From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
292
CORRESPONDENCE
Thrombopoietin From Human Embryonic Kidney CellsIs the Same Factor as c-mpl-Ligand
To the Editor:
Three groups of scientist^"^ have recently reported the purification, sequencing, and cloning of a ligand (L) that binds the c-myleoproliferative leukemia (mpl)-receptor (R) and has many chemical
and biological similarities to a thrombocytopoiesis-stimulatingfactor
(TSF or thrombopoietin) derived fromhuman embryonic kidney
(HEK) cells.' To further this observation, we now report that thrombopoietin from HEK cells stimulates a cell line that expresses a high
level of c-mpl-R; HEK cells contain the messenger (m)RNA for cmpl-L; andHEK cells in culture produce a factor that stimulates
BaF3/mpl cells.
Biologic and chemical characterisrics. There is agreement that
both TSF and c-mpl-L increase platelet counts of mice.'.'.' Previous
data' showed thatpurified TSF ( l ) increases platelet counts, (2)
elevates platelet sizes, and (3) increases the incorporation of "S into
platelets of immunothrombocythemic mice,without affecting red
blood cell (RBC) or white blood cell (WBC) values. The administration of low doses of c-mpl-L (IO to 20 pg) produced by de Sauvage
et all elevated platelet counts in mice by 20%; the ligand isolated
by Lok et alz caused a fourfold increase in platelet counts of mice
after treatment with 0.35 pg of the ligand over a 7-day period. WBC
values were reported to be unaltered. TSF elevated platelet counts
in mice after similar doses ( 1 to IO pg) of the partially purified
material.' Although the results of c-mpl-L on platelet sizes have not
been reported, the ligand obtained by the de Sauvage group' caused
increased "S incorporation into platelets of assay mice, as was observed previously with TSF.' Therefore, the biologic effects of both
agents on peripheral platelets of mice were specific for the platelet
lineage and remarkably similar in their potency and action.'.'.'
In addition to the effects of thrombopoietin on platelet counts of
mice, TSF has been shown to elevate the DNA content, in the form
of polyploidy, in megakaryocytes, and to increase megakaryocyte
size and number.' Kaushansky et al' reported identical responses and
showed that the ligand increased DNA content of megakaryocytes,
increased the number of colony-forming units-megakaryocyte, and
elevated substantially the number and size of megakaryocytes in both
marrow and spleens of mice. Moreover, it was shown previously in
micethat TSF from HEK cells increases megakaryocyte endomitosis, augments maturation of megakaryocytes, and raises the percentage of precursor cells, in the form of small acetylcholinesterase-
positive cells, in thebonemarrow.'
These latter megakaryocyte
indices have not yet been reported for the c-mpl-L, but these groups
of w o r k e r ~ are
l ~ ~actively pursuing the biologic effects of this material, and it is expected that the results will mimic the results with
TSF.
Not only is there agreement between the biologic activity of the
two factors, but there is also accord on its chemical characteristics.
TSF from HEK cells has a molecular weight (MW) on sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in
the unheated form of 30 kD,h a value that agrees precisely with the
results of de Sauvage et al.' Lok et alz report a value of 35 kD
for a molecule thatis devoid of carbohydrates, andtheBartley
et a14 product has activity in two bands, ie, 25 kD and 31 kD. All
workers"' agree thatthe factor is a glycoprotein andis stable to
treatment with SDS. Therefore, there is general agreement onthe
MW and chemical characteristics of these materials.
Because the TSF is obtained from HEK cells,' it is also interesting
to note that the ligand is produced in the kidney,'-4although a major
site of production of thrombopoietin appears to be the liver. de
Sauvage et all found c-mpl-L only in adult kidneys; the factor described by Lok et al' was found in kidneys by use of Northern blot
hybridization with a probe generated from c-mpl cDNA; and the
Bartley group4 obtained sequences for the ligand by polymerase
chain reaction (PCR) amplification ofcDNA derived from renal
tissue. Therefore, it seems certain thatthekidney plays a role in
thrombopoietin production.
In agreement with previous claims using TSF,' the stimulation of
megakaryocytopoiesis appears be
to
by a single
and
not
multiple factors as several workers using in vitro experiments have
claimed. Moreover, there is unanimous agreement that both TSF
and the ligand are lineage specific.'" However, TSF appears to have
a higher specific activity',6 than thematerial described by de Sauvage
et al.' indicating that highly purified TSF may be a truncated form
of c-mpl-L. Alternatively, the ligand could be partially denatured
during the recovery process, yielding a lower value. TSF has significant activity at both 15 kD and30 kD MW (depending on the method
of purification), andin its highlypurified form it has a specific
activity of about 21,000 U/mg protein? However, the de Sauvage
et al material,' tested as afull-length molecule, had a specific activity
of only about 41 U/mg protein. To arrive at this value the specific
activity was calculated as follows: in the de Sauvage et al report,'
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
CORRESPONDENCE
293
64,OOO U of the ligand gave an increase of about 40% in "S incorporation into platelets in the immunothromhocythemic mouse assay,
or about 0.8 U of TSF per 64.OOO U. Using the method ofMcDonald
et al" for calculating U. a 50% increase in 9 incorporation into
platelets equals I U. Therefore. 3.3 X 10' U (the specific activity reported for the ligand) divided by80.OOO U (number of U required to give l U of TSF) equals 41 U. Although the other preparations'.' have notbeen
assayed in the immunothrombocythemic
mouse assay, their activities appear to he more potent than the Genentech material.'
TSF srimttlares human MO-7E cells. By use of the human MO7E cell linethat is totally factor-dependent (the cells respondto
granulocyte macrophage-colony stimulating factor [GM-CSF], interleukin-3 [IL-31. and erythropoietin [EPO]) and expresses a high
level of c-mpl-R on the cell surface. we were able to show that TSF
causes the MO-7E cells to proliferate, indicating the likelihood that
TSF hinds the c-mpl-R. The TSF that was used was partially purified
step I1 material that had a specific activity of 129.4 U of TSFlmg
of protein.' This TSF preparation had no detectable levels of IL-6,
IL-3. GM-CSF, EPO, tissue necrosis factor (TNF). IL-l a and 0,
and endotoxins. The assay was a proliferation assay, similar to the
one usedwiththe transfected BaF3lmpl cells,' utilizing exponentially growing MO-7E cells (a-minimal essential medium [a-MEM]
+ 10% fetal calf serum [FCS] + 20 nglmL rhu-GM-CSF]. The cells
were washed three times in medium and starved for 4 hours before
seeding into a flat-hottom 96-well plate at a concentration of 30.OOO
cells in 100 pL medium (a-MEM + 10% FCS). TSF andhuman
serum albumin (HSA) were assayed in triplicate at final concentrations indicated on the figure. Cells were incubated for 48 hours, and
0.5 pCi of6-'H thymidine was added for 6 hours. Radioactivity
incorporation was determined by liquid scintillation counting. Results are presented as mean cpm for triplicate wells minus hackground (which was 6,540 cpm).
The results show that TSF contains an activity that induces the
proliferation of MO-7E cells (Fig I ) . Even at a final dilution of 1
nglmL (1.3 milliunits of TSF). the cpm was very high (>100,OOO
cpm). HSA,the carrier protein, didnot show the activity (Fig I ) .
The data outlined above show that TSF causes MO-7E cells to
proliferate. It seems likely that TSF binds the c-mpl-R, leading to
cell proliferation.
HEK cells contain mRNA f . r c-mpl-L. In addition to data illustrating that TSF may hind c-mpl-R. compelling evidence in support
of the hypothesis that TSF and c-mpl-L are the same factor comes
25 20
-
0
15-
x
UHSA
04
U
U
0.1
0.04
0.02
0.001
FINAL CONCENTRATION(pg/ml)
Fig 1. Dose-response curves of MO-7E cells to a TSF and human
serum albumin HSA. The final concentrationof the factors is as indicated on the horizontal axis.Values are the averageof triplicate
determinations.
M 1 2 3 4
"L
M 1 2 3 4
-1
GAPDH
Fig 2. Photograph showing reverse transcriptase IRTI-PCR of human embryonic kidney (HEKI cell RNA
with expected sizeband characteristic of the c-mpl-L (L]. For each set of reactions, M is 100-bp
molecular weight markers (100 to 1.500 bp with the brightest being
600 and 2,0721; lane 1 contains HEK cell RNA (RT-PCR);lane 2, human
cutaneous T-cell lymphoma RNA; lane 3 no RT RNA PCR reaction;
lane 4 is the positive control (L cDNA). In the upper gel, the positive
control reaction uses a human L cDNA as template, and in the lower
gel a fragment of the human glyceraldehyde phosphate dehydrogenase (GAPDHI cDNA was used as a template for the PCR reaction.
GAPDH was included to ensure adequacy of RT and loading.
from the fact that the mRNA for c-mpl-L is found in HEK cells. In
this work, HEK and human cutaneous T-cell lymphoma (HUT-78)
cells were grown in RPMI-1640 with 10% fetal bovine serum (FBS).
1% penicillin-streptomycin-Fungizone (PSF) to confluence for 7
days. Cells were harvested and total cellular RNA was made using
the RNAgents kit (Promega Corp. Madison WI) according tothe
manufacturer's specifications. Two micrograms oftotal cellular
RNA was subjected tofirst-strand cDNA synthesis usingthe SUPERSCRIPT 11 reverse transcriptase system (GIBCO BRL, Gaithersburg, MD) also according to manufacturer's suggested protocol.
Amplification was performed using 0.5 U Amplitaq (Perkin Elmer
Cetus. Nonvalk. CT) in the presence of I O mmol/L Tris-HCI (pH
8.3). 50 mmol/L KCI, 5 mmol/L MgC12, 200 pmol/L of each dNTP,
and 1 pmoVL of each primer in a 30-mL reaction. After 30 cycles
at 94°C X 1 minute, 60°C X I minute. 72°C X 2 minutes, the entire
a 0.8% agarose geland photographed. The
volumewasrunon
human-specific thromhopoietin primers (S' GCCAGAACTACTGGCTCTGG. 3' TGATGTCGGCAGTGTCTGAGAACC) yielded
a 455-bp product, and the human-specific glyceraldehyde phosphate
dehydrogenase (GAPDH) primers (S' CCATGGAGAAGGCTGGGG. 3' CAAAGTTGTCATGGATGACC)gave a 194-hp product.
These primers were designed to span introns to avoid contamination
with genomic DNA.
The results show the predicted hand of 455 nucleotides in HEK
cell RNA (Fig 2, upper gel, lane l). and in reactions containing
cDNA from the ligand (lane 4). hut not in reactions containing no
RNA (lane 3) or HUT-78 cell RNA (lane 2). A 194-nucleotideband
derived from GAPDH is also shown in the lower gelto insure
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
294
CORRESPONDENCE
adequacy of loading. These data show
that mRNA for c-mpl-L is
found in HEK cells.
HEK cells produce a factor that stimulates BaFJ/mpl cells. In
addition to the data outlined above illustrating similarities
in TSF
and c-mpl-L, additional new information show
that HEK cells grown
to confluence produce a factor
that stimulates BaF3lmpl cell proliferation.' Severaldilutions of spentculturemediumwereaddedto
3
logarithmically growing BaF3/mpl cells and the proliferation at
days was scored by the capacity of the cell pellet to reduce MTT
[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl
tetrazoliumbromide]as
described by Lok et al.* By using human thrombopoietin as a standard, HEK cell conditioned media contained-80 U/mL of thrombopoietin calculated by the method of Lok et al.'
In summary, our previous data show similarities in biologic and
chemical characteristics of TSF and c-mpl-L. We now report
that
TSF from HEK cells causesproliferation of MO-7E cells, a cell line
that expresses a high level of c-mpl-R. We also show
that HEK cells
contain the mRNA for c-mpl-L and produce a factor that causes
BaF3/mpl cells to proliferate. Therefore, we conclude that TSF and
c-mpl-L are the same factor.
T.P. McDonald
The University of Tennessee
College of Veterinary Medicine
Knoxville, TN
F. Wendling
W. Vainchenker
INSERM U 362
Institut Gustave Roussy
Villejuif: France
John M. McCarty
Maria J. Jorgenson
Kenneth Kaushansky
Division of Hematology
Univer.sity of Washington
School of Medicine
Seattle. WA
REFERENCES
1. de Sauvage FJ, Hass PE, Spencer SD, Malloy BE, GurneyAL.
Spencer SA, Darbonne WC, Henzel WJ, Wong SC,
Kuang WJ, Oles
KJ, Hultgren B, Solberg LA Jr. Coeddel DV, Eaton DL: Stimulation
of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand.
Nature 369533, 1994
2. Lok S, Kaushansky K, Holly RD, Kuijper JL, Lofton-Day CE,
Oort PJ, Grant FJ, Heipel MD, Burkhead SK, Kramer JM, Bell LA,
Sprecher CA, Blumberg H, Johnson R, PrunkardD,ChingAFT,
SG,
Mathews SL, Bailey MC, Forstron JW, Buddle MM, Osborn
Evans SJ, Sheppard PO, Presnell SR. O'Hara PJ, Hagen FS,
Roth
GJ, Foster DC: Cloning and expression of murine thrombopoietin
in vivo. Nature 369565,
cDNA and stimulation of platelet production
1994
3. Kaushansky K, Lok S, Holly RD. Broudy VC, Lin N. Bailey
MC, Forstron JW, Buddle MM, Oort PJ, Hagen FS, Roth GJ, Papayannopoulou T, Foster DC: Promotionof megakaryocyte progenitor
expansion and differentiation by the c-Mpl ligand thrombopoietin.
Nature 369568, 1994
4. Bartley TD, Bogenberger J, Hunt P, Li YS, Lu HS, Martin F,
Chang MS, Samal B, Nichol JL, Swift
S, Johnson MJ, HsuRY,
Parker VP, Suggs S, Skrine JD, Merewether LA, Clogston C, Hsu
E, Hokom MM, Hornkohl A, Choi E, Pangelinan M, Sun Y, Mar
V, McNich J, Simonet L, Jacobsen F, Xie C, Shutter
H, Chute H,
Basu R, Selander L, Trollinger D, Sieu L, Padilla D, Trail G, Elliott
G, Izumi R, Covey T, Crouse J, Garcia A, Xu W, Del Castillo J,
Biron J, Cole S, Hu MCT, Pacifici R, Ponting I, Saris C, Wen D,
Yung YP, Lin H, BosselmanRA: Identification andcloningofa
megakaryocyte growth and development factor that is a ligand for
the cytokine receptor mpl. Cell 77:1117, 1994
5. McDonaldTP:Thrombopoietin: Its biology,clinicalaspects
and possibilities. Am J Pediatr Hematol Oncol 14:8, 1992
6. McDonald TP, Clift RE, Cottrell MB: A four-step procedure
for the purification of thrombopoietin. Exp Hematol 17:865, 1989
7. Wendling F, Maraskovsky E, Debill N, Florindo C, Teepe M,
Titeux M, Methia N, Breton-Conus J, Cosman D, Vainchenker W:
c-Mpl ligandis a humoral regulatorof megakaryocytopoiesis. Nature
369571. 1994
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1995 85: 292-294
Thrombopoietin from human embryonic kidney cells is the same
factor as c-mpl-ligand [letter]
TP McDonald, F Wendling, W Vainchenker, JM McCarty, MJ Jorgenson and K Kaushansky
Updated information and services can be found at:
http://www.bloodjournal.org/content/85/1/292.citation.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.