Human Reproduction, Vol.24, No.7 pp. 1758– 1764, 2009
Advanced Access publication on March 11, 2009 doi:10.1093/humrep/dep047
ORIGINAL ARTICLE Early pregnancy
Influence of activating and inhibitory
killer immunoglobulin-like receptors
on predisposition to recurrent
miscarriages
R.M. Faridi 1, V. Das 2, G. Tripthi 1, S. Talwar1, F. Parveen 1,
and S. Agrawal 1,3
1
Department of Medical Genetics, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Raebareli Road, Lucknow, Uttar Pradesh
226014, India 2Department of Obstetrics and Gynaecology, Queen Mary Hospital, CSM Medical University, Lucknow, Uttar Pradesh, India
3
Correspondence address. Tel: þ91-522-668004-8 ext. 2338, 2346, 2347, 2339; Fax: þ91-522-6680973/6680017; E-mail: suraksha@sgpgi.
ac.in
background: Understanding of the immune events and mechanisms occurring at the feto –maternal interface is likely to help in understanding the ability of the fetus to survive within the maternal body. Evidence supporting extensive roles of natural killer cells during pregnancy
gives rise to a possibility that these NK cells can be mis-regulated and involved in fetal allograft rejection. Killer immunoglobulin-like receptors
(KIR) play an important role in regulating the NK cell activity through their activating and inhibiting isoforms. Since there exists a considerable,
genetically determined variation in the repertoire of KIR receptors between different individuals, a particular maternal KIR repertoire may
predispose to recurrent miscarriages (RMs).
methods: Gene-specific PCR amplification (PCR-SSP) was used to determine the individual KIR genotypes in women experiencing RM
and controls.
results: A higher prevalence of activating KIR genes was seen in patients than in controls. Among women experiencing RM, the BB
genotypes were more prevalent (P , 0.0001, OR ¼ 4.4, 95% CI ¼ 2.89 –6.69) compared with controls.
conclusions: Our results indicate that the balance between inhibitory and activating receptor-mediated signals present in natural killer
cells is inclined toward a more activating state that may contribute to pregnancy loss.
Key words: recurrent miscarriages / natural killer cells / trophoblast / activating and inhibitory killer immunoglobulin-like receptors
Introduction
Spontaneous miscarriage is defined as the loss of pregnancy prior to
the 20th gestational week. The definite cause for many pregnancy
losses still remains to be ascertained. It is well recognized that the definition of recurrent pregnancy loss includes three or more consecutive
spontaneous miscarriages, taking into account the fact that the risk of
miscarriage increases proportionately to the number of previous miscarriages. Despite the paucity of supporting evidence (Porter et al.,
2006; Rai and Regan, 2006), the idea of recurrent miscarriage (RM)
having an immunological etiology is widespread. Subsets of natural
killer cells which populate the deciduas during the first and second trimesters are the most debated candidate cells in this context. During
early pregnancy, the uterine NK (uNK) cells accumulate as a dense
infiltrate around the trophoblast cells, but they progressively disappear
from mid-gestation onwards and are absent at term. Therefore, their
presence is coincident with trophoblast invasion, because placentation
is complete at approximately the 20th week of gestation. The fetal trophoblast does not express the classical HLA-A and HLA-B antigens
and this may protect it from attack from maternal T cells, whereas
on the other hand, the lack of classical class I HLA antigens might
render it susceptible to attack from NK cells. The possibility that
uNK cells interact with the fetal trophoblast is suggested by the observations that uNK cells have a series of receptors including the killer
immunoglobulin-like receptor (KIR) family and the CD94/NKG2
family (Hiby et al., 1997; Verma et al., 1997, Wilson et al., 2000;
Mcqueen and Parham, 2002). The ligands for these receptors include
HLA-C, HLA-E and HLA-G, which are expressed on the trophoblast
cells (King et al., 2000a, b; Moffet and Loke, 2002). Of these, only
HLA-C is highly polymorphic and interacts with the KIRs expressed
& The Author 2009. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.
For Permissions, please email: [email protected]
1759
Genetic variability of KIR and recurrent miscarriage
on the NK cell surface. While the precise role of the uNK cells is not
clear, there is evidence to suggest their involvement in maternal blood
vessel remodeling (Ashkar et al., 2000; Croy et al., 2003). Several
studies have shown that women with RM have elevated NK cell
numbers and activity in the peripheral blood (Aoki et al., 1995;
Yamada et al., 2003) as well as in the endometrium (Clifford et al.,
1999). There is, however, a considerable debate concerning this
issue with conflicting reports. Moffet et al. (2004) and Rai et al.
(2005) reviewed at length the fundamental flaws in the methodologies
used in measuring the number and activity of both peripheral as well as
uNK cells. Currently, the role of both peripheral blood and uNK cells
in RM remains unknown, which means that understanding the function
of uNK cells is still a major challenge in human reproduction.
The KIR family of receptors contributes to the regulation of uNK cell
function through their activating and inhibitory isoforms. The KIR haplotypes vary greatly in the presence or absence of a particular gene
and are categorized into two groups designated as A and B. The classification is based on the number and type of genes encoding inhibitory
and activating KIRs. The simpler group-A KIR haplotype comprises a
fixed gene content of KIR3DL3-2DL3-2DL1-2DP1-3DP1-2DL4-3DL12DS4-3DL2. Haplotypes carrying any other combination of KIR loci
are classified as group-B haplotypes. Although both haplogroups
have comparable genes for inhibitory KIR, they differ in the genes
encoding activating KIR. Generally, the group-B KIR haplotypes
encode more activating KIRs (Rajalingam et al., 2008). Likewise,
KIR-mediated NK cell responses in individuals with two copies of A
haplotypes (AA) are mainly inhibitory in nature. The KIR-HLA-C receptor –ligand interactions conform to the dimorphisms in the HLA-Cw
a1 domain, which are characterized by Ser77/Asn80 and Asn77/
Lys80, and define serologically distinct allotypes of HLA-Cw, viz.
group 1 and group 2, respectively (Colonna et al., 1993; Parham,
2005). C1 allotypes are the ligands for KIR2DL2/3 (inhibitory) and
possibly KIR2DS2 (activating), whereas C2 allotypes are bound by
inhibitory KIR2DL1 and activating KIR2DS1 receptors. Other activating
KIR2DS receptors (KIR2DS3, 2DS4 and 2DS5) with very similar
sequences may also bind to HLA-C molecules (Carrington and
Norman, 2003).
It is imperative, however, that the purpose of these receptor –ligand
interactions on the NK cell–trophoblast interface is either to activate
the NK cells (through activating receptors) thereby stimulating them to
secrete blood vessel modifying cytokines, and/or to inhibit them
(through inhibiting receptors) thereby protecting the trophoblast
from NK-mediated lysis. Therefore, fine tuning between the fetal antigens and the maternal NK receptors is believed to be a crucial feature
of the fetal –maternal interaction. Nonetheless, it could be hypothesized that as there exists a considerable genetic variation in the repertoire of KIR receptors between different individuals, a particular KIR
repertoire might predispose an individual to RM. Till date, there
have been only a few reports pertaining to KIR gene polymorphisms
with RM, with conflicting conclusions. Witt et al. (2004) reported
that the maternal KIR repertoire was not associated with RM,
whereas Varla-Leftherioti et al. (2005) reported fewer appropriate
inhibitory KIRs in RM women in a study of 26 patients. Likewise,
Wang et al. (2007) and Hiby et al. (2008) reported an association
between the maternal KIR repertoire and HLA-Cw alleles in 67 and
73 RM couples, respectively. Therefore, in order to investigate
whether or not the outcome of pregnancy depends on the maternal
KIR gene repertoire, we have analyzed the KIR genotypes of a
well-characterized RM group of women who have suffered three or
more miscarriages with unknown etiology. We have compared our
results with a panel of ethnically matched parous control women
with at least two live births and no history of previous miscarriages.
Materials and Methods
Genomic DNA samples
All the samples were collected from patients attending the Out Patients’
Department of Sanjay Gandhi Post Graduate Institute of Medical Sciences
(SGPGIMS), Lucknow, and Queen Mary Hospital of CSM Medical University, Lucknow, Uttar Pradesh, India, for the evaluation of RMs. All had a
history of at least three spontaneous miscarriages (mean 4, range 3– 7)
and no previous successful pregnancy. All the patients were screened
for factors relating to various known causes of miscarriages, including parental chromosomes, Day 2 hormone levels of follicle-stimulating hormone
(3– 11 U/l), leutinizing hormone (3– 12 U/l) and testosterone (0.5–
3 nmol/l), antiphospholipid antibodies including lupus anticoagulant (positive likelihood ratio, 0.8 – 1.05) and anticardiolipin antibodies (IgG 0 – 12
GPL units, IgM 0 –5 MPL units) and prothrombotic risk factors including
activated protein-C resistance (2.6– 4.36 ratio), factor V Leiden and prothrombin mutations, leutal phase insufficiency, prolactin dosage, glycemic
curve, thyroid hormone levels, Toxoplasmosis, Cytomegalovirus,
Rubella, HIV, group B streptococci, Chlamydia trachomatis, hepatitis B
and C and bacterial vaginosis. The uterine cavity was investigated for cervical incompetence by hysteroscopy, hysterosalpingography and serial
ultrasound. Of all the initially screened individuals, 39% (n ¼ 205) had
no known cause of RMs were included in this study. All RM patients
selected were primary aborters, not having any live child and belonged
to four different caste groups: upper caste Hindus (Brahmin, Vaishya,
Kayastha and Kshatriya), backward class (OBC and SC/ST), Muslims
(Shiya and Sunni) and others (Sindhi, Sikh, Jain and Christians) Patients’
detailed clinical information was recorded prior to inclusion in this study.
The control group consisted of 224 healthy parous women of the same
ethnic distribution as that of RM patients (Table S1, Supplementary data),
and having at least two live births and with no history of miscarriage, preeclampsia, ectopic pregnancy or preterm delivery. From both controls
and RM women, 5 ml of blood was collected in EDTA-coated collection
vials and DNA was extracted using Qiagen kits. This investigation was
approved by the Ethics Committees of SGPGIMS and Queen Mary Hospital,
CSM medical University, Lucknow, Uttar Pradesh, India. Written informed
consent to participate in this study was obtained from all the individuals.
KIR genotyping
All the DNA samples of controls as well as RM patients were typed for the
KIR genes responsible for inhibitory signals (2DL1, 2DL2, 2DL3, 3DL1,
3DL2, 3DL3, 2DL4 and 2DL5) and for activating signals (2DS1, 2DS2,
2DS3, 2DS4, 2DS5 and 3DS1), as well as two pseudo-genes 2DP1 and
3DP1, based on the primers described by Vilches et al. (2007) and
Murdoch et al. (2006). Briefly, the KIR genes were typed for the presence
or absence by using 17 PCR-SSP reactions, each containing between two
and four KIR-specific primers. Every combination of sense and antisense
primers used was specific for a single gene (Table I). All reactions contained an internal positive control consisting of an additional pair of
primers specific for non-polymorphic sequences of the HLA-DRA gene:
FDRA360 (50 -gaggtaactgtgctcacgaacagc-30 ) and RDRA595 (50 -ggtccatacc
ccagtgcttgagaag-30 ) for reactions 1 – 16 (product length: 283 bp), and
FDRA360 and RDRA633 (50 -cacgttctctgtagtctctggg-30 ) for reaction 17
(product length: 608 bp). In each reaction, 50 ng of genomic DNA was
1760
Faridi et al.
Table I Sequence-specific primers for KIR genotyping
S. No.
Gene
Sense primer
Antisense primer
Product (bp)
.............................................................................................................................................................................................
1
2DL1
GTTGGTCAGATGTCATGTTTGAA
CCTGCCAGGTCTTGCG
142
2
2DL2
AAACCTTCTCTCTCAGCCCA
GCCCTGCAGAGAACCTACA
142
3
2DL3
AGACCCTCAGGAGGTGA
CAGGAGACAACTTTGGATCA
156
4
3DL1
TCCATCGGTCCCATGATGTT
CCACGATGTCCAGGGGA
3DL1b
CCATCGGTCCCATGATGCT
5
3DL2
CATGAACGTAGGCTCCG
GACCACACGCAGGGCAG
131
6
2DS1
TCTCCATCAGTCGCATGAA
GGTCACTGGGAGCTGAC
96
109
108
2DS1b
TCTCCATCAGTCGCATGAG
7
2DS2
TGCACAGAGAGGGGAAGTA
CCCTGCAAGGTCTTGCA
96
8
2DS3
CTTGTCCTGCAGCTCCT
GCATCTGTAGGTTCCTCCT
158
9
2DS4
GGTTCAGGCAGGAGAGAAT
CTGGAATGTTCCGTTGATG
133/111
10
2DS5
AGAGAGGGGACGTTTAACC
CTGATAGGGGGAGTGAGT
147
11
3DS1
CATCGGTTCCATGATGCG
CCACGATGTCCAGGGA
107
110
3DS1b
CATCAGTTCCATGATGCG
12
2DPI
CGACACTTTGCACCTCAC
GGGAGCTGACAACTGATG
141
13
3DL3
AATGTTGGTCAGATGTCAG
GCCGACAACTCATAGGGTA
196
14
3DX1
TTTCTGTGGGCCGTGCAA
GTCACTGGGGGCTTATAG
88
15
2DL4
TCAGGACAAGCCCTTCTGC
GGACAGGGACCCCATCTTTC
131
16
2DL5
ATCTATCCAGGGAGGGGAG
CATAGGGTGAGTCATGGAG
147
17
3DP1
GTACGTCACCCTCCCATGATGTA
GAAAACGGTGTTTCGGAATAC
398
amplified in 10 ml of PCR buffer [67 mM Tris–HCl, pH 8.8, 16 mM
(NH4)2SO4, 2 mM MgCl2, 0.01% Tween 20 and 100 mM dNTPs] containing 0.5 U of Taq DNA polymerase. All reactions were conducted in an
oil-free thermal cycler (PTC 200 Thermal Cyclers, Bio-Rad Inc.) The
amplification products were electrophoresed on 2% agarose gels containing ethidium bromide with a migrating distance of 3 cm, and the product
bands were visualized under ultraviolet light. The presence of each KIR
gene was determined by a band of the expected size (Figure 1). Individuals
were determined negative for a KIR gene when a band of the expected size
was absent in the presence of the control band. For easier size discrimination of KIR2DS4 full length and deletion variants, aliquots of PCR products of 2DS4 were run separately on the gel, and individuals were
assigned positive when either or both the variants gave signals, whereas
when both the variants were absent, the individual was labeled as 2DS4
negative. The data were verified and validated by Dr Raja Rajalingam of
University of California, Los Angeles (UCLA), CA, USA. In cases of
unique profiles or previously unreported profiles, genotyping was repeated
at least twice.
Statistical analysis
Gene and genotype frequency was determined by direct counting. Frequency differences between the RM and control groups were tested for
significance using the x 2 test. The magnitude of the effect was estimated
by odds ratios and their 95% confidence intervals (Windows
11.0.0.2001; SPSS Inc.). The different significances of average inhibitory
or activating KIR numbers between RM patients and control subjects
were tested and a linear model with a logistic link was used to test the
association between increasing/decreasing numbers of activating/inhibiting KIR and the prevalence of RM. P-values 0.05 were considered significant. Yates’ corrections were applied wherever required.
107
Results
Using gene-specific PCR amplifications, we have analyzed the presence/absence of 17 KIR genes in a panel of 205 RM patients and
compared them with that of 224 ethnically matched healthy parous
women. The observed genotypes, their designations and frequencies
are included in the Supplementary data (Tables S2 and S3).
Varied gene content incidences among
patients and controls
We observed significant differences in the prevalence of individual
genes for 2DL1, 3DL1, 2DS2, 2DS3, 2DS4 and 3DS1 in patients
when compared with controls. It was observed that there was a
decrease in the occurrence of inhibitory KIR2DL1 and KIR3DL1
genes in the RM patients in association with an increased incidence
of activating KIR2DS2, 2DS3 and 3DS1 genes when compared with
the control group (Table II). The only activating KIR (2DS4) which is
associated with the group-A haplotypes was found to be significantly
higher in the control group. Gene frequencies for other inhibitory
KIRs (2DL2, 2DL3, and 2DL5) did not reach statistical significance,
whereas genes comprising framework loci (3DL2, 3DL3, 2DL4 and
3DP1) were found in all the individuals. We observed that the odds
of occurrence of RM in the patient’s group were linearly related to
the increased incidences of activating KIR3DS1 (3.5-fold), 2DS2
(1.9-fold) and 2DS3 (2-fold). There was significant protective
effect against RM associated with inhibitory KIR2DL1 and 3DL1 gene
contents among patients and controls (P , 0.0001, OR ¼ 0.09, 95%
CI ¼ 0.04 –0.19; P , 0.0001, OR ¼ 0.27, 95% CI ¼ 0.17 –0.44,
1761
Genetic variability of KIR and recurrent miscarriage
had the AB genotype, when compared with 8.5% for AA, 43.3% for
BB and 48.2% for AB genotypes, respectively, in the control population
(Fig. 2). There was a significant association of the increased activating
gene content with RM patients, which is evident from the increased
prevalence of BB (P , 0.0001, OR ¼ 4.4, 95% CI ¼ 2.89 –6.69) genotypes among the patient group when compared with the control
group.
Discussion
Figure 1 Representative gel pictures of KIR genotyping.
(A) KIR-AA genotype; (B) KIR-BB genotype; (C) KIR-AB genotype; lanes 1 –17
(2DL1, 2DL2, 2DL3, 3DL1, 3DL2, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DS1,
2DP1, 3DL3, 3DX1, 2DL4, 2DL5 and 3DP1).
respectively). KIR-activating genes (3DS1, 2DS1, 2DS2, 2DS3 and
2DS5) mark group-B haplotypes and their increased prevalence
among patients when compared with controls revealed an increased
incidence of group-B haplotypes among patients.
Haplotypic and genotypic variability among
patients and controls
We further characterized the genotypic profiles of patients as well as
controls in group-A and -B haplotypes based on their gene contents
(Fig. 1). Individuals who carried a fixed gene set of nine genes consisting of KIR3DL3-2DL3-2DL1-2DP1-3DP1-2DL4-3DL1-2DS4-3DL2,
characteristic of group-A haplotypes, were considered as having two
copies of group-A KIR haplotypes (AA genotypes). On the other
hand, individuals lacking any of the four variable genes (KIR2DL1,
2DL3, 3DL1 and 2DS4) were regarded as carrying two copies of
group-B haplotypes (BB genotypes). All the remaining combinations
were regarded as heterozygotes carrying both the haplogroups, i.e.
AB genotypes. Of the patient group, 3.9% of individuals were homozygous for group A (AA), 76.1% for group B (BB), whereas 20.0%
The present study is the first report demonstrating the association of
maternal uNK cell KIR gene repertoire with RM among North Indian
women. Our results support the view of the cumulative effects of activating and inhibiting signals on the modulation of the effector function
of uNK cells. We found a shift toward the over activation of NK cells
based on the individual’s KIR gene content, comprising of a greater
number of activating and reduced number of inhibitory KIR2DL1
genes in the patient group compared with the control group. The
RM patients group showed a higher prevalence of B haplotypes
when compared with A haplotypes. Individuals having BB genotypes
were at a greater risk for spontaneous miscarriages (4.4-fold) than
those having AA or AB genotypes. There was a significant association
of RM patients with B haplotypes.
Several factors have been proposed to explain or contribute to
maternal tolerance to the potentially allogenic fetus, although our
understanding of the immunobiology of normal pregnancy and its
implications for pregnancy-related pathologies is still limited
(Pearson, 2002). One prominent feature of pregnancy is that human
decidua has a large number of NK cells, which constitute 70% of resident lymphocytes (Moffett-King, 2002). Thus, human uNK cells have
been thought to play a role in the implantation and pregnancy, at
least in early gestation. Although the precise functions of uNK cells
in vivo are still unknown, their proximity to the invading trophoblasts,
which lack expression of classical HLA-A and -B antigens (Faulk and
Temple, 1976) but selectively express HLA-C and the non-classical
HLA-G, HLA-E and CD1d molecules (King et al., 1996), has led to
the hypothesis that these MHC antigens on trophoblasts interact
with NK cell receptors (Boyson et al., 2002). The KIR locus is polygenic and polymorphic, giving rise to variable KIR repertoires that
are expressed on subsets of NK cells among individuals. It is unclear
if and which receptors on uNK cells interact with trophoblastexpressed HLA molecules, and whether such interactions inhibit NK
cell lysis, or lead to production of cytokines that favor normal placental
development and maintenance of pregnancy.
In the present report, we have demonstrated that the number of
activating KIR genes were higher in patients with unexplained RM
when compared with control subjects. Hence, we hypothesized that
the number of activating KIR genes per phenotype may influence
disease susceptibility through a gene dosage effect, which may lead
to the rejection of a potentially allogenic fetus. Although the potentially deleterious effects of activating KIRs are certainly not lethal,
these genes may remain and continue to induce or modulate pathogenesis of RM. In the findings of Hiby et al. (2004), the maternal AA
genotype was associated with increased risk of pre-eclampsia,
another pathological condition believed to be having similar pathogenicity with RM. They, however, implicated the strong inhibition of NK
cell activity through increased inhibitory receptor-mediated signaling
1762
Faridi et al.
Table II Distribution of KIR gene repertoire in recurrent miscarriage women and in healthy controls
S. No.
Gene
Control, n 5 224
Patients, n 5 205
x2
OR
95% CI
.............................................................................................................................................................................................
1
KIR2DL1
215 (95.9)
141 (68.8)
54.17**
0.09
0.04– 0.19
2
KIR2DL2
111 (49.6)
110 (53.7)
0.58
1.18
0.80– 1.72
3
KIR2DL3
187 (83.5)
169 (82.4)
0.02
0.93
0.56– 1.53
4
KIR3DL1
191 (85.2)
120 (61.5)
35.91**
0.25
0.15– 0.44
5
KIR3DL2
224 (100.00)
205 (100.00)
—
6
KIR2DS1
88 (39.3)
92 (44.9)
1.15
1.25
0.85– 1.84
7
KIR2DS2
79 (35.3)
104 (50.7)
9.84*
1.89
1.28– 2.78
8
KIR2DS3
66 (29.5)
94 (45.9)
11.60*
2.02
1.36– 3.01
9
KIR2DS4
163 (72.7)
109 (53.1)
16.88**
0.42
0.28– 0.63
10
KIR2DS5
122 (54.5)
122 (59.5)
0.92
1.22
0.83– 1.80
11
KIR3DS1
116 (51.8)
162 (79.0)
33.63**
3.51
2.29– 5.37
12
KIR2DP1
190 (84.82)
144 (70.24)
12.36*
13
KIR3DL3
224 (100.00)
205 (100.00)
—
14
KIR3DX1
112 (50.00)
90 (43.90)
15
KIR2DL4
224 (100.00)
205 (100.00)
16
KIR2DL5
152 (67.8)
127 (61.9)
17
KIR3DP1
224 (100.00)
205 (100.00)
1.36
—
1.39
—
—
0.42
—
0.78
—
1.66
—
—
0.26– 0.67
—
0.53– 1.14
—
1.11– 2.51
—
*P , 0.05.
**P , 0.0001.
in incomplete remodeling of spiral arteries. Our findings reflected a
shift toward the over activation of NK cells through increased activating KIRs. The effect is not directly lethal, but it can contribute to the
alteration of the cytokine milieu which could have important effects
on trophoblast behavior by affecting functions, for example, integrin
expression and metalloproteinase production (Norwitz et al., 2001),
which are important for their survival, growth and differentiation.
Figure 2 Genotypic and haplotypic distribution of KIR in recurrent
miscarriage women and in healthy controls. *Significant; ns, not significant.
The genetic predisposition caused by the maternal KIR gene content
is subject to the contribution of HLA-C genotype. For example, individuals who are 2DL122DS1þ were found to be more prevalent in the
patients group (14.7%) when compared with controls (2.4%). This
reflects a particular risk group if the fetus carries HLA-C2 genotype.
In the normal situation, the uNK cells are proposed to mediate a
mucosal immunological balancing act that prevents trophoblast overinvasion, but also allows degree of placental access to maternal
blood supply. A compromise is reached and both maternal and fetal
polymorphic gene systems and NK cell KIR genes may affect this
compromise.
There are only a few studies to date where maternal KIR gene
repertoires have been investigated for RM, and these have conflicting
conclusions. Witt et al. (2004) reported, in a study including 51 Brazilian Caucasian women, that maternal KIR repertoire was not associated with RM, whereas Varla-Leftherioti et al. (2005) reported
fewer appropriate inhibitory KIR in RM women in a study of 26
patients. Flores et al. (2007) conducted similar studies in 30 RM
couples and their findings support that in RM patients, the balance
between inhibitory and activating receptors present in natural killer
cells is inclined toward an activating state that may contribute to pregnancy loss. They, however, found an increased prevalence of the
inhibitory AA genotypes among the patients’ cohort. Likewise, Wang
et al. (2007), in a study with 67 RM couples from a Chinese Han Population, demonstrated that RM is associated with increased frequency of
activating KIR genes. Yet recently, Hiby et al. (2008), in a study on 73
RM patients, reported an increased prevalence of the maternal AA
genotype. It is important to appreciate the influence of different
ethnic groups, while conducting such studies on the outcome of KIR
frequencies, as KIR genotypes have a wide geographical distribution.
Genetic variability of KIR and recurrent miscarriage
This is exemplified by the increased prevalence of AA genotypes
reported by Hiby et al. (2008) where all the participants were Caucasians. The frequency of B haplotypes is higher and the frequency of A
haplotypes is lower in North Indians than in other Eurasian populations including Caucasian, Palestinian, Thai and Vietnamese panels
(Uhrberg et al., 1997; Witt et al., 1999; Crum et al., 2000; Norman
et al., 2001; Toneva et al., 2001; Rajalingam et al., 2002). We conducted this study on a relatively larger sample size when compared
with others in order to investigate whether or not the outcome of
pregnancy depends on the maternal KIR gene repertoire, and revealed
that there exists an increased prevalence of maternal BB genotypes
among patients when compared with controls. This demonstrates
an inclination of the NK cell activity toward a more activating state.
Understanding the basis for the observed genetic associations is
complicated due to the large repertoire of receptors used by NK
cells to interpret their environment. There is extensive polymorphism
among KIR haplotypes, which differ not only in nucleotide sequence
but also in gene content (Parham 2005). This genetic complexity
echoes the complications confronted clinically in defining and diagnosing RM, which can be considered not so much a disease or disorder
but ‘simply the extreme end of a continuum of characteristics
common to all pregnancies.’ Analysis of KIR genotype and phenotype
in repeated miscarriages may have a practical application as a marker
supporting the diagnosis of the alloimmune etiology in miscarriages.
Author’s role
R.M.F. was involved in the genotyping of the samples, analyzed the
results and drafted the manuscript. V.D. helped with the clinical evaluation of the RM patients. G.T. was involved in the statistical calculations. S.T. was involved in KIR genotyping. F.P. collected blood
samples and extracted DNA. S.A. designed the study, provided intellectual input and helped in finalizing the manuscript.
Supplementary data
Supplementary data are available at http://humrep.oxfordjournals.org/.
Acknowledgements
We are thankful to Dr Raja Rajalingam (UCLA Immunogenetics
Center, University of California at Los Angeles, Los Angeles, USA)
for his kind and generous help in verification of KIR genotyping and frequency data. R.M.F. is receiving his Doctoral Fellowship from the
Department of Biotechnology, Government of India, New Delhi, India.
Funding
We are indebted to the Department of Science and Technology, New
Delhi, India for financial support.
References
Aoki K, Kajiura S, Matsumoto Y, Ogasawara M, Okada S, Yagami Y,
Gleicher N. Preconceptional natural-killer-cell activity as a predictor of
miscarriage. Lancet 1995;345:1340– 1342.
1763
Ashkar AA, Di Santo JP, Croy BA. Interferon-g contributes to imitation of
uterine vascular modification, decidual integrity and uterine NK cell
maturation during normal murine pregnancy. J Exp Med 2000;
192:259– 279.
Boyson JE, Rybalov B, Koopman LA, Exley M, Balk SP, Racke FK, Schatz F,
Masch R, Wilson SB, Strominger JL. CD1d and invariant NKT cells at the
human maternal-fetal interface. Proc Natl Acad Sci USA 2002;
99:13741– 13746.
Carrington M, Norman P. The KIR Gene Cluster. Bethesda, MD: National
Library of Medicine (US), National Center for Biotechnology
Information, 2003, 48 pp.
Clifford K, Flanagan AM, Regan L. Endometrial CD56þ natural killer cells
in women with recurrent miscarriage: a histomorphometric study. Hum
Reprod 1999;14:2727– 2730.
Colonna M, Borsellino G, Falco M, Ferrara GB, Strominger JL. HLA-C is
the inhibitory ligand that determines dominant resistance to lysis by
NK1- and NK2-specific natural killer cells. Proc Natl Acad Sci USA
1993;90:12000 – 12004.
Croy BA, Esadeg S, Chantakru S, van den HM, Paffaro VA, He H, Black GP,
Ashkar AA, Kiso Y, Zhang J. Update on pathways regulating the
activation of uterine natural killer cells, their interactions with decidual
spiral arteries and homing of their precursors to the uterus. J Reprod
Immunol 2003;59:175– 191.
Crum KA, Logue SE, Curran MD, Middleton D. Development of a
PCR-SSOP approach capable of defining the natural killer cell
inhibitory receptor (KIR) gene sequence repertoires. Tissue Antigens
2000;56:313 – 326.
Faulk WP, Temple A. Distribution of beta2 microglobulin and HLA in
chorionic villi of human placentae. Nature 1976;262:799 – 802.
Flores AC, Marcos CY, Paladino N, Arruvito L, Williams F, Middleton D,
Fainboim L. KIR receptors and HLA-C in the maintenance of pregnancy.
Tissue Antigens 2007;69(Suppl 1):112 – 113.
Hiby SE, King A, Sharkey AM, Loke YW. Human uterine NK cells have a
similar repertoire of killer inhibitory and activatory receptors to those
found in blood, as demonstrated by RT-PCR and sequencing. Mol
Immunol 1997;34:419– 430.
Hiby SE, Walker JJ, O’shaughnessy KM, Redman CWG, Carrington M,
Trowsdale J, Moffett A. Combinations of maternal KIR and fetal
HLA-C genes influence the risk of preeclampsia and reproductive
success. J Exp Med 2004;200:957 – 965.
Hiby SE, Regan L, Lo W, Farell L, Carrington M, Moffet A. Association of
maternal killer-cell immunoglobulin-like receptors and parental HLA-C
genotypes with recurrent miscarriage. Hum Reprod 2008;23:972 – 976.
King A, Boocock C, Sharkey AM, Gardner L, Beretta A, Siccardi AG,
Loke YW. Evidence for the expression of HLA-C class I mRNA and
protein by human first trimester trophoblast. J Immunol 1996;
156:2068– 2076.
King A, Allan DS, Bowen M, Powis SJ, Joseph S, Verma S, Hiby SE,
McMichael AJ, Loke YW, Braud VM. HLA-E is expressed on
trophoblast and interacts with CD94/NKG2 receptors on decidual
NK cells. Eur J Immunol 2000a;30:1623 – 1631.
King A, Burrows TD, Hiby SE, Bowen JM, Joseph S, Verma S, Lim PB,
Gardner L, Le Bouteiller P, Ziegler A et al. Surface expression of HLA-C
antigen by human extravillous trophoblast. Placenta 2000b;21:376–387.
Mcqueen KL, Parham P. Variable receptors controlling activation and
inhibition of NK cells. Curr Opin Immunol 2002;14:615 –621.
Moffet A, Loke YW. Immunology of placentation in eutherian mammals.
Nat Rev Immunol 2002;2:656 – 663.
Moffet A, Regan L, Braude P. Natural killer cells, miscarriage, and infertility.
Br Med J 2004;329:1283 – 1285.
Moffett-King A. Natural killer cells and pregnancy. Nat Rev Immunol 2002;
2:656 – 663.
1764
Murdoch S, Soed M, Kircheisen R, Mazhar B, Slim R. Detailed gene and
allele content analysis of three homozygous KIR haplotypes. Tissue
Antigens 2006;68:72 – 77.
Norman PJ, Stephens HA, Verity DH, Chandanayingyong D, Vaughan RW.
Distribution of natural killer cell immunoglobulin-like receptor
sequences in three ethnic groups. Immunogenetics 2001;52:195 – 205.
Norwitz ER, Schust DJ, Fisher SJ. Implantation and the survival of early
pregnancy. N Engl J Med 2001;345:1400 – 1408.
Parham P. MHC class I molecules and KIRs in human history, health and
survival. Nat Rev Immunol 2005;5:201 – 214.
Pearson H. Reproductive immunology: immunity’s pregnant pause. Nature
2002;420:265 – 266.
Porter TF, LaCoursiere Y, Scott JR. Immunotherapy for recurrent
miscarriage. Cochrane Database Syst Rev 2006;19:CD000112.
Rai R, Regan L. Recurrent miscarriage. Lancet 2006;368:601 – 611.
Rai R, Sacks G, Trew G. Natural killer cells and reproductive failure—
theory, practice and prejudice. Hum Reprod 2005;20:1123– 1126.
Rajalingam R, Krausa P, Shilling HG, Stein JB, Balamuguran A, McGinnis MD,
Cheng NW, Mehra NK, Parham P. Dinstictive KIR and HLA diversity in a
panel of North Indian Hindus. Immunogenetics 2002;53:1009.
Rajalingam R, Du Z, Meenagh A, Luo L, Kavitha VJ, Arulvani RP,
Vidhyalaxmi A, Sharma SK, Balazs I, Middleton D et al. Distinctive
diversity of KIR genes in three southern Indian populations: comparison
with world populations revealed a link between KIR gene content and
pre-historic human migrations. Immunogenetics 2008;60:207–217.
Toneva M, Lepage V, Lafay G, Dulphy N, Busson M, Lester S, Vu-Trien A,
Michaylova A, Naumova E, McCluskey J et al. Genomic diversity of
natural killer cell receptor genes in three populations. Tissue Antigens
2001;57:358 – 362.
Uhrberg M, Valiante NM, Shum BP, Shilling HG, Lienert-Weidenbach K,
Corliss B, Tyan D, Lanier LL, Parham P. Human diversity in killer cell
inhibitory receptor genes. Immunity 1997;7:753– 763.
Faridi et al.
Varla-Leftherioti M, Spyropoulou-Vlachou M, Keramitsoglou T,
Papadimitropoulos M, Tsekoura C, Graphou O, Papadopoulou C,
Gerondi M, Stavropoulos-Giokas C. Lack of the appropriate natural
killer cell inhibitory receptors in women with spontaneous abortion.
Hum Immunol 2005;66:65 – 71.
Verma S, King A, Loke YW. Expression of killer cell inhibitory receptors on
human uterine natural killer cells. Eur J Immunol 1997;27:979 – 983.
Vilches C, Castano J, Gomez-Lozano N, Estefanıa E. Facilitation of KIR
genotyping by a PCR-SSP method that amplifies short DNA
fragments. Tissue Antigens 2007;70:415 – 422.
Wang S, Zhao YR, Jiao YL, Wang LC, Li JF, Cui B, Xu CY, Shi YH,
Chen ZJ. Increased activating killer Immunoglobulin-like receptor
genes and decreased specific HLA-C alleles in couples with recurrent
spontaneous abortion. Biochem Biophys Res Commun 2007;
360:696– 701.
Wilson MJ, Torkar M, Haude A, Milne S, Jones T, Sheer D, Beck S,
Trowsdale J. Plasticity in the organization and sequences of human
KIR/ILT gene families. Proc Natl Acad Sci USA 2000;97:4778 – 4783.
Witt CS, Dewing C, Sayer DC, Uhrberg M, Parham P, Christiansen FT.
Population frequencies and putative haplotypes of the killer cell
immunoglobulin-like receptor sequences and evidence for
recombination. Transplantation 1999;68:1784– 1789.
Witt CS, Goodridge J, Gerbase-Delima MG, Daher S, Christianen FT.
Maternal KIR repertoire is not associated with recurrent spontaneous
abortion. Hum Reprod 2004;19:2653 – 2657.
Yamada H, Morikawa M, Kato EH, Shimada S, Kobashi G, Minakami H. Pre
conceptional natural killer cell activity and percentage as predictors of
biochemical pregnancy and spontaneous abortion with normal
chromosome karyotype. Am J Reprod Immunol 2003;50:351– 354.
Submitted on July 18, 2008; resubmitted on January 31, 2009; accepted on
February 4, 2009