates with the
unsynapsed region of the translocation, which appears as a fork like structure. In
the right column, γH2A.X staining can be seen at the sex body and at all three
translocation trivalents. Row 5 shows diakenesis, the final stage of prophase I.
Desynapsis of homologs can be visualized with SC staining and the sex body
remains enriched in γH2A.X. In the picture in the right column, an additional
γH2A.X spot can be visualized, although it is difficult to determine if it is
associated with a translocation trivalent. Row 6 shows metaphase spermatocytes
where γH2A.X enrichment has been lost. The remaining SC staining appears as
focused red dots. Row 7 are round spermatids and can only be visualized with
DAPI staining as γH2A.X and SC staining are absent at this stage. Row 8 shows
the genome-wide γH2A.X enrichment which occurs in the condensing nuclei of
elongating spermatids.
Figure 2.4: A close up image of γH2AX staining in a pachytene nucleus of a
single translocation carrier spermatocyte. γH2A.X is represented in green, SC in
red and DAPI is blue. A. shows the whole nucleus with the sex body, labeled
“XY”, and an unsynapsed trivalent labeled “Rb (8,12)” and pointed at with a
yellow arrow, both enriched in γH2A.X. B. A zoomed-in view of the same
nucleus showing the sex body and unsynapsed trivalent. C. A cartoon
52
representation of the sex body and unsynapsed trivalent to show the area of
asynapsis, structure of the X and Y, and outline the area of enrichment.
Figure 2.5: Dynamics of γH2A.X localization to the chromosomal trivalents
during the pachytene stage differs from the enrichment of this marker at the XY
bivalent in spermatocytes of single translocation carriers.
EP- early pachytene, MP – mid pachytene; LP – late pachytene spermatocytes.
Arrowheads indicate trivalents. A. Distribution of γH2A.X-positive and negative
trivalents in 172 pachytene spermatocytes (from 5 mice). The y axis shows the
percent spermatocytes with different γH2A.X enrichment at different stages. A
reduction in γH2A.X at trivalents can be seen as the pachytene stage progresses
from early to late. Early pachytene stage shows γH2A.X enrichment in 67% of
spermatocytes. This is reduced to about 4% by the late pachytene stage. B.
Example of a γH2A.X-negative unsynapsed trivalent in an early pachytene
spermatocytes (asyn/ no γH2AX); C. Example of a γH2AX enrichment of a
synapsing trivalent in early pachytene spermatocytes (syn/γH2AX).
Figure 2.6: γH2A.X autosomal enrichment at the diplotene stage in wild type,
single translocation carriers and three translocation carriers. The y-axis represents
percent nuclei with autosomal enrichment. 4% of wild type, 14% from single
translocation carriers and 28% from carriers of three translocations show
autosomal γH2A.X enrichment.
Figure 2.7: Histone H3.3 marks in metaphase/anaphase I spermatocytes from
carriers of one or three Robertsonian translocations.
53
Panels on the left show H3.3S31 immunostaining merged with DAPI staining.
Panels on the right show DAPI staining alone. Arrowheads indicate chromosomal
trivalents. A. a single H3.3S31-enrichment domain in a spermatocyte from a
single translocation carrier corresponds to the sex body; B. two H3.3S31enrichment domains correspond to the X and Y univalents; C, D. three H3.3S31enrichment domains correspond to XY (D) or X and Y separately (C) and
autosomal centromeric regions. E. a single H3.3S31-enrichment domain in a
spermatocyte from a carrier of three translocations corresponds to the sex body. F,
G. FISH for chromosomes 8 and 12 (red) shows presence (F) or absence (G) of
co-localization of the Rb(8;12) trivalent with the autosomal H3.3S31 enriched
domain in carriers of three translocations. H. distribution of spermatocytes with
one, two or more than two H3.3S31 enrichment domains in wild type congenic
mice without translocations, heterozygous Rb(8;12) carriers and heterozygous
(Rb(1;3), Rb(8;12) and Rb(9;14) carriers. I. percent spermatocytes with
autosomal H3.3S31 enrichment in heterozygous carriers of translocations
compared to wild type congenic males.
54
Figure 2.1:
55
Figure 2.2:
56
Figure 2.3:
57
Figure 2.4:
58
Figure 2.5:
59
Figure 2.6:
60
Figure 2.7:
61
Chapter 3: Chromatin Immunoprecipitation (ChIP) on
Robertsonian translocation carrier testes confirms γH2A.X
enrichment at the Dnmt3a locus
Abstract:
Failure of homologous synapsis during meiotic prophase triggers
transcriptional repression, and asynapsis of autosomes resulting from autosomal
translocations shows high variation in outcomes ranging from meiotic arrest to
normal spermatogenesis. Such a phenotypic variation may result from a less
robust response to autosomal asynapsis than that which occurs in the sex body;
variable proportion of spermatocytes with meiotic silencing of unsynapsed
autosomal regions; and/or the difference in functions of affected autosomal genes.
To establish the span of chromosomes involved in autosomal asynapsis in carriers
of Robertsonian translocations, we conducted ChIP experiments on testes
chromatin from four week old translocation carrier mice. Enrichment of γH2A.X
and H3.3 was detected at the sex body, and γH2A.X was enriched at the
pericentromeic translocation associated DNA methyltransferase 3a (Dnmt3a)
gene in carriers of one and three translocations. Enrichment was not detected at
the pericentromeric chromosome 1 sex determining region Y-box 17 (Sox17) gene
in mice carrying three translocations (Rb(1.3), Rb(8.12), and Rb(9.14)). This
result shows heterogeneity between chromosomes of different translocations in
heterozygosis and their ability to synapse in prophase.
62
Introduction:
Failure of homologous synapsis in meiotic prophase causes transcriptional
repression termed meiotic silencing of unsynapsed chromatin (MSUC)
(Fernandez-Capetillo et al. 2003, Turner et al. 2004, 2005, Baarends et al. 2005,
Schimenti et al. 2005). In the mammalian male germ line, the X and Y
chromosomes cannot fully synapse, and thus, are packaged in a specialized,
transcriptionally silenced nuclear compartment termed the sex body in a process
known as meiotic sex chromosome inactivation (MSCI) (Solari 1974, McKee et
al. 1993, Turner et al. 2007). Through studies of autosomal asynapsis and the sex
body, it has been determined that MSCI is a type of MSUC (Fernandez-Capetillo
et al. 2003, Turner et al. 2004, 2005, Baarends et al. 2005, Schimenti et al. 2005).
These findings indicate that autosomal regions which do not synapse are also
transcriptionally silenced through a similar mechanism to MSCI.
Briefly, MSUC is initiated by the presence of DNA double strand breaks
(DSBs). DNA DSBs precede homologous synapsis in the pachytene stage, and
only after synapsis is achieved, do these lesions repair (Mahadevaiah et al. 2001).
If synapsis does not occur, as in the non-homologous regions of the X and Y
chromosomes, DSBs are retained and recruit an epigenetic response. First, breast
cancer 1 protein (BRCA1) localizes to the DSBs. This recruits the protein kinase
ataxia-telangiectasia and Rad3-related (ATR) which functions to phosphorylate
histone variant H2A.X (γH2A.X) (Turner et al. 2004). H2A.X phosphorylation
induces the chromatin change which causes the transcriptional silencing that
63
occurs in unsynapsed regions at the pachytene stage (Fernandez-Capetillo et al.
2003).
Chromosomal translocations have been used as a model for generating
autosomal asynapsis in mouse gametogenesis (Baarends et al. 2005, Turner et al.
2005, Manterola et al. 2009, Naumova et al. 2013). Through the use of different
markers that localize to areas of DNA damage, DNA repair, and transcriptionally
silenced chromatin, as well as, RNA FISH, it has been determined that
heterozygous autosomal translocations cause varying degrees of asynapsis at
translocated regions and consequent MSUC of these unsynapsed regions
(Baarends et al. 2005, Turner et al. 2005). These studies have yielded valuable
insights to the localization of markers, transcriptional consequences of asynapsis,
and dynamics of the epigenetic response to autosomal asynapsis. Further, these
findings reveal an ability of mammalian spermatocytes to proceed beyond the
pachytene stage with persistent autosomal asynapsis, avoiding a putative
pachytene checkpoint (Roeder et al. 2000). Stably unsynapsed autosomal
segments, like sex chromosomes, remain silenced in a post-meiotic sex chromatin
(PMSC)-like state (Baarends et al. 2005, Turner et al. 2007).
Histone variant H3.3 localizes to the sex body at the midpachytene stage
of prophase I and remains localized throughout the remainder of spermatogenesis
(van der Heijden et al. 2007). Phosphorylarted variant histone H2A.X (γH2A.X)
localizes to the sex body at the initiation of the pachytene stage and remains until
diakenesis (Svetlova et al. 2010)(Fig 3.1). The localization of these markers to
regions of autosomal asynapsis has not been investigated in higher resolution than
64
immunofluorescence on meiotic chromatin spreads. For this reason, reliable
estimates of gene silencing for specific heterozygous translocation carriers may
not be approximated.
Our previous work begins to unravel the dynamics of the response to
autosomal asynapsis in Robertosnain translocation carriers compared to sex
chromosomes. In general, initiation of γH2A.X localization to unsynapsed
translocation trivalents is the same as localization to the sex body, but as nonhomologous synapsis is achieved by translocation trivalents, γH2A.X enrichment
at trivalents is shed from a proportion of spermatocytes by the late pachytene
stage. In comparison, the sex body retains γH2A.X enrichment until the diakinesis
stage in 100% of spermatocytes (Naumova et al. 2013). It has been revealed that a
proportion of the spermatocyte population from translocation carriers retains
autosomal asynapsis beyond the pachytene stage and into metaphase I/anaphase I
(Naumova et al. 2013). This finding is consistent with previous reports (Baarends
et al. 2005, Turner et al. 2005, Manterola et al. 2009). It is unknown, however, the
exact extent to which these markers (γH2A.X and H3.3) localize to unsynapsed
autosomal regions. For this reason, we propose chromatin immunoprecipitation
sequencing (ChIP) experiments with antibodies for γH2A.X and H3.3 to uncover
which genomic regions are involved in this enrichment. Information from these
experiments will reveal if marker localization spreads into genic areas and glean
insights into meiotic silencing in unsynapsed autosomal regions.
Scientific Questions:
65
1. Can ChIP detect an enrichment of γH2A.X and H3.3 in the sex body and
translocation trivalents in testes cells from translocation carriers?
2. How far does silencing spread along chromosomes from the translocation
breakpoint in carriers of Robertsonian translocations?
3. Which genes are associated with enrichment of MSUC marks in
spermatocytes from translocation carriers?
Hypothesis:
Pericentromeric regions of translocated chromosomes are unsynapsed in a
proportion of spermatocytes from Robertsonian translocation carriers. ChIP with
whole testes chromatin from translocation carrier mice will determine the span of
enrichment of γH2A.X and H3.3 in pericentromeric regions associated with this
asynapsis.
Objectives:
A. Establish if ChIP in translocation carrier testes will show enrichment of
MSUC marks in sex body and translocation trivalents.
B. ChIP-qPCR analysis of translocation chromosome associated genes to
reveal if there is a centromeric enrichment of MSUC marks on
translocation chromosomes.
Materials and Methods:
Mice and crosses:
66
Mouse strains CBy.RBF-Rb(8.12)5Bnr/J (carries a single Rb(8.12)
translocation on a BALB/cBy genetic background); and RBF/Dnj (carries three
translocations: Rb(1.3), Rb(8.12), and Rb(9.14)) were purchased from the Jackson
Laboratory. The congenic strain B6.SPRET7MOLF12 was generated and
maintained in our laboratory (Croteau, 2001, 2005). Crosses between different
strains were conducted to generate heterozygous males for analysis of meiotic
silencing.
Chromatin Immunoprecipitation:
Chromatin was extracted from decapsulated mouse testes tissue using the
protocol provided by Smagulova et al. Samples were sonicated to yield fragments
in the range of 150-900bp. Samples were then incubated overnight in γH2AX or
H3.3 antibodies. Chromatin bound to antibodies was precipitated with Millipore
protein G agarose beads or dynabeads magnetic agarose beads. After washing,
chromatin was eluted from beads at 65 degrees, crosslinks were reversed
overnight with addition of 5M NaCl and DNA was purified with Qiagen minielute
columns.
Real time PCR:
Real time PCR was performed using a CYBR-green quantification method
with ABI CYBR-green mix. The reaction was carried out using 10μl of mix and
carried out in an ECO Real Time PCR System (Illumina). All qPCR reactions
were carried out with 40 cycles. For primer list, genome coordinates and PCR
conditions, see Table 3.1.
67
Results
To determine the size of the region associated with MSUC on
translocation trivalents, ChIP experiments were carried out with γH2A.X and
H3.3. The full span of the enrichment of these histone variants will only be
determined with ChIP-seq experiments. To validate the quality of the templates,
we first conducted ChIP experiments with γH2A.X and H.3.3 with testes
chromatin from wild type, single translocation carrier, and mice carrying three
translocations (3 mice from controls and single translocation carriers and 5 mice
carriers of three translocations, each mouse representing an independent ChIP
experiment) and analyzed levels of enrichment with real-time quantitative PCR
(qPCR). All testes samples were extracted from four weeks post-partum mice to
ensure optimal levels of pachytene stage spermatocytes (Bellve et al. 1977). ChIP
results described hereafter are in a qPCR context. Briefly, markers designed for
genes on the X chromosome as a control for sex body enrichment, as both
γH2A.X and H3.3 should be enriched at this stage. Next, genes were selected
within 5 Mb of the translocation breakpoint to test for translocation enrichment.
More distal markers on translocated chromosomes at least 50Mb from the
centromere were also assessed, which should not be unsynapsed or enriched in the
pachytene stage or beyond. Analysis of these results should give a confirmation of
enrichment of these histone variants at the sex body and at the pericentromeric
regions of the translocations. Genes at least 50Mb from the centromere should not
be enriched if the hypothesis is correct.
68
For ChIP with γH2A.X we utilized mice which were 4 weeks old to
optimize the percentage of pachytene stage spermatocytes in the whole testis.
γH2A.X enrichment occurs specifically in areas of DNA DSBs and is observed in
the zygotene stage, dynamically throughout pachytene stage at unsynapsed axes,
and during elongation of spermatids (Fig. 3.1). As such, testes chromatin was
extracted from 4 week old mice, which have testes that have the greatest
proportion of pachytene spermatocytes, at about 33% (Bellve et al., 1977).
Further, these mice have no elongating spermatids at this stage so γH2A.X
enrichment is representing only leptotene, zygotene, and pachytene
spermatocytes. This gives us the greatest chance of detecting enrichment in
pachytene spermatocytes at unsynapsed translocation trivalents, with the
minimum background.
H3.3 deposition in the sex body of spermatocytes occurs by the midpachytene stage and remains in X and Y chromatin throughout spermatogenesis.
We attempted ChIP with a ChIP verified H3.3 antibody with an epitope covering
the four amino acid changes from canonical H3 at positions 87, 89, 90 and 96
(Millipore 17-10245). Given the pattern of H3.3 deposition in spermatocytes
beginning at the pachytene stage, and the inability to test this antibody with
immunofluorescence, we decided to first test it in testes chromatin from 4 weeks
old mice.
For both the γH2A.X and H3.3 testes ChIP, we expect to see an
enrichment at the sex body and genes within close proximity to the translocation
breakpoints. Maximal enrichment should be represented by X and Y chromosome
69
genes. It is important to note that a baseline γH2A.X enrichment occurs genome
wide in the leptotene stage. We expect that even though γH2A.X and H3.3
enrichment does not occur at translocation trivalents in all spermatocytes, that
there will be sufficient enrichment to detect a signal in ChIP. This foldenrichment should, in theory, be represented by levels between baseline and those
observed in the sex body, since the sex body is present in 100% of spermatocytes
and asynapsis occurs variably across stages of spermatocyte development.
γH2A.X ChIP detected a 4 to 7 fold increased enrichment, on average, in
all mouse crosses (wild type n=3, single translocation carriers n=3, three
translocation carriers n=5) at X chromosome loci (Fig 3.3). All genes analyzed
were normalized to the H19 gene, as H19 should represent baseline enrichment
since it is located in the distal region of chromosome 7, which is not involved in
any of the translocations present in our mouse strains. A second normalization
was then conducted to the respective unbound fractions of each treatment in each
experiment. Additionally, at the Dnmt3a gene, which is located about 3.9 Mb
from the centromere on chromosome 12, a 2.5 to 3 fold enrichment was detected
in translocation carriers, but not in wild type controls. Since the Rb. 8,12
translocation is present in both carriers of one and three translocations, this
enrichment matches our expectations. Next, we analyzed Meg3, a distal marker at
about 110Mb from the centromere on chromosome 12, for enrichment. Meg3
showed no γH2A.X enrichment in all crosses. This result shows that γH2AX
deposition reaches at least 3.9 Mb from the centromere in potentially unsynapsed
70
trivalents and that this enrichment due to asynapsis does not reach distal portions
of the chromosome.
Analysis of Sox17, a marker located about 4.5 Mb from the centromere on
chromosome 1, yielded an unexpected result. No γH2A.X enrichment was
detected in any cross. While this was to be expected in wild type controls and the
Rb5 single translocation carriers, which do not carry a chromosome 1
translocation, it is an unexpected result for carriers of three translocations. These
mice are heterozygous for a translocation of chromosomes 1 and 3 and a
pericentromeric γH2A.X enrichment would be expected at these chromosomes in
the pachytene stage. As expected, there was also a lack of γH2A.X enrichment at
the 3-ketodihydrosphingosine reductase (Kdsr) gene, a marker located about
107Mb from the centromere on chromosome 1.
In summary, wild type controls had detectable enrichment of γH2A.X at
the sex body as determined by X chromosome gene qPCR. Carriers of a single
Rb. translocation (Rb. 8,12) show detectable enrichment at the pericentromeric
region of chromosome 12, but not at a more distal marker on the same
chromosome. Carriers of three Rb. translocations (Rb. 1,3; Rb. 8,12; Rb. 9,14)
show similar enrichment levels at chromosome 12 as single translocation carriers,
but no enrichment at the pericentromeric Sox17 gene on chromosome 1 (Fig. 3).
H3.3 ChIP failed to detect enrichment at X chromosome loci in testes
from carriers of three translocations. On average at Cdx4 an enrichment of 1.7
fold (from 4 experiments with 4 mice at 4 weeks post-partum) normalized to H19
and then to unbound fraction was detected. This low level of enrichment indicates
71
that this antibody either does not work in spermatocytes or a high background
enrichment of H3.3, masking the sex body enrichment. This was consistent with
Dnmt3a result, which was slightly increased to 2.25 fold enrichment. Because of
this result, H3.3 ChIP was not further pursued.
Conclusions:
ChIP with γH2A.X reliably detects high levels of enrichment at X
chromosome loci in testes optimized for pachytene stage spermatocytes. The Rb
(8.12) translocation in heterozygosis persists with asynapsis and γH2A.X
enrichment spread at least 3.9 Mb from the centromere on chromosome 12. The
Rb (1.3) translocation from carriers of three translocations does not persist with
detectable γH2A.X enrichment.
Discussion:
γH2A.X ChIP successfully detected pericentromeric translocation
associated enrichment on chromosome 12, representing asynapsis of the
translocation of chromosomes 8 and 12 in spermatocytes of translocation carriers.
This ChIP failed, however, to show γH2A.X enrichment at the Sox17 gene located
in the pericentromeric region of the Rb (1.3) translocation. This finding may be
explained by a few scenarios. First, the pericentromeric genes associated with the
translocation of chromosomes 1 may be essential at the early pachytene stage. It is
possible that if these genes are silenced by MSUC, spermatocytes may arrest,
preventing accumulation of a population of spermatocytes with asynapsed
chromosome 1 and 3 trivalents. A second possibility is that chromosomes 1 and 3
may be more efficient at achieving non-homologous synapsis. We report that
72
about 90% of spermatocytes from single translocation carriers achieve nonhomologous synapsis by the end of the pachytene stage (Naumova et al. 2013).
This finding, however, is specific to the Rb (8.12) translocation, and it is possible
that the Rb. (1.3) translocation achieves non-homologous synapsis in a higher
proportion of spermatocytes by the early pachytene stage. If either, or both of
these scenarios were true, it would explain why a lack of enrichment was detected
in ChIP at the chromosome 1 marker Sox17.
Additionally, the Rb (1.3) translocation may be unsynapsed but MSUC
marks do not spread 4.5 Mb to the Sox17 locus. The Rb(8.12) translocation was
analyzed utilizing the Dnmt3a gene, located at a more proximal 3.9 Mb from the
centromere on chromosome 12. This preliminary result may show the span of
γH2A.X enrichment at unsynapsed translocation trivalents, in the range of 3.9-4.5
Mb. ChIP-seq experiments in the future will help to determine if this scenario is
true or if some other mechanism in acting in this translocation.
The less robust H3.3 ChIP result (i.e. lesser enrichment at the sex body
and little-to-no enrichment at pericentromeric translocation associated genes) may
be explained by a higher background enrichment of this variant genome-wide
during spermatogenesis. γH2A.X is normally only enriched at the sex body by the
pachytene stage in prophase I of meiosis, but H3.3 has a less clear dynamic. H3.3
does associate with the sex body, but also with centromeric and telomeric
autosomal regions (van der Heijden et al. 2007, Santenard et al. 2010, Szenker et
al. 2011). Additionally it is possible that H3.3 does not assemble in as high a
73
proportion of nucleosomes as H2A.X relative to non-sex chromosomes, which
would yield a less robust ChIP result, but may not affect its biological relevance.
Our ChIP results, taken together with our previous findings in
immunofluorescence, reveal a potential for translocation associated gene silencing
in post-pachytene stages of spermatogenesis. We have previously reported that
markers of MSUC localized to translocation trivalents in spermatocytes as late as
metaphase I/anaphase I (Naumova et al. 2013). This localization represents
unsynapsed trivalents that persist until at least metaphase I, which are silenced
through the MSUC pathway (Turner et al. 2004, 2005, Baarends et al. 2005,
Schimenti et al. 2005). Interestingly, autosomal regions that are silenced through
MSUC are also transcriptionally repressed after meiosis in post meiotic sex
chromatin-like repression (Baarends et al. 2005, Turner et al. 2006, 2007). If the
γH2A.X enrichment we detected with ChIP were to persist in a proportion of
spermatocytes from translocation carriers as we report in immunofluorescence
experiments, this same proportion should be transcriptionally repressed at the
unsynapsed region of the translocation. For example, the novel finding that the
Dnmt3a gene on chromosome 12 shows about a 3 fold γH2A.X enrichment in
translocation carriers is significant, and gives a genic context to the visual
immunostaining enrichment at this translocation. Based on proportions reported in
our previous study, about 10% of single translocation carrier spermatocytes will
have post meiotic repression of the Dnmt3a gene.
Furthermore, a previous study by our lab on the single Rb. 8, 12
translocation carriers reveals that these mice have a methylation defect at the
74
imprinted H19 region in 10% of sperm (Saferali et al. 2010). Our finding that
γH2A.X ChIP shows enrichment at Dnmt3a is consistent with this result. The
persistence of asynapsis at trivalents in 10% of spermatocytes from these mice
causes MSUC and consequent silencing of genes involved which includes
Dnmt3a. Since Dnmt3a is a de novo DNA methyltransferase, it is responsible for
imprint reestablishment in spermatogenesis (Kaneda et al. 2004, Kato et al. 2007).
H19 is a gene that gains its methylation during spermatogenesis (reviewed by
Trasler 2009), and this may be disrupted by silencing of Dnmt3a, which is silent
at the onset of meiosis but normally expressed by the mid-pachytene stage and
DNMT3A protein remains in the nucleus through spermatogenesis until the
spermatid stage (Saferali et al. 2010). These two works (Saferali et al. 2010,
Naumova et al. 2013) together with this current study, begin to show a
mechanism of chromatin based genic silencing leading to methylation defects and
imprint disruption in translocation carrier mice.
75
Figure legends:
Figure 3.1: A schematic of the dynamics of γH2AX during spermatogenesis.
Pictures were generated from immunofluorescence experiments with testes cell
spreads using rabbit anti-synaptomenal complex (SC) and mouse anti-γH2AX
antibodies as well as DAPI to visualize the nucleus. SC is represented in red,
γH2AX in green and DAPI in blue. The left column are nuclear spreads from wild
type mice, the middle are from single translocation carriers, and the right from
carriers of three translocations. Row 1 are spermatogonia and can only be
visualized with the DAPI staining in this experiment. Row 2 nuclei are from
leptotene spermatocytes. This is the first stage of prophase I and γH2AX begins to
localize to DNA double strand breaks which are occurring genome-wide, and can
be visualized as a diffuse green cloud. Also, the synaptonemal complex begins to
form and appears as small red spots across the nuclei. Row 3 shows nuclei from
the zygotene stage. In all three pictures a genome-wide γH2AX enrichment on all
chromosomes can be visualized by a bright green cloud that nearly fill the
nucleus. Also, the synaptonemal complex is becoming more structured across all
chromosomes. Row 4 are pachytene nuclei where homologous synapsis has been
completed. SC staining shows all chromosome pairs as individual red lines. The
sex body can be observed in all three nuclei as a bright green spot as the X and Y
chromosomes are fully enriched in γH2AX at the perimeter of the nucleus. In the
second column, the single translocation carrier nucleus, shows an unsynapsed
trivalent where γH2AX associates with the unsynapsed region of the
translocation, which appears as a fork like structure. In the right column, γH2AX
76
staining can be seen at the sex body and at all three translocation trivalents. Row 5
shows diakinesis, the final stage of prophase I. Desynapsis of homologs can be
visualized with SC staining and the sex body remains enriched in γH2AX. In the
picture in the right column, an additional γH2AX spot can be visualized, although
it is difficult to determine if it is associated with a translocation trivalent. Row 6
shows metaphase spermatocytes where γH2AX enrichment has been lost. The
remaining SC staining appears as focused red dots. Row 7 are round spermatids
and can only be visualized with DAPI staining as γH2AX and SC staining are
absent at this stage. Row 8 shows the genome-wide γH2AX enrichment which
occurs in the condensing nuclei of elongating spermatids.
Figure 3.2: Markers for qPCR ChIP analysis. Cdx4 and Atrx are X-linked and
serve as a control for γH2A.X enrichment at the pachytene/diplotene stages.
Sox17 and Kdsr were designed on chromosome 1 to test for pericentromeric
enrichment. If a chromosome 1 and 3 trivalent is unsynapsed and enriched in
γH2A.X, we would expect to detect this enrichment at Sox17 due to its 4.5 Mb
proximity to the centromere and not at the more distally located Kdsr. The same
rational is true for Dnmt3a and Meg3, where an unsynapsed and enriched trivalent
of chromosomes 8 and 12 would show enrichment at Dnmt3a, but not at Meg3.
All qPCR values are normalized to H19 due to its location on chromosome 7,
which is not associated with any translocations in the mouse strains used in this
study.
Figure 3.3: γH2A.X enrichment analysis at all markers tested across all crosses.
The y-axis represents enrichment in comparison to the unbound fraction. Data
77
were normalized to correct for sampling errors (to H19). γH2A.X enrichment at
the unbound fraction was set to 1. Atrx and Cdx4 show enrichment across all
crosses and Dnmt3a shows enrichment in translocation carriers. Carriers of three
translocations do not show increased γH2A.X enrichment at Sox17.
Figure 3.4: H3.3 enrichment analysis in three translocation carriers. The y-axis
represents enrichment normalized to H19. γH2A.X enrichment at the unbound
ChIP fraction was set at 1. Both the control Cdx4 and translocation associated
Dnmt3a show very little H3.3 enrichment.
Table 3.1: Primers and conditions used for ChIP qPCR analysis.
78
Figure 3.1:
79
Figure 3.2:
Figure 3.3:
80
Figure 3.4:
Table 3.1:
ChIP
primers
Gene
Atrx
Cdx4
Dnmt3a
Sox17
H19
Kdsr
Meg3
Forward primer
aagagggaagagggtgacga
Ttggtccgctaccctcttac
Tcccctcctctcctcttttc
Tgagcgagcaggtgagaag
Gagtccgagtccacgaggta
gatgggagaatgaccgaaaa
gacacacggacacagacacc
Reverse primer
caacatcaaaatggcagaacc
acaaacccacctcaacaacc
Cttcctccccagccctac
aggggactttggcagttttt
gattgcgccaaacctaaaga
tgattttctgggctgtaggg
aagcaccatgagccactagg
Chr.
X
X
12
1
7
1
12
Annealing
temp. (C°)
60
60
60
55
60
60
60
81
Chapter 4: Meiotic silencing does not affect gene expression in
embryos sired by heterozygous Robertsonian translocation
carriers
Abstract:
Robertsonian (Rb) translocations in heterozygosis form trivalent structures
in prophase which incompletely synapse at the centromeric regions. Failure of
synapsis in prophase I of meiosis results in epigenetic silencing termed meiotic
silencing of unsynapsed chromatin (MSUC) and abnormal chromosomal
segregation. We have studied MSUC in heterozygous carriers of one (Rb 8,12)
and three (Rb 1,3; Rb 8,12; Rb 9,14) Robertsonian translocations. Previous work
in our lab has shown a heterogeneity of the spermatocyte population with respect
to MSUC with 10% of metaphase spermatocytes from single translocation carriers
and 30% from carriers of three translocations retaining MSUC marks at trivalents
(Naumova et al. 2013). The embryo epigenome undergoes major remodeling
during preimplantation development (reviewed by Reik et al. 2001). However,
occasionally parental epigenetic marks resist reprogramming and, in principle,
may influence embryo’s phenotype (Anway et al. 2005, Santenard et al. 2010).
Here, we asked if effects of MSUC during gametogenesis at unsynapsed
translocation trivalents could affect expression levels of those genes silenced in
meiosis in embryos sired from translocation carriers. We hypothesize that MSUC
marks, or effects thereof, are transmitted to the offspring of translocation carriers
and not erased during epigenetic reprogramming in early embryos. If this
hypothesis is correct, we expect to find significantly reduced expression of
82
pericentromeric genes on chromosomes 8 and 12 in 10% of embryos from single
translocation carriers. From carriers of three translocations, we expect to find
expression reductions in pericentromeric genes distributed evenly across the three
translocations in collectively 30% of embryos.
To test our hypothesis, we first characterized the viability of offspring
from translocation carrier fathers at birth. We observed a reduction of fertility in
carriers of three translocations (but not single translocation) compared to wild
type controls. Carriers of three translocations had an average litter size of 3.5 pups
(n=10 litters), whereas wild type controls had 8.7 pups per litter (n=24 litters). To
determine if loss of fertility is due to loss of gametes or loss of embryos post
fertilization, embryos were collected at 7.5 and 9.5 dpc and found that embryos
were lost from 7.5 dpc to birth. We compared expression levels in 28 9.5 dpc
embryos from an intercross between single translocation carriers, 12 9.5 dpc
embryos sired by carriers of three translocations, and 20 control embryos. Since
Rb translocations cause chromosomal segregation errors, we expect to detect
trisomies in translocation-associated chromosomes, but not monosomies as
embryos with monosomies do not implant. Hence, all embryos with reduced gene
expression at pericentromeric regions will be likely those with inherited MSUC
marks.
Expression analysis detected inter-individual variation in gene expression
in 9.5 dpc embryos. Embryos with reduced expression were found among controls
too. Possible explanations for these findings are: 1) we cannot reliably detect
transmission of epigenetic marks of MSUC due to inter-individual variation or
83
small sample size; or 2) MSUC-associated marks are not transmitted to offspring.
Further studies are necessary to determine which of these scenarios is the correct
one.
Introduction:
Failure of homologous synapsis in meiotic prophase causes transcriptional
repression termed meiotic silencing of unsynapsed chromatin (MSUC) (Schimenti
et al. 2005). In the mammalian male germ line, the X and Y chromosomes cannot
fully synapse, and thus, are packaged in a specialized, transcriptionally silenced
nuclear compartment termed the sex body in a process known as meiotic sex
chromosome inactivation (MSCI) (Solari 1974, McKee et al. 1993, Turner et al.
2007). Through studies of autosomal asynapsis and the sex body, it has been
determined that MSCI is a type of MSUC (Fernandez-Capetillo et al. 2003,
Turner et al. 2004, 2005, Baarends et al. 2005, Schimenti et al. 2005). These
findings indicate that autosomal regions which do not synapse are also
transcriptionally silenced through a similar mechanism to MSCI.
Briefly, MSUC is initiated by the presence of DNA double strand breaks
(DSBs). DNA DSBs precede homologous synapsis in the pachytene stage, and
only after synapsis is achieved, do these lesions repair (Mahadevaiah et al. 2001).
If synapsis does not occur, as in the non-homologous regions of the X and Y
chromosomes, DSBs are retained and recruit an epigenetic response. First, breast
cancer 1 protein (BRCA1) localizes to the DSBs. This recruits the protein kinase
ataxia-telangiectasia and Rad3-related (ATR) which functions to phosphorylate
histone variant H2A.X (γH2A.X) (Turner et al. 2004). H2A.X phosphorylation
84
induces the chromatin change which causes the transcriptional silencing that
occurs in unsynapsed regions at the pachytene stage (Fernandez-Capetillo et al.
2003).
Chromosomal translocations have been used as a model for generating
autosomal asynapsis in mouse gametogenesis (Baarends et al. 2005, Turner et al.
2005, Manterola et al. 2009, Naumova et al. 2013). Through the use of different
markers that localize to areas of DNA damage, DNA repair, and transcriptionally
silenced chromatin, as well as, RNA FISH, it has been determined that
heterozygous autosomal translocations cause varying degrees of asynapsis at
translocated regions and consequent MSUC of these unsynapsed regions
(Baarends et al. 2005, Turner et al. 2005). These studies have yielded valuable
insights to the localization of markers, transcriptional consequences of asynapsis,
and dynamics of the epigenetic response to autosomal asynapsis. Further, these
findings reveal an ability of mammalian spermatocytes to proceed beyond the
pachytene stage with persistent autosomal asynapsis, avoiding a putative
pachytene checkpoint (Roeder et al. 2000). Stably unsynapsed autosomal
segments, like sex chromosomes, remain silenced in a post-meiotic sex chromatin
(PMSC)-like state (Baarends et al. 2005, Turner et al. 2006, 2007).
Furthermore, recent studies show that X inactivation in mice is imprinted
on paternal X chromosome in extra embryonic tissues and in preimplantation
embryos (reviewed by Reik et al. 2005, Namekawa et al. 2010). Specifically, a
two-step imprinted X inactivation mechanism is proposed by Lee and colleagues.
They show that at the two cell stage, repeat elements are exclusively silenced on
85
the paternal X chromosome. By the morula-to-blastocyst stage the paternal X
genic regions are then silenced by Xist RNA. This proposed two step, imprinted X
chromosome inactivation suggests that there may be a memory from the inactive
X in spermatogenesis (Namekawa et al. 2010). Whether this imprinted
inactivation is due to properties specific to the X chromosome or it is as a result of
transmitted marks of MSCI is unclear. This does however; give rise to the
question if autosomal regions that experience MSUC can pass on a silent state to
the next generation.
Histone variants play an important role in MSUC as it is the
conformational chromatin change that they induce that causes transcriptional
repression (Fernandez-Capetillo et al. 2003). Histone variant H2A.X is at the
forefront of this silencing in the pachytene stage of prophase I, but is shed from
unsynapsed areas, such as the sex body by the diakinesis stage. Since
transcriptional repression persists throughout meiosis and post-meiotically,
studies of other histone variants and post translational modifications have been
essential to understanding this silencing. For example, ubiquitinated histone H2A
is present in the sex body and remains localized to post-meiotically,
transcriptionally repressed sex chromatin until spermatid stage of spermatogenesis
(Baarends et al. 2005). Histone variant H3.3 also localizes to the sex body during
MSCI and also remains localized to repressed sex chromosomes until the
spermatid stage potentially contributing to their transcriptional repression (van der
Heijden et al. 2007, Szenker et al. 2011). Interestingly, H3.3, when retained in
mature sperm, serves to recruit heterochromatin formation in the form of histone
86
H3 trimethylation at lysine 27 (H3K27me3) at areas of its retention in the zygote
(Ooi et al. 2007, Orsi et al. 2009, Santenard et al. 2010) (Fig. 4.1). It is, therefore,
reasonable to hypothesize that H3.3 retained at areas of asynapsis in translocation
carrier mice may be retained in the mature sperm of these carriers. This aberrant
retention in sperm may cause heterochromatin formation of genes associated with
translocations and their subsequent silencing which may cause developmental
defects in the offspring of translocation carriers. For these reasons, we propose
breeding translocation carrier mice and performing gene expression analysis of
translocation associated genes on post-implantation embryos with the aim of
detecting reduction of expression of these genes.
Scientific questions:
1. Is fertility affected in mice which carry translocations?
2. Does reduced fertility in translocation carriers result from loss of embryos
after fertilization or from loss of germ cells?
3. Are epigenetic marks that are deposited on unsynapsed chromosomes
during meiotic prophase transmitted to embryos, and if they are can we
detect them?
Hypothesis:
MSUC marks are transmitted to the offspring of translocation carriers and
not erased during epigenetic reprogramming in early embryos. Such epigenetic
inheritance causes changes in expression of genes located in those regions that
were silenced during meiosis.
87
Objectives:
A. Determine fertility of translocation carriers
B. Extract embryos from translocation carriers at various stages of post
implantation development to assess the possibility of embryo loss after
fertilization.
C. Perform gene expression analysis of pericentromeric translocation
associated genes in embryos to assess changes in expression.
Materials and Methods:
Mice and crosses:
Mouse strains CBy.RBF-Rb(8.12)5Bnr/J (carries a single Rb(8.12)
translocation on a BALB/cBy genetic background); and RBF/Dnj (carries three
translocations: Rb(1.3), Rb(8.12), and Rb(9.14)) were purchased from the Jackson
Laboratory. The congenic strains B6.SPRET7 and B6.SPRET7MOLF12 were
generated and maintained in our laboratory (Croteau, 2001, 2005). Crosses
between congenic mice and homozygous translocation carriers were conducted to
generate heterozygous males and females for fertility testing (Table 4.2) and for
analysis of meiotic silencing.
For 9.5 dpc embryo expression analysis of single translocation carriers,
CBy.RBF-Rb(8.12)5Bnr/J mice were crossed with B6.SPRET7 to generate F1
heterozygous Rb5 mice. F1s were intercrossed for embryo collection and gene
expression analysis (Fig. 4.5).
88
For 9.5 dpc embryo expression analysis of carriers of three translocations,
RBF/Dnj males were crossed with B6.SPRET7/MOLF12 females to generate
heterozygous F1 carriers of the three RBF/Dnj translocations. F1 males were
crossed with B6.SPRET7/MOLF12 females and embryos were collected for
analysis at 9.5 dpc.
RNA extraction and reverse transcription:
RNA from each individual embryo was extracted using Trizol (Life
Technologies). Reverse transcription reaction was performed with Invitrogen
Oligo(dT)12-18 primers and M-MLV reverse transcriptase and protocol from the
manufacturer. Briefly, 1μg of RNA was used per reverse transcription reaction
and treated with DNAse1 enzyme. For each sample, duplicate PCR tubes were
prepared with extracted RNA and reaction mix, except only one tube received the
M-MLV enzyme and the other was a negative control. Reaction mix was
incubated at 37°C for 50 minutes then at 70°C for 15 minutes to inactivate the
reaction. The resulting cDNA library from the M-MLV positive tube and the nonreacted RNA from the negative control tube were then assessed with conventional
PCR with Hprt gene, using 1μl of cDNA or M-MLV negative mix. A 2% agarose
gel was electrophoresed to test for DNA contamination, which would appear as a
higher molecular weight band than expected cDNA product size. All cDNA
primer sets were designed to skip an intron for this purpose, where a larger PCR
product in base pairs would indicate DNA contamination. Only samples with no
DNA contamination were used for expression analysis.
89
Expression analysis:
Sex of the embryo was determined using RT-PCR for the X-inactive
specific transcript (Xist) that is expressed only in female somatic cells.
RNA levels were evaluated using quantitative real time PCR (qPCR). The
reaction was carried out using 10μl of mix containing ABI CYBR-green mix and
carried out in an ECO Real Time PCR System (Illumina). All qPCR reactions
were carried out with 40 cycles. For primer list, genome coordinates and PCR
conditions, see Table 4.2.
Results:
Fertility testing of translocation carriers:
To test if meiotic silencing affects gametogenesis or embryonic
development of the offspring of translocation carriers, litter sizes were determined
at 3 time points: embryonic day 7.5, 9.5 and birth (day 20) in crosses between
heterozygous translocation carriers and control mice. Fertility of both male and
female single translocation (Rb (8.12)) carrier mice, RBF/Dnj, three translocation
(Rb (1.3), Rb (8.12), and Rb (9.14)) carrier mice, and congenic control
(B6.SPRET7.MOLF12) was assessed. (Table 4.1).
If there is a reduction in fertility due failed gametogenesis, we would
expect to detect reduced litter sizes from translocation carriers compared to
controls, and that this reduction will be consistent across all time points evaluated.
If, however, a reduction in fertility of translocation carriers is due to postimplantation embryo loss, we would expect to see a reduction in litter size from
90
7.5 dpc to birth compared to controls. Additionally if some of the loss is due to
embryonic death between 7.5 dpc and 9.5 dpc, we would expect to see a reduction
in litter sizes between these two stages.
Litter sizes at all three time points for each cross are summarized in Table
4.1. Carriers of three translocations have reduced fertility. When the male carriers
the translocations the birth count is 3.8 (n=5 litters) and when the female is the
carrier the birth count is about 3.2 (n=5 litters), as compared to 8.9 (n=18 litters)
for control mice. Further, this cross has larger litter sizes at 7.5 dpc, 9.3 pups per
litter (n=3 litters) when the male carries the translocations and 8.3 pups per litter
(n=4 litters) when the female is the carrier. These numbers are further reduced at
9.5 dpc. In comparison, single translocation carriers have birth counts which are
comparable to controls at 8.8 (n=6 litters) and 9.3 (n=3) from male translocation
carriers and female translocation carriers, respectively.
9.5 dpc embryos from carriers of three translocations also showed
heterogeneity in size, and upon collection, these embryos were grouped based on
their size of either small, medium or large (Fig 4.3).
Expression analysis to test the possibility that meiotic silencing affects
embryonic development:
9.5dpc embryos were collected from F1 translocation carriers crossed
with control mice or intercrossed with other translocation carrier F1s for RNA
extraction. Reverse transcription PCR was performed to generate cDNA for
qPCR to check for differences in gene expression levels of genes associated with
translocated chromosomes. Primer design was based on genes located on
91
translocated chromosomes within 10 Mb of the centromere to represent regions
expected to be affected by MSUC. Genes on chromosomes that are not involved
in translocations were used as markers which were not expected to be affected by
MSUC (Fig. 4.4). Normalization for qPCR was done with ubiquitously expressed
embryonic Hprt (Chr. X) gene which was used to normalize RNA levels.
Specifically, Dnmt3a (chromosome 12) and Xab (chromosome 8) were
chosen as pericentromeric genes on translocated chromosomes that may be
affected by MSUC in spermatogenesis. Yy1 was selected as a marker on
chromosome 12 that should not be affected by MSUC, due to its distal location at
109 Mb from the centromere. Ormdl3 was selected as a gene not involved with a
translocation in either strain as it resides on chromosome 11. The purpose of this
analysis is to compare non-translocation-associated with translocation-associated
gene expression levels. Finally, all genes are normalized to Hprt, which is also not
associated with any of the translocations.
First, we expect not to detect any monosomy in our embryos because all
embryos with monosomies fail to implant and thus do not advance beyond 4.5 dpc
(reviewed by Gearhart et al. 1984). If a trisomy were to be detected, one would
expect to see a significant increase in gene expression levels of genes located on
the chromosome in trisomy, representative of transcription from the extra
chromosome. No mouse embryos with trisomy of any chromosome survive after
birth, and usually die by mid-gestation, but some may live up to 14 dpc(reviewed
by Gearhart et al. 1984) (Fig. 4.2). If, however, silencing is passed from gametes
to embryo, then a reduction of gene expression levels in genes associated with the
92
translocation is expected. For carriers of a single translocation we estimate that
10% of sperm will persist with MSUC marks at trivalents, and thus, an estimated
10% of embryos sired from a single translocation carrier may show transmitted
effects of this MSUC. Likewise, for embryos sired by carriers of three
translocations, we expect to see 30% of embryos with this effect of reduced
expression of pericentromeric translocation associated genes transmitted from
MSUC. Based on our observations in spermatocytes (Naumova et al. 2013), we
expect that each of the 30% of embryos with transmitted MSUC effects in this
cross would likely have silencing at just one of the translocations, with each
translocation representing one third of the embryos with transmitted effects of
MSUC.
Analysis of gene expression was carried out on 9.5 dpc F2 embryos from
F1 carriers of a single Rb 8, 12 translocation (Rb5 F2) (from 4 litters, average
litter size=10.5) and control F2s (from 3 litters, average litter size=10.7).
Additionally, 15 F1 embryos sired by heterozygous carriers of three translocations
were analyzed (from 2 litters, average litter size=7.5). Of the 42 Rb5 F2 embryos,
15 had degraded or insufficient RNA levels for RT reaction, leaving 27 for
analysis. For control F2s only 20 of the 37 RNA samples were used for this same
reason. 12 of the 15 embryos sired by carriers of three translocations had
sufficient RNA levels for successful RT and analysis.
Dnmt3a analysis:
The Dnmt3a gene was selected for expression analysis of all three crosses
due to its pericentromeric location on chromosome 12, which is associated with a
93
translocation in both carrier strains. Similar Ormdl3 analysis was conducted as a
control for expression of a gene that is not associated with a translocation in either
strain, as it is located on chromosome 11. Analysis of 27 Rb5 F2 embryos, 15
embryos sired by three translocation carriers, and 20 controls reveals no reduction
in expression of the translocation associated gene based on distribution analysis.
Distribution histograms for expression levels of each gene in each embryo were
plotted and no embryos had expression levels that fell below the normal
distribution curve. There were however, embryos from each cross that had
increased expression of the Dnmt3a gene as determined by a bimodal distribution.
Two of the Rb5 F2 embryos and 3 of the embryos sired by carriers of three
translocations had an increase in Dnmt3a expression. It is unclear in the controls
whether one group shows and increase or decrease in expression as the bimodal
distribution is relatively even (Fig 4.6).
Rb5 F2 analysis:
To further analyze the Rb5 F2 embryos, expression of Xab, a gene located
in the pericentromeric region of chromosome 8, was determined. Since
chromosome 8 is the other chromosome involved in the Rb (8.12) translocation,
both pericentromeric regions hypothesized to be affected by MSUC were
assessed. As with Dnmt3a, Xab analysis revealed no embryos with reduction of
expression based on distribution analysis. An increase of expression, however,
was observed in 3 Rb5 F2 embryos (Fig 4.7).
Additionally, to compliment the pericentromeric chromosome 12 analysis
of the Dnmt3a gene, an expression analysis was conducted for the Yy1 gene
94
located at a more distal 109 Mb from the centromere on chromosome 12. The
purpose of this analysis was to compare levels of increase or decrease of
expression of genes on the same chromosome between embryos. Yy1 is
hypothesized to be unaffected by MSUC due to its distance from the centromere,
and as such, a change in expression of Dnmt3a in an embryo due to passed on
effects of MSUC should not be present at Yy1 in that same embryo. Yy1 analysis
yielded a normal distribution in Rb5 F2 embryos and a slightly bimodal
distribution in controls corresponding to the bimodal distribution of Dnmt3a
expression levels in those same embryos. This analysis should also be helpful in
detecting possible trisomies. If an embryo shows increased expression in the
pericentromeric Dnmt3a gene and the same embryo also shows an increase in
Yy1, it may be argued that trisomy 12 is causing this increase. For one such
embryo (41-39), we have observed this phenomenon. (Fig 4.7)
Sex analysis:
Sex of the embryos was determined by analyzing the expression of Xist. A
total of 12 females and 15 males in the Rb5 F2 embryos, 6 females and 6 males
in the embryos sired by carriers of three translocations, and 11 females and 9
males from controls. Embryo sex had no apparent effect on expression of any of
the genes tested.
Conclusions:
The reduction in fertility in carriers of three translocations is due to
embryonic loss after 7.5 dpc and not due to gamete loss in translocation carriers.
No decrease in expression was observed at Dnmt3a and Xab in 9.5 dpc embryos
95
sired by translocation carriers. There was no apparent correlation in gene
expression levels and sex of the embryo for the genes analyzed.
Discussion:
A 54-67% reduction in fertility in carriers of three translocations, the
former if the translocation comes from the paternal germ line and the later from
the maternal germ line. This reduction is most likely due to aneuploidy caused by
meiotic segregation errors (reviewed by Gearhart et al. 1984). An additional
possibility as a contributor to this reduction is loss of embryos due to transmitted
effects of autosomal MSUC in spermatogenesis. Our previous works have
highlighted retention of MSUC marks in a proportion of translocation carrier
spermatocytes. This proportion depends upon the amount of translocations
present. If genes essential to early embryogenesis are silenced by transmitted
effects of MSUC, then embryonic death may occur.
We were, however, unable to detect any reduction of expression in
pericentromeric translocation associated genes in Rb5 F2 embryos. Several
scenarios may be in play to explain this result. First, transmitted effects of MSUC
may be occurring in these embryos, but may be embryonic lethal prior to 9.5dpc.
It is possible that embryos with transmitted effects of MSUC on these
chromosomes fail to implant, or die shortly after implantation. Second, it is
possible that effects of MSUC are not transmitted to embryos. Either, sperm with
these defects do not have the ability to fertilize and oocyte, or the effects are
reprogrammed in early embryogenesis. Alternatively, there may be a
compensation effect from the non-affected allele. For example, if one transmitted
96
allele retains a silent state from MSUC in gametogenesis, and the allele from the
second parent is not silenced, it may compensate for the silenced allele. Finally,
the approach may not be sensitive enough to detect the actual effects transmitted
to embryos by MSUC in gametogenesis. It is possible that effects are transmitted,
but their manifestation is more subtle than complete silencing. There may be a
repression that may not be detected by RT-qPCR methods. Also, we detect similar
variation in Rb5 F2 and controls, which is due to inter-individual variation. This
variation is not statistically different than our expected effect size (10% for single
translocation carriers) and may diminish our ability to reliably detect transmitted
effects in this context. In any case, more studies have to be conducted to
determine which scenario or combination of scenarios is correct.
Furthermore, this inability to detect transmitted effects of MSUC in
spermatogenesis may be due to properties of autosomal MSUC. Skinner and
colleagues report transgenerational epigenetic inheritance in terms of aberrant
DNA methylation patterns in rats that were exposed to endocrine disruptors in
utero. This effect was detected as late as the F4 generation (Anway et al. 2005).
This effect was of a DNA methylation context, and the effect we aim to detect is
of a chromatin context which may be less penetrant than DNA methylation
effects. For example, Turner and colleagues report that areas of autosomal MSUC
do undergo post meiotic repression in spermatids, like the sex chromosomes.
However, unlike sex chromosomes, areas of autosomal MSUC do reactivate in a
proportion of spermatids, leading to the conclusion that autosomal MSUC has a
less penetrant post meiotic effect than at sex chromosome (Turner et al. 2006). It
97
is therefore, reasonable to hypothesize that this less penetrant effect during
spermatogenesis may be even further less penetrant in the next generation.
Although MSUC marks may be passed on, their effect may be diminished during
embryogenesis, especially since the embryo genome undergoes significant
epigenetic reprogramming.
An interesting finding is the increase of expression in translocation
associated genes in embryos sired by translocation carriers. A simple explanation
for this increase is meiotic segregation errors which caused trisomy in the
resultant embryos. In the Rb5 F2 analysis of Dnmt3a, two embryos have
increased expression levels of the pericentromeric gene. These embryos may
indeed have trisomy 12 and Yy1analysis should show a comparable increase of the
more distally located gene if this is the case. Yy1 analysis strengthens this
argument for one embryo, but the other does not show the same increase in Yy1
expression. A possible explanation for this particular result is a transmitted effect
of MSUC which causes an increase of expression of genes silenced in meiosis.
Although additional analysis is required to strengthen this argument, the fact that
the same pattern of increased expression of pericentromeric translocation
associated genes and no decrease is observed in embryos from both single and
three translocation carriers, warrants mention of this possibility.
98
Figure legends:
Figure 4.1: The hypothesis that aberrant MSUC marks that persist in
spermatogenesis may be passed on to the next generation. This illustration focuses
on H3.3 retention at unsynapsed translocation trivalents. H3.3 may be retained in
mature sperm and in these retained areas, a heterochromatic state is recruited in
the zygote with localization of H3K27me3. This heterochromatin recruitment may
cause gene repression in the developing embryo.
Figure 4.2: Trisomy survival by chromosome. The y-axis represents the
chromosomes which are translocated in our Rb. translocation carrier mice. The xaxis is embryo survival in dpc. All monosomies fail to implant and die by 4.5dpc
and all trisomies are unviable. Chromosome 14 trisomy is sometimes viable to
term, but dies after birth.
Figure 4.3: 9.5 dpc embryos extracted from a congenic female crossed with a
male carrier of three translocations. Embryos were grouped by size at this stage,
but no differences in expression could be attributed to different size embryos.
Figure 4.4: Gene selection for expression analysis. Markers were placed on
translocated chromosomes in pericentromic and distal regions. Hprt, Ormdl3 and
Rpl19 were used as controls.
Figure 4.5: A schematic of the breeding scheme for developing Rb5 F2s and
control F2s for analysis of transmitted effects of MSUC from single translocation
carriers. Either CBy.RBF-Rb(8.12)5Bnr/J (Rb. 8,12 translocation homozygote)
99
(Rb5), or BALB/cBy (background strain) mice were crossed with B6.SPRET7
mice. F1s were then intercrossed to generate F2 embryos for analysis.
Figure 4.6: Distribution analysis of Ormdl3 (A.) and Dnmt3a (B.) expression in
control embryos (blue), Rb5 F2 embryos (red), and embryos sired by carriers of
three translocations (green). Distribution histogram bars represent percentage of
total embryos in each cross which fall under a expression level after normalization
to Hprt. No embryos from either translocation carrier cross show a decrease of
expression of Dnmt3a or Ormdl3.
Figure 4.7: Expression distribution comparison between Rb5 F2 embryos (red)
and control F2 embryos (blue). Each bar represents a percentage of the total
embryos of that cross with a specific expression level of each gene depicted on
the X axis as values normalized to Hprt expression. A. Dnmt3a expression in Rb5
F2s shows a bimodal distribution with two embryos with increased expression
relative to the normal distribution. B. Dnmt3a expression distribution in control
embryos also shows a bimodal distribution. C. Yy1 expression in RB5 F2s shows
a normal distribution as expected, but D. Yy1 in wild type shows a bimodal
distribution reflective of the Dnmt3a distribution from the same chromosome. E.
Xab in Rb5 F2s shows no decrease but an increase in at least three embryos as
determined by bimodal distribution. F. control F2s show a normal distribution on
the chromosome 8 Xab gene. This analysis reveals a probable trisomy 12 in at
least one Rb5 F2 and a possible 3 trisomy 8 embryos in the same group.
100
Table 4.1: Fertility testing result table. Litter sizes are given for all crosses tested.
Standard error (±) is given where applicable and the number of litters in given in
parentheses. A reduction in fertility is revealed in carriers of 3 translocations from
8.9 pups per litter in B6xB6 controls and 8.0 pups per litter in CgxCg controls to
3.2-3.8 pups per litter in carriers. This reduction in fertility is due to a loss of
embryos from 8.3-9.3 at 7.5dpc to 3.2-3.8 at birth.
Table 4.2: Primers used in ChIP qPCR analysis.
101
Figure 4.1:
Figure 4.2:
102
Figure 4.3:
Figure 4.4:
103
Figure 4.5:
104
Figure 4.6:
105
Figure 4.7:
106
Table 4.1:
Cross (female x male)
Live birth
count
7.5 dpc embryo
count
9.5 dpc embryo
count
B6xRb5
9.4 ± 0.76 (12)
B6xRBF/Dnj
7.6 ± 0.81 (5)
B6x(Rb5 heterozygous)
8.8 ± 0.83 (6)
11 ± 0.58 (3)
8 (1)
B6x(RBF/Dnj
heterozygous)
3.8 ± 0.54 (5)
9.3 ± 0.67 (3)
7.5± 0.9 (2)
B6xB6
8.9 ± 0.37 (18)
CgxCg
8.0 ± 0.55 (6)
Cross (female x male)
Live birth
count
7.5 dpc embryo
count
9.5 dpc embryo
count
(Rb5 heterozygous)xCg
9.3 ± 1.2 (3)
11.7 ± 0.67 (3)
10.3 ± 0.5 (3)
(RBF/Dnj
heterozygous)xCg
3.2 ± 0.49 (5)
8.3 ± 0.47 (4)
Table 4.2:
Expression primers
Gene
Forward primer
Reverse primer
Chr.
Dnmt3a
accacccctgagccagtag
cctgtcatccaccaagacac
12
Annealing
temp.(°C)
60
Hprt
agttattggtggagatgatctctca
ggcctgtatccaacacttcgaga
X
60
Ormdl3
agactcgagaccaaggcaaa
ccagaggctcctgtcttcag
11
60
Yy1
agctcaaagctaaaacgacacc
cgcaaattgaagtccagtga
12
60
Xab
atagcgcgagatgaatttgg
ccacgccacagatcgttatt
8
60
107
References
Ahmad, K., & Henikoff, S. (2001). Centromeres are specialized replication
domains in heterochromatin. The Journal of Cell Biology, 153(1), 101-110.
Ahmad, K., & Henikoff, S. (2002). Histone H3 variants specify modes of
chromatin assembly. Proceedings of the National Academy of Sciences of the
United States of America, 99 Suppl 4, 16477-16484.
Ahmad, K., & Henikoff, S. (2002). The histone variant H3.3 marks active
chromatin by replication-independent nucleosome assembly. Molecular
Cell, 9(6), 1191-1200.
Anway, M. D., Cupp, A. S., Uzumcu, M., & Skinner, M. K. (2005). Epigenetic
transgenerational actions of endocrine disruptors and male fertility. Science
(New York, N.Y.), 308(5727), 1466-1469.
Baarends, W. M., Wassenaar, E., van der Laan, R., Hoogerbrugge, J., SleddensLinkels, E., Hoeijmakers, J. H., et al. (2005). Silencing of unpaired chromatin
and histone H2A ubiquitination in mammalian meiosis.Molecular and
Cellular Biology, 25(3), 1041-1053.
Bassing, C. H., & Alt, F. W. (2004). The cellular response to general and
programmed DNA double strand breaks. DNA Repair, 3(8-9), 781-796.
Bellve, A. R., Cavicchia, J. C., Millette, C. F., O'Brien, D. A., Bhatnagar, Y. M.,
& Dym, M. (1977). Spermatogenic cells of the prepuberal mouse. isolation
and morphological characterization. The Journal of Cell Biology,74(1), 6885.
Berger, S. L. (2007). The complex language of chromatin regulation during
transcription. Nature, 447(7143), 407-412.
Borgel, J., Guibert, S., Li, Y., Chiba, H., Schubeler, D., Sasaki, H., et al. (2010).
Targets and dynamics of promoter DNA methylation during early mouse
development. Nature Genetics, 42(12), 1093-1100.
Bramlage, B., Kosciessa, U., & Doenecke, D. (1997). Differential expression of
the murine histone genes H3.3A and H3.3B. Differentiation; Research in
Biological Diversity, 62(1), 13-20.
Brykczynska, U., Hisano, M., Erkek, S., Ramos, L., Oakeley, E. J., Roloff, T. C.,
et al. (2010). Repressive and active histone methylation mark distinct
promoters in human and mouse spermatozoa. Nature Structural & Molecular
Biology, 17(6), 679-687.
108
Burgoyne, P. S. (1982). Genetic homology and crossing over in the X and Y
chromosomes of mammals. Human Genetics, 61(2), 85-90.
Burgoyne, P. S., Mahadevaiah, S. K., & Turner, J. M. (2009). The consequences
of asynapsis for mammalian meiosis. Nature Reviews.Genetics, 10(3), 207216.
Caron, C., Govin, J., Rousseaux, S., & Khochbin, S. (2005). How to pack the
genome for a safe trip. Progress in Molecular and Subcellular Biology, 38,
65-89.
Clark, J. M., & Eddy, E. M. (1975). Fine structural observations on the origin and
associations of primordial germ cells of the mouse. Developmental
Biology, 47(1), 136-155.
Cloutier, J. M., & Turner, J. M. (2010). Meiotic sex chromosome
inactivation. Current Biology : CB, 20(22), R962-3.
Costanzi, C., & Pehrson, J. R. (1998). Histone macroH2A1 is concentrated in the
inactive X chromosome of female mammals. Nature, 393(6685), 599-601.
Davis, T. L., Yang, G. J., McCarrey, J. R., & Bartolomei, M. S. (2000). The H19
methylation imprint is erased and re-established differentially on the parental
alleles during male germ cell development. Human Molecular
Genetics, 9(19), 2885-2894.
Dobson, M. J., Pearlman, R. E., Karaiskakis, A., Spyropoulos, B., & Moens, P. B.
(1994). Synaptonemal complex proteins: Occurrence, epitope mapping and
chromosome disjunction. Journal of Cell Science, 107 ( Pt 10)(Pt 10), 27492760.
Doyen, C. M., Montel, F., Gautier, T., Menoni, H., Claudet, C., Delacour-Larose,
M., et al. (2006). Dissection of the unusual structural and functional
properties of the variant H2A.bbd nucleosome. The EMBO Journal,25(18),
4234-4244.
Drane, P., Ouararhni, K., Depaux, A., Shuaib, M., & Hamiche, A. (2010). The
death-associated protein DAXX is a novel histone chaperone involved in the
replication-independent deposition of H3.3. Genes & Development, 24(12),
1253-1265.
Egozcue, S., Blanco, J., Vendrell, J. M., Garcia, F., Veiga, A., Aran, B., et al.
(2000). Human male infertility: Chromosome anomalies, meiotic disorders,
abnormal spermatozoa and recurrent abortion. Human Reproduction
Update, 6(1), 93-105.
109
Fernandez-Capetillo, O., Mahadevaiah, S. K., Celeste, A., Romanienko, P. J.,
Camerini-Otero, R. D., Bonner, W. M., et al. (2003). H2AX is required for
chromatin remodeling and inactivation of sex chromosomes in male mouse
meiosis. Developmental Cell, 4(4), 497-508.
Franklin, S. G., & Zweidler, A. (1977). Non-allelic variants of histones 2a, 2b and
3 in mammals. Nature, 266(5599), 273-275.
Frydman, N., Romana, S., Le Lorc'h, M., Vekemans, M., Frydman, R., &
Tachdjian, G. (2001). Assisting reproduction of infertile men carrying a
robertsonian translocation. Human Reproduction (Oxford, England),16(11),
2274-2277.
Gearhart, J. D., Davisson, M. T., & Oster-Granite, M. L. (1986). Autosomal
aneuploidy in mice: Generation and developmental consequences. Brain
Research Bulletin, 16(6), 789-801.
Giroux, C. N., Dresser, M. E., & Tiano, H. F. (1989). Genetic control of
chromosome synapsis in yeast meiosis. Genome / National Research Council
Canada = Genome / Conseil National De Recherches Canada, 31(1), 88-94.
Godmann, M., Auger, V., Ferraroni-Aguiar, V., Di Sauro, A., Sette, C., Behr, R.,
et al. (2007). Dynamic regulation of histone H3 methylation at lysine 4 in
mammalian spermatogenesis. Biology of Reproduction, 77(5), 754-764.
Goetz, P., Chandley, A. C., & Speed, R. M. (1984). Morphological and temporal
sequence of meiotic prophase development at puberty in the male
mouse. Journal of Cell Science, 65, 249-263.
Guillemette, B., Bataille, A. R., Gevry, N., Adam, M., Blanchette, M., Robert, F.,
et al. (2005). Variant histone H2A.Z is globally localized to the promoters of
inactive yeast genes and regulates nucleosome positioning. PLoS
Biology, 3(12), e384.
Hajkova, P., Ancelin, K., Waldmann, T., Lacoste, N., Lange, U. C., Cesari, F., et
al. (2008). Chromatin dynamics during epigenetic reprogramming in the
mouse germ line. Nature, 452(7189), 877-881.
Hajkova, P., Erhardt, S., Lane, N., Haaf, T., El-Maarri, O., Reik, W., et al. (2002).
Epigenetic reprogramming in mouse primordial germ cells. Mechanisms of
Development, 117(1-2), 15-23.
Hammoud, S. S., Nix, D. A., Hammoud, A. O., Gibson, M., Cairns, B. R., &
Carrell, D. T. (2011). Genome-wide analysis identifies changes in histone
retention and epigenetic modifications at developmental and imprinted gene
110
loci in the sperm of infertile men. Human Reproduction (Oxford,
England), 26(9), 2558-2569.
Hammoud, S. S., Nix, D. A., Zhang, H., Purwar, J., Carrell, D. T., & Cairns, B. R.
(2009). Distinctive chromatin in human sperm packages genes for embryo
development. Nature, 460(7254), 473-478.
Hazzouri, M., Pivot-Pajot, C., Faure, A. K., Usson, Y., Pelletier, R., Sele, B., et al.
(2000). Regulated hyperacetylation of core histones during mouse
spermatogenesis: Involvement of histone deacetylases.European Journal of
Cell Biology, 79(12), 950-960.
Heo, K., Kim, H., Choi, S. H., Choi, J., Kim, K., Gu, J., et al. (2008). FACTmediated exchange of histone variant H2AX regulated by phosphorylation of
H2AX and ADP-ribosylation of Spt16. Molecular Cell, 30(1), 86-97.
Jenkins, T. G., & Carrell, D. T. (2012). The sperm epigenome and potential
implications for the developing embryo. Reproduction (Cambridge,
England), 143(6), 727-734.
Jensen, K., Santisteban, M. S., Urekar, C., & Smith, M. M. (2011). Histone
H2A.Z acid patch residues required for deposition and function. Molecular
Genetics and Genomics : MGG, 285(4), 287-296.
Jenuwein, T., & Allis, C. D. (2001). Translating the histone code. Science (New
York, N.Y.), 293(5532), 1074-1080.
Kaneda, M., Okano, M., Hata, K., Sado, T., Tsujimoto, N., Li, E., et al. (2004).
Essential role for de novo DNA methyltransferase Dnmt3a in paternal and
maternal imprinting. Nature, 429(6994), 900-903.
Kato, Y., Kaneda, M., Hata, K., Kumaki, K., Hisano, M., Kohara, Y., et al.
(2007). Role of the Dnmt3 family in de novo methylation of imprinted and
repetitive sequences during male germ cell development in the
mouse. Human Molecular Genetics, 16(19), 2272-2280.
Keeney, S., Giroux, C. N., & Kleckner, N. (1997). Meiosis-specific DNA doublestrand breaks are catalyzed by Spo11, a member of a widely conserved
protein family. Cell, 88(3), 375-384.
Khalil, A. M., Boyar, F. Z., & Driscoll, D. J. (2004). Dynamic histone
modifications mark sex chromosome inactivation and reactivation during
mammalian spermatogenesis. Proceedings of the National Academy of
Sciences of the United States of America, 101(47), 16583-16587.
111
Kimmins, S., & Sassone-Corsi, P. (2005). Chromatin remodelling and epigenetic
features of germ cells. Nature, 434(7033), 583-589.
Kobayashi, H., Sakurai, T., Imai, M., Takahashi, N., Fukuda, A., Yayoi, O., et al.
(2012). Contribution of intragenic DNA methylation in mouse gametic DNA
methylomes to establish oocyte-specific heritable marks.PLoS Genetics, 8(1),
e1002440.
Kofman-Alfaro, S., & Chandley, A. C. (1970). Meiosis in the male mouse. an
autoradiographic investigation. Chromosoma, 31(4), 404-420.
Kovaleva, N. V. (2005). Sex-specific chromosome instability in early human
development. American Journal of Medical Genetics.Part A, 136A(4), 401413.
Leduc, F., Maquennehan, V., Nkoma, G. B., & Boissonneault, G. (2008). DNA
damage response during chromatin remodeling in elongating spermatids of
mice. Biology of Reproduction, 78(2), 324-332.
Lewis, P. W., Elsaesser, S. J., Noh, K. M., Stadler, S. C., & Allis, C. D. (2010).
Daxx is an H3.3-specific histone chaperone and cooperates with ATRX in
replication-independent chromatin assembly at telomeres.Proceedings of the
National Academy of Sciences of the United States of America, 107(32),
14075-14080.
Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., & Richmond, T. J.
(1997). Crystal structure of the nucleosome core particle at 2.8 A
resolution. Nature, 389(6648), 251-260.
Lyndaker, A. M., Lim, P. X., Mleczko, J. M., Diggins, C. E., Holloway, J. K.,
Holmes, R. J., et al. (2013). Conditional inactivation of the DNA damage
response gene Hus1 in mouse testis reveals separable roles for components of
the RAD9-RAD1-HUS1 complex in meiotic chromosome
maintenance. PLoS Genetics, 9(2), e1003320.
Mahadevaiah, S. K., Bourc'his, D., de Rooij, D. G., Bestor, T. H., Turner, J. M.,
& Burgoyne, P. S. (2008). Extensive meiotic asynapsis in mice antagonises
meiotic silencing of unsynapsed chromatin and consequently disrupts meiotic
sex chromosome inactivation. The Journal of Cell Biology, 182(2), 263-276.
Mahadevaiah, S. K., Turner, J. M., Baudat, F., Rogakou, E. P., de Boer, P.,
Blanco-Rodriguez, J., et al. (2001). Recombinational DNA double-strand
breaks in mice precede synapsis. Nature Genetics, 27(3), 271-276.
Mannironi, C., Bonner, W. M., & Hatch, C. L. (1989). H2A.X. a histone
isoprotein with a conserved C-terminal sequence, is encoded by a novel
112
mRNA with both DNA replication type and polyA 3' processing
signals.Nucleic Acids Research, 17(22), 9113-9126.
Manterola, M., Page, J., Vasco, C., Berrios, S., Parra, M. T., Viera, A., et al.
(2009). A high incidence of meiotic silencing of unsynapsed chromatin is not
associated with substantial pachytene loss in heterozygous male mice
carrying multiple simple robertsonian translocations. PLoS Genetics, 5(8),
e1000625.
McKee, B. D., & Handel, M. A. (1993). Sex chromosomes, recombination, and
chromatin conformation. Chromosoma, 102(2), 71-80.
Mello, J. A., & Almouzni, G. (2001). The ins and outs of nucleosome
assembly. Current Opinion in Genetics & Development, 11(2), 136-141.
Namekawa, S. H., Park, P. J., Zhang, L. F., Shima, J. E., McCarrey, J. R.,
Griswold, M. D., et al. (2006). Postmeiotic sex chromatin in the male
germline of mice. Current Biology : CB, 16(7), 660-667.
Namekawa, S. H., Payer, B., Huynh, K. D., Jaenisch, R., & Lee, J. T. (2010).
Two-step imprinted X inactivation: Repeat versus genic silencing in the
mouse. Molecular and Cellular Biology, 30(13), 3187-3205.
Naumova, A. K., Fayer, S., Leung, J., Boateng, K. A., Camerini-Otero, R. D., &
Taketo, T. (2013). Dynamics of response to asynapsis and meiotic silencing
in spermatocytes from robertsonian translocation carriers.PloS One, 8(9),
e75970.
Naumova, A. K., & Greenwood, C. M. T. (2013). Epigenetics and complex traits.
New York: Springer.
Ooi, S. L., & Henikoff, S. (2007). Germline histone dynamics and
epigenetics. Current Opinion in Cell Biology, 19(3), 257-265.
Orsi, G. A., Couble, P., & Loppin, B. (2009). Epigenetic and replacement roles of
histone variant H3.3 in reproduction and development. The International
Journal of Developmental Biology, 53(2-3), 231-243.
Page, J., de la Fuente, R., Manterola, M., Parra, M. T., Viera, A., Berrios, S., et al.
(2012). Inactivation or non-reactivation: What accounts better for the silence
of sex chromosomes during mammalian male meiosis? Chromosoma, 121(3),
307-326.
Pandita, R. K., Sharma, G. G., Laszlo, A., Hopkins, K. M., Davey, S.,
Chakhparonian, M., et al. (2006). Mammalian Rad9 plays a role in telomere
113
stability, S- and G2-phase-specific cell survival, and homologous
recombinational repair. Molecular and Cellular Biology, 26(5), 1850-1864.
Paull, T. T., Rogakou, E. P., Yamazaki, V., Kirchgessner, C. U., Gellert, M., &
Bonner, W. M. (2000). A critical role for histone H2AX in recruitment of
repair factors to nuclear foci after DNA damage. Current Biology :
CB, 10(15), 886-895.
Peters, A. H., Plug, A. W., van Vugt, M. J., & de Boer, P. (1997). A drying-down
technique for the spreading of mammalian meiocytes from the male and
female germline. Chromosome Research : An International Journal on the
Molecular, Supramolecular and Evolutionary Aspects of Chromosome
Biology, 5(1), 66-68.
Redon, C., Pilch, D., Rogakou, E., Sedelnikova, O., Newrock, K., & Bonner, W.
(2002). Histone H2A variants H2AX and H2AZ. Current Opinion in
Genetics & Development, 12(2), 162-169.
Redon, C., Pilch, D., Rogakou, E., Sedelnikova, O., Newrock, K., & Bonner, W.
(2002). Histone H2A variants H2AX and H2AZ. Current Opinion in
Genetics & Development, 12(2), 162-169.
Reik, W., Dean, W., & Walter, J. (2001). Epigenetic reprogramming in
mammalian development. Science (New York, N.Y.), 293(5532), 1089-1093.
Reik, W., & Lewis, A. (2005). Co-evolution of X-chromosome inactivation and
imprinting in mammals. Nature Reviews.Genetics, 6(5), 403-410.
Roeder, G. S. (1997). Meiotic chromosomes: It takes two to tango. Genes &
Development, 11(20), 2600-2621.
Roeder, G. S., & Bailis, J. M. (2000). The pachytene checkpoint. Trends in
Genetics : TIG, 16(9), 395-403.
Romanienko, P. J., & Camerini-Otero, R. D. (2000). The mouse Spo11 gene is
required for meiotic chromosome synapsis. Molecular Cell, 6(5), 975-987.
Romanienko, P. J., & Camerini-Otero, R. D. (2000). The mouse Spo11 gene is
required for meiotic chromosome synapsis. Molecular Cell, 6(5), 975-987.
Saferali, A., Berlivet, S., Schimenti, J., Bartolomei, M. S., Taketo, T., &
Naumova, A. K. (2010). Defective imprint resetting in carriers of
robertsonian translocation rb (8.12). Mammalian Genome : Official Journal
of the International Mammalian Genome Society, 21(7-8), 377-387.
114
Santenard, A., & Torres-Padilla, M. E. (2009). Epigenetic reprogramming in
mammalian reproduction: Contribution from histone variants. Epigenetics :
Official Journal of the DNA Methylation Society, 4(2), 80-84.
Santenard, A., Ziegler-Birling, C., Koch, M., Tora, L., Bannister, A. J., & TorresPadilla, M. E. (2010). Heterochromatin formation in the mouse embryo
requires critical residues of the histone variant H3.3. Nature Cell
Biology, 12(9), 853-862.
Sassone-Corsi, P. (2002). Unique chromatin remodeling and transcriptional
regulation in spermatogenesis. Science (New York, N.Y.), 296(5576), 21762178.
Seisenberger, S., Andrews, S., Krueger, F., Arand, J., Walter, J., Santos, F., et al.
(2012). The dynamics of genome-wide DNA methylation reprogramming in
mouse primordial germ cells. Molecular Cell, 48(6), 849-862.
Shaffer, L. G., & Lupski, J. R. (2000). Molecular mechanisms for constitutional
chromosomal rearrangements in humans. Annual Review of Genetics, 34,
297-329.
Solari, A. J. (1974). The behavior of the XY pair in mammals. International
Review of Cytology, 38(0), 273-317.
Stasiak, A., & Egelman, E. H. (1994). Structure and function of RecA-DNA
complexes. Experientia, 50(3), 192-203.
Stein, G., Park, W., Thrall, C., Mans, R., & Stein, J. (1975). Regulation of cell
cycle stage-specific transcription of histone genes from chromatin by nonhistone chromosomal proteins. Nature, 257(5529), 764-767.
Svetlova, M. P., Solovjeva, L. V., & Tomilin, N. V. (2010). Mechanism of
elimination of phosphorylated histone H2AX from chromatin after repair of
DNA double-strand breaks. Mutation Research, 685(1-2), 54-60.
Szenker, E., Ray-Gallet, D., & Almouzni, G. (2011). The double face of the
histone variant H3.3. Cell Research, 21(3), 421-434.
Talbert, P. B., & Henikoff, S. (2010). Histone variants--ancient wrap artists of the
epigenome. Nature Reviews.Molecular Cell Biology, 11(4), 264-275.
Trasler, J. M. (2009). Epigenetics in spermatogenesis. Molecular and Cellular
Endocrinology, 306(1-2), 33-36.
Tsuzuki, T., Fujii, Y., Sakumi, K., Tominaga, Y., Nakao, K., Sekiguchi, M., et al.
(1996). Targeted disruption of the Rad51 gene leads to lethality in embryonic
115
mice. Proceedings of the National Academy of Sciences of the United States
of America, 93(13), 6236-6240.
Turner, J. M. (2007). Meiotic sex chromosome inactivation. Development
(Cambridge, England), 134(10), 1823-1831.
Turner, J. M., Aprelikova, O., Xu, X., Wang, R., Kim, S., Chandramouli, G. V., et
al. (2004). BRCA1, histone H2AX phosphorylation, and male meiotic sex
chromosome inactivation. Current Biology : CB, 14(23), 2135-2142.
Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., & Burgoyne, P. S.
(2006). Pachytene asynapsis drives meiotic sex chromosome inactivation and
leads to substantial postmeiotic repression in spermatids. Developmental
Cell, 10(4), 521-529.
Turner, J. M., Mahadevaiah, S. K., Fernandez-Capetillo, O., Nussenzweig, A.,
Xu, X., Deng, C. X., et al. (2005). Silencing of unsynapsed meiotic
chromosomes in the mouse. Nature Genetics, 37(1), 41-47.
van den Bosch, M., Lohman, P. H., & Pastink, A. (2002). DNA double-strand
break repair by homologous recombination. Biological Chemistry, 383(6),
873-892.
van der Heijden, G. W., Derijck, A. A., Posfai, E., Giele, M., Pelczar, P., Ramos,
L., et al. (2007). Chromosome-wide nucleosome replacement and H3.3
incorporation during mammalian meiotic sex chromosome
inactivation. Nature Genetics, 39(2), 251-258.
von Wettstein, D. (1984). The synaptonemal complex and genetic
segregation. Symposia of the Society for Experimental Biology, 38, 195-231.
Weiss, R. S., Kostrub, C. F., Enoch, T., & Leder, P. (1999). Mouse Hus1, a
homolog of the schizosaccharomyces pombe hus1+ cell cycle checkpoint
gene. Genomics, 59(1), 32-39.
Western, P. S., Miles, D. C., van den Bergen, J. A., Burton, M., & Sinclair, A. H.
(2008). Dynamic regulation of mitotic arrest in fetal male germ cells. Stem
Cells (Dayton, Ohio), 26(2), 339-347.
Wykes, S. M., & Krawetz, S. A. (2003). The structural organization of sperm
chromatin. The Journal of Biological Chemistry, 278(32), 29471-29477.
Yoshida, K., Kondoh, G., Matsuda, Y., Habu, T., Nishimune, Y., & Morita, T.
(1998). The mouse RecA-like gene Dmc1 is require
116