Behavioral Ecology
doi:10.1093/beheco/ari049
Advance Access publication 13 April 2005
Reproductive asynchrony and population
divergence between two tropical bird
populations
Ignacio T. Moore,a Frances Bonier,b and John C. Wingfieldb
Department of Biology, 2119 Derring Hall, Virginia Tech, Blacksburg, VA 24061, USA, and
b
Department of Biology, University of Washington, Seattle, WA 98195, USA
a
High-latitude vertebrates generally breed seasonally and synchronously as the primary environmental cue used to time seasonal
processes is photoperiod. Investigations of tropical vertebrates have also documented seasonal reproduction, but it is unclear
how synchronous reproduction is, both within and between populations. In this study, we investigated whether seasonal
reproduction in a tropical species is synchronous between two populations in close proximity and, if not, whether asynchrony is
correlated with genetic and cultural differentiation. We describe two equatorial populations of rufous-collared sparrows
(Zonotrichia capensis), at the same latitude and separated by 25 km, that each breed seasonally but out of phase with each other.
This asynchronous reproductive phenology is associated with local weather patterns and is independent of photoperiod. At
a finer scale, reproductive timing is more highly synchronized within monogamous pairs than within the population as a whole.
Associated with the difference in reproductive phenologies, we document that males in each population sing different song
dialects. Using microsatellite DNA analysis, we found limited gene flow and significant genetic differentiation between the two
populations. From these results we hypothesize that cultural and genetic differentiation between populations, which can be
greater in tropical populations than temperate ones, can be associated with locally adapted reproductive phenologies. Key words:
biodiversity, bird, dialects, DNA, estrogen, evolution, microsatellite, migration rate, reproduction, song, speciation, testosterone,
tropics, Zonotrichia capensis. [Behav Ecol 16:755–762 (2005)]
easonal reproduction synchronizes breeding with food
abundance to maximize reproductive success (Lack, 1968).
Day length (hereafter referred to as photoperiod) has long
been known to be crucial to the timing of seasonal processes
(Gwinner, 2003). Photoperiodicity has been especially well
studied in temperate-zone birds (Dawson et al., 2001) where
the ultimately predictable change in the length of the day
is the initial predictive cue used to time reproduction
(Wingfield and Farner, 1993; Wingfield and Kenagy, 1991).
Supplementary cues, such as food availability, temperature,
and rainfall, are then used to fine-tune the timing of breeding
to the local environment (Wingfield and Kenagy, 1991). The
use of photoperiodic cues by animals increases with latitude
and results in synchronized breeding, both within and among
populations at the same latitude (Wingfield et al., 1997).
Mechanisms of seasonal reproduction in tropical species,
including birds, have not been nearly as well studied as in
temperate-zone species. Observational studies, in both the old
and new world tropics, have described seasonal activities such
as reproduction and molt but often without investigating the
environmental cues used for timing and regional variation
in timing (reviewed in Stutchbury and Morton, 2001). In
addition, some tropical birds exhibit a circannual endogenous
rhythm when kept in constant conditions (Gwinner and
Dittami, 1990; Lofts, 1964) while others are sensitive to small
changes (as little as 17 min) in photoperiod (Hau et al., 1998).
Generally, breeding seasons tend to be longer in the tropics
than in the temperate zone (Stutchbury and Morton, 2001).
Correspondingly, the level of reproductive synchrony, both
within and among populations, is expected to be lower in
S
Address correspondence to I. T. Moore. E-mail: [email protected].
Received 29 July 2004; accepted 15 March 2005.
The Author 2005. Published by Oxford University Press on behalf of
the International Society for Behavioral Ecology. All rights reserved.
For permissions, please e-mail: [email protected]
tropical populations due to the lack of environmental cues as
predictable as photoperiod (Stutchbury and Morton, 2001).
Because seasonally breeding equatorial populations may not
have the opportunity to rely on changes in photoperiod to
time reproduction, they must rely on other cues, such as food
availability, rainfall, and/or temperature change. These cues
vary locally, but can be predictable and reliable (e.g., Bendix
and Rafiqpoor, 2001). This could lead to locally adapted
breeding phenologies that vary on a much finer geographic
scale than is observed at higher latitudes. Indeed, it is likely
that many species and populations use a variety of environmental cues when determining when to breed.
It has recently been documented that, within species,
populations at lower latitudes are more genetically divergent
than those at higher latitudes (Martin and McKay, 2004). This
is thought to be a proximate explanation (Martin and McKay,
2004) that results in the tropics being more biodiverse than
the temperate zone (Willig et al., 2003). However, it is not
well understood what factors contribute to the greater genetic divergence among populations initially. If reliance on
environmental cues, other than photoperiod, for timing
reproduction can promote reproductive asynchrony among
populations, then locally adapted seasonal reproduction
could be playing a crucial role in population differentiation.
We predicted that in tropical populations, particularly near
the equator, climatically distinct sites would promote breeding
asynchrony among the resident populations. We also predicted that asynchronous reproduction among populations
would then be associated with genetic and cultural isolation
and divergence. To test these predictions, we investigated two
equatorial populations of rufous-collared (also called chingolo or Andean) sparrows (Zonotrichia capensis) that are 25 km
apart and experience different climatic conditions (Figure 1)
but the same photoperiodic cues. We measured reproductive
activity during four distinct times of the year and used
756
Behavioral Ecology
Figure 1
Monthly rainfall amounts (average 2002–2004) at the two field sites,
Papallacta (east) and Pintag (west) that are separated by 25 km.
microsatellite DNA analysis and recorded local song dialects
to determine if the populations had diverged both genetically
and culturally, respectively.
Male Z. capensis in these two populations only sing during
the breeding season (Moore et al., 2004c), and males in each
population sing a distinct dialect (Figure 2). The neural songcontrol system is plastic and is fully grown during the
breeding season and regressed during the nonbreeding
season (Moore et al., 2004c). The songs of Z. capensis are
initiated with a series of note complexes (labeled as the theme
in Figure 2) and terminated by a trill (labeled as the trill in
Figure 2). Males in each population sing two song types, and
individuals may switch song types during bouts of singing.
Within both populations, the major difference between the
two songs types is in the theme portion, with little difference
in the trill. The theme portion may consist of two to three
notes (Papallacta) or one to two notes (Pintag). All males in
each population sing the local dialect with no apparent
crossover between the populations. It is not known if males or
females are able to discriminate between the song dialects.
METHODS
To investigate the relationships between reproductive phenology and population differentiation, we identified two
populations of Z. capensis that are very close to the equator.
These two sites are located near the towns of Papallacta and
Pintag, Ecuador, and are hereafter referred to as such
(Papallacta: 0 21.79 S, 78 9.09 W, 3300 m elevation; Pintag:
0 22.69 S, 78 22.59 W, 2900 m elevation). The two sites are
approximately 25 km apart but are geographically separated
by the Andean Divide (;4000 m). Being on the eastern
(Papallacta) slope of the Andes and in an inter-Andean valley
(Pintag), these two sites experience very different rainfall
patterns (Figure 1, Bendix and Rafiqpoor, 2001). We initiated
studies of Z. capensis in Papallacta in 2000 and later chose to
study the population in Pintag based on published (Bendix
and Rafiqpoor, 2001) climatic differences between the sites.
Breeding synchrony within equatorial populations
To investigate the level of breeding synchrony within the
population, we determined the reproductive state of individuals in the Papallacta populations from 18 August to 12
September 2000. This is the prebreeding period during which
individuals are recrudescing their gonads in anticipation of
the upcoming breeding season. Individuals were captured
and their reproductive state (testis length and width in
males and diameter of the largest ovarian follicle in females)
was determined by laparotomy and then released with an
Figure 2
Song variation between the two populations. Sonograms of representative songs from each population. Males in both the Papallacta
and Pintag populations sing two song types and alternate between
them.
individual color band. Testis volume in males was calculated
using a formula for ellipsoid cylinders (4/3p a2b where a is
half the testis width and b half the length). We followed birds
through observation and were able to identify seven pairs by
observing close association between individuals. Identified
pairs used for the analysis consisted of pairs that had been
captured at close to the same time (mean ¼ 1 day; range 0–4
days). We statistically compared the relationship between date
and male testis volume to determine the level of breeding
synchrony within the population and the relationship
between male testis volume and the diameter of the female’s
largest ovarian follicle to determine the degree of breeding
synchrony within pairs.
Moore et al.
•
Reproductive phenology and genetic isolation
Table 1
Sampling periods and sample sizes (by sex and age) from the two
populationsa
Sampling period
February
Papallacta
1119 February 2003,
M:14, F:6, Juv:8
April/May
19 April1 May 2002,
M:51, F:26, Juv:1
August/September 126 September 2002,
M:61, F:25, Juv:0
October
1622 October 2003,
M:9, F:12, Juv:5
a
Pintag
2125 February, 2003,
M:15, F:12, Juv:7
28 May 2002,
M:21, F:10, Juv:7
2831 August 2002,
M:7, F:9, Juv:0
1115 October 2003,
M:15, F:6, Juv:0
Abbreviations: M, male; F, female; Juv, juvenile.
Reproductive seasonality and synchrony between
equatorial populations
To investigate breeding seasonality between the populations,
we documented the reproductive states of individuals in the
Papallacta and Pintag populations during four different times
during the year (February, April/May, August/September,
October; see Table 1 for exact dates). During each of these
trips, we went to one site first and subsequently visited the
other site. Thus, the sites were investigated as closely as
reasonably possible to the same time. During each period we
passively caught individuals from each population in mist
nets, primarily during the early morning. On capture, a
;250-ll sample of whole blood was obtained from the alar
wing vein of each individual. We also obtained measurements
of body fat, wing length, body weight, cloacal protuberance
length (an androgen-sensitive copulatory organ in males),
and brood patch development (females). Body fat and brood
patch were scored on a scale from 1 to 5 (for details of
measurements see Wingfield and Farner, 1976). Blood
samples were stored on ice until the end of each day when
the plasma and red blood cells were separated through
centrifugation and each frozen (plasma for hormone analyses
and red blood cells for genetic analyses). We also compared
the proportion of each population that was comprised of
juveniles (juveniles have distinct plumage) during these four
periods of the year using a log-linear analysis for a 3 3 3
contingency table.
Blood samples were analyzed in duplicate by radioimmunoassay for testosterone in males and estradiol and progesterone in females (Moore et al., 2002). Briefly, steroids
were extracted from plasma using distilled dichloromethane
and subsequently purified and separated by chromatography
757
using diatomaceous earth columns. Plasma hormone concentrations were corrected for individual extraction efficiency.
The average amount of plasma used in the assays was 107 ll
(range 28–200 ll). The limits of detection for the assays
averaged 0.05 ng/ml for testosterone, 0.23 ng/ml for
estradiol, and 0.4 ng/ml for progesterone and depended on
the volume of the plasma sample. The samples were run in
four assays. Average intraassay variations were testosterone
13%, estradiol 9%, and progesterone 9%. Interassay variations
were testosterone 14%, estradiol 14%, and progesterone 31%.
Statistical analyses on reproductive timing between the two
populations were conducted separately on males and females.
In both cases, a MANOVA was conducted with month
(February, April/May, August/September, October), population (Papallacta, Pintag), and the interaction between the two
as explanatory variables. The response variables were testosterone levels and cloacal protuberance length in males and
estradiol levels, progesterone levels, and brood patch score in
females. After the MANOVA, individual ANOVAs were
conducted to determine where differences occurred. Statistically significant differences in the ANOVAs were based on
sequential Bonferroni adjustments using the Dunn-Šidák
method (Sokal and Rohlf, 1995).
Genetic divergence
Twenty-four individuals (12 male, 12 female) from each
population were genotyped at four neutral microsatellite loci.
We extracted DNA from red blood cells using the Qiagen
DNeasy Tissue Kit, following the manufacturer’s instructions
for extraction from nucleated blood cells. Primer sequences
and annealing temperatures are summarized in Table 2. We
amplified fragments at the four loci (Table 2) using 20-ll
polymerase chain reactions (PCRs) containing 50 mM KCl,
10 mM Tris-HCl, 2.5 mM MgCl, 0.2 mM deoxynucleoside
triphosphate, 0.5 lM of each primer, 0.5 units of polymerase,
and 50 ng of template. The following thermal conditions were
used for all loci: 94 C for 3 min followed by 33 cycles of 94 C
for 40 s, annealing temperature (Table 2) for 40 s, 72 C for 40
s, and a final extension step of 72 C for 5 min. PCR products
were separated on an Applied Biosystems 3100 capillary
electrophoresis system.
We performed tests of linkage disequilibrium and population differentiation and estimated FST and the number of
migrants per generation using GENEPOP (Raymond and
Rousset, 1995). The Slatkin private allele method is the
default method for estimating the number of migrants using
GENEPOP (Slatkin, 1985). Recent levels of gene flow between
the two sites were estimated using BayesAss (Wilson and
Rannala, 2003) with 3.0 3 107 iterations and default values for
burn-in and sampling frequency. We varied random seed
Table 2
Microsatellite loci used in the genetic analysis
Locus
Primer sequence (forward/reverse)
Escl1
TTCTCTTGGTCTATGGAAGGTG
GCTTGAAAGACAGTCACCAGG
TAGCATTTCTATGTAGTGTTATTTTAA
TTTATTTATGTTCATATAAACTGCATG
GCTATTGAGCTAACTAAATAAACAACT
CACAAATAGTAATTAAAAGGAAGTACC
AGGAAAAGGGAGGGAGAGGGTG
GGGAGTGCAGAATGTGCAAATG
Gf01
Gf06
Mme1
Annealing
temperature ( C)
Original reference
55
Hanotte et al. (1994)
50
Petren (1998)
50
Petren (1998)
55
Jeffery et al. (2001)
Behavioral Ecology
758
Figure 3
Relationship between male and female reproductive stage within
monogamous pairs. These data were collected during a single earlybreeding season period in the Papallacta population.
numbers and prior distributions to test the robustness of
our results.
RESULTS
Breeding synchrony within equatorial populations
During the prebreeding period there was individual variation
in the timing of reproductive development, within the
Papallacta population, independent of date (relationship
between male testis volume and date: N ¼ 81, R2 ¼ .005,
p ¼ .52). However, within monogamous pairs there was
a significant relationship between a male’s testis volume and
the diameter of the female’s largest ovarian follicle (Figure 3,
N ¼ 7, R2 ¼ .75, p ¼ .012).
Reproductive seasonality and synchrony between
equatorial populations
For adult males, the MANOVA on reproductive factors
demonstrated a significant effect of month, month by
population, but not population alone (for statistics on all
male reproductive factors, see Table 3 and Figure 4). For the
Table 3
Reproductive phenology of males
MANOVA
Intercept
Population
Month
Population 3 month
ANOVAs
Cloacal protuberance length
Population
Month
Population 3 month
Testosterone
Population
Month
Population 3 month
F
df
401.978
0.746
6.252
22.427
2,
2,
6,
6,
p
184
186
368
368
,0.0001*
0.476
,0.0001*
,0.0001*
0.044
11.245
52.936
1, 185
3, 185
3, 185
0.835
,0.0001*
,0.0001*
1.259
0.453
3.727
1, 185
3, 185
3, 185
0.263
0.716
0.012*
Figure 4
Male reproductive characters during four different times of year
between the two populations. For statistical analyses see Table 3
and text.
subsequent ANOVAs, cloacal protuberance length varied
significantly by month and month by population. Plasma
testosterone levels in males exhibited a significant interaction
between month and population. For adult females, the
MANOVA on reproductive factors demonstrated a significant
effect of month, population, and the interaction between
the two (for statistics on all female reproductive factors, see
Table 4 and Figure 5). For the subsequent ANOVAs, brood
patch score varied significantly by month and month by
population. Plasma progesterone and estradiol levels varied
significantly by month.
The proportion of each population that comprised
juveniles changed between the sampling periods (Table 5).
A log-linear analysis of a 3 3 3 contingency table (A ¼
population [Papallacta, Pintag], B ¼ month [February, April/
May, August/September, October], C ¼ age [adult, juvenile])
showed a significant interaction between the three terms
(G2 ¼ 81.58, df ¼ 10, p , .0001). Population and month are
dependent at each level of age (G2 ¼ 45.44, df ¼ 6, p , .0001).
Population and age are dependent at each month (G2 ¼
18.14, df ¼ 4, p ¼ .0012). Finally, month and age are
dependent at each population (G2 ¼ 47, df ¼ 6, p , .0001).
Genetic divergence
* Statistically significant result. The significance levels for univariate
tests on population 3 month were 0.0253 (cloacal protuberance
length) and 0.05 (testosterone), based on sequential Bonferroni
adjustments by the Dunn-Šidák method. The explanatory variables
are population (Papallacta, Pintag) and month (February, May,
September, October).
We found that all four loci were unlinked. The two
subpopulations were significantly genetically differentiated
(G-based Fisher’s combined probability test of differentiation,
v2 ¼ 32.61, df ¼ 8, p ¼ .00007). The estimate of FST was 0.014
and the number of migrants per generation was 2.33. The
Moore et al.
•
Reproductive phenology and genetic isolation
759
Table 4
Reproductive phenology of females
F
df
MANOVA
Intercept
Population
Month
Population 3 month
47.188
2.725
4.177
8.007
3,
3,
9,
9,
ANOVAs
Brood patch
Population
Month
Population 3 month
4.966
6.577
24.142
1, 98
3, 98
3, 98
0.028
0.0004*
,0.0001*
Progesterone
Population
Month
Population 3 month
2.868
3.208
1.785
1, 98
3, 98
3, 98
0.094
0.026*
0.155
Estradiol
Population
Month
Population 3 month
0.454
3.777
1.525
1, 98
3, 98
3, 98
0.502
0.013*
0.213
p
96
96
234
234
,0.0001*
0.048
,0.0001*
,0.0001*
* Statistically significant result based on sequential Bonferroni adjustments by the Dunn-Šidák method. The significance levels for
univariate tests on population were 0.0170 (brood patch), 0.0253
(progesterone), and 0.05 (estradiol). Significance level for univariate
tests on month were 0.0170 (brood patch), 0.0253 (estradiol), and
0.05 (progesterone). The significance levels for univariate tests on
population 3 month were 0.0170 (brood patch), 0.0253 (progesterone), and 0.05 (estradiol). The explanatory variables are
population (Papallacta, Pintag) and month (February, May, September, October).
rates of gene flow between the two populations are
summarized in Table 6. The posterior distributions of
migration rate were not sensitive to changes in random seed
number or prior distribution estimates.
DISCUSSION
This study suggests that reliance on cues other than
photoperiod to time seasonal processes can result in locally
adapted reproductive phenologies. Thus, population level
reproductive phenologies can be asynchronous even between
populations in close proximity if the environmental and
climatic conditions vary. This asynchronous reproduction can
also be associated with genetic and cultural isolation and
divergence, although the causal factor is unknown. Allochronic speciation (speciation associated with different
phenologies) has been previously described, especially in
insects (e.g., Alexander and Bigelow, 1960; Cooley et al., 2001,
2003), but to our knowledge it has not been described in
birds. In the current system, it is not known if each
population’s reproductive phenology is genetically based or
is a phenotypically plastic response to the local environment.
If reproductive phenologies are genetically based (e.g.,
Gwinner and Dittami, 1990; Lambrechts et al., 1999), this
could serve as an obvious barrier to gene flow between
populations, promoting genetic differentiation. This potential
reproductive isolating mechanism could then be a critical
initial factor for future speciation. Locally adapted reproductive phenologies, even if a result of phenotypic plasticity,
could result in genetic drift and divergence if the populations
are not continuous. In this scenario, the barrier of the
Figure 5
Female reproductive characters during four different times of year
between the two populations. For statistical analyses see Table 4
and text.
Andean Divide is likely responsible for both the asynchronous
reproductive phenologies and genetic and cultural divergence. Often, reproductive phenology is governed by a combination of genetic and environmental factors (Gwinner,
2003; Lambrechts et al., 1999). Future studies will attempt to
discern if the asynchronous reproduction between the sites
is the result of genetically based endogenous rhythms or
phenotypic plasticity. In either case, genetic or plastic, we
hypothesize that locally adapted reproductive phenologies are
a potential mechanism to help explain the greater genetic
divergence among tropical populations, relative to temperatezone populations, and the greater biodiversity in the tropics.
Behavioral Ecology
760
Table 5
Proportion of juveniles in the population
Papallacta
Pintag
February
April/May
August/September
October
8/28 ¼ 29%
7/34 ¼ 21%
1/78 ¼ 1%
7/38 ¼ 18%
0/86 ¼ 0%
0/16 ¼ 0%
5/26 ¼ 19%
0/21 ¼ 0%
Proportion of each population that are juveniles during each of the four sampling periods.
Breeding synchrony within equatorial populations
From our results, and those published previously (Moore et
al., 2002, 2004a,b), it appears that breeding synchrony is
greater within pairs than within populations. Both these
equatorial populations of Z. capensis have extended breeding
seasons, and not all individuals initiate seasonal gonadal
growth at the same time. As such, there is a relatively large
degree of within-population asynchrony at the beginning of
the breeding season, in comparison with high-latitude species
(Hahn et al., 1995; Hunt et al., 1995). This species is also
socially monogamous (Miller and Miller, 1968). Thus, being
able to synchronize reproductive stage within pairs facilitates
successful reproduction. There is debate on the relationship
between within-population breeding synchrony and the rates
of extrapair fertilizations (EPF) (Schwagmeyer and Ketterson,
1999; Stutchbury and Morton, 2001). We do not currently
know the EPF rate in these populations.
Social cues are used as supplementary factors to fine-tune
the seasonal growth of gonads in temperate-zone species
(Wingfield and Kenagy, 1991). Previous studies in closely
related temperate-zone species have suggested that these
social cues are hormonally mediated (Moore, 1982, 1983,
1984). It is probable that the breeding synchrony within pairs,
that we describe, is mediated by social cues. It is unclear if
these social cues are serving as supplementary cues or if one
sex is simply driving the reproductive seasonality and the
other is following. Future studies will investigate the hormonal
and behavioral basis of reproductive synchrony within pairs.
Reproductive seasonality and synchrony between
equatorial populations
Broad-level seasonal processes such as reproduction, territoriality, and molt have been previously described in tropical
birds (for a review see Stutchbury and Morton, 2001). The
current study documents seasonal reproduction in each of the
two populations investigated. We conclude that the reproduction is truly seasonal and asynchronous in nature, and not
opportunistic, because the same pattern has been observed
over 4 years in Papallacta and over 2 years in Pintag. In
addition, the gonads are fully regressed during nonbreeding
periods, suggesting that the birds are truly unable to breed
Table 6
Migration rates between the populations
Home population
Pintag
Papallacta
Pintag
Papallacta
0.92 (0.04)
0.08 (0.04)
0.11 (0.09)
0.89 (0.09)
The proportion of the total home population of each generation that
is derived from its and the other population (mean and SD).
during those times of the year and every individual in the
population is following the same general schedule. Molt also
occurs asynchronously between the two populations (Moore,
personal observation). The reproductive pattern we describe
is also accompanied by changes in brain structure that are
thought to be associated with seasonal reproduction. The size
and structure of the neural song-control system in these birds
changes seasonally and asynchronously between these populations (Moore et al., 2004c) as does the hypothalamic
gonadotropin-releasing hormone system (Moore IT, Bonier F,
Wingfield JC, in preparation).
The fact that the reproductive cycle is consistent year to
year suggests that breeding is being driven by either an
endogenous rhythm, some factor in the environment, or
a combination of both (Gwinner, 2003). While it would be
novel, the environmental factor could be serving as a circannual zeitgeber (an environmental factor used to entrain
biological rhythms such as annual cycles) to set the clock
(Scheuerlein and Gwinner, 2002). This has been previously
discussed as a mechanism tropical birds could use to time
seasonal processes in environments lacking the predictable
photoperiodic cues (Gwinner, 2003). At this point, it is
unclear whether the differences in timing of breeding
between the populations are due to genetically based differences between the populations, phenotypic plasticity, or
a combination of both.
Seasonal reproduction in these populations is most likely
occurring independent of photoperiod, but it is unclear what
the relevant environmental cues are. It is unknown if seasonal
changes in timing of dawn and dusk are important for these
birds (Borchert et al., 2005). While even small changes in
photoperiod can mediate gonad growth in tropical birds (Hau
et al., 1998), it is unlikely that the slight changes that occur at
the two field sites, so close to the equator, are perceptible. In
addition, the fact that the breeding schedules are asynchronous in the two populations, despite the fact that they are
found at the same latitude, further suggests that the birds are
relying on environmental cues other than photoperiod.
It is possible that the two populations (1) rely on the same
cue, which is timed differently between the sites; (2) rely on
different cues; or (3) rely on the same cue, which is timed the
same, but stimulates different responses. Rainfall patterns are
different between these two sites despite their close proximity
(Figure 1). It is possible that seasonal changes in food supply
rather than, but associated with, rainfall pattern are responsible for the timing of reproduction in these two
populations. In another tropical species, the Seychelles
warbler (Acrocephalus sechellensis), food supply appears be an
important determinant of seasonal reproductive patterns
(Komdeur, 1996). Birds transferred to islands with higher
food availability extended their breeding seasons and produced more broods of young.
However, there does appear to be an endogenous basis for
some seasonal reproduction in tropical birds (Gwinner, 2003).
While food availability can modify the timing of reproduction, it
does not appear to be the zeitgeber and seasonal processes
Moore et al.
•
Reproductive phenology and genetic isolation
continue in constant conditions (Gwinner and Dittami, 1990;
Scheuerlein and Gwinner, 2002). Other studies in midlatitude
species (blue tits, Parus caeruleus) have documented population
differences in breeding phenology in populations at the same
latitude (Lambrechts and Perret, 2000; Lambrechts et al.,
1996). While there appears to be a genetic difference in
response to photoperiod cues, the birds are also using food cues
to modify the timing of reproduction (Lambrechts et al., 1999).
Population divergence
These two populations, separated by 25 km, have diverged
both genetically (microsatellite DNA) as well as culturally
(song dialects). It is worth noting that both these populations
are point samples within much larger populations that exist
on both slopes of the Andes but are not locally continuous
due to the Andean Divide. Members of the genus Zonotrichia
are typically good dispersers and have relatively low population levels of genetic structuring (Soha et al., 2004), although
the populations we studied are nonmigratory. Our results for
FST are similar to those published for other members of the
genus despite the use of similar (Soha et al., 2004) and
dissimilar techniques (Lougheed and Handford, 1992; Soha
et al., 2004). As our samples were obtained at sites within two,
probably very large and genetically diverse populations on
either slope of the Andes, FST is not expected to be high
(O’Reilly et al., 2004). The presence of multiple private alleles
and limited migration rates (Table 6) suggest high levels of
isolation for populations in such close proximity. It is also
worth noting that documenting genetic divergence at neutral
loci suggests that even greater divergence would be seen using
quantitative genetic trait variation (Qst) as Qst is typically larger
than FST (McKay and Latta, 2002). We would predict that
genetic divergence would be lower among equidistant
populations on each slope of the Andes than among
populations across the slope.
We do not know the cause and effect relationships between
reproductive asynchrony, cultural divergence, genetic divergence, and the geological barrier of the Andean Divide. It
seems likely that the Andean Divide has caused both the
reproductive asynchrony and the genetic divergence between
the two populations. This could result from the divide altering
weather patterns (Figure 1) and thus optimal periods for
reproduction, or the divide could be serving as a high-elevation
geological barrier to dispersal. The upper elevation limit for
breeding Z. capensis in Ecuador is ;3500 m (Ridgley and
Greenfield, 2001) and the lowest local pass is ;4000 m. It would
be difficult to discriminate which function of the divide is most
important for the genetic divergence between the populations.
It is also possible that an unidentified factor is responsible for
the genetic divergence between the populations.
While there is little previous information on breeding
synchrony and genetic relatedness, there is more information
on the relationship between culturally transmitted behaviors,
such as song dialects, and genetic relatedness (Baptista and
Trail, 1992). Vocal dialects and genetic differentiation have
been extensively studied in birds of the genus Zonotrichia.
Despite a number of studies, in a number of species and
subspecies of Zonotrichia, investigators have found little effect
of dialect on population genetic differentiation (Lougheed
and Handford, 1992; Lougheed et al., 1993; Soha et al., 2004).
The sole exception seems to be the mountain white-crowned
sparrow (Zonotrichia leucophrys oriantha), where there was
a small but significantly greater amount of genetic variation
among dialect areas than among sites within a dialect
(MacDougall-Shackleton EA and MacDougall-Shackleton SA,
2001). Dialect variation has been well documented in
Z. capensis (Handford and Lougheed, 1991; Lougheed et al.,
761
1989; Nottebohm, 1969, 1975). However, no relationship has
been found between genetic variation and dialects in
Z. capensis (Lougheed and Handford, 1992; Lougheed et al.,
1989, 1993). Thus, it appears that the current results are an
example of genetic divergence with song dialects, although it
is likely that the asynchronous reproduction between the
populations plays a role.
In summary, this study documents high levels of divergence
in multiple factors between tropical bird populations in close
proximity. Reproduction is seasonal in each population with
high levels of synchrony within monogamous pairs. Between
the two populations there is divergence in song dialects,
reproductive phenology, and neutral genetic markers. It is, as
yet, unknown what are the causal factors and what factors are
the effects. However, the results do suggest that local
adaptation can occur among populations in close proximity
in the tropics, especially when photoperiodic cues are not
used to organize seasonal processes, and this can be associated with genetic and cultural divergence. This divergence
could help explain the greater genetic divergence among
populations, and the greater biodiversity, in the tropics in
comparison to the temperate zone.
We would like to thank the following people for assistance in the field
and laboratory: Lisa Belden, Shallin Busch, Darren Lerner, Nicole
Perfito, Beth Ramage, Haruka Wada, and Brian Walker. We also thank
Toby Bradshaw, Ray Huey, Holly Goyert, Paul Martin, Paige Warren,
and Greg Wilson for useful comments on the genetic analyses and
earlier versions of the manuscript. We would like to thank the
Fundación Antisana, Fundación Terra, Termas de Papallacta, and
Patricio Muñoz for field arrangements. We thank L. Erckmann for
steroid assay assistance. This research was approved by the University
of Washington IACUC and supported by NSF IBN-9905679 to J.C.W.
and a Franklin Research Grant from the American Philosophical
Society to I.T.M. I.T.M. was supported by a NSF Postdoctoral
fellowship (DBI-9904144) and a Society for Neuroscience Postdoctoral fellowship (T32 MH20069).
REFERENCES
Alexander RD, Bigelow RS, 1960. Allochronic speciation in field
crickets, and a new species, Acheta veletis. Evolution 14:334–346.
Baptista LF, Trail PW, 1992. The role of song in the evolution of
passerine diversity. Syst Biol 41:242–247.
Bendix J, Rafiqpoor MD, 2001. Studies on the thermal conditions of
soils at the upper tree line in the paramo of Papallacta (eastern
cordillera of Ecuador). Erdkunde 55:257–276.
Borchert R, Renner SS, Calle Z, Navarrete D, Tye A, Gautler L,
Spichiger R, von Hildebrand P, 2005. Photoperiodic induction of
synchronous flowering near the Equator. Nature 433:627–629.
Cooley JR, Simon C, Marshall DC, 2003. Temporal separation and
speciation in periodical cicadas. Bioscience 53:151–157.
Cooley JR, Simon C, Marshall DC, Slon K, Ehrhardt C, 2001.
Allochronic speciation, secondary contact, and reproductive character displacement in periodical cicadas (Hemiptera: Magicicada
spp.): genetic, morphological, and behavioural evidence. Mol Ecol
10:661–671.
Dawson A, King VM, Bentley GE, Ball GF, 2001. Photoperiodic control
of seasonality in birds. J Biol Rhythms 16:365–380.
Gwinner E, 2003. Circannual rhythms in birds. Curr Opin Neurobiol
13:770–778.
Gwinner E, Dittami JP, 1990. Endogenous reproductive rhythms in
a tropical bird. Science 249:906–908.
Hahn TP, Wingfield JC, Mullen R, 1995. Endocrine bases of spatial
and temporal opportunism in arctic-breeding birds. Am Zool 35:
259–273.
Handford P, Lougheed SC, 1991. Variation in duration and frequency
characters in the song of the rufous-collared sparrow, Zonotrichia
capensis, with respect to habitat, trill dialects and body size. Condor
93:644–658.
762
Hanotte O, Zanon C, Pugh A, Grieg C, Dixon A, Burke T, 1994.
Isolation and characterization of microsatellite loci in a passerine
bird: the reed bunting Emberiza schoeniclus. Mol Ecol 3:529–530.
Hau M, Wikelski M, Wingfield JC, 1998. A neotropical forest bird can
measure the slight changes in tropical photoperiod. Proc R Soc
Lond B 265:89–95.
Hunt K, Wingfield JC, Astheimer LB, Buttemer WA, Hahn TP, 1995.
Temporal patterns of territorial behavior and circulating testosterone in the lapland langspur and other arctic passerines. Am Zool
35:274–284.
Jeffery KJ, Keller LF, Arcese P, Bruford MW, 2001. The development of
microsatellite loci in the song sparrow, Melospiza melodia (Aves) and
genotyping errors associated with good quality DNA. Mol Ecol
Notes 1:11–13.
Komdeur J, 1996. Seasonal timing of reproduction in a tropical bird,
the Seychelles warbler: a field experiment using translocation. J Biol
Rhythms 11:333–346.
Lack D, 1968. Ecological adaptations for breeding in birds. London:
Methuen.
Lambrechts MM, Perret P, 2000. A long photoperiod overrides nonphotoperiodic factors in blue tits’ timing of reproduction. Proc R
Soc Lond B 267:585–588.
Lambrechts MM, Perret P, Blondel J, 1996. Adaptive differences in
the timing of egg laying between different population of birds
results from variation in photoresponsiveness. Proc R Soc Lond B
263:19–22.
Lambrechts MM, Perret P, Maistre M, Blondel J, 1999. Do experiments
with captive non-domesticated animals make sense without population field studies? A case study with blue tits’ breeding time. Proc
R Soc Lond B 266:1311–1315.
Lofts B, 1964. Evidence of an autonomous reproductive rhythm in an
equatorial bird (Quelea quelea). Nature 201:523–524.
Lougheed SC, Handford P, 1992. Vocal dialects and structure of
geographic variation in morphological and allozymic characters
in the rufous-collared sparrow, Zonotrichia capensis. Evolution 46:
1443–1456.
Lougheed SC, Handford P, Baker AJ, 1993. Mitochondrial DNA
hyperdiversity and vocal dialects in a subspecies transition of the
rufous-collared sparrow. Condor 95:889–895.
Lougheed SC, Lougheed AJ, Handford P, 1989. Analysis of a dialect
boundary in chaco vegetation in the rufous-collared sparrow.
Condor 91:1002–1005.
MacDougall-Shackleton EA, MacDougall-Shackleton SA, 2001. Cultural and genetic evolution in mountain white-crowned sparrows:
song dialects are associated with population structure. Evolution 55:
2568–2575.
Martin PR, McKay JK, 2004. Latitudinal variation in genetic divergence of populations and the potential for future speciation.
Evolution 58:938–945.
McKay JK, Latta RG, 2002. Adaptive population divergence: markers,
QTL and traits. Trends Ecol Evol 17:285–291.
Miller AH, Miller VD, 1968. The behavioral ecology and breeding biology of the Andean sparrow, Zonotrichia capensis. Caldasia
10:83–154.
Moore IT, Perfito N, Wada H, Sperry TS, Wingfield JC, 2002.
Latitudinal variation in plasma testosterone levels in birds of the
genus Zonotrichia. Gen Comp Endocrinol 129:13–19.
Moore IT, Wada H, Perfito N, Busch DS, Wingfield JC, 2004a.
Territoriality and testosterone in an equatorial population of rufouscollared sparrows, Zonotrichia capensis. Anim Behav 67:411–420.
Moore IT, Walker BG, Wingfield JC, 2004b. The effects of combined
aromatase inhibitor and anti-androgen on male territorial aggression in a tropical population of rufous-collared sparrows, Zonotrichia
capensis. Gen Comp Endocrinol 135:223–229.
Moore IT, Wingfield JC, Brenowitz EA, 2004c. Plasticity of the avian
song control system in response to localized environmental cues in
an equatorial songbird. J Neurosci 24:10182–10185.
Moore MC, 1982. Hormonal response of free-living male whitecrowned sparrows to experimental manipulation of female sexual
behavior. Horm Behav 16:323–329.
Moore MC, 1983. Effect of female sexual displays on the endocrine
physiology and behaviour of male white-crowned sparrows, Zonotrichia leucophrys. J Zool (Lond) 199:137–148.
Moore MC, 1984. Changes in territorial defense produced by changes
in circulating levels of testosterone: a possible hormonal basis for
Behavioral Ecology
mate-guarding behavior in white-crowned sparrows. Behaviour 88:
215–226.
Nottebohm F, 1969. The song of the Chingolo, Zonotrichia capensis, in
Argentina: description and evaluation of a system of dialects.
Condor 71:299–315.
Nottebohm F, 1975. Continental patterns of song variability in
Zonotrichia capensis: some possible ecological correlates. Am Nat
109:605–624.
O’Reilly PT, Canino MF, Bailey M, Bentzen P, 2004. Inverse relationship between FST and microsatellite polymorphism in the marine
fish, walleye pollock (Theragra chalcogramma): implications for
resolving weak population structure. Mol Ecol 13:1799–1814.
Petren K, 1998. Microsatellite primers from Geospiza fortis and crossspecies amplification in Darwins finches. Mol Ecol 7:1771–1788.
Raymond M, Rousset F, 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered 86:248–249.
Ridgley RS, Greenfield PJ, 2001. The birds of Ecuador—field guide.
Ithaca, New York: Cornell University Press.
Scheuerlein A, Gwinner E, 2002. Is food availability a circannual
zeitgeber in tropical birds? A field experiment on stonechats in
tropical Africa. J Biol Rhythms 17:171–180.
Schwagmeyer PL, Ketterson ED, 1999. Breeding synchrony and EPF
rates: the key to a can of worms? Trends Ecol Evol 14:47–48.
Slatkin M, 1985. Rare alleles as indicators of gene flow. Evolution
39:53–65.
Soha JA, Nelson DA, Parker PG, 2004. Genetic analysis of song dialect
populations in Puget Sound white-crowned sparrows. Behav Ecol
15:636–646.
Sokal RR, Rohlf FJ, 1995. Biometry: the principles and practice of
statistics in biological research, 3rd ed. New York: W.H. Freeeman
and Company.
Stutchbury BJM, Morton ES, 2001. Behavioral ecology of tropical
birds. San Diego: Academic Press.
Willig MR, Kaufman DM, Stevens RD, 2003. Latitudinal gradients of
biodiversity: pattern, process, scale, and synthesis. Annu Rev Ecol
Evol Syst 34:273–309.
Wilson GA, Rannala B, 2003. Bayesian inference of recent migration
rates using multilocus genotypes. Genetics 163:1177–1191.
Wingfield JC, Farner DS, 1976. Avian endocrinology—field investigations and methods. Condor 78:571–573.
Wingfield JC, Farner DS, 1993. Endocrinology of reproduction in wild
species. In: Avian biology (Farner DS, King JR, Parkes KC, eds). San
Diego, Californai: Academic Press; 163–327.
Wingfield JC, Jacobs J, Hillgarth N, 1997. Ecological constraints
and the evolution of hormone-behavior interrelationships. In: The
integrative neurobiology of affiliation (Carter CS, Lederhendler II,
Kirkpatrick B, eds). New York: New York Academy of Sciences;
22–41.
Wingfield JC, Kenagy GJ, 1991. Natural regulation of reproductive
cycles. In: Vertebrate endocrinology: fundamentals and biomedical
implications (Pawg PKT, Schreibruan MP, eds). San Diego:
Academic Press Inc.; 181–241.