Biochem. J. (2013) 450, 427–432 (Printed in Great Britain)
427
doi:10.1042/BJ20121713
ACCELERATED PUBLICATION
Mammalian Trit1 is a tRNA[Ser]Sec -isopentenyl transferase required for full
selenoprotein expression
Noelia FRADEJAS*, Bradley A. CARLSON†, Eddy RIJNTJES*, Niels-Peter BECKER*, Ryuta TOBE† and Ulrich SCHWEIZER*‡1
*Institut für Experimentelle Endokrinologie, Charité-Universitätsmedizin Berlin, 13353 Berlin, Germany, †Molecular Biology of Selenium Section, BRL, National Cancer Institute,
National Institutes of Health, Bethesda, MD 10892, U.S.A., and ‡Institut für Biochemie und Molekularbiologie, Rheinische Friedrich-Wilhelms-Universität Bonn, Nussallee 11, 53115
Bonn, Germany
Selenoproteins are proteins carrying the rare amino acid Sec
(selenocysteine). Full expression of selenoproteins requires
modification of tRNA[Ser]Sec , including N 6 -isopentenylation of base
A37 . We show that Trit1 is a dimethylallyl:tRNA[Ser]Sec transferase.
Knockdown of Trit1 reduces expression of selenoproteins.
Incubation of in vitro transcribed tRNA[Ser]Sec with recombinant
Trit1 transfers [14 C]dimethylallyl pyrophosphate to tRNA[Ser]Sec .
37A>G tRNA[Ser]Sec is resistant to isopentenylation by Trit1.
INTRODUCTION
[IPT (2 -isopentenyl transferase); Figure 1B] [9–13]. The
i6 A modification is found in many bacterial and eukaryotic
tRNAs that read codons starting with U. Plants do not have
i6 A and archaea usually carry m1 G37 instead. tRNA carrying
the i6 A modification bind the ribosome more strongly and
form a minihelix with the codon more efficiently, possibly
because the modification disrupts competing interactions of bases
within the anticodon loop of tRNA [14,15]. Despite IPT homology
and the fact that most tRNA sequences are known, prediction of
which tRNA is a substrate of a given IPT is not yet possible
[16]. All enzymes responsible for tRNA[Ser]Sec modification in the
anticodon loop are still unknown. We speculated that TRIT1 is
the IPT for tRNA[Ser]Sec and thus modulates selenoprotein
expression. We tested this hypothesis in cell culture and in vitro
using recombinant Trit1 and in vitro transcribed tRNA[Ser]Sec .
Selenoproteins contain the rare amino acid Sec (selenocysteine)
which is co-translationally inserted into protein in response to
UGA codons (reviewed in [1]). The human genome contains
25 genes encoding selenoproteins, such as GPxs (glutathione
peroxidases), TXNRDs (thioredoxin reductases) and deiodinases
[2]. Many selenoproteins are involved in protection from
oxidative stress and have been implicated in protection from
carcinogenesis [1]. tRNA[Ser]Sec UCA is initially charged with Ser
(serine), which is converted into Sec on the tRNA. It is essential
for selenoprotein expression and Figure 1(A) highlights its
specific features. At 90 nucleotides, it is the longest tRNA in
mammals, and contains a few modified bases, e.g. 55 , m1 A58
(1-methyladenosine-58), and i6 A37 (N 6 -isopentenyl-adenosine37), and was the first mammalian tRNA shown to contain
mcm5 U34 (5-methoxycarbonylmethyluridine-34) and mcm5 Um34
(5-methylaminomethyl-2-thiouridine-34) [1].
Bioavailability of selenium is reflected by the ratio of the
two tRNA[Ser]Sec isoforms containing mcm5 U and mcm5 Um
at the wobble position [1]. Moreover, mcm5 Um formation
correlates with expression of stress-related selenoproteins such
as GPx1, SEPT (selenoprotein T) and SEPR (selenoprotein
R). The same selenoproteins also require i6 A37 , because
mutation of tRNA[Ser]Sec to G37 abolishes their expression [3–5].
Expression of selenoproteins is highest with full modification
of tRNA[Ser]Sec containing 55 , m1 A58 , mcm5 Um and i6 A37 .
Incubation with lovastatin reduced i6 A modification of tRNA[Ser]Sec
and selenoprotein expression in cell culture [6]. Overexpression
of 37A>G tRNA[Ser]Sec in mice not only reduced selenoprotein
expression, but also accelerated prostate carcinogenesis [7,8].
The enzyme responsible for tRNA isopentenylation is encoded
by the miaA gene in Escherichia coli, MOD5 in Saccharomyces
cerevisiae and tit1 + in Schizosaccharomyces pombe. It was
identified as a dimethylallyl pyrophosphate:tRNA transferase
Key words: dimethylallyl:tRNA[Ser]Sec transferase, N 6 -isopentenyladenosine (i6 A), isopentenyl tRNA transferase (IPT), isopentenylation, selenium, tRNA modification.
MATERIALS AND METHODS
Cultured cells and treatments
NIH 3T3 knockdown cells were grown at 37 ◦ C, 5 % CO2 in
DMEM (Dulbecco’s modified Eagle’s medium) supplemented
with 10 % FBS (fetal bovine serum) and 200 μg/ml hygromycin B
(Invitrogen). HepG2-overexpressing and -knockdown cells were
grown at 37 ◦ C, 5 % CO2 in DMEM/Ham’s F12 supplemented
with 10 % FBS and 2 μg/ml puromycin. Cells were seeded and
treated with sodium selenite (Na2 SeO3 ) in FBS-free medium at
the concentrations given in the Figures for 24 h or 3 days for NIH
3T3 and HepG2 cells respectively.
Knockdown and overexpression of Trit1
NIH 3T3 cells were transfected and stably selected (500 μg/ml
hygromycin B) with three different Trit1 shRNA (small hairpin
Abbreviations used: 2D, two-dimensional; DMAPP, dimethylallyl pyrophosphate; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine
serum; GPx, glutathione peroxidase; i6 A, N 6 -isopentenyl adenosine; IPT, 2 -isopentenyl tRNA transferase; m1 A58 , 1-methyladenosine-58; mcm5 U, 5methoxycarbonylmethyluridine; mcm5 Um, 5-methylaminomethyl-2-thiouridine; pi6 A, phospho-i6 A; qPCR, quantitative PCR; Sec, selenocysteine; SEPP,
selenoprotein P; Ser, serine; shRNA, small hairpin RNA; TXNRD, thioredoxin reductase; SEPS, selenoprotein S; TCA, trichloroacetic acid.
1
To whom correspondence should be addressed (email [email protected])
c The Authors Journal compilation c 2013 Biochemical Society
428
Figure 1
N. Fradejas and others
Modification of tRNA[Ser]Sec
(A) The tRNA in cloverleaf representation with anticodon and modified bases indicated in bold. (B) Transfer of DMAPP to A37 in tRNA is catalysed by TRIT1.
RNA) constructs and the corresponding non-specific control
as described in [17]. Sequences are given in Table 1. After
analysing the cell pools for Trit1 expression, selection of
different clones was performed from the pool which showed
the lowest expression of Trit1. Analysis of Trit1 mRNA levels
was performed by RT (reverse transcription)–PCR (results not
shown). One knockdown was chosen as that which showed the
lowest Trit1 expression in mRNA and protein levels compared
with the non-specific sequence. TRIT1 was amplified from HepG2
cDNA with primers given in Table 1 and cloned into the
pGEM T-Easy vector (Promega). After sequence verification,
TRIT1 was subcloned into pcDNA3 (Invitrogen). This construct
was subsequently used as a template for cloning V5- and
His-tagged TRIT1 into the pCDH-CMV-MCS-EF1-GreenPuro
plasmid (System Biosciences). The primers used included NheI
and EcoRI restriction sites respectively, and V5 and His tags
were added using the reverse primers given in Table 1. Plasmids
containing shRNA sequences against TRIT1 were obtained from
LFGC (Laboratory for Functional Genomic Research; CharitéUniversitätsmedizin, Berlin, Germany) (catalogue numbers
V2LHS_18767 and V2LHS_18771). HEK (human embryonic
kidney)-293T cells were co-transfected with the corresponding
target and packing plasmids as follows: 12.2 μg of psPAX2,
7.3 μg of pMD2.G and 17.6 μg of the TRIT1 overexpression,
empty plasmid, non-specific or respective shRNA plasmid, using
LipofectamineTM 2000 (Invitrogen) following the manufacturer’s
recommendations. After 48 h, virus particles were harvested and
used to transduce HepG2 cells. After selection with 5 μg/ml
puromycin, protein expression was analysed by Western blotting.
Western blotting and protein precipitation
Protein extracts (50 μg) were resolved by SDS/PAGE (12 %
gels), transferred on to nitrocellulose membranes and subjected
to immunoblotting with rabbit polyclonal anti-GPx1 (Abcam;
1:1000 dilution), anti-GPx4 (Abcam; 1:1000 dilution), antiTrit1 (Sigma; 1:1000 dilution), anti-SEPS (selenoprotein S;
Sigma–Aldrich; 1:1000 dilution) and anti-SEPP (selenoprotein
P; Immunoglobe; 1:400 dilution) antibodies; and our sheep
polyclonal anti-SEPP antibody (1:500 dilution). Monoclonal antiTXNRD1 (Abcam; 1:1000 dilution) and anti-V5 (Invitrogen;
1:5000 dilution) antibodies were also used. Membranes were
c The Authors Journal compilation c 2013 Biochemical Society
Table 1
Sequences and primers used for cloning and knockdown
fwd, forward; rev, reverse; ns, non-specific; Sh, shRNA
Function
Primer name
Sequence
Trit1 knockdown
Sh1
Sh2
Sh3
ns
fwd
rev
5 -GGAGATGGGCACTGGGAAA-3
5 -GGAAAGTGGTTGATCGGAA-3
5 -GGTATATGGCTTAGAAGTA-3
5 -CTACCGTTGTTATAGGTG-3
5 -ACCATGGCGTCCGTGGCG-3
5 -TTGGTCTTCAAGTCCTATGTCACAGC-3
fwd
5 -CTAGGCTAGCGGTACCATGGCGTCCGTGGCGGCTGCACGA-3
5 -TGCAGAATTCGGGTTTAAACTCAATGGTGATGGTGATGATGACCGGTACGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTTCGAACCGCGGGCCCTCTAGACTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTGCCCTTAACGCTGCATTTCAGCTCTTGATC-3
5 -AGAGATATGCCCGGAAACAG-3
5 -CTCCTCCCACTTGGAAACAT-3
5 -ATACGGAAGAAGGTGGTGGT-3
5 -TCTAGAACTGCCTGGTCAGC-3
TRIT1 cloning
TRIT1 overexpression
V5/His-rev
qPCR
Trit1 fwd
Trit1 rev
TRIT1 fwd
TRIT1 rev
reprobed with mouse monoclonal anti-β-actin antibody (Sigma;
1:25 000 dilution). In order to detect the secreted SEPP to the
cell medium, total protein was precipitated from 1 ml of medium
using TCA (trichloroacetic acid). Protein pellets were dissolved
in lysis buffer and used as mentioned aboved.
qPCR (quantitative PCR)
Analysis was performed with SYBR Green on iCycler (Bio-Rad
Laboratories) using primers given in Table 1 and normalized to
GAPDH (glyceraldehyde 3-phosphate dehydrogenase).
Recombinant expression of Trit1
Trit1 was expressed as a C-terminally 10×His-tagged fusion.
The D55G and T32A Trit1 mutants were generated using a
site-directed mutagenesis kit. Recombinant protein was purified
Trit1 isopentenylates A37 in tRNA[Ser]Sec
429
after induction with IPTG (isopropyl β-D-thiogalactopyranoside)
under native conditions by Ni-NTA (Ni2 + -nitrilotriacetate)
affinity chromatography.
Isopentenylation assay
Murine tRNA[Ser]Sec for activity assays was the same as that
crystallized recently [18]. The [14 C]DMAPP (dimethylallyl
pyrophosphate) reaction was performed as described in [16]
with minor modifications. In 100 μl of reaction buffer (50 mM
Tris/HCl, pH 7.5, 5 mM MgCl2 and 1 mM dithiothreitol), 10 μg
of tRNA[Ser]Sec , 1 nmol of [14 C]DMAPP, 10 units of RNase
inhibitor (Genecraft) and 2.6 μM recombinant Trit1 protein were
added. After incubation at 37 ◦ C, tRNA extraction was performed
using TRIzol® reagent (Invitrogen) following the manufacturer’s
instructions. Pellets were dissolved in scintillation liquid and
measured in a β-scintillation counter.
Minor base analysis
[α-32 P]ATP-labelled wild-type and 37A>G mutant tRNA[Ser]Sec
transcripts were prepared using the Riboprobe In Vitro
Transcription System (Promega) according to the manufacturer’s
instructions. A total of ∼500 000 c.p.m. of [α-32 P]ATP-labelled
wild-type and 37A>G mutant tRNA[Ser]Sec transcripts were treated
with or without 2 μg of Trit1 in a 100 μl reaction volume
containing 50 mM Tris/HCl, pH 7.5, 5 mM MgCl2 , 1 mM dithiothreitol and 2 mM DMAPP. Following a 2 h incubation at 37 ◦ C,
reaction mixtures were heated at 65 ◦ C for 10 min, extracted using
phenol/chloroform/isoamyl alcohol (125:24:1 by vol., pH 4.5)
and tRNA was precipitated with 0.1 vol. of 3 M ammonium
acetate and 3 vol. of ethanol. tRNA was collected by
centrifugation, washed with 70 % ethanol and dissolved in
25 μl of water. tRNAs were digested overnight with nuclease
P1 (Sigma) in 50 mM ammonium acetate, pH 5.3, at 37 ◦ C,
concentrated by SpeedVac, dissolved in 5 μl of water and spotted
on to a cellulose TLC plate (20 cm×20 cm, CEL 300 DEAE,
Macherey + Nagel). The resulting 5 -monophosphate nucleosides
were resolved by 2D (two-dimensional)-TLC as described in [19].
TLC plates were dried and exposed to a PhosphorImager. The
mobility rate of each base was compared with those of known
modified bases [19–21].
Statistical analysis
Overexpression and knockdown experiments were performed
in triplicate and all experiments were repeated at least twice.
Statistical analyses were performed using GraphPad Prism
software. Data are depicted as means +
− S.D.
RESULTS AND DISCUSSION
Knockdown of Trit1 reduces selenoprotein expression
We knocked down Trit1 protein expression in NIH 3T3 cells
by stable expression of shRNA (Figure 2A). Analysis of mRNA
abundance confirmed reduced Trit1 expression (Figure 2B). GPx1
expression is highly sensitive to tRNA[Ser]Sec modification as
demonstrated in mouse liver expressing only tRNA[Ser]Sec carrying
a 37A>G substitution [5]. Accordingly, we found that GPx1
levels in murine NIH 3T3 cells expressing the Trit1-knockdown
construct were significantly reduced compared with control cells
(Figure 2C).
We then asked whether selenoprotein expression also depends
on TRIT1 in human cells. We transduced and stably selected
Figure 2
GPx1 expression is reduced in Trit1 knockdown NIH 3T3 cells
(A) The amount of Trit1 protein is reduced in Trit1-knockdown (KD) cells compared with the
non-specific (NS) sequence. Note that the antiserum detects faster migrating non-Trit1 bands
(n.s) which are not affected by knockdown. (B) qPCR of Trit1 mRNA. (C) Western blotting
for GPx1 in Trit1-knockdown cells. NIH 3T3 cells were cultured in medium containing FBS or
sodium selenite (in nM). β-Actin served as loading control.
HepG2 cells with human V5-tagged TRIT1 or two TRIT1 shRNAs
(KD7 and KD8). qPCR confirmed moderate knockdown and
overexpression of TRIT1 (Figures 3A and 3B). Western blotting
for TRIT1 protein confirmed reduction of endogenous TRIT1
(Figure 3C). TRIT1 protein levels did not depend on selenium
availability in the medium (Figure 3D).
We then assessed selenoprotein expression in HepG2 cells
expressing the TRIT1-knockdown construct. Expression of
TXNRD1, GPx4 and SEPS was reduced in both KD7 and KD8
cells, but only in the absence of additional selenium (Figure 3E).
Secretion of SEPP into the medium was not reduced under lowselenium conditions. A moderate reduction is not unexpected
considering the fundamental role of i6 A37 in decoding UCN Ser
codons by tRNASer IGA and respective selective pressure in cell
culture. Although TXNRD1 activity has also been found to be
reduced in 37A>G tRNA[Ser]Sec -overexpressing CHO (Chinesehamster ovary) cells, TXNRD1 was efficiently expressed in
hepatocytes of transgenic mice expressing exclusively 37A>G
tRNA[Ser]Sec [5].
Overexpression of TRIT1 does not increase selenoprotein
expression
Overexpression of TRIT1 massively increased TRIT1 protein
levels, but did not change protein abundance of cellular TXNRD1,
GPx4, SEPS or secreted SEPP in the cell culture medium, irrespective of the availability of selenium in the medium (Figure 4).
This finding is probably explained by the observation that normal
mature tRNA populations are saturated with i6 A modifications
[9]. Overexpression of the modifying enzyme thus cannot increase
isopentenylation of tRNA[Ser]Sec further.
Recombinant Trit1 isopentenylates tRNA[Ser]Sec at A37
We expressed His-tagged murine Trit1 in E. coli, purified
the enzyme by Ni2 + affinity chromatography, and performed
c The Authors Journal compilation c 2013 Biochemical Society
430
Figure 3
cells
N. Fradejas and others
TRIT1 knockdown decreases selenoprotein expression in HepG2
(A) Knockdown shRNA constructs (KD7 and KD8) reduce TRIT1 mRNA. NS, non-specific shRNA.
(B) Overexpression (OE) of TRIT1 levels. (C) TRIT1 protein expression in stably transfected
HepG2 clones. Overexpressed V5-tagged TRIT1 is also detected by the V5 epitope tag. β-Actin
was used as loading control. C, naive control cells. (D) TRIT1 protein levels are independent
of selenium levels. (E) Selenoprotein expression is reduced in TRIT1-knockdown cells only
under selenium-deficient conditions. SEPP was precipitated from the medium with TCA (see
the Materials and methods section) prior to Western blotting.
Figure 4 Overexpression of TRIT1 does not increase selenoprotein
expression in HepG2 cells
The amounts of selenoproteins are not changed irrespective of the amount of selenium in the
medium. β-Actin was used as a loading control. SEPP was precipitated from medium. OE,
overexpressed.
c The Authors Journal compilation c 2013 Biochemical Society
tRNA[Ser]Sec modification assays with [14 C]DMAPP and in vitro
transcribed tRNA[Ser]Sec . Transfer of the 14 C-labelled isopentenyl
moiety on tRNA[Ser]Sec was time-dependent (Figure 5A).
tRNA[Ser]Sec from E. coli also carries the i6 A37 modification [22].
To exclude co-purification of undetected traces of endogenous
MiaA, we expressed two mutant variants of Trit1 and compared
these with wild-type enzyme in the tRNA[Ser]Sec -isopentenylation
assay. We chose to mutate Thr32 and Asp55 , because both amino
acids are conserved in MiaA and MOD5p and site-directed
mutagenesis in miaA significantly inhibited catalytic activity [23].
This is rationalized by their positions in the active centres of both
enzymes, where the corresponding threonine residue activates the
DMAPP moiety, whereas the corresponding aspartate engages in
hydrogen bonds with N6 of A37 and thus positions the acceptor
amino group [24,25]. Trit1 proteins carrying the D55G or T32A
mutations exhibited significantly reduced specific activity of 50 %
and 10 % of wild-type respectively (Figure 5B).
We then prepared 32 P-labelled tRNA[Ser]Sec by in vitro transcription in the presence of [α-32 P]ATP. In vitro isopentenylation with
DMAPP was followed by precipitation of high-molecular-mass
tRNA, enzymatic hydrolysis with ribonuclease P1, and separation
of 5 -32 P-labelled adenosines by TLC. As expected, incubation
with Trit1 and DMAPP produced a minor fraction of [32 P]pi6 A
(phospho-i6 A; Figure 5C). Finally, we found that substitution of
guanine for A37 in in vitro transcribed tRNA[Ser]Sec completely
abolished the formation of [32 P]pi6 A, demonstrating that A37 is
the only adenosine modified by Trit1 in tRNA[Ser]Sec .
We did not attempt to further characterize Trit1 as a
DMAPP:tRNA transferase using other tRNAs as substrates,
because there is a consensus that Trit1 is the mammalian
homologue of MiaA, MOD5p and Tit1p [16]. Yeast are devoid of
selenoproteins, but do express mod5-dependent phenotypes associated with nonsense suppression or stress-response, potentially
regulated through MOD5 prion formation [16,26]. Interestingly,
the other highly modified base position in tRNA[Ser]Sec is U34 .
It carries the mcm5 U modification, which depends on tRNA
methyltransferase TRM9/ABH8. Reduced activity of this enzyme
in yeast or human cells mediates translational control of a
class of stress-response genes characterized by skewed codon
usage [27,28]. This is reminiscent of the dependence of many
selenoprotein genes that are called ‘stress-responsive’ and are
sensitive to mutations in tRNA[Ser]Sec affecting bases 37 and 34
[5]. The human TRM9/ABH8 homologue probably involved in
the mcm5 U modification at the wobble base of tRNA[Ser]Sec is often
lost in colorectal carcinoma [29].
Selenium levels and selenoprotein expression have been implicated in cancer risk [1,7]. Interestingly, TRIT1 has been found
as a tumour suppressor gene in A549 lung cancer cells and
is down-regulated and lost in cancer-promoting changes in
tumorigenicity [30]. However, we are not aware of follow-up
studies on selenoprotein expression in A549 lung cancer cells
that show that this effect relies on selenoprotein expression.
Other studies have shown that reducing selenoprotein expression
can enhance tumour formation [7]. Given the fact that TRIT1
has other substrates beyond tRNA[Ser]Sec , however, other potential
mechanisms may as well contribute to translational control of gene
expression, e.g. frameshifting or nonsense suppression. Finally,
MOD5p, and probably also Trit1, may act on mitochondrial
tRNAs, thereby profoundly affecting cellular physiology [13,30].
Recently, a second prenyl modification of tRNA was discovered.
The well-known mnm5 s2 U (5-methoxycarbonylmethyl-2 -Omethyluridine) modified base at position 34 was shown to be
further modified by geranylation leading to the highly modified
base mnm5 ges2 U (5-methylaminomethyl-2-geranylthiouridine)
[31]. It is intriguing that SelU, the enzyme responsible for
Trit1 isopentenylates A37 in tRNA[Ser]Sec
Figure 5
431
Trit1 catalyses isopentenylation of tRNA[Ser]Sec at A37
(A) Time-dependent transfer of [14 C]DMAPP to tRNA[Ser]Sec by recombinant Trit1 protein in vitro . (B) Trit1 mutants D55G and T32A affecting the active site of Trit1 show reduced activity. Results
32
[Ser]Sec
. Autoradiography
are the means +
− S.D. for duplicate samples. **P < 0.01; ***P < 0.005; tested with ANOVA. (C) Minor base analysis of in vitro isopentenylated [α- P]ATP-labelled tRNA
shows Trit1-dependent formation of pi6 A, which is resolved from pA by 2D-TLC. 37A>G tRNA[Ser]Sec is not isopentenylated by Trit1.
geranylation of s2 U derivatives, is also able to exchange the sulfur
for selenium [31].
AUTHOR CONTRIBUTION
Noelia Fradejas, Bradley Carlson, Eddy Rijntjes, Niels-Peter Becker and Ryuta Tobe planned
and performed the experiments, and analysed the data. Ulrich Schweizer analysed the data
and wrote the paper. Noelia Fradejas, Bradley Carlson, Niels-Peter Becker and Ryuta Tobe
participated in writing the paper. Ulrich Schweizer designed the study and planned the
experiments.
ACKNOWLEDGEMENT
We thank Dr Oleg Ganishkin (Institut für Biochemie, Freie Universität Berlin, Berlin,
Germany) for the gift of in vitro transcribed murine tRNA[Ser]Sec .
FUNDING
N.F. was supported by Junta de Comunidades de Castilla-La Mancha (Spain). U.S.
was supported by Deutsche Forschungsgemeinschaft [grant number Schw914/2-1] and
Charité-Universitätsmedizin Berlin.
REFERENCES
1 Hatfield, D. L., Carlson, B. A., Xu, X. M., Mix, H. and Gladyshev, V. N. (2006)
Selenocysteine incorporation machinery and the role of selenoproteins in development
and health. Prog. Nucleic Acid Res. Mol. Biol. 81, 97–142
2 Kryukov, G. V., Castellano, S., Novoselov, S. V., Lobanov, A. V., Zehtab, O., Guigo, R. and
Gladyshev, V. N. (2003) Characterization of mammalian selenoproteomes. Science 300,
1439–1443
3 Diamond, A. M., Choi, I. S., Crain, P. F., Hashizume, T., Pomerantz, S. C., Cruz, R., Steer,
C. J., Hill, K. E., Burk, R. F. and McCloskey, J. A. (1993) Dietary selenium affects
methylation of the wobble nucleoside in the anticodon of selenocysteine tRNA[Ser]Sec . J.
Biol. Chem. 268, 14215–14223
4 Carlson, B. A., Xu, X. M., Gladyshev, V. N. and Hatfield, D. L. (2005) Selective rescue of
selenoprotein expression in mice lacking a highly specialized methyl group in
selenocysteine tRNA. J. Biol. Chem. 280, 5542–5548
5 Carlson, B. A., Moustafa, M. E., Sengupta, A., Schweizer, U., Shrimali, R., Rao, M.,
Zhong, N., Wang, S., Feigenbaum, L., Lee, B. J. et al. (2007) Selective restoration of the
selenoprotein population in a mouse hepatocyte selenoproteinless background with
different mutant selenocysteine tRNAs lacking Um34. J. Biol. Chem. 282, 32591–32602
c The Authors Journal compilation c 2013 Biochemical Society
432
N. Fradejas and others
6 Warner, G. J., Berry, M. J., Moustafa, M. E., Carlson, B. A., Hatfield, D. L. and Faust, J. R.
(2000) Inhibition of selenoprotein synthesis by selenocysteine tRNA[Ser]Sec lacking
isopentenyladenosine. J. Biol. Chem. 275, 28110–28119
7 Diwadkar-Navsariwala, V., Prins, G. S., Swanson, S. M., Birch, L. A., Ray, V. H., Hedayat,
S., Lantvit, D. L. and Diamond, A. M. (2006) Selenoprotein deficiency accelerates prostate
carcinogenesis in a transgenic model. Proc. Natl. Acad. Sci. U.S.A. 103, 8179–8184
8 Irons, R., Carlson, B. A., Hatfield, D. L. and Davis, C. D. (2006) Both selenoproteins and
low molecular weight selenocompounds reduce colon cancer risk in mice with genetically
impaired selenoprotein expression. J. Nutr. 136, 1311–1317
9 Fittler, F., Kline, L. K. and Hall, R. H. (1968) N6-(Delta 2-isopentenyl)adenosine:
biosynthesis in vitro by an enzyme extract from yeast and rat liver. Biochem. Biophys.
Res. Commun. 31, 571–576
10 Bartz, J. K., Kline, L. K. and Söll, D. (1970) N6-(Delta 2-isopentenyl)adenosine:
biosynthesis in vitro in transfer RNA by an enzyme purified from Escherichia coli .
Biochem. Biophys. Res. Commun. 40, 1481–1487
11 Eisenberg, S. P., Yarus, M. and Soll, L. (1979) The effect of an Escherichia coli regulatory
mutation on transfer RNA structure. J. Mol. Biol. 135, 111–126
12 Golovko, A., Hjalm, G., Sitbon, F. and Nicander, B. (2000) Cloning of a human tRNA
isopentenyl transferase. Gene 258, 85–93
13 Dihanich, M. E., Najarian, D., Clark, R., Gillman, E. C., Martin, N. C. and Hopper, A. K.
(1987) Isolation and characterization of MOD5, a gene required for isopentenylation of
cytoplasmic and mitochondrial tRNAs of Saccharomyces cerevisiae . Mol. Cell. Biol. 7,
177–184
14 Cabello-Villegas, J., Winkler, M. E. and Nikonowicz, E. P. (2002) Solution conformations
of unmodified and A37 N6 -dimethylallyl modified anticodon stem-loops of Escherichia coli
tRNAPhe . J. Mol. Biol. 319, 1015–1034
15 Chimnaronk, S., Forouhar, F., Sakai, J., Yao, M., Tron, C. M., Atta, M., Fontecave, M.,
Hunt, J. F. and Tanaka, I. (2009) Snapshots of dynamics in synthesizing
N6 -isopentenyladenosine at the tRNA anticodon. Biochemistry 48, 5057–5065
16 Lamichhane, T. N., Blewett, N. H. and Maraia, R. J. (2011) Plasticity and diversity of tRNA
anticodon determinants of substrate recognition by eukaryotic A37
isopentenyltransferases. RNA 17, 1846–1857
17 Xu, X. M., Yoo, M. H., Carlson, B. A., Gladyshev, V. N. and Hatfield, D. L. (2009)
Simultaneous knockdown of the expression of two genes using multiple shRNAs and
subsequent knock-in of their expression. Nat. Protoc. 4, 1338–1348
18 Ganichkin, O. M., Anedchenko, E. A. and Wahl, M. C. (2011) Crystal structure analysis
reveals functional flexibility in the selenocysteine-specific tRNA from mouse. PLoS ONE
6, e20032
Received 12 November 2012/21 December 2012; accepted 4 January 2013
Published as BJ Immediate Publication 4 January 2013, doi:10.1042/BJ20121713
c The Authors Journal compilation c 2013 Biochemical Society
19 Silberklang, M., Gillum, A. M. and RajBhandary, U. L. (1979) Use of in vitro 32 P labeling
in the sequence analysis of nonradioactive tRNAs. Methods Enzymol. 59, 58–109
20 Choi, I. S., Diamond, A. M., Crain, P. F., Kolker, J. D., McCloskey, J. A. and Hatfield, D. L.
(1994) Reconstitution of the biosynthetic pathway of selenocysteine tRNAs in Xenopus
oocytes. Biochemistry 33, 601–605
21 Kim, L. K., Matsufuji, T., Matsufuji, S., Carlson, B. A., Kim, S. S., Hatfield, D. L. and Lee,
B. J. (2000) Methylation of the ribosyl moiety at position 34 of selenocysteine
tRNA[Ser]Sec is governed by both primary and tertiary structure. RNA 6, 1306–1315
22 Schön, A., Böck, A., Ott, G., Sprinzl, M. and Söll, D. (1989) The selenocysteine-inserting
opal suppressor serine tRNA from E. coli is highly unusual in structure and modification.
Nucleic Acids Res. 17, 7159–7165
23 Soderberg, T. and Poulter, C. D. (2001) Escherichia coli dimethylallyl diphosphate:tRNA
dimethylallyltransferase: site-directed mutagenesis of highly conserved residues.
Biochemistry 40, 1734–1740
24 Zhou, C. and Huang, R. H. (2008) Crystallographic snapshots of eukaryotic
dimethylallyltransferase acting on tRNA: insight into tRNA recognition and reaction
mechanism. Proc. Natl. Acad. Sci. U.S.A. 105, 16142–16147
25 Seif, E. and Hallberg, B. M. (2009) RNA-protein mutually induced fit: structure of
Escherichia coli isopentenyl-tRNA transferase in complex with tRNAPhe . J. Biol. Chem.
284, 6600–6604
26 Suzuki, G., Shimazu, N. and Tanaka, M. (2012) A yeast prion, Mod5, promotes acquired
drug resistance and cell survival under environmental stress. Science 336, 355–359
27 Begley, U., Dyavaiah, M., Patil, A., Rooney, J. P., DiRenzo, D., Young, C. M., Conklin,
D. S., Zitomer, R. S. and Begley, T. J. (2007) Trm9-catalyzed tRNA modifications link
translation to the DNA damage response. Mol. Cell 28, 860–870
28 Fu, D., Brophy, J. A., Chan, C. T., Atmore, K. A., Begley, U., Paules, R. S., Dedon, P. C.,
Begley, T. J. and Samson, L. D. (2010) Human AlkB homolog ABH8 is a tRNA
methyltransferase required for wobble uridine modification and DNA damage survival.
Mol. Cell. Biol. 30, 2449–2459
29 Flanagan, J. M., Healey, S., Young, J., Whitehall, V., Trott, D. A., Newbold, R. F. and
Chenevix-Trench, G. (2004) Mapping of a candidate colorectal cancer tumor-suppressor
gene to a 900-kilobase region on the short arm of chromosome 8. Genes, Chromosomes
Cancer 40, 247–260
30 Spinola, M., Galvan, A., Pignatiello, C., Conti, B., Pastorino, U., Nicander, B., Paroni, R.
and Dragani, T. A. (2005) Identification and functional characterization of the candidate
tumor suppressor gene TRIT1 in human lung cancer. Oncogene 24, 5502–5509
31 Dumelin, C. E., Chen, Y., Leconte, A. M., Chen, Y. G. and Liu, D. R. (2012) Discovery and
biological characterization of geranylated RNA in bacteria. Nat. Chem. Biol. 8, 913–919