Am J Physiol Heart Circ Physiol 306: H214–H224, 2014.
First published November 8, 2013; doi:10.1152/ajpheart.00310.2013.
Contractile protein expression is upregulated by reactive oxygen species in
aorta of Goto-Kakizaki rat
Sukrutha Chettimada,1 Hirotaka Ata,1 Dhwajbahadur K. Rawat,1 Salil Gulati,2 Andrea G. Kahn,3
John G. Edwards,4 and Sachin A. Gupte1
1
Department of Biochemistry and Molecular Biology, College of Medicine, University of South Alabama, Mobile, Alabama;
Department of Surgery, Plastic Surgery and Burn Division, College of Medicine, University of South Alabama, Mobile,
Alabama; 3Department of Pathology, College of Medicine, University of South Alabama, Mobile, Alabama; and 4Department
of Physiology, New York Medical College, Valhalla, New York
2
Submitted 8 April 2013; accepted in final form 28 October 2013
superoxide; hydrogen peroxide; microRNA; type 2 diabetes; vascular
smooth muscle; aortic smooth muscle cell line; smooth muscle phenotype
TYPE 2 DIABETES (T2D), which is currently a pandemic around
the world, is a major independent risk factor for cardiovascular
disease (13). Indeed, vasculopathies are the most commonly
observed clinical manifestation among diabetic individuals.
These vascular complications include hypertension, peripheral
arterial disease, atherosclerosis, and poor angiogenesis and
coronary artery collateral growth (13). Accumulating evidence
suggests that endothelial dysfunction is the primary cause of
vascular disease in diabetes, but effective treatments for T2D-
Address for reprint requests and other correspondence: S. A. Gupte, Dept. of
Pharmacology, BSB 546, New York Medical College, 15 Dana Rd., Valhalla,
NY 10595 (e-mail: [email protected]; [email protected]).
H214
associated vascular diseases remain lacking. For example, T2D
patients often have a poor outcome following thrombolytic
therapy and revascularization, and they have higher rates of
stent and graft failure after coronary angioplasty or coronary
artery bypass grafting surgery (32).
Many factors are involved in regulating the vascular structure-function relation. A delicate balance between endotheliumderived factors and signaling pathways in the underlying vascular smooth muscle cells (VSMCs) play a pivotal role in
tightly regulating the relaxation-contraction function that
maintains the basal vasomotor tone of the systemic arteries. It
is now thought that impaired endothelium-dependent relaxation of VSMCs and increased reactive oxygen species (ROS)
within VSMCs are contributors to coronary artery dysfunction
and disease in diabetes (5). We recently demonstrated that
decreased bioavailability of endothelium-derived nitric oxide
(NO) is a cause of vascular dysfunction in Goto-Kakizaki (GK)
rats, a prototype of mild T2D (15). NO signaling not only
regulates vascular tone but also inhibits platelet aggregation,
monocyte adhesion, VSMC migration and phenotypic modulation, and vascular remodeling (3, 11, 30).
Within smooth muscle, expression of the contractile phenotype is regulated by NO-protein kinase G (PKG) signaling (21)
and by the transcription factor serum response factor (SRF)
(25). SRF-dependent transcription of contractile protein genes
is regulated by two cotranscription factors, myocardin and
Krüppel-like factor (klf)-4, which respectively promote and
stall the transcription of contractile protein genes (23). In
addition, the expression of myocardin is upregulated by microRNA (miR)-145, whereas expression of klf-4 is downregulated by miR-1 and miR-145 (8). For those reasons, it is now
thought that events occurring between PKG signaling (7) and
the expression of either myocardin or klf-4 decide the phenotypic fate of VSMCs and hence the vessel’s structure-function
relation. Although NO levels reduced in type 1 and 2 diabetes
are known to cause vascular dysfunction, the consequences of
reducing NO and PKG-mediated signaling on the expression of
contractile proteins within the vasculature in nonobese type 2
diabetic animals and patients are not clearly known. Moreover,
what happens to miRs that mediate the expression of myocardin or klf-4 and their target proteins within the arteries of
nonobese type 2 diabetics has not yet been investigated. Our
hypothesis, therefore, was that the NO-PKG-dependent expression of smooth muscle contractile proteins is reduced and miRs
that regulate expression of myocardin and myocardin-dependent smooth muscle contractile protein genes downregulated in
the arteries of mildly diabetic GK rats. This switches the
0363-6135/14 Copyright © 2014 the American Physiological Society
http://www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Chettimada S, Ata H, Rawat DK, Gulati S, Kahn AG, Edwards
JG, Gupte SA. Contractile protein expression is upregulated by
reactive oxygen species in aorta of Goto-Kakizaki rat. Am J Physiol
Heart Circ Physiol 306: H214 –H224, 2014. First published November 8, 2013; doi:10.1152/ajpheart.00310.2013.—Although it is known
that blood vessels undergo remodeling in type 2 diabetes (T2D), the
signaling pathways that underlie the structural and functional changes
seen in diabetic arteries remain unclear. Our objective was to determine whether the remodeling in type 2 diabetic Goto-Kakizaki (GK)
rats is evoked by elevated reactive oxygen species (ROS). Our results
show that aortas from GK rats produced greater force (P ⬍ 0.05) in
response to stimulation with KCl and U46619 than aortas from Wistar
rats. Associated with these changes, aortic expression of contractile
proteins (measured as an index of remodeling) and the microRNA
(miR-145), which act to upregulate transcription of contractile protein
genes, was twofold higher (P ⬍ 0.05) in GK than Wistar (agematched control) rats, and there was a corresponding increase in ROS
and decrease in nitric oxide signaling. Oral administration of the
antioxidant Tempol (1 mmol/l) to Wistar and GK rats reduced (P ⬍
0.05) myocardin and calponin expression. Tempol (1 mmol/l) decreased expression of miR-145 in Wistar and GK rat aorta. To
elucidate the mechanism through which ROS increases miR-145, we
measured their levels in freshly isolated aorta and cultured aortic
smooth muscle cells incubated for 12 h in the presence of H2O2 (300
␮mol/l). H2O2 increased expression of miR-145, and there were
corresponding nuclear increases in myocardin, a miR-145 target
protein. Intriguingly, H2O2-induced expression of miR-145 was decreased by U0126 (10 ␮mol/l), a MEK1/2 inhibitor, and myocardin
was decreased by anti-miR-145 (50 nmol/l) and U0126 (10 ␮mol/l).
Our novel findings demonstrate that ROS evokes vascular wall remodeling and dysfunction by enhancing expression of contractile
proteins in T2D.
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
VSMC from differentiated to dedifferentiated phenotype, and
we speculate this contributes to vascular dysfunction in GK
rats.
MATERIALS AND METHODS
with 1⫻ PBS-Tween 20 and incubated with secondary antibody
(anti-mouse Alexa488 or Alexa568 and anti-rabbit Alexa568 or
Alexa488, Invitrogen) for 1 h at room temperature. After washing the
sections again, they were stained with 4,6-diamidino-2-phenylindole
(1 ␮g/ml) and mounted using DAKO mounting medium. Imaging was
done using a Nikon-A1 confocal microscope.
Immunohistochemical staining. Frozen sections of artery were
fixed in cold (4°C) acetone for 10 min. After being blocked for 10 min
in 3% hydrogen peroxidase and a biotin blocking system (DAKO), the
sections were incubated for 30 min, each first with the primary
antibody (DAKO monoclonal mouse anti-rat Ki-67 antibody, clone
MIB-5, 1:10 dilution) and then with a biotinylated horse anti-mouse
IgG (rat absorbed), which served as the secondary antibody (1:100
dilution; Vector). Peroxidase-conjugated streptavidin (DAKO) was
then used for detection, with diaminobenzidine serving as the chromogenic substrate and hematoxylin as a counterstain. The stain was
developed using a DAKO Autostainer Link 48 instrument (DAKO,
Carpinteria, CA).
Dihydroethidine fluorescence. Hydroethidine, an oxidative fluorescent dye, was used as we previously described to localize superoxide
production in situ (14, 15). In brief, vessels were incubated with
hydroethidine (5 ␮mol/l; at 37°C for 60 min) and then washed three
times, embedded in optimum cutting temperature medium and cryosectioned. Fluorescence images were captured using Nikon A1 confocal microscope equipped with a 60⫻ objective lens and were
analyzed using Nikon element imaging software. Ten to 15 fields/
vessel were analyzed using one image per field. The mean fluorescence intensities of ethidium-stained nuclei in the medial layer were
calculated for each vessel. Thereafter, the intensity values for each
animal in the group were averaged.
Chemiluminescence. ROS was determined using lucigenin and
luminol luminescence assay as previously described (34). In brief,
aortas were homogenized in ice-cold buffer, after which the protein
concentrations were determined using the Bradford method. To determine ROS, tissue homogenates (20 ␮l) were incubated at 37°C in
the presence of 5 ␮M lucigenin for the detection of O⫺
2 and 10 ␮M
luminol plus 1 ␮M horseradish peroxidase for the detection of H2O2
in a final volume of 200 ␮l of air-equilibrated Krebs solution buffered
with 10 mM HEPES-NaOH (pH 7.4). Chemiluminescence was determined using a microplate reader (Synergy 2 from BioTek Instruments,
Winooski, VT).
Statistical analysis. Values are presented as means ⫾ SE. ANOVA
and post hoc Fisher protected t-tests were used for analysis in all
studies of vascular contractility. All other data were analyzed using
Student’s t-tests or two-way ANOVA. Values of P ⬍ 0.05 were
considered significant. In all cases, the number of experimental
determinations (n) was equal to the number of rats from which aortas
were harvested for this study.
RESULTS
Aortas Isolated from GK Rats Generate Greater Maximum
Force than Those from Wistar Rats
Our first goal was to determine whether the aorta was
remodeled and contractile function of arteries was increased in
GK rats. We measured internal diameter and medial thickness
of the aorta isolated from GK and Wistar rats microscopically
and found that internal diameter was not different between GK
(1.2 ⫾ 0.3 mm) and Wistar (1.3 ⫾ 0.7 mm) rats but the media
of aorta from GK rats was thicker than Wistar rats (Fig. 1A).
We next determined the maximum force generation of rings of
endothelium-intact thoracic aorta in response to stimulation
with KCl (120 and 30 mmol/l) or the thromboxane A2 analog
U46619 (100 nmol/l). We found that aortic rings from GK rats
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Animal model. Male (3 mo old) euglycemic Wistar and diabetic GK
rats, a nonobese model of T2D (15), were used throughout this study.
Experimental protocols using animals had approval from the New
York Medical College (A3362-01) and University of South Alabama
(11036) Institutional Animal Care and Use Committees. Animals
were maintained in accordance with institutional polices and the
Public Health Service Policy on Humane Care and Use of Laboratory
Animals (revised 8/2002).
Vessel isolation and functional studies. To test for physiological
function and perform biochemical analysis in samples obtained from
the same animal, we used aorta instead of microvessels. Aortas were
isolated and vascular function was assessed as previously described
(15). In brief, thoracic aortas were excised, cut into ring segments 1.5
mm in length with internal diameters of 1.0 mm, and used for
measurements of isometric tension. Within a tissue bath the vessel
rings were superfused with Krebs buffer solution containing (in
mmol/l) 118 NaCl, 4.7 KCl, 1.5 CaCl2, 25 NaHCO3, 1.1 MgSO4, 1.2
KH2PO4, and 5.6 glucose at 37°C, gassed with 95% air and 5% CO2.
After an equilibration period of 1 h, during which an optimal passive
tension was applied to the rings (as determined from the vascular
length-tension relationship), the designed experiments were performed.
miR analysis. Total RNA was extracted from rat aorta and smooth
muscle cells (SMCs) using a miRNeasy kit (No. 217004, Qiagen).
TaqMan miR assays (Applied Biosystems, Foster City, CA) were
used to prepare cDNA from total RNA, after which quantitative PCR
was performed using TaqMan universal PCR master mix. Ct values
from standard curves were then used to quantify relative expression of
specific miR. All quantitative PCR reactions were performed in
triplicate. Standard curves for miR-1 and miR-145 were made using
synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequences: rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, rno-miR143: UGAGAUGAAGCACUGUAGCUC, rno-miR-21: UAGCUUAUCAGACUGAUGUUGA, rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG.
Western blot analysis. Proteins were extracted from frozen tissue in
lysis buffer, after which Western blot analysis using the specific
antibodies indicated in the individual lures was performed as previously described (2).
Nitrite measurements. Nitrite levels were measured using a colorimetric method. Aortas from Wistar and GK rats were crushed and
homogenized in lysis buffer containing 50 mmol/l Tris·HCl, 150
mmol/l NaCl (pH 7.4), and 0.5% Nonidet P-40. The resultant homogenates (25 ␮l) were incubated for 10 min in a 96-well plate with
Griess reagent 1 (50 ␮l of 2% sulphanilamide in 5% phosphoric acid)
and Griess reagent 2 [50 ␮l of 0.2% N-(1-naphthyl) ethylenediamine
dihydrochloride], after which absorbance was measured at 540 nm.
The nitrite concentration was then calculated using a standard curve
and normalized to the protein content determined using the Bradford
method. The standard curve was plotted using sodium nitrite.
PKG and vasodilator phosphoprotein phosphorylation. Tissue homogenates were subjected to Western blot analysis using anti-PKG
and antiphosphorylated vasodilator phosphoprotein (VASP) antibodies (Cell Signaling) to assess PKG-catalyzed phosphorylation of
VASP at Ser239 (p-VASP) (2).
Immunofluorescent staining. Frozen sections of artery were fixed in
acetone, and antigen-retrieval was accomplished using 0.1% Triton
X-100. After blocking the sections by incubation for 1 h in 5% normal
goat serum or 5% BSA at room temperature, they were incubated with
primary antibody overnight at 4°C. The sections were then washed
H215
H216
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
generated significantly more force than those from Wistar rats
in response to KCl or U46619 (Fig. 1B).
In another experiment, aortic rings were contracted using
two different doses of KCl. The rings were first primed using
KCl (120 mmol/l), then washed with normal Krebs solution,
and recontracted with KCl (30 mmol/l). This was followed by
washout with normal Krebs. After 15–20 min, normal Krebs
buffer was replaced with Ca2⫹-free Krebs buffer containing the
Ca2⫹-chelating agents EGTA (0.5 mmol/l) and BAPTA (0.2
mmol/l), and the rings were allowed to equilibrate in the
Ca2⫹-free solution for 20 min. Thereafter, we determined the
force generation elicited by U46619 (100 mmol/l). We found
that under Ca2⫹-free conditions, U46619 elicited greater (P ⬍
0.05) contractions in aortas from GK rats (Fig. 1C).
Additionally, we found that U46619-elicited contraction of
Wistar and GK rat aorta under Ca2⫹-free conditions was
Fig. 2. Oxidative stress is increased in GK rat
aorta: reactive oxygen species (ROS) production was assessed in aortas from Wistar and
GK rats based on dihydroethidium (DHE; 5
␮mol/l) staining and lucigenin chemiluminescence (5 ␮mol/l). A: representative images of
DHE staining of frozen sections of aorta
from Wistar and GK rats. Some sections
were pretreated without and with Tempol (1
mmol/l) for 30 min before DHE staining and
used as a positive and negative control. Images were collected using a CoolSnap CCD
camera attached to a Nikon A1 microscope
equipped with a 60⫻ water immersion objective. Scale bar ⫽ 50 ␮m. B: summary
data comparing DHE-positive nuclei/areas
in Wistar vs. GK rat aortas. C: lucigenin
chemiluminescence comparing aortic ROS
production in Wistar vs. GK rats in absence
and presence of Tempol (1 mmol/l) and
peg-catalase (Cat: 300 U/ml). AU, arbitrary
units. D: comparison of hydrogen peroxide
(H2O2) produced by Wistar vs. GK rat aorta
(n ⫽ 5 in each group). *P ⬍ 0.05 between
Wistar and GK vs. treatment groups; significance was calculated using Student’s t-test.
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Fig. 1. Aortas isolated from Goto-Kakizaki
(GK) rats generated greater maximum force
than those from Wistar rats. A: comparison
of aortic medial wall thickness between GK
and Wistar rat aorta. B: summary results
comparing force generation between aortas
from GK and Wistar rat in response to 120
and 30 mmol/l KCl (120K and 30K, respectively; n ⫽ 8) and U46619 (U4; 100 nmol/l;
n ⫽ 7). C and D: aortas from Wistar and GK
rats in response to stimulation with U46619
(100 nmol/l) under Ca2⫹-free conditions (C)
and upon readdition of Ca2⫹ (0.09 to 1.5
mol/l) (D). Statistical significance was determined using unpaired student’s t-test for
data in A–C, whereas statistical significance
in D was determined using 1-way ANOVA
and post hoc Bonferroni’s multiple comparison test.
H217
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
inhibited by Y-27632 (10 ␮mol/l), Rho kinase inhibitor, by
95.1 ⫾ 4.9 and 44.5 ⫾ 9.1%, respectively. Thereafter, in the
presence of U46619 when Ca2⫹ (0.09 –1.5 mmol/l) was added
back to the bath solution in dose-dependent fashion, the resultant dose-effect curve was shifted significantly upward with
aortas from GK rats, compared with Wistar rats (Fig. 1D).
ROS Are Increased in Aortas from GK Rats
PKG Expression and Activity Is Reduced in Aortas from GK
Rats
Endothelial function is compromised in diabetes. Potentially, hyperglycemia could remodel the intimal layer of the
arteries and inhibits endothelial NO biosynthesis. We found
there no was difference in the appearance/morphology of
lumen surface between GK and Wistar rats. We next estimated
nitrite levels, PKG expression as well as activity based on
VASP phosphorylation at S239, and determined peroxinitrite
by nitrotyrosine staining. We found that nitrite levels were
decreased (Fig. 3A) and nitrotyrosine staining (Fig. 3B) was
unchanged in GK compared with Wistar rat aorta. On those lines,
PKG expression (Fig. 3, C and D) and p-VASP levels were lower
in aortas from GK than Wistar rats (Fig. 3, E and F).
Fig. 3. Nitric oxide (NO) and phosphorylated vasodilator phosphoprotein (p-VASP)
levels in aortas from GK and Wistar rats.
A: nitrite (NOx) levels were measured using
a colorimetric assay. B: peroxinitrite formation was measured using nitrotyrosin staining. C–F: Western blot showing aortic levels
of protein kinase G (PHG) and p-VASP in
Wistar and GK rats. A representative blot
from among 3 experiments is shown. ␤-Actin served as a loading control. Summary
data showing that aortic expression of PKG
and p-VASP normalized by ␤-actin in GK
than Wistar rats (n ⫽ 4 to 5 in each group).
Significance was calculated using Student’s
t-test. T-Vasp, total VASP.
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Many studies, including ours, have shown that levels of
NADPH oxidase- and mitochondria-derived ROS are increased
in the vascular tissue of diabetics (34) and are known to alter
vascular function. Consistent with that finding, we observed
that ROS levels, as indicated by dihydroethidium (DHE) fluorescence, were increased approximately twofold (P ⬍ 0.05) in the
medial layer of aortas from diabetic GK rats (Fig. 2, A and B).
Tempol treatment (for 3 wk) decreased DHE fluorescence in
Wistar ⫹ Tempol (45 ⫾ 8 nuclei/␮m2) vs GK ⫹ Tempol
(26 ⫾ 4 nuclei/␮m2) rat aorta. Similarly, lucigenin chemiluminescence assays showed that ROS were ⬃2.5-fold higher
(P ⬍ 0.05) in aortic homogenates prepared from GK rats than
Wistar rats (Fig. 2C). On the other hand, incubating the
homogenates with Tempol (1 mmol/l; Fig. 2C), a spin trap that
scavenges superoxide and hydrogen peroxide (H2O2) and prevents formation of hydroxyl radicals (41), or pegalated-SOD
(100 U/ml; Wistar, 150 ⫾ 75; and GK,: 853 ⫾ 145 arbitrary
units) and pegalated-catalase (300 U/ml; Fig. 2C) decreased
(P ⬍ 0.05) lucigenin chemiluminescence in GK samples. On
those lines, ebselen (100 ␮mol/l), a glutathione peroxidase
mimetic that detoxifies H2O2 (16), reduced (P ⬍ 0.05) lucigenin chemiluminescence in GK samples by 52.8 and 55.7%,
respectively, as compared with untreated samples and almost
completely abolished (89.1 and 62.4%, respectively) ROS
production in aortic homogenates from Wistar rats. Furthermore, we found that GK rat aorta produced ⬃267 ␮mol/l H2O2
more than the Wistar rat aorta (Fig. 2D).
H218
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
Expression of Contractile Proteins Is Increased in Aortas
from GK Rats
Because NO-PKG signaling is known to upregulate contractile protein gene transcription, we used immunofluorescence
microscopy and immunoblotting to assess the expression of
contractile proteins in aortas from Wistar and GK rats. Unexpectedly, we found that expression of smooth muscle myosin
heavy chain (SM-MHC) (Fig. 4A, top) and SM22␣ (Fig. 4A,
middle) was higher in aortas (medial layer) from GK than
Wistar rats. Likewise, expression of myocardin, a co-transcription factor that regulates SM-MHC and SM22␣ expression in
VSMCs, was also higher in GK rats (Fig. 4A, bottom). Immunoblot analysis showed that aortic expression of calponin was
about fourfold (P ⬍ 0.05) higher in GK rats than Wistar rats (Fig.
4, B and C). By contrast, there were no differences in the
expression levels of GAPDH, an enzyme involved in glucose
metabolism, or ␤-actin, a cytoskeleton protein, between the two
rat types (Fig. 4B and D). Nor was there a difference in the
aortic expression of Ki-67 (Fig. 4E), a mitogenic marker that is
commonly used to determine cell proliferation, between GK
and Wistar rats.
Expression of Contractile Proteins in Aortas from GK Rats
Is Increased by ROS
To determine whether the contractile protein expression is
increased by elevated ROS seen in GK rats, we added Tempol
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Fig. 4. Aortic expression of contractile and
cell proliferative proteins in GK and Wistar
rats. A: immunohistochemical detection of
aortic expression of smooth muscle myosin
heavy chain (SM-MHC, top), SM22␣ (middle), and myocardin (Myoc, bottom) in GK
and Wistar rats. Nuclei are stained with 4,6diamidino-2-phenylindole (DAPI; blue), and
the autofluorescence from the laminae is
green. All images were captured using a
Nikon A1 microscope equipped with a 60⫻
water immersion objective. Scale bar ⫽ 50
␮m. B: Western blot analysis. The blot
shown is representative of 3 experiments
assessing aortic expression of calponin,
glyceraldehyde-6-phosphate dehydrogenase
(GAPDH), and ␤-actin in GK and Wistar
rats. ␤-Actin served as the loading control
was same from Fig. 3. C and D: summary
data showing calponin and GAPDH expression in GK than in Wistar rats. E: Ki67
staining in rat aorta (top) and in skin and
lungs (bottom). All images were captured
using a Nikon microscope equipped with a
20⫻ objective. Significance was calculated
using Student’s t-test.
H219
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
(1 mmol/l) to the rats’ drinking water for 3 wk and then
measured aortic myocardin and calponin levels compared with
untreated rats. We found that Tempol administration reduced
(P ⬍ 0.05) myocardin and calponin levels in aortas from GK
rats (Fig. 5, A–C). Tempol decreased medial thickness by
150 –175 ␮m and U46619-elicited contraction of GK rat aorta
in presence of extracellular Ca2⫹ (Fig. 5D).
Expression of miR-145 and miR-1 Increases in Aortas from
GK Rats
To further determine whether ROS increases miR expression, we incubated freshly isolated rat aorta with H2O2 (300
␮mol/l) in vitro for 12 h and measured miR-145 and miR-1
levels. H2O2 (300 ␮mol/l) increased miR-145 and decreased
miR-1 (Fig. 7).
Additionally, to find out whether H2O2 increased miR in the
SMCs, we incubated aortic SMCs for 12 h in the presence of
Tempol (1 mmol/l) and H2O2 (300 ␮mol/l). We found that
Tempol (1 mmol/l) decreased [control (Con), 0.48 ⫾ 0.02
pg/100 ␮g total RNA; and Tempol, 0.36 ⫾ 0.02 pg/100 ␮g
total RNA; P ⬍ 0.05, n ⫽ 9] and H2O2 increased (Fig. 8A) the
expression levels of miR-145 compared with untreated cells.
As p38 MAPK and ERK1/2 pathways regulate miR’s expression and because p-ERK1/2-to-total ERK ratio is increased
(P ⬍ 0.05; n ⫽ 4) in GK (2.33 ⫾ 0.064) compared with Wistar
(1.87 ⫾ 0.17) rat aorta, we determined the effect of U0126 (10
␮mol/l), widely used MEK1/2 inhibitor, on basal and H2O2
(300 ␮mol/l)-induced expression of miR-145 and its target
proteins myocardin. Interestingly, U0126 had no significant
effect on basal miR levels but decreased (P ⬍ 0.05) H2O2induced miR-145 (Fig. 8A) and not miR-1 (Con, 0.019 ⫾
0.002; H2O2, 0.012 ⫾ 0.004; and H2O2 ⫹ U0126, 0.021 ⫾
0.003 fg/100 ␮g total RNA; not significant, n ⫽ 7–9) after 12
h. Furthermore, immunofluorescent microscopy revealed that
H2O2 increased nuclear levels of myocardin (Fig. 8, B and C).
On the contrary, H2O2 decreased cytosolic levels of myocardin
(Con, 0.0005205 ⫾ 9.563e-005, n ⫽ 22; and H2O2, 0.0002124 ⫾
4.881e-005; n ⫽ 15). H2O2-induced increase of nuclear myocardin expression was decreased (P ⬍ 0.05) by U0126 (Fig. 8,
Fig. 5. Aortic expression of contractile proteins in GK and Wistar (W) rats treated with
Tempol (T, Temp, Tem). A–C: myocardin and
calponin expression in aorta from GK rats
treated with Tempol (1 mmol/l). D: comparison of U46619 (100 nmol/l)-induced contraction of aortic ring from GK rats untreated
and treated with Tempol (n ⫽ 4 to 5 in each
experiment). *P ⬍ 0.05 between Wistar and
GK; #P ⬍ 0.05 between GK and treatment
groups. Statistical significance between GK
and Wistar rat aortas was determined using
2-way ANOVA and post hoc Bonferroni’s
test. Con. control.
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Because miR-145 and miR-1 are known to upregulate contractile protein gene expression, we next measured miR expression in aortic tissue from Wistar and GK rats (Fig. 6A). We
found that levels of both miR-145 and miR-1 were increased (P
⬍ 0.05) in GK rat aortas (Fig. 6, A–C). miR-145/143 and
miR-1/133a are bicistronic miR clusters. Therefore, we estimated miR-143 and miR-133a levels in Wistar and GK rat
aorta (Fig. 6A), and found that miR-143 levels were slightly
increased (Wistar: 0.87 ⫾ 0.11 and GK: 1.22 ⫾ 0.17 pg/100
␮g total RNA; P ⬍ 0.05, n ⫽ 7) but miR-133a levels were
unchanged (Wistar: 0.42 ⫾ 0.02 and GK: 0.35 ⫾ 0.03 pg/100
␮g total RNA; not significant, n ⫽ 7) in GK compared with
Wistar rat aorta. Additionally, we found that miR-21 levels
were slightly but significantly elevated (Wistar: 0.95 ⫾ 0.10
and GK: 1.31 ⫾ 0.09 pg/100 ␮g total RNA; P ⬍ 0.05, n ⫽ 7)
in GK compared with Wistar rat aorta.
To determine whether this rise reflected the elevated ROS seen in
GK rats, we measured miR levels in aortic tissue from rats treated
with and without Tempol (1 mmol/l) for 3 wk. We found that Tempol
administration reduced (P ⬍ 0.05) miR-145 levels in aortas from
both GK and Wistar (Fig. 6B) rats, and that Tempol did not reduce
miR-1, but increased, in GK rats and Wistar rats (Fig. 6C).
Expression of miR-145 Is Increased in Aorta and Aortic
SMCs by H2O2 via MEK1/2 Pathway
H220
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
B and C), and by anti-miR-145 (50 nmol/l; 0.0085 ⫾ 0.0002)
pretreatment.
Additionally, in some studies, p38 MAPK (SB202190; 10
␮mol/l) and JNK (SP200169; 10 ␮mol/l) inhibitors were found
not to affect H2O2-induced miR-145 expression.
DISCUSSION
Fig. 6. Aortic levels of microRNAs (miRs) in GK and Wistar rats. Total RNA
was extracted from aortas from Wistar and GK rats, after which levels of miRs
expression were determined using 2-step RT-PCR (in triplicate). A: aortic
expression of miRs in GK rats. B and C: concurrently, GK rats treated with
Tempol (1 mmol/l) for 3 wk in drinking water decreased miR-145 and
increased miR-1 expression (n ⫽ 8 per group). *P ⬍ 0.05 between Wistar and
GK; #P ⬍ 0.05 between Wistar and GK vs. treatment groups. Significance was
calculated using Student’s t-test (A) and 2-way ANOVA (B and C).
Our findings demonstrate that generation of ROS, the expression of contractile proteins, and miR-145 levels were
increased in aortas from GK rats, a model of mild T2D. The
increase in ROS-induced contractile proteins presumably underlies the remodeling of the T2D aorta that led to enhanced
force generation. Our other significant findings suggest that
increases in ROS augment miR-145 expression and nuclear
levels of myocardin in VSMCs.
Studies have shown that ROS reduce the biological activity
of NO and inactivate soluble guanylate cyclase, thereby inhibiting NO-induced relaxation of vascular smooth muscle in
diabetic animal models and VSMCs (15, 34, 40). Consistent
with those earlier findings, our present results clearly demonstrate that ROS levels were increased by two- to threefold in
the medial smooth muscle layer of aortas (detected by DHE
staining) from GK rats, as well as in homogenates of whole
aorta (estimated by lucigenin chemiluminescence) from the
T2D animals. This elevation in ROS would be expected to
reduce nitrite and PKG activity and so inhibit vascular smooth
muscle relaxation (30, 40).
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Fig. 7. H2O2 increases expression of miR-145 and miR-1 in rat aorta. Total
RNA was extracted from freshly isolated rat aorta untreated or treated for 12
h with H2O2 (300 ␮mol/l; n ⫽ 5), after which expression of miR-145 was
assessed using 2-step RT-PCR (in triplicate). Expression of miR-145 (A) and
miR-1 (B) was increased and decreased, respectively, by H2O2. Significance
was calculated using Student’s t-test.
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
H221
Vascular inflammation, monocyte adhesion to smooth muscle, platelet coagulation, hyperproliferation, and VSMC migration have all been shown to contribute to vascular remodeling
in diabetes (6, 12, 17, 19, 31). Apart from controlling vasomotor function, NO and cGMP-PKG signaling also regulates
VSMC inflammation, phenotype, proliferation, and migration
(1, 4, 21). Activation of PKG via NO-cGMP signaling inhibits
cell migration and proliferation and increases expression of
contractile proteins (21). Given that endothelium-derived NOmediated relaxation (15) and nitrite/PKG/p-VASP levels (Fig.
3) were downregulated in aortas from GK rats, we anticipated
that aortic expression of contractile proteins would be lower
and expression of cell proliferative proteins would be higher in
GK than Wistar rats. To our surprise, however, aortic expression of myocardin, SM-MHC, SM22␣, and calponin was
significantly increased in GK rats, compared with Wistar rats.
There was no Ki67⫹ cell in GK as well as Wistar rat aortas.
This indicates that VSMCs were not in mitotic phase or
proliferating in rat aorta at the time of the experiment. Although these findings rule out that increase of contractile
protein expression in GK rat aorta was due to increase in cell
numbers, there is a plausibility that proliferation could have
occurred earlier and there could be more VSMCs in the medial
layer of GK rats compared with Wistar rats that could account
for the increased levels of contractile proteins. However, it is
highly unlikely that cell proliferation, if turned on, in diabetes
would abruptly stop, and hence there is alternate route/mechanism through which the contractile protein expression is
potentially increased in GK rat aortas. The expression of
transforming growth factor-␤ (TGF-␤) and platelet-derived
growth factor (PDGF) is increased in diabetes (26, 29, 37).
Given that these two mediators are known to control the
phenotype of VSMCs [e.g., TGF-␤ promotes expression of
contractile proteins (36)], we therefore speculate that they may
have contributed to the increases in myocardin, SM-MHC,
SM22␣, and calponin expression observed in GK rats. Consistent with that idea, activation of TGF-␤ signaling reportedly
increases miR-145 expression via SRF-myocardin in cultured
human coronary artery SMCs (24). Conversely, myocardin
expression is upregulated by miR-145 (8). Since anti-miR-145
suppressed H2O2-induced nuclear expression of myocardin
protein, it is safe to suggest that miR-145 promoted myocardin
expression in aortic SMCs. Elevation of myocardin also promotes transcription of SM-MHC and other contractile protein
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
Fig. 8. H2O2 increases expression of miR-145 and on nuclear levels of myocardin in A7r5 cells. Total RNA was extracted from A7r5 cells untreated or treated
for 12 h with H2O2 (300 ␮mol/l) or H2O2 ⫹ U0126 (10 ␮mol/l), after which expression of miR-145 was assessed using two-step-RT-PCR (in triplicate).
A: expression of miR-145 was increased by H2O2. Cotreatment with U0126 and H2O2 inhibited miR-145 expression. B: representative confocal images of
myocardin (green) staining in A7r5 cells untreated or treated for 12 h with H2O2 (300 ␮mol/l), H2O2 (300 ␮mol/l) ⫹ U0126 (10 ␮mol/l), and H2O2 (300 ␮mol/l) ⫹
anti-miR-145 (50 nmol/l). Nuclei were stained with DAPI (blue). C: summary data showing that nuclear myocardin was increased by H2O2 treatment. Data were
collected from A7r5 cells (4 to 5 fields) cultured on coverslips (n ⫽ 5 in each group). *P ⬍ 0.05 between Wistar and GK; #P ⬍ 0.05 between Wistar and GK
vs. treatment groups.
H222
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
which elevates myocardin, and they simultaneously facilitate
the increase of nuclear myocardin. Our results are opposite to
the previous findings showing miR-145 (detected by microarray analysis) decreased in cultured aortic SMCs isolated from
control rat aortas and incubated with H2O2 (200 ␮mol/l) for 6
h (20). We attribute these differences to the different: pathologies, doses of H2O2, duration of incubation periods, and
methodologies employed between our studies. Nonetheless,
our findings are consistent with studies that have shown that
ROS regulate the expression of some miRs involved in angiogenic pathways (33) and miR-21 involved in inhibiting apoptosis (20) in VSMCs. Furthermore, p38 MAPK and ERK1/2
pathways control miR expression (39). A recent study has
shown that the miR-133a-1/miR-1–2 and miR-133a-2/miR1–1, two bicistronic miR clusters expressed specifically in
cardiac and skeletal muscle (22), are also present in VSMCs
and miR-133a, but not miR-1, is downregulated via the PDGFinduced MEK-ERK pathway (38). We found that U0126, a
MEK1/2 inhibitor that inhibits ERK phosphorylation in rat
VSMCs (18), significantly decreased H2O2-induced miR-145
and myocardin, but not miR-1, expression in aortic SMCs.
Since U0126 decreased miR-145 and myocardin expression
after 12 and 48 h, respectively, this indicates MEK-ERK
pathway activated by H2O2 increased miR-145 that subsequently elevated myocardin expression. Coincidentally, ROS
and H2O2 also elicit contraction of coronary arteries by activating MEK-ERK pathway (27). We therefore suggest that
increase in H2O2-induced MEK1/2 activity selectively upregulated miR-145 and myocardin expression, and that they make
conditions conducive for the synthesis of contractile proteins
evoked by increased ROS in VSMCs and for the remodeling of
smooth muscle in GK rats.
Vascular complications are common in T2D. Endothelial
dysfunction leading to lower levels of endothelium-derived NO
signaling has been implicated as a probable cause of vasoconstriction in diabetes, although other studies have reported that
arteries are also structurally remodeled in T2D. Our novel
Fig. 9. Schematic illustration. Overall effect of ROS
signaling on miRs and contractile proteins in diabetic
arteries. Broken arrows demonstrate a novel ROS/
H2O2-dependent mechanism increased miR-145 expression that upregulated the contractile protein expression
in the type 2 diabetic rat aorta. Solid arrows represent
known information. Black and gray colored arrows
indicate positive and negative regulation, respectively.
SRF, serum response factor; ROCK, RhoA-Rho kinase;
MLC-P, myosin light chain phosphorylation; [Ca2⫹]i,
intracellular calcium concentration.
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
genes. MiR-1 and miR-145 that controls cardiac and smooth
muscle myocyte differentiation in turn reduces expression of
klf-4, a suppressor of the SRF-myocardin complex (8), thereby
increasing transcription of contractile protein genes (9). Interestingly, we observed that aortic miR-145 levels were higher in
GK than Wistar rats and that expression of miR-145 and
myocardin, but not miR-1, could be reduced by treating the rats
with Tempol, an antioxidant. Consistently, expression of miR21, which is upregulated by H2O2 in cultured aortic SMCs
(20), was slightly increased in GK compared with Wistar rat
aorta. Collectively, these results suggest that miR-145 and
miR-1 expression was differentially regulated and that expression of myocardin-dependent contractile proteins calponin and
SM-MHC, which potentiate vasoconstriction (10), is increased
via a ROS-miR-145 pathway in arterial smooth muscle. Since
GK rat aorta generated significantly higher force than Wistar
rat aorta in Ca2⫹-free condition and in presence of Rho kinase
inhibitor that almost completely inhibited U46619-induced
contraction of Wistar rat aorta, we suggest that increase in the
ROS-induced SM-MHC expression additionally contributed to
increase force generation in Ca2⫹- and Rho kinase-independent
manner in aorta from GK rats.
To test our hypothesis that elevated ROS increases miR-145
expression in smooth muscle, we examined the effect of H2O2
on miR-145 and miR-1 levels and their target protein, myocardin, in freshly isolated aorta from Wistar rat or cultured
aortic SMCs. Incubating aorta or aortic SMCs for 12 h in the
presence of 300 ␮mol/l H2O2, a concentration found in GK rat
aortas (see RESULTS) and often observed under pathophysiological conditions (28, 35), significantly increased expression
of miR-145 as well as nuclear myocardin levels. Conversely,
the antioxidant Tempol reduced expression of miR-145. These
findings, which were similar to what we found in Wistar and
GK rats, demonstrate that endogenous basal ROS production
supported miR-145 expression and that ROS exert twofold
effects on the mechanisms that regulate contractile protein
synthesis in aortic SMCs: they increase expression of miR-145,
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
findings demonstrate that elevated ROS selectively increases
expression of miR-145 that upregulates expression of contractile proteins in GK rat aorta. The resultant ROS-mediated
overexpression of contractile proteins in conduit arteries,
which along with decreased NO signaling, contributes to
VSMC contraction observed in non-obese T2D (Fig. 9).
ACKNOWLEDGMENTS
S. A. Gupte is the guarantor of this work, had full access to all the data, and
takes full responsibility for the integrity of data and the accuracy of data
analysis.
GRANTS
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
AUTHOR CONTRIBUTIONS
S.C., H.A., D.K.R., A.G.K., and J.G.E. performed experiments; S.C., H.A.,
A.G.K., and J.G.E. analyzed data; S.C., S.G., A.G.K., J.G.E., and S.A.G.
interpreted results of experiments; S.C. and H.A. prepared/lures; S.C. and
S.A.G. drafted manuscript; S.G., J.G.E., and S.A.G. edited and revised manuscript; J.G.E. and S.A.G. conception and design of research; S.A.G. approved
final version of manuscript.
REFERENCES
1. Ahanchi SS, Tsihlis ND, Kibbe MR. The role of nitric oxide in the
pathophysiology of intimal hyperplasia. J Vasc Surg 45, Suppl A: A64 –
A73, 2007.
2. Ata H, Rawat DK, Lincoln T, Gupte SA. Mechanism of glucose-6phosphate dehydrogenase-mediated regulation of coronary artery contractility. Am J Physiol Heart Circ Physiol 300: H2054 –H2063, 2011.
3. Bath PM, Hassall DG, Gladwin AM, Palmer RM, Martin JF. Nitric
oxide and prostacyclin. Divergence of inhibitory effects on monocyte
chemotaxis and adhesion to endothelium in vitro. Arterioscler Thromb 11:
254 –260, 1991.
4. Bian K, Doursout MF, Murad F. Vascular system: role of nitric oxide in
cardiovascular diseases. J Clin Hypertens (Greenwich) 10: 304 –310,
2008.
5. Ceriello A, Taboga C, Tonutti L, Quagliaro L, Piconi L, Bais B, Da
Ros R, Motz E. Evidence for an independent and cumulative effect of
postprandial hypertriglyceridemia and hyperglycemia on endothelial dysfunction and oxidative stress generation: effects of short- and long-term
simvastatin treatment. Circulation 106: 1211–1218, 2002.
6. Cheng ZJ, Vaskonen T, Tikkanen I, Nurminen K, Ruskoaho H,
Vapaatalo H, Muller D, Park JK, Luft FC, Mervaala EM. Endothelial
dysfunction and salt-sensitive hypertension in spontaneously diabetic
Goto-Kakizaki rats. Hypertension 37: 433–439, 2001.
7. Choi C, Sellak H, Brown FM, Lincoln TM. cGMP-dependent protein
kinase and the regulation of vascular smooth muscle cell gene expression:
possible involvement of Elk-1 sumoylation. Am J Physiol Heart Circ
Physiol 299: H1660 –H1670, 2010.
8. Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, Muth AN,
Lee TH, Miano JM, Ivey KN, Srivastava D. miR-145 and miR-143
regulate smooth muscle cell fate and plasticity. Nature 460: 705–710,
2009.
9. Deaton RA, Gan Q, Owens GK. Sp1-dependent activation of KLF4 is
required for PDGF-BB-induced phenotypic modulation of smooth muscle.
Am J Physiol Heart Circ Physiol 296: H1027–H1037, 2009.
10. Eddinger TJ, Meer DP. Single rabbit stomach smooth muscle cell
myosin heavy chain SMB expression and shortening velocity. Am J
Physiol Cell Physiol 280: C309 –C316, 2001.
11. Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromocyclic guanosine monophosphate inhibit mitogenesis and proliferation of
cultured rat vascular smooth muscle cells. J Clin Invest 83: 1774 –1777,
1989.
12. Gerrits AJ, Koekman CA, van Haeften TW, Akkerman JW. Platelet
tissue factor synthesis in type 2 diabetic patients is resistant to inhibition
by insulin. Diabetes 59: 1487–1495, 2010.
13. Grundy SM. Pre-diabetes, metabolic syndrome, and cardiovascular risk.
J Am Coll Cardiol 59: 635–643, 2012.
14. Gupte RS, Rawat DK, Chettimada S, Cioffi DL, Wolin MS, Gerthoffer WT, McMurtry IF, Gupte SA. Activation of glucose-6-phosphate
dehydrogenase promotes acute hypoxic pulmonary artery contraction. J
Biol Chem 285: 19561–19571, 2010.
15. Gupte S, Labinskyy N, Gupte R, Csiszar A, Ungvari Z, Edwards JG.
Role of NAD(P)H oxidase in superoxide generation and endothelial
dysfunction in Goto-Kakizaki (GK) rats as a model of nonobese NIDDM.
PLoS One 5: e11800, 2010.
16. Gupte SA, Kaminski PM, George S, Kouznestova L, Olson SC,
Mathew R, Hintze TH, Wolin MS. Peroxide generation by p47phox-Src
activation of Nox2 has a key role in protein kinase C-induced arterial
smooth muscle contraction. Am J Physiol Heart Circ Physiol 296: H1048 –
H1057, 2009.
17. Jager A, van Hinsbergh VW, Kostense PJ, Emeis JJ, Nijpels G,
Dekker JM, Heine RJ, Bouter LM, Stehouwer CD. Increased levels of
soluble vascular cell adhesion molecule 1 are associated with risk of
cardiovascular mortality in type 2 diabetes: the Hoorn study. Diabetes 49:
485–491, 2000.
18. Jiang B, Xu S, Brecher P, Cohen RA. Growth factors enhance interleukin-1 beta-induced persistent activation of nuclear factor-kappa B in rat
vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 22: 1811–
1816, 2002.
19. Kario K, Matsuo T, Kobayashi H, Matsuo M, Sakata T, Miyata T.
Activation of tissue factor-induced coagulation and endothelial cell dysfunction in non-insulin-dependent diabetic patients with microalbuminuria. Arterioscler Thromb Vasc Biol 15: 1114 –1120, 1995.
20. Lin Y, Liu X, Cheng Y, Yang J, Huo Y, Zhang C. Involvement of
MicroRNAs in hydrogen peroxide-mediated gene regulation and cellular
injury response in vascular smooth muscle cells. J Biol Chem 284:
7903–7913, 2009.
21. Lincoln TM, Wu X, Sellak H, Dey N, Choi CS. Regulation of vascular
smooth muscle cell phenotype by cyclic GMP and cyclic GMP-dependent
protein kinase. Front Biosci 11: 356 –367, 2006.
22. Liu N, Olson EN. MicroRNA regulatory networks in cardiovascular
development. Dev Cell 18: 510 –525, 2010.
23. Liu Y, Sinha S, McDonald OG, Shang Y, Hoofnagle MH, Owens GK.
Kruppel-like factor 4 abrogates myocardin-induced activation of smooth
muscle gene expression. J Biol Chem 280: 9719 –9727, 2005.
24. Long X, Miano JM. Transforming growth factor-beta1 (TGF-beta1)
utilizes distinct pathways for the transcriptional activation of microRNA
143/145 in human coronary artery smooth muscle cells. J Biol Chem 286:
30119 –30129, 2011.
25. Miano JM, Long X, Fujiwara K. Serum response factor: master regulator of the actin cytoskeleton and contractile apparatus. Am J Physiol Cell
Physiol 292: C70 –C81, 2007.
26. Mikhail N, Fukuda N, Tremblay J, Hamet P. Platelets, growth factors,
and vascular smooth-muscle cells in hypertension and diabetes. J Cardiovasc Pharmacol 22, Suppl 6: S64 –S74, 1993.
27. Oeckler RA, Kaminski PM, Wolin MS. Stretch enhances contraction of
bovine coronary arteries via an NAD(P)H oxidase-mediated activation of
the extracellular signal-regulated kinase mitogen-activated protein kinase
cascade. Circ Res 92: 23–31, 2003.
28. Oliveira-Marques V, Marinho HS, Cyrne L, Antunes F. Role of
hydrogen peroxide in NF-kappaB activation: from inducer to modulator.
Antioxid Redox Signal 11: 2223–2243, 2009.
29. Peterson MC. Circulating transforming growth factor beta-1: a partial
molecular explanation for associations between hypertension, diabetes,
obesity, smoking and human disease involving fibrosis. Med Sci Monit 11:
RA229 –RA232, 2005.
30. Radomski MW, Palmer RM, Moncada S. Comparative pharmacology
of endothelium-derived relaxing factor, nitric oxide and prostacyclin in
platelets. Br J Pharmacol 92: 181–187, 1987.
31. Ragolia L, Palaia T, Koutrouby TB, Maesaka JK. Inhibition of cell
cycle progression and migration of vascular smooth muscle cells by
prostaglandin D2 synthase: resistance in diabetic Goto-Kakizaki rats. Am
J Physiol Cell Physiol 287: C1273–C1281, 2004.
32. Roffi M, Angiolillo DJ, Kappetein AP. Current concepts on coronary
revascularization in diabetic patients. Eur Heart J 32: 2748 –2757, 2011.
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
This work was supported by National Heart, Lung, and Blood Institute
Grant RO1-HL-085352 (to S. A. Gupte).
H223
H224
H2O2, miRs, AND CONTRACTILE PROTEINS IN T2D
33. Sen CK, Gordillo GM, Khanna S, Roy S. Micromanaging vascular
biology: tiny microRNAs play big band. J Vasc Res 46: 527–540, 2009.
34. Serpillon S, Floyd BC, Gupte RS, George S, Kozicky M, Neito V,
Recchia F, Stanley W, Wolin MS, Gupte SA. Superoxide production by
NAD(P)H oxidase and mitochondria is increased in genetically obese and
hyperglycemic rat heart and aorta before the development of cardiac
dysfunction. The role of glucose-6-phosphate dehydrogenase-derived
NADPH. Am J Physiol Heart Circ Physiol 297: H153–H162, 2009.
35. Sies H. Intact organ spectrophotometry and single-photon counting. Arch
Toxicol 60: 138 –143, 1987.
36. Tang Y, Urs S, Boucher J, Bernaiche T, Venkatesh D, Spicer DB,
Vary CP, Liaw L. Notch and transforming growth factor-beta (TGFbeta)
signaling pathways cooperatively regulate vascular smooth muscle cell
differentiation. J Biol Chem 285: 17556 –17563, 2010.
37. Thomas JA, Deaton RA, Hastings NE, Shang Y, Moehle CW,
Eriksson U, Topouzis S, Wamhoff BR, Blackman BR, Owens GK.
PDGF-DD, a novel mediator of smooth muscle cell phenotypic mod-
38.
39.
40.
41.
ulation, is upregulated in endothelial cells exposed to atherosclerosisprone flow patterns. Am J Physiol Heart Circ Physiol 296: H442–
H452, 2009.
Torella D, Iaconetti C, Catalucci D, Ellison GM, Leone A, Waring CD,
Bochicchio A, Vicinanza C, Aquila I, Curcio A, Condorelli G, Indolfi
C. MicroRNA-133 controls vascular smooth muscle cell phenotypic
switch in vitro and vascular remodeling in vivo. Circ Res 109: 880 –893,
2011.
Ufer C, Wang CC, Borchert A, Heydeck D, Kuhn H. Redox control in
mammalian embryo development. Antioxid Redox Signal 13: 833–875,
2010.
Wang S, Lincoln TM, Murphy-Ullrich JE. Glucose downregulation of
PKG-I protein mediates increased thrombospondin1-dependent TGF-␤
activity in vascular smooth muscle cells. Am J Physiol Cell Physiol 298:
C1188 –C1197, 2010.
Wilcox CS. Effects of tempol and redox-cycling nitroxides in models of
oxidative stress. Pharmacol Ther 126: 119 –145, 2010.
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.5 on June 16, 2017
AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00310.2013 • www.ajpheart.org