J. Mol. Microbiol. Biotechnol. (2002) 4(5): 495–501.
JMMB Research article
The General Stress Protein Ctc of Bacillus subtilis
is a Ribosomal Protein
Matthias Schmalisch, Ines Langbein, and Jörg
Stülke*
Lehrstuhl für Mikrobiologie, Institut für Mikrobiologie,
Biochemie und Genetik der Friedrich-AlexanderUniversität Erlangen-Nürnberg, Staudtstr. 5, D-91058
Erlangen, Germany
Abstract
Cells respond to stress conditions by synthesizing
general or specific stress proteins. The Ctc protein
of Bacillus subtilis belongs to the general stress
proteins. The synthesis of Ctc is controlled by an
alternative s factor of RNA polymerase, sB . Sequence analyses revealed that Ctc is composed of
two domains, an N-terminal domain similar to the
ribosomal protein L25 of Escherichia coli, and a
C-terminal domain. The similarity of the N-terminal
domain of Ctc to L25 suggested that Ctc might be a
ribosomal protein in B. subtilis. The function of the
C-terminal domain is unknown. We purified Ctc to
homogeneity and used the pure protein to raise
antibodies. Western blot analyses demonstrate that
Ctc is induced under stress conditions and can be
found in ribosomes of B. subtilis. As observed for
its E. coli counterpart L25, Ctc is capable of binding
5S ribosomal RNA in a specific manner. The stressspecific localization of Ctc in B. subtilis ribosomes
and the sporulation defect of ctc mutants at high
temperatures suggest that Ctc might be required for
accurate translation under stress conditions.
Introduction
In soil, the natural habitat of Bacillus subtilis, the cells
are more often found in a non-growing than in a growing
state. Growing cells are often faced with nutrient limitations or different other stresses that result in the
cessation of growth. Exposure to any stress results in
the expression of specific proteins, the stress proteins.
These stress proteins may help the cells to adapt to the
actual stress but also to be prepared for future stresses.
While some stress proteins are synthesized only in
response to a specific stress such as heat shock or
heavy metal ions, others are expressed generally under
all stress conditions. The expression of these general
stress proteins depends in B. subtilis on the alternative
sigma factor, sB (Hecker et al., 1996).
General stress proteins and the genes encoding
them were identified by proteome, transcriptome and
*For correspondence. Email [email protected];
Tel. +49-9131-8528818; Fax. +49-9131-8528082.
# 2002 Horizon Scientific Press
promoter analyses. Altogether, these studies revealed
that more than 150 genes are under the control of sB in
B. subtilis (Bernhardt et al., 1997, Petersohn et al.,
1999, Price et al., 2001, Petersohn et al., 2001, Hecker
and Völker, 2001). Whereas intensive work has been
devoted to the elucidation of the regulatory network
that govern the activity of sB and thus the synthesis
of the general stress proteins, much less is known
about the function of the proteins of the sB regulon.
B. subtilis sigB mutants devoid of sB are viable as the
wild type but are impaired in resistance to severe oxidative, alkaline or heat stress (Antelmann et al., 1996;
Gaidenko and Price, 1998, Völker et al., 1999). Among
the general stress proteins with known functions are
the solute transporter OpuE, the catalase KatE, the
ClpC and ClpP protease subunits and several regulators of sB activity (Kempf and Bremer, 1998, Engelmann et al., 1995, Krüger et al., 1994, Gerth et al.,
1998, Benson and Haldenwang, 1992). About 100
proteins of the sB regulon are of unknown function.
Database analyses allowed to predict a function for
about 50 of these proteins, however, these predictions
need to be tested experimentally (Price et al., 2001).
The first gene known to be transcribed by RNA
polymerase carrying an alternative sigma factor was
ctc (Ollington et al., 1981). Expression of ctc is driven
by a sB -dependent promoter upstream of ctc (Hilden
et al., 1995). Upon stress, expression of ctc is about
10-fold induced. Thus, ctc is among the genes that are
most strongly induced by stress (Völker et al., 1994).
The high expression of ctc suggests an important
function for the Ctc protein, which is, however,
unknown so far. B. subtilis strains lacking a functional
ctc gene are viable under normal growth conditions but
they are impaired in sporulation at high temperature. In
addition, a ctc spoVG double mutant exhibits a growth
defect at 37! C which is not observed in ctc or spoVG
single mutant strains. However, the reason for the
effects of ctc mutations has so far remained obscure
(Truitt et al., 1988).
Based on its sequence, Ctc is composed of two
domains. The N-terminal domain of the protein shows a
significant similarity to the ribosomal protein L25 from
Escherichia coli (Stoldt et al., 1998). However, in many
bacteria there exist homologues of Ctc that contain
both the N-terminal (L25-like) and the C-terminal
domain. These proteins are exemplified by the ribosomal protein TL5 from Thermus thermophilus (Gryaznova et al., 1996). Proteins, which show similarity to the
C-terminal domain as well as proteins which consist
only of the C-terminal domain, like Ctc of Aquifex
aeolicus (Deckert et al., 1998) are known.
Although the function of Ctc is still unknown,
the function of several Ctc-homologues has been
determined. Being ribosomal proteins, both L25 from
Further Reading
Caister Academic Press is a leading academic publisher of
advanced texts in microbiology, molecular biology and medical
research.
Full details of all our publications at caister.com
• MALDI-TOF Mass Spectrometry in Microbiology
Edited by: M Kostrzewa, S Schubert (2016)
www.caister.com/malditof
• Aspergillus and Penicillium in the Post-genomic Era
Edited by: RP Vries, IB Gelber, MR Andersen (2016)
www.caister.com/aspergillus2
• The Bacteriocins: Current Knowledge and Future Prospects
Edited by: RL Dorit, SM Roy, MA Riley (2016)
www.caister.com/bacteriocins
• Omics in Plant Disease Resistance
Edited by: V Bhadauria (2016)
www.caister.com/opdr
• Acidophiles: Life in Extremely Acidic Environments
Edited by: R Quatrini, DB Johnson (2016)
www.caister.com/acidophiles
• Climate Change and Microbial Ecology: Current Research
and Future Trends
Edited by: J Marxsen (2016)
www.caister.com/climate
• Biofilms in Bioremediation: Current Research and Emerging
Technologies
Edited by: G Lear (2016)
www.caister.com/biorem
• Flow Cytometry in Microbiology: Technology and Applications
Edited by: MG Wilkinson (2015)
www.caister.com/flow
• Microalgae: Current Research and Applications
• Probiotics and Prebiotics: Current Research and Future Trends
Edited by: MN Tsaloglou (2016)
www.caister.com/microalgae
Edited by: K Venema, AP Carmo (2015)
www.caister.com/probiotics
• Gas Plasma Sterilization in Microbiology: Theory,
Applications, Pitfalls and New Perspectives
Edited by: H Shintani, A Sakudo (2016)
www.caister.com/gasplasma
Edited by: BP Chadwick (2015)
www.caister.com/epigenetics2015
• Virus Evolution: Current Research and Future Directions
Edited by: SC Weaver, M Denison, M Roossinck, et al. (2016)
www.caister.com/virusevol
• Arboviruses: Molecular Biology, Evolution and Control
Edited by: N Vasilakis, DJ Gubler (2016)
www.caister.com/arbo
Edited by: WD Picking, WL Picking (2016)
www.caister.com/shigella
Edited by: S Mahalingam, L Herrero, B Herring (2016)
www.caister.com/alpha
• Thermophilic Microorganisms
Edited by: F Li (2015)
www.caister.com/thermophile
Biotechnological Applications
Edited by: A Burkovski (2015)
www.caister.com/cory2
• Advanced Vaccine Research Methods for the Decade of
Vaccines
• Antifungals: From Genomics to Resistance and the Development of Novel
• Aquatic Biofilms: Ecology, Water Quality and Wastewater
• Alphaviruses: Current Biology
• Corynebacterium glutamicum: From Systems Biology to
Edited by: F Bagnoli, R Rappuoli (2015)
www.caister.com/vaccines
• Shigella: Molecular and Cellular Biology
Treatment
Edited by: AM Romaní, H Guasch, MD Balaguer (2016)
www.caister.com/aquaticbiofilms
• Epigenetics: Current Research and Emerging Trends
Agents
Edited by: AT Coste, P Vandeputte (2015)
www.caister.com/antifungals
• Bacteria-Plant Interactions: Advanced Research and Future Trends
Edited by: J Murillo, BA Vinatzer, RW Jackson, et al. (2015)
www.caister.com/bacteria-plant
• Aeromonas
Edited by: J Graf (2015)
www.caister.com/aeromonas
• Antibiotics: Current Innovations and Future Trends
Edited by: S Sánchez, AL Demain (2015)
www.caister.com/antibiotics
• Leishmania: Current Biology and Control
Edited by: S Adak, R Datta (2015)
www.caister.com/leish2
• Acanthamoeba: Biology and Pathogenesis (2nd edition)
Author: NA Khan (2015)
www.caister.com/acanthamoeba2
• Microarrays: Current Technology, Innovations and Applications
Edited by: Z He (2014)
www.caister.com/microarrays2
• Metagenomics of the Microbial Nitrogen Cycle: Theory, Methods
and Applications
Edited by: D Marco (2014)
www.caister.com/n2
Order from caister.com/order
496 Schmalisch et al.
E. coli and TL5 from T. thermophilus form a complex
with 5S rRNA. The structure of the two proteins has been
solved and represents a distinct RNA-binding motif
(Gongadze et al., 1996, Stoldt et al., 1998, Fedorov et
al., 2001). Thus, RNA-binding properties of the proteins
are very well characterized. Both proteins bind strongly
and specifically to a region of the 5S rRNA called loop E
(Stoldt et al., 1999, Fedorov et al., 2001). The amino
acid residues in TL5 and L25 that interact with the 5S
rRNA are well conserved in Ctc and in Ctc homologues
from different bacteria (Stoldt et al., 1999, Fedorov et al.,
2001). Thus, Ctc of B. subtilis might be a ribosomal
protein.
The gene encoding L25 of E. coli, rplY, is strongly
constitutively expressed as are the known genes
coding for ribosomal proteins in B. subtilis (Karlin
et al., 2001). In contrast, ctc is expressed weakly during
logarithmic growth but strongly induced after stress.
This expression pattern suggests that Ctc may not be
necessary as a ribosomal component under normal
conditions but that it becomes part of the ribosome
under stress conditions. The implication of a ribosomal
protein in the activation of the stress response of
B. subtilis was already demonstrated for the L11 protein
which is required for the activation of sB in response to
environmental stress (Zhang et al., 2001).
In this work, we demonstrate that Ctc is indeed a
ribosomal protein that binds 5S rRNA. While Ctc was
undetectable in ribosomal protein extracts from exponentially growing cultures, it was present in extracts
prepared from stressed cultures of B. subtilis. This
finding suggests that Ctc might play a role in translation in stressed cells.
Results
Purification of Ctc-His 6
In order to have Ctc available for both assays of
interaction with its potential target RNA and for the
generation of antibodies, we decided to purify the Ctc
protein. To facilitate the purification, a plasmid encoding
Ctc with a C-terminal hexahistidine sequence (pGP807)
was constructed as described in the Experimental
Procedures. This plasmid allows overexpression of
the cloned gene after induction with IPTG in E. coli
BL21/pLysS. Ctc-His6 was purified on a Ni 2+ chelating
column. Pure Ctc-His 6 eluted at an imdazol concentration of 500 mM (see Figure 1). About 3 mg of Ctc-His6
were used to immunize rabbits to obtain a polyclonal
antiserum raised against Ctc.
Localization of Ctc in Ribosomes
To test the possibility that Ctc may be a ribosomal
protein, we performed experiments to detect Ctc in
purified B. subtilis ribosomes. For the preparation of
intact ribosomes, cells of B. subtilis 168 and the
isogenic Dctc mutant GP500 were grown in LB medium
and the ribosomes were purified from heat-stressed and
control cultures (Figure 2A). Inspection of the purified
ribosomes failed to indicate the presence of Ctc in any
of the preparations. It was therefore possible that the
amount of Ctc was below the limit of detection by
Coomassie Blue stain. Similarly, Ctc was not detectable
in ribosomal preparation after silver staining (data not
shown). To circumvent this problem, a Western blot
analysis was perfomed. Using antibodies raised against
His-tagged Ctc signals were detected in protein extracts
from cultures exposed to a heat shock. In contrast, no
Ctc was detectable in unstressed cells. As expected,
Ctc was absent from protein extracts of the Dctc mutant
strain GP500. As shown in Figure 2B, Ctc was present
in purified ribosomes of B. subtilis 168 obtained after a
heat shock. However, this result did not rule out the
possibility that Ctc was just loosely associated to the
ribosomes. Therefore, we assayed the presence of a
non-ribosomal protein, the HPr protein of the phosphotransferase system, in the ribosome preparations by
Western blot analysis with antibodies raised against
His-tagged HPr. While HPr was present in the cell
extracts of both the mutant and the wild type strains
under both conditions tested, it was not detectable in
any of the ribosome preparations (Figure 2C). Similarly,
the repressor CggR and the glyceraldehyde 3-phosphate dehydrogenase GapA were absent from our
Figure 1. Purification of Ctc-His 6. Ctc-His6 was overexpressed in E. coli BL21/pLysS and purified using a Ni2+-NTA column. The fractions were
analyzed on a 12.5% SDS polyacrylamide gel. Lane 1: molecular weight marker; lanes 2–4: flow through; lanes 5–10: fractions from the washing
step; lanes 11–12: pure Ctc-His6 from the elution step.
Function of the General Stress Protein Ctc 497
Figure 2. SDS-PAGE and Western blot analysis to localize Ctc in B. subtilis ribosomes. Both crude and ribosomal protein extracts were analyzed by
SDS-PAGE (A) and immunodetection with antibodies against Ctc (B) and HPr (C). Sizes of molecular weight marker (lane 1) are indicated on the left.
100 ng of purified HPr (lane 2) and Ctc-His6 (lane 3) were loaded on the gel. Crude protein extracts and ribosome from control (lanes 4, 6, 8, 10) and
heat-shocked cultures (lanes 5, 7, 9, 11) were isolated as described in Experimental procedures. 10 mg of crude protein extracts of the wild type
strain 168 (lanes 4, 5) and the Dctc mutant GP500 (lanes 6, 7) were loaded on the gel. Ribosome preparations of both the wild type strain (lanes 8, 9)
and the Dctc mutant (lanes 10, 11) were analyzed. 10 mg protein extracts of a DptsGHI mutant were used to identify the HPr band (lane 12).
purified ribosomes (data not shown). Taken together,
these data demonstrate that Ctc is present in ribosomes
after a heat stress.
Specific Interaction of Ctc with 5S rRNA
The presence of Ctc in ribosomes and the high similarity
with proteins binding 5S rRNA suggested that this RNA
might be the target of Ctc. This hypothesis was tested
by gel retardation experiments. B. subtilis 5S rRNA was
prepared by in vitro transcription as described in
Experimental Procedures. Increasing amounts of CtcHis 6 were incubated with 6 mg 5S rRNA. As shown in
Figure 3, the 5S rRNA was retarded if the molar excess
of Ctc-His 6 was threefold or more. A complete retardation of 5S rRNA was observed at a fivefold excess of Ctc
(see Figure 3, lane 8).
The obvious binding of Ctc-His 6 to the 5S rRNA
might be due to an ability of Ctc to unspecifically bind
RNA. To verify that the observed interaction is specific,
we repeated the interaction assays in the presence of
a non-specific RNA. Non-specific competitor RNA
was used in a twofold excess. As shown in Figure 4,
5S rRNA was efficiently bound by Ctc even in the
presence of non-specific RNA (compare lanes 2 and 3).
Discussion
Ctc is among the B. subtilis general stress proteins that
have been investigated for a long time. However, the
function of Ctc has so far not been elucidated. Based on
results that demonstrate that homologues of Ctc from
other organisms are ribosomal proteins (Gryaznova
498 Schmalisch et al.
Figure 3. Interaction of Ctc-His6 with 5S rRNA. The different samples were analyzed on a 4% native agarose gel as described in Experimental
procedures. 6 mg of 5S rRNA were loaded on the gel (lane 1). Interaction between Ctc-His6 and 5S rRNA was tested by adding increasing amounts of
Ctc-His6 to the 5S rRNA. Molar ratios of 1:1 (lane 2), 1:1,5 (lane 3), 1:2 (lane 4), 1:2,5 (lane 5), 1:3 (lane 6), 1:3,5 (lane 7) and 1:5 (lane 8) were used.
et al., 1996; Harms et al., 2001), we tested whether Ctc
in B. subtilis might also be a component of the
ribosome.
So far, 53 ribosomal proteins have been described
in B. subtilis. Homologues of L25 from E. coli or TL5
from T. thermophilus have not yet been identified in
B. subtilis ribosomes (Henkin, 2002). The data presented in this work unequivocally demonstrate that Ctc
is indeed a ribosomal protein. One aspect, however,
distinguishes the ribosomes of B. subtilis from all other
ribosomes that contain L25 and/or TL5 homologues:
In the latter, L25 or TL5 are constitutive components of
the ribosomes whereas B. subtilis Ctc is detectable in
ribosomes only after the cells were exposed to stress
conditions. It is known that Ctc is present in the cells
even during lorarithmic growth, however, in very small
amounts (Hilden et al., 1995). Our Western blots failed
to reproducibly detect Ctc both in cell extracts from
unstressed cells and in the ribosomes isolated from
these extracts. Taking into account the large number of
ribosomes in exponentially growing cells and the usual
high expression of genes encoding ribosomal proteins
(Karlin et al., 2001), it is very unlikely that Ctc plays a
significant role in ribosomes of unstressed growing
cells.
The obvious exclusive association of Ctc with the
ribosome under stress conditions raises the question of
its function in the ribosome. As observed for L25 and
TL5, Ctc specifically binds the 5S rRNA. This interaction
involves the N-terminal domain of TL5, and therefore
probably also of Ctc (Gongadze et al., 1999). The structure of the large ribosomal subunit of Deinococcus
Figure 4. Gel mobility shift assays on a 4% agarose gel in the presence of unspecific RNA. 5S rRNA (lane 1) aund unspecific RNA (lane 5) were mixed
in a ratio of 1:2 (lane 4). 5S rRNA was incubated with Ctc-His 6 in a molar ratio of 1:5 in the absence (lane 2) or presence of unspecific RNA (lane3).
Function of the General Stress Protein Ctc 499
radiodurans revealed that Ctc is localized in this
organism at the interface between the large and the
small subunits of the ribosome (Harms et al., 2001).
Similar results were obtained with L25 from E. coli by
immunological mapping (Herfurth and Wittmann-Liebold, 1995). While L25 is made up of just one (the Nterminal domain), its D. radiodurans counterpart is
composed of three domains: the N-terminal domain
that binds 5S rRNA, a middle domain that is homologous
to the C-terminal domain of Ctc and a third domain that
has no counterparts in any other Ctc homologues
(Harms et al., 2001). The middle domain of D. radiodurans Ctc fills a gap between the 5S rRNA and the L11
protein. This might point to the function of Ctc in B.
subtilis ribosomes: it was recently shown that L11 is
required for stress activation of sB , the master regulator
of the general stress response (Zhang et al., 2001).
Thus, Ctc may somehow be involved in the regulation of
the stress response. Moreover, the middle domain of
D. radiodurans Ctc interacts with a helix of the 23S rRNA
(H38) and partially wraps the central protuberance of
the large ribosomal subunit. These interactions are
thought to provide additional stability (Harms et al.,
2001). This function may be of special significance
under the adverse conditions that D. radiodurans or
T. thermophilus are often exposed to. Moreover, it might
also be an important function for B. subtilis Ctc, to
stabilize the ribosome under stress conditions.
If Ctc was required for the stabilization of the
ribosome under stress conditions or for the activation of
the stress response, one would expect that ctc mutants
might exhibit some defects under stress conditions.
However, the complete general stress regulon is not
essential unless essayed under very specific conditions
(Hecker and Völker, 2001; Price, 2002). Similarly,
experiments with our Dctc mutant did not reveal any
growth defects or specific deficiencies in survival under
stress conditions. Moreover, defects in translation of a
ctc-bgaB fusion that is induced upon heat stress could
not be observed in the Dctc mutant strain. Thus, the
sporulation defect at elevated temperatures remains
the only known phenotype of a ctc mutant (Truitt et al.,
1988). Sporulation involves a complex program of gene
expression which may require perfect action of all
components of the transcription, translation, secretion
and protein folding machineries. Even subtle adverse
effects caused by a ctc mutation may thus result in
impaired sporulation at high temperatures.
Now that the action of Ctc as a ribosomal protein is
clear it will be interesting to device experiments aimed
at the elucidation of the function of Ctc in the ribosome
under stress conditions.
Experimental Procedures
Bacterial Strains and Culture Media
The Bacillus subtilis strains were derivatives of the 168 Marburg strain.
These included the wild type (trpC2), the DptsGHI mutant strain GM329
(Eiserman et al., 1988) and the ctc deletion mutant GP500 (trpC2
Dctc::spc, for details of construction, see below). Escherichia coli DH5a
(Sambrook et al., 1989) and BL21(DE3)/pLysS (Studier, 1991) were
used for cloning and overexpression experiments, respectively. E. coli
and B. subtilis were grown in LB medium. LB or SP plates were
prepared by the addition of 17 g Bacto agar/l (Difco) to the medium.
DNA Manipulation
Transformation of E. coli and plasmid DNA extraction was performed
using standard procedures (Sambrook et al., 1989). Restriction
enzymes, T4 DNA ligase and DNA polymerases were used as
recommended by the manufacturers. DNA fragments were purified
from agarose gels using the Nucleospin extract kit (Macherey and
Nagel). Pfu DNA polymerase was used for the polymerase chain
reaction (PCR) as recommended by the manufacturer. DNA sequences were determined using the dideoxy chain termination method
(Sambrook et al., 1989). Chromosomal DNA of B. subtilis was isolated
as described (Kunst and Rapoport, 1995). B. subtilis was transformed
with plasmid DNA according to the two-step protocol (Kunst and
Rapoport, 1995). Transformants were selected on SP plates containing spectinomycin (Spc, 100 mg ml " 1).
Construction of a Dctc Mutant Strain
To delete the ctc gene from the chromosome of B. subtilis, we used
plasmid pGP803 which contains the flanking regions of ctc and a spc
gene conferring resistance to spectinomycin instead of ctc. pGP803
was constructed in several steps as follows: A fragment of 309 bp
corresponding to the region of the chromosome immediately downstream of ctc was amplified by PCR using the primers MS6
(5 0 AAAGGATCCGAAGTATATGCATGCTGTACACACCCT) and MS8
(5 0 AAAGAATTCAGTTGCCATATTCAGCACCATCCTCTT). The PCR
product was digested with BamHI and EcoRI (restriction sites were
introduced with the PCR primers, underlined in the sequence). The
fragment was cloned into pBluescriptIISK+ (Stratagene) cut with the
same enzymes to give plasmid pGP801. The region upstream of ctc
( 2 7 9 b p f r a g m e n t ) w a s a m p l i fi e d u s i n g t h e p r i m e r s M S 4
(5 0 AAAGAATTCGAAAACGAACAATAATAGCTTAAGGCG) and MS5
(5 0 AAAAGCTTTAACAAGTAGAACCTTTTTGCCGGAAA). The PCR
product was digested with EcoRI and HindIII and cloned into pGP801.
The resulting plasmid was pGP802. A 1.4 kb EcoRI fragment of pSpec
(P. Trieu-Cuot, Institut Pasteur, France) containing the spc gene,
which confers resistance to spectinomycin, was inserted into the
unique EcoRI site of pGP802. The resulting plasmid, pGP803, was
linearized with ScaI and used for transformation of B. subtilis 168. The
successful deletion of ctc in the chromosome of the resulting strain
GP500 was verified by analyzing the chromosomal DNA by PCR with
several appropriate primer pairs.
Overexpression of Ctc-His 6
To facilitate the purification of Ctc, we fused the protein to a C-terminal
hexahistidine sequence. The ctc coding region was amplified using the
primers MS11 (5 0 AAACATATGGCAACTTTAACGGCAAAAGAA) and
MS13 (50 AAAGGATCCCATTTAGTGATGGTGATGGTGATGCATTTGTTCGTTTTCACCTTCAGGCTG). MS13 was designed to
allow to attach a DNA fragment encoding a hexahistidine sequence
to the C-terminus of Ctc. The PCR product was digested with NdeI
and BamHI and cloned into pET3c (Novagen). The resulting plasmid
pGP807 was verified by DNA sequencing.
For overexpression, E. coli BL21(DE3)/pLysS was transformed
with pGP807. Expression was induced by the addition of IPTG (final
concentration 1 mM) to logarithmically growing cultures (OD600 of 0.6).
The crude extracts were passed over a Ni 2+ HiTrap chelating column
(Pharmacia) followed by elution with an imidazole gradient. The BioRad dye-binding assay was used to determine protein concentration.
Bovine serum albumin was used as the standard.
In vitro Transcription
To obtain a template for the in vitro synthesis of the 5S rRNA, a 112 bp
PCR product was generated using chromosomal DNA of B. subtilis as
template and primers MS9 (5 0 CTAATACGACTCACTATAGGGAGATTTGGTGGCGAT) and MS10 (5 0 GCTTG GCGGCGTCCTACTCT).
The presence of a T7 RNA polymerase recognition site on primer MS19
(underlined) allowed the use of the PCR product as a template for in
vitro transcription with T7 RNA polymerase (Roche Diagnostics). As a
non-specific RNA, a bicistronic 2 kb cggR-gapA transcript was
prepared as described previously (Ludwig et al., 2001). The integrity
of the RNA transcripts was analyzed by denaturating agarose gel
electrophoresis (Homuth et al., 1997).
Assay of Interaction Between Ctc and 5S rRNA
Binding of Ctc-His6 to 5S rRNA was analyzed by gel retardation
experiments. The 5S rRNA (in 10 mM MgCl2, 89 mM Tris-borate pH8.3,
1 mM EDTA) was denatured by incubation at 80! C for 5 minutes and
renatured by slowly cooling down at room temperature. If required,
500 Schmalisch et al.
non-specific RNA was renatured separately and mixed with the 5S
rRNA prior to protein addition. Purified Ctc-His6 was added to the 5S
rRNA and the samples were incubated for 10 minutes at room
temperature. After this incubation, glycerol was added to a final
concentration of 10% (w/v). The samples were then analyzed on 4%
agarose gels.
Preparation of 70S Ribosomes from B. subtilis Cells
Cultures of B. subtilis were grown in LB medium to an OD 600 of 0.3.
An aliquot of the culture was transferred to 48 ! C (heat stress).
30 min after exposure to heat stress, the stressed and the untreated
control culture were harvested and resuspended in ribosomal buffer I
(20 mM Tris-Cl pH 7.5; 100 mM NH 4Cl; 10 mM MgCl 2 ; 10 mM
2-mercaptoethanol). After cell disruption using a French press the
extract was incubated with 20 units DNase (RNase free) for
20 minutes on ice. After two centrifugation steps (6,400 # g, 4 ! C,
30 min; 30,000 # g, 4 ! C, 30 min) the supernatant was layered on a
sugar cushion (1.1 M sucrose). After a further centrifugation
(120,000 # g, 4! C, 18 h) the pellet containing the intact ribosomes
was washed with ice-cold ribosomal buffer II (20 mM Tris-Cl pH 7.5;
100 mM NH4 Cl; 6 mM MgCl2 ; 3 mM dithiothreitol) and suspended in
the same buffer. After a final centrifugation (10,000 # g, 4! C, 10 min)
the pure ribosomes were present in the supernatant. The concentration of the ribosomes was adjusted to 500 A260 /ml and the samples
were stored at " 80 ! C.
Western Blot Analysis
Purified Ctc-His 6 was injected to rabbits to generate polyclonal
antibodies. For Western blot analysis, B. subtilis cell extracts and
ribosomes were separated on 12.5% SDS-PAA gels and transferred to
a polyvinylidene difluoride membrane (Fluorotrans) by electroblotting.
Ctc and HPr were detected with polyclonal antibodies. Antibodies
raised against His-tagged HPr from B. subtilis (Monedero et al., 2001)
were a kind gift from J. Deutscher.
Acknowledgements
We wish to thank Matthias Görlach and Anders Liljas for drawing our
attention to Ctc. We are grateful to Rolf Wagner for useful tips for the
preparation of ribosomes and Josef Deutscher for the gift of antibodies
against HPr from B. subtilis. Uwe Völker and Matthias Brigulla are
acknowledged for helpful discussions.
This work was supported by the Deutsche Forschungsgemeinschaft
through SFB 473 ‘‘Schaltvorgänge der Transkription’’. I.L. was
supported by a personal grant from the Boehringer Ingelheim Fonds.
References
Antelmann, H., Engelmann, S., Schmid, R., and Hecker, M. 1996.
General and oxidative stress response in Bacillus subtilis: cloning,
expression, and mutation of the alkyl hydroperoxide reductase
operon. J. Bacteriol. 178: 6571–6578.
Benson, A.K., and Haldenwang, W.G. 1992. Characterization of a
regulatory network that controls sB expression in Bacillus subtilis.
J. Bacteriol. 174: 749–757.
Bernhardt, J., Völker, U., Völker, A., Antelmann, H., Schmid, R.,
Mach, H., and Hecker, M. 1997. Specific and general stress proteins
in Bacillus subtilis – a two-dimensional protein electrophoresis study.
Microbiology 143: 999–1017.
Deckert, G., Warren, P.V., Gaasterland, T., Young, W.G., Lenox, A. L.,
Graham, D.E., Overbeek, R., Snead, M.E., Keller, M., Aujay, M.,
Huber, R., Feldman, R.A., Short, J.M., Olsen, G.J., and Swanson, R.V.
1998. The complete genome of the hyperthermophilic bacterium
Aquifex aeolicus. Nature 392: 353–358.
Eisermann, R., Deutscher, J., Gonzy-Tréboul, G., and Hengstenberg, W. 1988. Site-directed mutagenesis with the ptsH gene of
Bacillus subtilis. J. Biol. Chem. 263: 17050–17054.
Engelmann, S., Lindner, C., and Hecker, M. 1995. Cloning, nucleotide
sequence, and regulation of katE encoding a sB-dependent catalase
in Bacillus subtilis. J. Bacteriol. 177: 5598–5605.
Fedorov, R., Meshcheryakov, V., Gongadze, G., Fomenkova, N.,
Nevskaya, N., Selmer, M., Laurberg, M., Kristensen, O., Al-Karadaghi, S., Liljas, A., Garber, M., and Nikonov, S. 2001. Structure of
ribosomal protein TL5 complexed with RNA provides new insights into
the Ctc family of stress proteins. Acta Cryst. Sect. D 57: 968–976.
Gaidenko, T.A., and Price, C.W. 1998. General stress transcription
factor sB and sporulation transcription factor sH each contribute
to survival of Bacillus subtilis under extreme growth conditions.
J. Bacteriol. 180: 3730–3733.
Gerth, U., Krüger, E., Derré, I., Msadek, T., and Hecker, M. 1998.
Stress induction of the Bacillus subtilis clpP gene encoding a
homologue of the proteolytic component of the ClpP protease and
the involvement of ClpP and ClpX in stress tolerance. Mol. Microbiol.
28: 787–802.
Gongadze, G., Kashparov, I., Lorenz, S., Schroeder, W., Erdmann, V. A.,
Liljas, A., and Garber, M. 1996. 5S rRNA binding ribosomal proteins
from Thermus thermophilus: identification and some structural
properties. FEBS Lett. 386: 260–262.
Gongadze, G.M., Meshcheryakov, V.A., Serganov, A.A., Fomenkova,
N.P., Mudrik, E.S., Jonsson, B.-H., Liljas, A., Nokonov, S.V., and
Garber, M.B. 1999. N-terminal domain, residues 1–91, of ribosomal
protein TL5 from Thermus thermophilus binds specifically and
strongly to the region of 5S rRNA containing loop E. FEBS Lett.
451: 51–55.
Gryaznova, O.I., Davydova, N.L., Gongadze, G.M., Jonsson, B.H.,
Garber, M.B., and Liljas, A. 1996. A ribosomal protein from Thermus
thermophilus is homologous to a general shock protein. Biochimie
78: 915–919.
Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon,
I., Bartels, H., Franceschi, F., and Yonath, A. 2001. High resolution
structure of the large ribosomal subunit from a mesophilic eubacterium. Cell 107: 679–688.
Hecker, M., Schumann, W., and Völker, U. 1996. Heat-shock and
general stress response in Bacillus subtilis. Mol. Microbiol. 19:
417–428.
Hecker, M., and Völker, U. 2001. General stress response of Bacillus
subtilis and other bacteria. Adv. Microbial Physiol. 44: 35–91.
Henkin, T.M. 2002. Ribosomes, protein synthesis factors, and tRNA
synthetases. In Bacillus subtilis and its closest relatives: From
genes to cells. A.L. Sonenshein, J.A. Hoch, and R. Losick, eds.
Washington, DC: American Society for Microbiology Press, pp. 313–
322.
Herfurth, E., and Wittmann-Liebold, B. 1995. Determination of peptide
regions exposed at the surface of the bacterial ribosome with
antibodies against synthetic peptides. Biol. Chem. Hoppe Seyler
376: 81–90.
Hilden, I., Krath, B.N., and Hove-Jensen, B. 1995. Tricistronic operon
expression of the genes gcaD (tms), which encodes N-acetylglucosamine 1-phosphate uridyltransferase, prs, which encodes phosphoribosyl diphosphate synthetase, and ctc in vegetative cells of
Bacillus subtilis. J. Bacteriol. 177: 7280–7284.
Homuth, G., Masuda, S., Mogk, A., Kobayashi, Y., and Schumann, W.
1997. The dnaK operon of Bacillus subtilis is heptacistronic.
J. Bacteriol. 179: 1153–1164.
Karlin, S., Mrazek, J., Campbell, A., and Kaiser, D. 2001. Characterization of highly expressed genes of four fast-growing bacteria.
J. Bacteriol. 183: 5025–5040.
Kempf, B., and Bremer, E. 1998. Uptake and synthesis of compatible
solutes as microbial stress responses to high-osmolality environments. Arch. Microbiol. 170: 319–330.
Krüger, E., Völker, U., and Hecker, M. 1994. Stress induction of clpC
in Bacillus subtilis and its involvement in stress tolerance.
J. Bacteriol. 176: 3360–3367.
Kunst, F., and Rapoport, G. 1995. Salt stress is an environmental
signal affecting degradative enzyme synthesis in Bacillus subtilis.
J. Bacteriol. 177: 2403–2407.
Ludwig, H., Homuth, G., Schmalisch, M., Dyka, F.M., Hecker, M., and
Stülke, J. 2001. Transcription of glycolytic genes and operons in
Bacillus subtilis: evidence for the presence of multiple levels of
control of the gapA operon. Mol. Microbiol. 41: 409–422.
Monedero, V., Poncet, S., Mijakovic, I., Fieulaine, S., Dossonnet, V.,
Martin-Verstraete, I., Nessler, S., and Deutscher, J. 2001. Mutations
lowering the phosphatase activity of HPr kinase/phosphatase switch
off carbon metabolism. EMBO J. 20: 3928–3937.
Ollington, J.F., Haldenwang, W.G., Huynh, T.V., and Losick, R. 1981.
Developmentally regulated transcription in a cloned segment of the
Bacillus subtilis chromosome. J. Bacteriol. 147: 432–442.
Petersohn, A., Bernhardt, J., Gerth, U., Höper, D., Koburger, T.,
Völker, U., and Hecker, M. 1999. Identification of sB-dependent
genes in Bacillus subtilis using a promoter consensus-directed
search and oligonucleotide hybridization. J. Bacteriol. 181:
5718–5724.
Function of the General Stress Protein Ctc 501
Petersohn, A., Brigulla, M., Haas, S., Hoheisel, J.D., Völker, U., and
Hecker, M. 2001. Global analysis of the general stress reponse of
Bacillus subtilis. J. Bacteriol. 183: 5617–5631.
Price, C.W., Fawcett, P., Cérémonie, H., Su, N., Murphy, C.K., and
Youngman, P. 2001. Genome-wide analysis of the general stress
response in Bacillus subtilis. Mol. Microbiol. 41: 757–774.
Price, C.W. 2002. General stress response. In: Bacillus subtilis and its
closest relatives: From genes to cells. Sonenshein, A.L., Hoch, J. A.,
and Losick, R. eds. Washington, DC: American Society for Microbiology Press, pp. 369–384.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning:
a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y.
Stoldt, M., Wöhnert, J., Görlach, M., and Brown, L.R. 1998. The NMR
structure of Escherichia coli ribosomal protein L25 shows homology
to general stress proteins and glutamyl-tRNA synthetases. EMBO J.
17: 6377–6384.
Stoldt, M., Wöhnert, J., Ohlenschläger, O., Görlach, M., and Brown, L.R.
1999. The NMR structure of the 5S rRNA E-domain-protein L25
complex shows performed and induced recognition. EMBO J. 18:
6508–6521.
Studier, F.W. 1991. Use of bacteriophage T7 lysozyme to improve an
inducible T7 expression system. J. Mol. Biol. 219: 37–44.
Truitt, C.L., Weaver, E.A., and Haldenwang, W.G. 1988. Effects on
growth and sporulation of inactivation of a Bacillus subtilis gene (ctc)
transcribed in vitro by minor vegetative cell RNA polymerases
(E-s37 , E-s32). Mol. Gen. Genet. 212: 166–171.
Völker, U., Engelmann, S., Maul, B., Riethdorf, S., Völker, U.,
Schmid, R., Mach, H., and Hecker, M. 1994. Analysis of the
induction of general stress proteins of Bacillus subtilis. Microbiology
140: 741–752.
Völker, U., Maul, B., and Hecker, M. 1999. Expression of the sBdependent general stress regulon confers multiple stress resistance
in Bacillus subtilis. J. Bacteriol. 181: 3942–3948.
Zhang, S., Scott, J.M., and Haldenwang, W.G. 2001. Loss of
ribosomal protein L11 blocks stress activation of the Bacillus subtilis
transcription factor sB. J. Bacteriol. 183: 2316–2321.