From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
RAPID COMMUNICATION
Nonimmunoglobulin Gene Hypermutation in Germinal Center B Cells
By Huai-Zheng Peng, Ming-Qing Du, Athanasios Koulis, Antonella Aiello,
Ahmet Dogan, Lang-Xing Pan, and Peter G. Isaacson
Somatic hypermutation is the most critical mechanism underlying the diversification of Ig genes. Although mutation
occurs specifically in B cells during the germinal center
reaction, it remains a matter of debate whether the mutation
machinery also targets non-Ig genes. We have studied
mutations in the 58 noncoding region of the Bcl6 gene in
different subtypes of lymphomas. We found frequent hypermutation in follicular lymphoma (25 of 59 ⴝ 42%) (germinal
center cell origin) and mucosa-associated lymphoid tissue
(MALT) lymphoma (19 of 45 ⴝ 42%) (postgerminal center),
but only occasionally in mantle cell lymphoma (1 of
21 ⴝ 4.8%) (pregerminal center). Most mutations were outside the motifs potentially important for transcription, sug-
T
HE GENERATION of highly diverse antibodies with high
affinity is the key element of acquired immunity. This is
primarily achieved by sequential somatic alterations of the Ig
genes during B-cell development.1 Functional Ig genes are first
generated by recombination of the germline Ig building blocks,
ie, the variable (V), diversity (D), and joining (J) segments,
during which random nucleotides are inserted into the VD and
DJ junctions to increase diversity.1,2 After antigen exposure,
somatic hypermutations are introduced into the rearranged Ig
genes.1 B cells expressing antibodies with high affinity to
exogenous antigens are positively selected, whereas those
failing to express high-affinity antibodies or expressing those
recognizing autoantigens are eliminated.1,3
Somatic hypermutations occur specifically in B cells during
the germinal center reaction and are exclusively found within 2
kb downstream of the Ig promoter, with the great majority in
and around the rearranged V genes.3,4 The mutation process
appears to target certain specific sequence motifs, such as
RGYW (A/G G C/T A/T).5 In addition, the nucleotides vulnerable for mutation may be associated with the features of the
neighboring sequences, such as repeat sequences and/or
palindromic structures.6,7 Although the mechanisms underlying
the mutation process are not fully understood, the research to
date indicates that mutation activity is coupled with the
transcription process but does not depend specifically on the
presence of the Ig promoter or the Ig coding sequence.8,9
Whether the mutation process depends specifically on the Ig
enhancer elements remains to be tested. Somatic hypermutation
of the Ig gene is believed to be a locus-specific, differentiationstage specific, and lineage-specific phenomenon. However, in
view of the fact that the Ig promoter and coding sequence are
not specifically required, the hypermutation process may not
target only the Ig gene. We have studied mutations in the 58
noncoding region of the Bcl6 gene in various B-cell lymphomas
and different cell populations microdissected from normal
lymphoid follicles and found unequivocal evidence of non-Ig
gene mutation in normal germinal center but not in naive mantle
B cells.
Blood, Vol 93, No 7 (April 1), 1999: pp 2167-2172
gesting they were not important in lymphomagenesis but
may, like Ig mutation, represent an inherent feature of the
lymphoma precursor cells. Therefore, we investigated their
normal cell counterparts microdissected from a reactive
tonsil. Bcl6 mutation was found in 13 of 24 (54%) clones from
the germinal centre but only in 1 of 24 (4%) clones from the
naive B cells of the mantle zone. The frequency, distribution,
and nature of these mutations were similar to those resulting from the Ig hypermutation process. The results show
unequivocal evidence of non-Ig gene hypermutation in germinal center B cells and provide fresh insights into the process
of hypermutation and lymphomagenesis.
r 1999 by The American Society of Hematology.
MATERIALS AND METHODS
Materials. Frozen and paraffin-embedded tissue blocks from 125
cases of lymphoma were retrieved from the Department of Histopathology, University College London Medical School. They comprised 59
follicular, 45 mucosa-associated lymphoid tissue (MALT), and 21
mantle cell lymphomas. Frozen tonsil tissue from a 25-year-old woman
was also retrieved from the departmental tissue bank.
Microdissection and DNA extraction. The percentage of malignant
cells was estimated by histological examination. The follicular
and mantle cell lymphomas contained at least 60% tumor cells,
whereas most MALT lymphomas contained only 10% to 60% of
tumor cells. For these latter cases, tumor cells were enriched
by microdissection.10 Germinal center and mantle B cells were separately microdissected from a frozen section of tonsil immuno-stained
for IgD (Fig 1). DNA extraction was performed as described elsewhere.10,11
Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). The 58 noncoding region (a 1.3-kb fragment 112
bp downstream of the promoter) of the Bcl6 gene was amplified by five
different overlapped PCR reactions using the previously published
primer sets (E1.7, E1.8, E1.10, E1.11, and E1.12, Fig 2A).12 The PCR
reaction mix consisted of 1 µL DNA extract, 10 mmol/L Tris (pH 8.3),
50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1% Triton X-100, 200 µmol/L of
each dNTP, 5 pmol of each primer, 0.001% gelatin, and 0.25 U Taq
From the Department of Histopathology, University College London
Medical School, London, UK; and Divisione Di Anatomia Patologica,
Istituto Nazionale Tumori, Milano, Italy.
Submitted November 12, 1998; accepted January 18, 1999.
Supported by the Cancer Research Campaign (CRC, Grant No.
SP1758, United Kingdom) and Leukemia Research Fund (LRF, 9609,
United Kingdom), and Associazionr Italiana per la Ricerca sul Cancro
(AIRC, Italy).
Address reprint requests to Ming-Qing Du, PhD, Department of
Histopathology, University College London Medical School, Rockefeller
Bldg, University St, London WC1E 6JJ, UK; e-mail:[email protected].
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1999 by The American Society of Hematology.
0006-4971/99/9307-0053$3.00/0
2167
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2168
PENG ET AL
FF), denatured at 99°C for 5 minutes on a hot plate, and separated on the
Genphor electrophoresis system (Amersham-Pharmacia Biotech, Little
Chalfont, UK) under 15 W constant power for 2 to 3 hours at 5°C.
Sequencing and sequence analysis. The PCR products showing
altered SSCP patterns were purified using the Wizard PCR purification
system (Promega) and directly sequenced using an ABI 377 sequencer
(Perkin Elmer, Warrington, UK) with dye terminators, according to the
manufacturer’s protocol. Mutations were identified by comparison with
the published Bcl6 gene sequence (Z79581) using web-based BLAST
programme (http://www.ncbi.nih.gov/blast). The RGYW hot motif and
features of the neighboring sequences, such as repeat sequences and
palindromic structures, in the region with mutations were analysed by
sequence searching and/or using Wisconsin GCG software (Human
Genomic Mapping Project, Cambridge, UK), as described previously.5-7
RESULTS
Fig 1. Microdissection of germinal center (A) and naive B cells (B)
of the mantle zone. Frozen sections of a tonsil were immuno-stained
for IgD to highlight mantle cells. Germinal center cells were directly
microdissected (the hole), whereas mantle cells were first isolated
(the island) then harvested.
polymerase (Promega, Southampton, UK) in a total volume of 25 µL.
Amplification was performed on a thermal cycler (Hybaid, Teddington,
UK) using a hot-start procedure,13 followed by a touch down program,
comprising a cycle of 94°C for 30 seconds, 66°C (then reducing 1°C per
cycle to 56°C) for 30 seconds and 72°C for 45 seconds, and 35 further
cycles with an annealing temperature of 55°C. PCR products (3 µL)
were checked for yield and size on 1% agarose gels before further
analysis.
For cell populations microdissected from tonsil, the 1.3-kb fragment
of the 58 noncoding region of the Bcl6 gene was amplified using primers
GGAAAGCAAAGCGCACTC and CACGATACTTCATCTCATC. In
addition, a fragment of 151 bp from the coding region of the
house-keeping gene iduronate 2-sulfatase (IDS) (humids.gp_pr) was
amplified as a control, using primers CCAAAGAAGGGAGGGTCCAC and AGACCAGCTATACGGAGAATCACC. Both Bcl6 and IDS
PCR products were cloned into pGEM-T vector and transformed into
JM109 competent cells (Promega). The resulting colonies were boiled
in 50 µL of distilled water at 95°C for 10 minutes before a brief
centrifuge and 1 µL of the subsequent supernatant was used as template
for PCR amplification as above.
For SSCP analysis, 2 µL of PCR products was mixed with 4 µL
sequencing loading buffer (98% formamide, 10 mmol/L NaOH, 20
mmol/L EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol
Bcl6 gene is mutated in lymphomas derived from antigen
experienced but not in those from naive B cells. Following a
recent report of somatic mutation in the 58 noncoding region of
the Bcl6 gene in follicular lymphoma,12 we screened this region
for mutation in various lymphomas derived from B cells at
different maturation stages using PCR-SSCP and sequencing.
Mutation was frequently found in follicular (25 of 59 ⫽ 42%)
and MALT (19 of 45 ⫽ 42%) lymphomas, both of which are
derived from antigen-experienced B cells. However, mutation
was only occasionally observed in mantle cell (1 of 21 ⫽ 4.8%)
lymphomas, which originate from naive B cells (Table 1). Most
mutations were outside the motifs potentially important for
transcription. Details of these mutations are presented below.
Bcl6 is mutated in normal germinal center but not in naive B
cells. To examine whether Bcl6 mutation also occurs in
normal B cells, the 1.3-kb fragment of the 58 noncoding region
of the Bcl6 gene, together with a fragment of 151 bp of the
housekeeping gene IDS, was PCR-amplified and cloned from
microdissected germinal center and mantle B cells. In initial
experiments, DNA from four colonies was mixed and subjected
to PCR-SSCP and a total of 96 clones from each cell population
were screened for Bcl6 mutation. Single or multiple abnormal
SSCP bands were observed in each mixture from germinal
center B cells, but in only one from the naive B cells of the
mantle zone. Subsequently, we repeated the PCR-SSCP analysis of the Bcl6 gene on 24 single colonies from each cell
population, followed by sequencing. Mutation was found in 13
clones (13 of 48 ⫽ 54%) from the germinal center but only in 1
(1 of 24 ⫽ 4%) from mantle cells (Fig 3). However, no mutation
was found in 48 clones of the control gene IDS from either cell
population.
Bcl6 mutations resemble those found in the rearranged Ig
gene. Because the Bcl6 mutations found in follicular and
MALT lymphoma most likely inherited from their malignant
precursor cells, like the Ig gene mutation, and there was no
significant difference in the characteristics of Bcl6 mutation
between these lymphomas and germinal center B cells as shown
by separate analysis, the data were thus combined. In total, 103
mutations were found among 56 Bcl6 sequences (mutations
from mantle cell lymphoma and normal mantle cells were not
included). The distribution of these mutations was nonrandom.
The great majority (83 of 103 ⫽ 80.6%) were localized in a
region of 603 bp spanning the E1.10 and E1.12 (Fig 2B) and the
overall frequency of mutation in this region was 11.3 ⫻
10⫺4/bp. The details of the mutation frequency in different
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
NON-Ig GENE HYPERMUTATION
2169
Fig 2. The schematic illustration of the positions of the PCR
primers (A) and the distribution
of the somatic mutation in the 58
noncoding region of the Bcl6
gene (B). MCL, mantle cell lymphoma; FL, follicular lymphoma;
MALT, MALT lymphoma; MC,
mantle cell; FC, follicle centre
cell. (<) Mutation.
lymphomas and normal cell populations of a reactive tonsil are
shown in Table 1. Mutations were nearly exclusively single
substitutions, with only one being a deletion. The majority of
the substitutions (60%) were caused by transition mutations, of
which a major portion were T to C. Details of these mutations
are presented in Table 2. A substantial proportion of substitutions (48%) were within or flanked by the mutation hot motif
RGYW (A/G G C/T A/T) found in the Ig gene on both sides.5
Interestingly, all mutations were also within the stem of an
imperfect palindromic (hairpin) structure, and/or close to a
repeat sequence, by the previous described standards6,7 (Fig 4).
Multiple mutations (2-4), frequently within a short sequence
(⬍100 bp), were observed in 31 Bcl6 sequences, accounting for
54% of the mutants. Among germinal center B cells, two
distinct mutations were shared by two pairs of clones, respectively.
DISCUSSION
Following a recent report of somatic mutation in the 58
noncoding region of the Bcl6 gene in follicular lymphoma,12 we
examined the same region for mutation in various lymphomas
derived from B cells at different maturation stages. Mutation
was frequently found in lymphomas deriving from antigenexperienced B cells, namely follicular and MALT lymphomas,
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2170
PENG ET AL
Table 1. Frequencies of Bcl6 Mutation in Lymphoma
and Normal B Cells
Mutation Frequency*
Lymphoma
MCL
FL
MALT
Normal
MC
FC
Mutated
Cases/Clones
(%)
Whole Region
(1.3 kb)
Hot-Spot
Region
(603 bp)
1/21 (4.8)
25/59 (42)
19/45 (42)
0.37 ⫻ 10⫺4/bp
6.0 ⫻ 10⫺4/bp
6.0 ⫻ 10⫺4/bp
0 ⫻ 10⫺4/bp
9.28 ⫻ 10⫺4/bp
11.4 ⫻ 10⫺4/bp
1/24 (4)
13/24 (54)
0.32 ⫻ 10⫺4/bp
7.1 ⫻ 10⫺4/bp
0.69 ⫻ 10⫺4/bp
13.1 ⫻ 10⫺4/bp
Abbreviations: MCL, mantle cell lymphoma; FL, follicular lymphoma; MALT, MALT lymphoma; MC, mantle cell; FC, follicle center
cell.
*The mutation frequencies were calculated according to the formula: No. of Mutations/No. of Cases (clones) ⫻ Sequence Length
Tested.
but only occasionally in mantle cell lymphomas originating
from naive B cells. Most of these mutations were outside the
motifs potentially important for Bcl6 transcription.14 This,
together with the rarity or absence of t(3;14)(q27;q32) and Bcl6
rearrangement in these low-grade lymphomas,15-17 suggests that
the observed mutations were not important in lymphomagenesis
but may, like Ig mutation, represent an inherent mutation
signature of the lymphoma precursor cells.18 To investigate this,
we therefore examined their normal cell counterparts.
As expected, similar Bcl6 mutations were found in germinal
center but not in naive B cells of the mantle zone. Most or all of
Fig 3. PCR-SSCP analysis of the 58 noncoding region E1.11 of the
Bcl6 gene in a reactive tonsil. Abnormal SSCP bands were shown in
clones 1, 2, 4, 5, 10, 16, and 17 from follicular center cell (B), but in
none from mantle cell (A) populations.
Table 2. Nature of Bcl6 Mutations
A
A=
C=
G=
T=
Total (%)
—
3
10
8
21 (20%)
C
1
—
5
41
47 (45%)
G
6
12
—
6
24 (23%)
T
6
6
1
—
13 (12%)
these mutations were of somatic origin rather than due to a PCR
error, because no mutations were found in 48 IDS clones and
the estimated PCR error rate is less than 0.01% in our
experimental system.19,20 Several features of these Bcl6 mutations resemble those found in the Ig gene as follows. (1)
Nonrandom distribution: the majority of Bcl6 mutations localize in a region of 603 bp, 723 bp downstream of the promoter,
which is in line with that of the rearranged Ig gene. In addition,
48% of mutations are within or flanked by the Ig mutation hot
motif RGYW. (2) High frequency: the incidence of mutation in
the hot region of the Bcl6 gene was 11.3 ⫻ 10⫺4/bp, which is far
above the estimated PCR error rate in our system,19,20 although
about 100 times lower than that of the Ig gene in the germinal
center B cells (about 10%).8,21,22 (3) Nature of the mutations:
like the Ig mutation, most Bcl6 mutations were single substitutions, mainly due to transitions. (4) Clustering: multiple mutations within a short stretch of sequence were frequently found in
the Bcl6 gene. More strikingly, some of the Bcl6 sequences
from the germinal center B cells showed both common and
unique mutations, resembling the intraclonal variations of the Ig
gene found in normal germinal center B cells.22 (5) Effects of
neighboring sequences: Mutation of the Bcl6 gene was frequently within the stem of an imperfect hairpin structure or
close to a repeat sequence. Although these structures may not
template the mutation because mismatch repair is not closely
involved in the hypermutation process,23-25 it may induce
pausing of RNA polymerase during transcription elongation and
then result in the transfer of the putative mutator factor to this
region.8 Therefore, it appears likely that Bcl6 mutation may
result from the Ig hypermutation process.
While preparing this paper, two studies have reported the
occurrence of Bcl6 mutations in normal B cells.26,27 Unlike our
approach of examining microdissected germinal center and
mantle cells, they used isolated normal B cells from peripheral
blood or from tonsil and found Bcl6 mutation in 30% to 42% of
the memory but none in the naive B cells. The complimentary
data from this and the above-mentioned studies clearly indicate
that the Bcl6 mutations are introduced in germinal center B cells
and are subsequently inherited by their normal and malignant
derivatives.
The Ig hypermutation process may also target non-Ig genes
of the germinal center cells of non–B-lineage. Zheng et al28
examined germinal center T cells of the spleen from immunized
mice and found frequent somatic hypermutation in T-cell
receptor (TCR) ␣, but not in ␤, chain gene. Cheynier et al29
studied T cells of splenic white pulp from human immunodeficiency virus (HIV)-1–positive patients and demonstrated hypermutation in a proportion of TCR␤ gene clones. The frequency
of these TCR␤ mutations (1 to 5 ⫻ 10⫺4/bp) is similar to those
seen in the Bcl6 gene of the germinal center B cells. As in the
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
NON-Ig GENE HYPERMUTATION
2171
Fig 4. A T G A mutation in a follicular lymphoma
(FL). The proximity of the mutation to a (TTA)n
repeat sequence (underlined) and its localization to
the stem of an imperfect hairpin structure in the
germline (GL) sequence were shown in (A) and (B),
respectively.
Bcl6 mutations, the TCR gene mutations resemble those of the
Ig genes.
Although several features of Bcl6 and TCR mutations
resemble those of the Ig genes, there are important differences
in both the proportion of germinal center B cells with mutations
and the mutation frequency in the affected cells between the Ig
and non-Ig genes. In adults, the rearranged Ig gene is mutated in
most germinal center cells,18,21 whereas the Bcl6 gene is
mutated in only 30% to 50% and the TCR gene is only mutated
in 10% to 50% of germinal center T cells.28,29 The frequency of
both Bcl6 and TCR mutation are 100 times lower than that of
the Ig gene of the germinal center B cells. It thus appears that
the Ig hypermutation process may target non-Ig genes in both
germinal center B and T cells, but in an inefficient manner. This
may explain the heterogeneous incidence of Bcl6 mutations in
germinal center cells and their derivatives, and may also
underlie the lack of somatic mutations in other genes expressed
in germinal centers such as c-myc and S14 shown by Shen et
al.26 Study of the cis-acting element shared by the Ig and Bcl6
genes but not by c-myc and S14 may provide fresh insights into
the mechanism of Ig hypermutation.26
The finding of non-Ig gene hypermutation in normal germinal center B cells suggests imperfection of the Ig hypermutation
process. Theoretically, mutation could occur in the coding
region of other cellular genes, which are potentially important
in cell growth and survival. It is possible that in the case of
lethal mutation, the cell affected will die naturally, whereas in
the case of nonlethal mutation causing important cellular
biological alterations, such as growth properties, the cell
affected will usually be detected and deleted. However, if the
mutation escapes from immune surveillance, it may initiate
lymphomagenesis. In this context, it is particularly interesting
to note that follicular lymphomas, which are derived from
germinal center B cells, are the most common B-cell malignancy. Furthermore, a number of B-cell lymphoma subtypes
such as follicular and MALT show intimate interaction of tumor
cells with lymphoid follicles,30 where tumor cells frequently
show high-grade transformation30,31 and occasionally exhibit
positive p53 staining.32 It is tempting to speculate that the
‘‘infidelity’’ of the Ig hypermutation machinery to other cellular
genes may underlie, at least in part, the genesis and progression
of B-cell lymphomas associated with the germinal center
microenvironment.
ACKNOWLEDGMENT
We thank Dr T.C. Diss (Department of Histopathology, University
College London Medical School, London, UK) for critical reading of
the manuscript. We are also grateful to Daniela Papini (Divisione Di
Anatomia Patologica, Istituto Nazionale Tumori, Milano, Italy) for her
excellent support in sequencing.
REFERENCES
1. Rajewsky K: Clonal selection and learning in the antibody system.
Nature 381:751, 1996
2. Pascual V, Capra JD: Human Immunoglobulin heavy-chain variable region genes: organization, polymorphism, and expression. Advances in Immunology 49:1, 1991
3. Storb U: Progress in understanding the mechanism and consequences of somatic hypermutation. Immunol Rev 162:5, 1998
4. Dorner T, Foster SJ, Brezinschek H, Lipsky PE: Analysis of the
targeting of the hypermutational machinery and the impact of subsequent selection on the distriburtion of nucleotide changes in human
VHDJH rearrangements. Immunol Rev 162:161, 1998
5. Rogozin IB, Kolchanov NA: Somatic hypermutagenesis in immunoglobulin genes. II. Influence of neighbouring base sequences on
mutagenesis. Biochim Biophys Acta 1171:11, 1992
6. Golding GB, Gearhart PJ, Glickman BW: Patterns of somatic
mutations in immunoglobulin variable genes. Genetics 115:169, 1987
7. Winter DB, Gearhart PJ: Dual enigma of somatic hypermutation
of immunoglobulin variable genes: Targeting and mechanism. Immunol
Rev 162:89, 1998
8. Storb U, Peters A, Klotz E, Kim N, Shen HM, Hackett J, Rogerson
B, Martin TE: Cis-acting sequences that affect somatic hypermutation
of Ig genes. Immunol Rev 153, 1998
9. Neuberger MS, Ehrenstein MR, Klix N, Jolly CJ, Yelamos J, Rada
C, Milstein C: Monitoring and interpreting the intrinsic features of
somatic hypermutation. Immunol Rev 162:107, 1998
10. Pan LX, Diss TC, Peng HZ, Isaacson PG: Clonality analysis of
defined B-cell populations in archival tissue sections using microdissection and the polymerase chain reaction. Histopathology 24:323, 1994
11. Diss TC, Peng HZ, Wotherspoon AC, Isaacson PG, Pan L:
Detection of monoclonality in low-grade B-cell lymphomas using the
polymerase chain reaction is dependent on primer selection and
lymphoma type. J Pathol 169:291, 1993
12. Migliazza A, Martinotti S, Chen W, Fusco C, Ye BH, Knowles
DM, Offit K, Chaganti RS, Dalla Favera R: Frequent somatic hypermutation of the 58 noncoding region of the BCL6 gene in B-cell lymphoma.
Proc Natl Acad Sci USA 92:12520, 1995
13. Peng H, Chen G, Du M, Singh N, Isaacson PG, Pan L:
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2172
Replication error phenotype and p53 gene mutation in lymphomas of
mucosa-associated lymphoid tissue. Am J Pathol 148:643, 1996
14. Migliazza A, Ye BH, Fracchiolla N, Neri A, Baldi L, Chaganti
RSK, Dalla Favera R: Mutations of the 58 non-coding region of the
BCL-6 are common in B cell malignancies and can deregulate BCL-6
expression. Blood 90:780, 1997 (abstr)
15. Bernardin F, Collyn D, Quief S, Bastard C, Leprince D,
Kerckaert JP: Small deletions occur in highly conserved regions of the
LAZ3/BCL6 major translocation cluster in one case of non-Hodgkin’s
lymphoma without 3q27 translocation. Oncogene 14:849, 1997
16. Dalla Favera R, Ye BH, Lo Coco F, Chang CC, Cechova K,
Zhang J, Migliazza A, Mellado W, Niu H, Chaganti S, Chen W, Rao PH,
Parsa NZ, Louie DL, Offit K, Chaganti RSK: BCL-6 and the molecular
pathogenesis of B-cell lymphoma. Cold Spring Harb Symp Quant Biol
59:117, 1994
17. Otsuki T, Yano T, Clark HM, Bastard C, Kerckaert JP, Jaffe ES,
Raffeld M: Analysis of LAZ3 (BCL-6) status in B-cell non-Hodgkin’s
lymphomas: results of rearrangement and gene expression studies and a
mutational analysis of coding region sequences. Blood 85:2877, 1995
18. Klein U, Goossens T, Fischer M, Kanzler H, Braeuninger A,
Rajewsky K, Kuppers R: Somatic hypermutation in normal and
transformed human B cells. Immunol Rev 162:261, 1998
19. Ling LL, Keohavong P, Dias C, Thilly WG: Optimization of the
polymerase chain reaction with regard to fidelity: modified T7, Taq, and
vent DNA polymerases. PCR Methods Appl 1:63, 1991
20. Eckert KA, Kunkel TA: DNA polymerase fidelity and the
polymerase chain reaction. PCR Methods Appl 1:17, 1991
21. Kuppers R, Zhao M, Hansmann ML, Rajewsky K: Tracing B cell
development in human germinal centres by molecular analysis of single
cells picked from histological sections. EMBO J 12:4955, 1993
PENG ET AL
22. Jacob J, Kelsoe G, Rajewsky K, Weiss U: Intraclonal generation
of antibody mutants in germinal centres [see comments]. Nature
354:389, 1991
23. Kim N, Storb U: The role of DNA repair in somatic hypermutation of immunoglobulin genes. J Exp Med 187:1729, 1998
24. Wiesendanger M, Scharf MD, Edelmann W: Somatic hypermutation, transcription, and DNA mismatch repair. Cell 94:415, 1998
25. Kelsoe G: V(D)J hypermutation and DNA mismatch repair:
Vexed by fixation. Proc Natl Acad Sci USA 95:6576, 1998
26. Shen HM, Peters A, Baron B, Zhu X, Storb U: Mutation of
BCL-6 gene in normal B cells by the process of somatic hypermutations
of Ig genes. Science 280:1750, 1998
27. Pasqualucci L, Migliazza A, Fracchiolla N, William C, Neri A,
Baldini L, Chaganti RS, Klein U, Kuppers R, Rajewsky K, Dalla Favera
R: BCL-6 mutations in normal germinal center B cells: evidence of
somatic hypermutation acting outside Ig loci. Proc Natl Acad Sci USA
95:11816, 1998
28. Zheng B, Xue W, Kelsoe G: Locus-specific somatic hypermutation in germinal centre T cells. Nature 372:556, 1994
29. Cheynier R, Henrichwark S, Wain Hobson S: Somatic hypermutation of the T cell receptor V beta gene in microdissected splenic white
pulps from HIV-1-positive patients. Eur J Immunol 28:1604, 1998
30. Isaacson PG: Malignant lymphomas with a follicular growth
pattern. Histopathology 28:487, 1996
31. Peng H, Du M, Diss TC, Isaacson PG, Pan L: Genetic evidence
for a clonal link between low and high-grade components in gastric
MALT B-cell lymphoma. Histopathology 30:425, 1997
32. Du M, Peng H, Singh N, Isaacson PG, Pan L: The accumulation
of p53 abnormalities is associated with progression of mucosaassociated lymphoid tissue lymphoma. Blood 86:4587, 1995
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1999 93: 2167-2172
Nonimmunoglobulin Gene Hypermutation in Germinal Center B Cells
Huai-Zheng Peng, Ming-Qing Du, Athanasios Koulis, Antonella Aiello, Ahmet Dogan, Lang-Xing Pan and
Peter G. Isaacson
Updated information and services can be found at:
http://www.bloodjournal.org/content/93/7/2167.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.