Carcinogenesis vol.35 no.5 pp.1121–1131, 2014
doi:10.1093/carcin/bgt491
Advance Access publication January 7, 2014
Inhibition of the nuclear transporter, Kpnβ1, results in prolonged mitotic arrest and
activation of the intrinsic apoptotic pathway in cervical cancer cells
Liselotte Angus†, Pauline J.van der Watt† and
Virna D.Leaner*
Division of Medical Biochemistry, Faculty of Health Sciences, University of
Cape Town, Institute of Infectious Disease and Molecular Medicine, Cape
Town 7925, South Africa
*To whom correspondence should be addressed. Division of Medical
Biochemistry, Faculty of Health Sciences, University of Cape Town,
Observatory, Cape Town 7925, South Africa. Tel: +27 21 406 6250;
Fax: +27 21 406 6061;
Email: [email protected]
The karyopherin β proteins are involved in nuclear-cytoplasmic
trafficking and are crucial for protein and RNA subcellular localization. We previously showed that Kpnβ1, a nuclear importin protein, is overexpressed in cervical cancer and is critical for cervical
cancer cell survival and proliferation, whereas non-cancer cells
are less dependent on its expression. This study aimed to identify
the mechanisms by which inhibition of Kpnβ1 results in cervical
cancer cell death. We show that the inhibition of Kpnβ1 results in
the induction of apoptosis and a prolonged mitotic arrest, accompanied by distinct mitotic defects in cervical cancer cells but not
non-cancer cells. In cervical cancer cells, Kpnβ1 downregulation
results in sustained degradation of the antiapoptotic protein, Mcl1, and elevated Noxa expression, as well as mitochondrial membrane permeabilization resulting in the release of cytochrome
C and activation of associated caspases. Although p53 becomes
stabilized in Kpnβ1 knockdown cervical cancer cells, apoptosis
occurs in a p53-independent manner. These results demonstrate
that blocking Kpnβ1 has potential as an anticancer therapeutic
approach.
Introduction
Karyopherin β1 (Kpnβ1, also known as importin β or p97) is a member of the karyopherin β superfamily of nuclear transport proteins.
Karyopherin β proteins are soluble nuclear transport receptor proteins
that function in transporting cargo proteins into and out of the cell
nucleus, via the nuclear pore complex (1). Karyopherin β proteins may
act as importins or exportins depending on the direction of transport.
Nuclear import via the importin protein, Kpnβ1, can occur by Kpnβ1
acting as an autonomous nuclear transport receptor. Alternatively,
Kpnβ1 can function in combination with up to 11 different partners
to ferry distinct cargoes (2). These include Kpnα (importin α) family
members, snurportin (3), importin 7 (4) and XRIPα (5). Kpnβ1 acts
mainly in association with Kpnα family members, which recognize
protein cargoes bearing nuclear localization signals and bind these
proteins in the cytoplasm (6). Kpnβ1 then translocates the import
complex (cargo:Kpnα:Kpnβ1) into the nucleus, at which point it dissociates on the binding of RanGTP, and the cargo proteins can then act
on their downstream targets.
In addition to the nuclear import function of Kpnβ1, it is also
reported to play a key role in the transition of the cell cycle, mitosis and replication (2,7). Kpnβ1 protein localization is spatially
and temporarily regulated during mitosis, and it has been shown to
interact with mitotic microtubules after nuclear envelope breakdown
Abbreviations: FACS, fluorescence-activated cell sorting; HPV, human papillomavirus; Kpnβ1, karyopherin β 1; mRNA, messenger RNA; MTT, 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bromide; PBS, phosphate-buffered
saline; SAF, spindle assembly factor; siRNA, short interfering RNA.
†
These authors contributed equally to this work.
and accumulate at spindle poles (8). Roscioli et al. (9) have recently
shown that Kpnβ1 regulates multiple aspects of mitosis, whereby
overexpression of Kpnβ1 resulted in dynamic mitotic defects in HeLa
cells, including multipolar division, abnormal chromosome alignment, mitotic delay and spindle axis reorientation.
As Kpnβ1 and its family members are required for multiple cellular processes, this protein family has received interest as potential
targets for cancer therapy (10–12). Kpnβ1, in particular, has recently
been identified as a potential anticancer target (reviewed in ref. 13).
In previous studies, we showed that Kpnβ1 messenger RNA (mRNA)
and protein expression is elevated in cervical cancer cells compared
with normal epithelial cells, as well as in transformed fibroblast cells
compared with untransformed fibroblasts, suggesting that Kpnβ1
overexpression might be a feature of the transformed phenotype (14).
Furthermore, we showed that elevated Kpnβ1 expression in cervical cancer/transformed cells derives from deregulated E2F activity
(15). In cervical cancer cells infected with the human papillomavirus
(HPV), E6 and E7 oncoproteins are expressed, which function in the
degradation of p53 and inactivation of Rb, respectively (16,17). As
Rb negatively regulates the expression of E2F and E2F functions in
the activation of the Kpnβ1 promoter, E7-mediated inactivation of Rb
accounts for, at least in part, the increased Kpnβ1 expression observed
in these cells (15). Smith et al. (18) observed increased Kpnβ1 mRNA
expression in ovarian cancer cell lines and transformed ovarian cells
compared with normal epithelial cells, suggesting that Kpnβ1 overexpression is not specific to cervical cancer, and Kuusisto et al. (19)
observed increased Kpnβ1 protein expression in transformed fibroblast
and epithelial cell lines compared with their untransformed counterparts. These authors showed that increased expression of Kpnβ1 (and
its adaptor Kpnα2, also known as Impα1) enables enhanced import
efficiencies in transformed cells (19). We previously showed that the
elevated expression of Kpnβ1 is necessary for cancer cell survival
as its inhibition in cervical cancer and transformed cells results in
cell death (14). The inhibition of Kpnβ1 in normal cells, on the other
hand, does not result in cell death (14). These results show that normal
and cancer cells respond differently to the inhibition of Kpnβ1 and
suggest that cancer cells become functionally dependent on Kpnβ1
overexpression, highlighting the importance of Kpnβ1 upregulation
in maintaining cancer cell biology. The mechanism by which cancer
cell death is activated when Kpnβ1 is inhibited remains unknown.
In this study, we examined the mechanism of cervical cancer cell
death induced by Kpnβ1 inhibition. We show that the inhibition of
Kpnβ1 in cervical cancer cells results in distinct mitotic defects, a
prolonged mitotic arrest, sustained degradation of Mcl-1 and elevated
Noxa expression. In addition, Kpnβ1 downregulation affects mitochondrial membrane permeabilization resulting in the release of
cytochrome C, activation of associated caspases-3/7 and cell death
via apoptosis. Although p53 becomes stabilized in Kpnβ1 knockdown
cells, apoptosis occurs in a p53-independent manner.
Materials and methods
Cell culture and RNA interference
HeLa, CaSki and WI38 were obtained from the American Type Culture
Collection. FG0 cells were obtained from the Department of Medicine,
University of Cape Town (Cape Town, South Africa) (20). Cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with penicillin (100 U/ml), streptomycin (100 μg/ml) and 10% fetal calf serum (Gibco,
Paisley, Scotland). All cells were cultured in 5% CO2 at 37°C. For the inhibition of Kpnβ1 gene expression, short interfering RNA (siRNA) was used
(sc-35736, Santa Cruz, Santa Cruz, CA). siRNA consisting of a scrambled
sequence (sc-37007, Santa Cruz) was used as a non-silencing control. Cells
were transiently transfected with 20 nM of siRNA using transfectin (Bio-Rad,
Richmond, CA). All cell lines were authenticated by DNA profiling using the
Cell ID System (Promega, Madison, WI).
© The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected]
1121
L.Angus, P.J.van der Watt and V.D.Leaner
Cell cycle synchronization
Cells were transfected with either 20 nM control siRNA or Kpnβ1 siRNA. After
48 h of post-transfection, cells were treated with 2 mM thymidine (Sigma–
Aldrich, St Louis, MO) for 24 h. Cells were released from the thymidine block
for 3 h, after which the cells were incubated with 100 ng/ml nocodazole (Sigma)
for 12 h. The nocodazole-containing medium was removed and cells were
washed with phosphate-buffered saline (PBS) before fresh growth medium was
added. After various time points, total protein and cells were harvested for western blot and fluorescence-activated cell sorting (FACS) analysis, respectively.
Cell cycle analysis
About 0.5 × 106 cells were fixed in 80% ethanol and incubated overnight
at 4°C. Fixed cells were resuspended in PBS containing 3 μM propidium
iodide and 500 U ribonuclease A. Cells cycle profiles were analyzed using
the Beckman FACSverse Flow Cytometer at 615 nm. Quantification of the cell
cycle profiles was performed using ModFit LT software.
Western blot analysis
Cells were treated as desired and lysed in radioimmunoprecipitation assay
buffer [10 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1% sodium deoxycholate, 0.1% sodium dodecyl sulphate, 1% Triton X-100, 1× complete protease
inhibitor cocktail (Roche, Mannheim, Germany)]. Protein concentrations
were quantified using a BCA Assay Kit (Pierce, Rockford, IL) and separated
on a polyacrylamide gel and transferred to a HyBond™-ECL™ nitrocellulose membrane (Amersham, Buckinghamshire, UK). Western blot analysis
were performed using rabbit anti-Karyopherin β1 (H-300; sc-11367), mouse
anti-p53 (M7001, DakoCytomation, Glostrup, Denmark), rabbit anti-p21
(H-164; sc-756), rabbit anti-Mcl-1 (H-260; sc-20679), rabbit anti-PARP
(H-250; sc-7150), rabbit anti-psHis3 (ser-10; sc-8656), rabbit anti-β-tubulin
(H235; sc-9104), rabbit anti-TATA-box binding protein (N-12; sc-204), mouse
anti-cytochrome C (BD Pharmingen, San Diego, CA), mouse anti-Bax (BD
Pharmingen), rabbit anti-p38 (M0800, Sigma), rabbit anti-pereroxiredoxin-3
(P1247, Sigma), mouse Rb (4H1; #9309, Cell Signaling, Danvers, MA) and
rabbit phospho-Rb (ser780; #9307S, Cell Signaling) antibodies. All antibodies
were obtained from Santa Cruz Biotechnology unless otherwise stated.
3-(4,5-Dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bromide assays
Cells were plated at 2000 cells per well in 96-well plates and the following day
transfected with 20 nM control or Kpnβ1 siRNA. After 120 h of post-transfection, viable cells were measured using 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) reagent (Cell Proliferation Kit I, Roche)
and absorbance at 595 nm was measured on a microplate spectrophotometer.
To assay for MTT absorbance after simultaneous Kpnβ1 and p53 knockdown,
cells were plated as described previously and the following day transfected
with 20 nM control or Kpnβ1 siRNA, in addition to 20 nM control or p53
siRNA. Forty-eight hours after transfection, cells were re-transfected with
10 nM control or p53 siRNA to maintain p53 downregulation. Ninety-six hours
after post-transfection, viable cells were measured using the MTT reagent.
Trypan blue assay
HeLa cells were plated at 25 000 cells per well in 24-well plates and the following day transfected with 20 nM control or Kpnβ1 siRNA. Every day posttransfection cells were trypsinized, incubated with 0.4% Trypan blue and the
number of stained (dead) and unstained (live) cells counted using a haemocytometer. The number of dead/live cells was expressed relative to the total
number of cells for each time point.
Fluorescent microscopy
Cells grown on coverslips were transfected with 20 nM control or Kpnβ1 siRNA.
To obtain images of kinetochore-associated proteins, cells were pre-incubated
in calcium extraction buffer (100 mM 1,4-piperazinediethane-sulphonic acid, 1
mM MgCl2, 1 mM CaCl2, 0.5% Triton X-100, pH 6.8) at 37°C for 3 min before
fixation in 4% paraformaldehyde. Cells were blocked in PBS-T containing 1%
bovine serum albumin and 0.3 M glycine for 30 min. Coverslips were subsequently incubated with anti-β-tubulin (1:100; Santa Cruz) for 45 min. After
three washes with PBS, Cy3-conjugated goat anti-rabbit secondary antibody
(1:400; Jackson ImmunoResearch) was applied for 45 min. Nuclear DNA was
stained using 100 ng/ml 4′,6-diamidino-2-phenylindole and coverslips were
mounted with Mowiol. Cells were examined under a Zeiss Axiovert 200 fluorescence microscope (Carl Zeiss International, Jena, Germany).
Subcellular fractionation
For mitochondria and cytoplasmic protein extraction. Cells were grown in
10 cm plates and treated with combinations of control siRNA, Kpnβ1 siRNA
and p53 siRNA. Cells were lysed in subcellular fractionation buffer (250 mM
sucrose, 20 mM N-2-hydroxyethylpiperazine-N′-2-ethanesulphonic acid,
10 mM KCl, 1.5 mM MgCl2, 1 mM ethylenediaminetetraacetic acid, 1 mM
1122
ethyleneglycol-bis(aminoethylether)-tetraacetic acid, 1 mM dithiothreitol
and 1× complete protease inhibitor cocktail [Roche]), passed through a 25 G
needle and incubated on ice for 20 min. The nuclear pellet was centrifuged
out at 720g for 5 min. The supernatant was further centrifuged at 10 000g
and the supernatant was used as the cytoplasmic fraction. The pellet containing the mitochondria fraction was washed in subcellular fractionation buffer
and passed through a 25 G needle. The mitochondria fraction was pelleted at
10 000g and resuspended in RIPA buffer. Anti-β-tubulin and anti-pereroxiredoxin-3 antibodies were used as protein loading controls for cytoplasmic and
mitochondrial fractions, respectively.
For nuclear and cytoplasmic protein extraction. Nuclear and cytoplasmic protein fractionation was performed using the NE-PER Nuclear Protein Extraction
Kit (ThermoScientific, Rockford, IL), according to manufacturer’s instructions.
Anti-β-tubulin and anti-TATA-box binding protein antibodies were used as protein loading controls for cytoplasmic and nuclear fractions, respectively.
Cycloheximide half-life experiments
For p53 half-life experiments, cells were transfected with control or Kpnβ1
siRNA and incubated for 72 h before treatment with 50 µg/ml cycloheximide.
Protein was harvested at various time points after cycloheximide treatment
and subjected to western blot analysis using an anti-p53 antibody. An anti-p38
MAP kinase antibody was used to control for protein loading. Bands were
quantitated by densitometric scanning and analyzed using Image J. To determine the protein half-life, the band intensities were plotted in log scale relative
to time and a linear trend-line drawn. The half-life equated to log2/slope.
Caspase-3/7 assays
For the analysis of caspase-3/7 activity following Kpnβ1 inhibition in HeLa,
CaSki, FG0 and WI38 cells, cells were plated at 2000 cells per well in 96-well
plates and 24 h later transfected with 20 nM Kpnβ1 siRNA or control siRNA.
After 72 h of post-transfection, the caspase-3/7 assay was performed using
the Caspase-Glo® 3/7 Assay Kit (Promega), according to the manufacturers’
instructions. For the analysis of caspase-3/7 activity following Kpnβ1 and concomitant p53 inhibition, cells were plated at 2000 cells per well in 96-well
plates and 24 h later transfected with 20 nM control or Kpnβ1 siRNA, together
with 20 nM control or p53 siRNA. After 48 h of siRNA transfection, cells
were re-transfected with 10 nM control or p53 siRNA, and the following day,
the caspase-3/7 assay was performed using the Caspase-Glo® 3/7 Assay Kit.
An MTT assay was performed concurrently to normalize for cell number, and
caspase-3/7 activity was expressed relative to cell number.
RNA isolation and real-time reverse transcription–PCR analysis
Cells were transfected with 20 nM siRNA and RNA harvested 72 or 96 h
post-siRNA transfection, using Qiazol (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Complementary DNA was synthesized using 2 µg RNA and used in real-time reverse transcription (RT)–PCR
analysis. The CT method was used for the calculation of expression fold
change between samples. CT values were standardized to the levels of glyceraldehyde 3-phosphate dehydrogenase. Experiments were performed in
triplicate and the average mRNA expression levels determined after normalization to glyceraldehyde 3-phosphate dehydrogenase. The average normalized value for control siRNA treated samples was converted to 1.0, and
the fold increase/decrease in the Kpnβ1 siRNA treated samples determined,
with the standard error of the mean representative of the repeated measurements. The sequence of quantitative PCR primers are as follows: Noxa F: 5ʹ
TGGAAGTCGAGTGTGCT ACTCAA 3ʹ and R: 5ʹ AGATTCAGAAGTTTC
TGCCGGAA 3ʹ; Puma F: 5ʹ CCTGGAGGGTCCTGTACAATCT 3ʹ and R:
5ʹ GCACCTAATTGGGCTCCATCT 3ʹ; HPV16 E6 F: 5ʹ ATGTTTCAGGAC
CCACAGG 3ʹ and R: 5ʹ TAAATCCCGAAAAGCAAAGTC 3ʹ; HPV16 E7 F:
5ʹ AAGTGTGACTCTACGCTTCGGTT 3ʹ and R: 5ʹ GCCCATTAACAGGTC
TTCCAAA 3ʹ; p73 F: 5ʹ CTCTGGAACCAGACAGC ACC 3ʹ and R: 5ʹ TGCT
CAGCAGATTGAACTGG 3ʹ; p63 F: ATGTCCCAG AGCACACAGAC and
R: CACGTCGAAACTGTGCGGGC; glyceraldehyde 3-phosphate dehydrogenase F: 5ʹ GGCTCTCCAGAACATCATCC 3ʹ and R: 5ʹ GCCTGCTTC
ACCACCTTC 3ʹ.
Statistical analysis
For all data analysis comparisons, the Student’s t-test was performed. A Pvalue of <0.05 was considered statistically significant.
Results
Kpnβ1 inhibition results in prolonged mitotic arrest and apoptosis in
cervical cancer cells
In previous studies, we have shown that Kpnβ1 mRNA and protein expression is elevated in cervical cancer and transformed cells,
Kpnβ1 inhibition results in mitotic arrest and apoptosis
through deregulation of E2F activity, and that the inhibition of Kpnβ1
results in cell death (14,15). Interestingly, the inhibition of Kpnβ1
did not affect normal cell survival (14). To further support these findings, we investigated the effect of Kpnβ1 siRNA on representative
cervical cancer and non-cancer cells over a period of 5 days using
the MTT assay. Kpnβ1 inhibition in HeLa and CaSki cervical cancer
cells resulted in a significant decrease in MTT absorbance, indicative of decreased cell proliferation and/or the induction of cell death
(Figure 1A, a and b). The non-cancer cells (FG0 and WI38), on the
other hand, were unaffected (Figure 1Ac and d). Western blot analysis
confirmed >60% Kpnβ1 knockdown in each cell line (Figure 1B and
C) and also revealed elevated Kpnβ1 levels in the cervical cancer cells
compared with the non-cancer fibroblasts (Figure 1B).
As Kpnβ1 inhibition in cervical cancer cells resulted in decreased
MTT absorbance, we next investigated whether there was an induction of cell death, using the trypan blue assay. Results showed a significant increase in the percentage of dead cells after Kpnβ1 inhibition,
and a concomitant decrease in the percentage of live cells, confirming
the induction of cancer cell death after Kpnβ1 knockdown (Figure 1D
and E). We further investigated whether apoptosis was induced as the
mechanism of cell death. Caspase-3/7 activity was measured after
Kpnβ1 inhibition in HeLa and CaSki cervical cancer cell lines and
compared with that in the two non-cancer cell lines (FG0 and WI38).
Kpnβ1 inhibition resulted in significant activation of caspase-3/7
in HeLa and CaSki cells but not in non-cancer FG0 and WI38 cells
(Figure 1F). These results highlight how normal and cancer cells
respond differently to the inhibition of Kpnβ1.
As Kpnβ1 inhibition in cervical cancer cells resulted in apoptotic
cell death, we further investigated its effect on cell cycle progression
due to the reported role of karyopherin proteins in the transition of the
cell cycle, mitosis and replication (2,7). Cervical cancer cells were
treated with either control or Kpnβ1 siRNA and cell cycle analysis
performed 96 h post-transfection. Interestingly, Kpnβ1 inhibition
resulted in a significant decrease in the percentage of cells in G1 and an
associated significant increase in the percentage of cells in the G2/M
phase of the cell cycle (Figure 2A). As expected, there was a significant increase in the percentage of sub-G1 cells, indicative of cell death
(Figure 2A). The G2/M arrest was investigated further by blocking the
cells in the G2/M stage of the cell cycle using a thymidine–nocodazole
block. Cells were released from the mitotic block and harvested for
protein for immunoblot or fixed for FACS analysis, respectively. The
cell cycle profiles obtained by FACS analysis showed that Kpnβ1
inhibition resulted in a prolonged G2/M arrest compared with cells
transfected with control siRNA (Figure 2B, Table I). In control siRNA
treated cells, the number of cells in the G2/M phase of the cell cycle
decreased within 4 h after the release of the G2/M block (Figure 2B).
In contrast, Kpnβ1 knockdown cells remained in the G2/M phase of
the cell cycle 12 h after the release of the G2/M block (Figure 2B).
Western blot analysis confirmed that Kpnβ1 inhibition resulted in a
prolonged mitotic arrest. After the release of the G2/M block, pS10Histone-3, a marker for cells in mitosis, remained elevated for longer in
cells treated with Kpnβ1 siRNA compared with controls (Figure 2C).
The prolonged G2/M arrest in Kpnβ1 inhibited cells associated with
decreased levels of Mcl-1. Mcl-1, an antiapoptotic member of the
Bcl-2 family, has previously been shown to be degraded during prolonged G2/M arrest (21). Cells treated with Kpnβ1 siRNA resulted
in Mcl-1 degradation within 6 h after the release of the nocodazole
block. In contrast, Mcl-1 was expressed at all of the time points tested
(0–12 h) in control siRNA treated cells (Figure 2C). p53 and p21 levels were elevated in Kpnβ1 treated cells compared with cells treated
with control siRNA (Figure 2C), supporting previously reported data
by van der Watt et al. (14) showing that p53 and p21 levels become
elevated when Kpnβ1 expression is inhibited in cervical cancer cells.
PARP cleavage, a hallmark of DNA damage and apoptosis, was also
observed in cells treated with Kpnβ1 siRNA (Figure 2C).
Interestingly, no prolonged mitotic arrest was observed when
Kpnβ1 was inhibited in the non-cancer cell line WI38 (Supplementary
Figure 1A, available at Carcinogenesis Online). Furthermore,
pS10His3 and Mcl-1 levels were unchanged between control and
Kpnβ1 siRNA-transfected WI38 cells, confirming that no prolonged
mitotic arrest was induced (Supplementary Figure 1B, available at
Carcinogenesis Online). These results further demonstrate that normal and cancer cells respond differently to the inhibition of Kpnβ1
and suggest that while cervical cancer cells become functionally
dependent on high Kpnβ1 expression, relying on it for mitotic progression, normal cells can function in the presence of low levels of
Kpnβ1.
Kpnβ1 inhibition results in distinct mitotic defects
Previous studies have shown that Kpnβ1 operates in physical association with the mitotic spindle in human cells (8). To investigate
whether loss of endogenous Kpnβ1 resulted in mitotic defects, cervical cancer cells were treated with either control or Kpnβ1 siRNA
and mitotic cells analyzed by immunofluorescence. Figure 2Da–d
shows representative fluorescent microscopy images of the mitotic
abnormalities induced by the inhibition of Kpnβ1 in asynchronous
CaSki cells. Multipolar spindles (i), chromosome misalignment (ii)
and lagging chromosomes in anaphase/telophase (iii) and metaphase
(iv) were observed in CaSki cells treated with Kpnβ1 siRNA for 96
h (Figure 2D, Supplementary Figure 2A, available at Carcinogenesis
Online). Quantification of the mitotic defects observed in CaSki cells
treated with Kpnβ1 siRNA showed a significant increase in mitotic
abnormalities (53%) compared with control (16%) siRNA treated
cells (Figure 2E). The quantification of mitotic defects in HeLa cells
similarly revealed a significant increase in mitotic abnormalities in
Kpnβ1 knockdown cells compared with control cells (Figure 2E,
Supplementary Figure 2B and C, available at Carcinogenesis Online).
Non-cancer cells (FG0 and WI38), however, did not display any
increase in mitotic defects after Kpnβ1 inhibition (Figure 2E).
Kpnβ1 knockdown results in mitochondrial membrane permeablization and cell death via the intrinsic apoptotic pathway, accompanied by an increase in p53 levels
As we observed the induction of caspase-3/7 activity, mitotic defects
and a prolonged mitotic arrest associated with Mcl-1 degradation,
we hypothesized that the intrinsic mitochondrial pathway might
be activated and responsible for cell death after Kpnβ1 inhibition.
Cytochrome C subcellular localization was thus investigated, as its
release into the cytoplasm is a characteristic feature of the intrinsic
mitochondrial pathway. Western blot analysis confirmed that Kpnβ1
protein expression was downregulated when cervical cancer cells
were treated with Kpnβ1 siRNA (Figure 3A). Mitochondrial and cytoplasmic fractions were extracted from these cells and cytochrome C
subcellular localization investigated by immunoblot analysis. Results
showed that cytochrome C was released from the mitochondria into
the cytoplasm in cells with Kpnβ1 knockdown, whereas cytochrome
C was absent in the cytoplasm in cells treated with control siRNA
(Figure 3B). This suggests that Kpnβ1 knockdown results in apoptosis through mitochondrial cytochrome C release.
Recent studies have shown that Bax is translocated to the mitochondrial membrane, to induce cytochrome C release into the cytoplasm (23). As cytochrome C was released in cells treated with Kpnβ1
siRNA, Bax translocation was investigated. Western blot analysis
revealed that there was Bax translocation from the cytoplasm to the
mitochondria in cervical cancer cells treated with Kpnβ1 siRNA
(Figure 3B). No cytoplasmic to mitochondria Bax translocation was
observed in control siRNA treated cells (Figure 3B).
Degradation of Mcl-1 has previously been shown to be induced
in both the cytoplasm and mitochondria under stress-induced conditions (23). As Mcl-1 was shown to be degraded in synchronized
cells, due to a prolonged mitotic arrest as a result of Kpnβ1 inhibition (Figure 2C), the levels of Mcl-1 protein in both the cytoplasm
and mitochondria were further investigated in asynchronous cells.
Subcellular fractionation showed that Mcl-1 levels were decreased in
both the cytoplasmic and mitochondria fractions when Kpnβ1 expression was inhibited compared with control (Figure 3B). Bax translocation to the mitochondria and Mcl-1 degradation in the cytoplasmic as
1123
L.Angus, P.J.van der Watt and V.D.Leaner
Fig. 1. Kpnβ1 inhibition results in cell death and caspase-3/7 activation in cervical cancer but not in non-cancer cells. (A) Representative cervical cancer
(HeLa and CaSki) and non-cancer (FG0 and WI38) cell lines were transfected with control (ctl) or Kpnβ1 siRNA and cell number measured over a period of
5 days using the MTT assay. Kpnβ1 inhibition in cervical cancer cells significantly reduced cell number (*P < 0.05, N = 3), whereas non-cancer cells were
unaffected. Error bars represent the mean ± SD. (B) Western blot showing Kpnβ1 knockdown in HeLa, CaSki, FG0 and WI38 cells. β-Tubulin was used to
control for cell loading. (C) Densitometric quantification of the western blot in B, showing >60% Kpnβ1 knockdown in each cell line. (D and E) Trypan blue
assay showing a decrease in the percentage of live cells and associated increase in the percentage of dead cells after Kpnβ1 inhibition (*P < 0.05, N = 3). (F)
Caspase-3/7 activity was measured in cervical cancer (HeLa and CaSki) and fibroblast (FG0 and WI38) cells 72 h post-transfection with control or Kpnβ1
siRNA. Kpnβ1 inhibition resulted in a significant induction of caspase-3/7 activity in cervical cancer but not in non-cancer cells. Error bars represent the mean
± SEM (*P < 0.05, N = 3).
1124
Kpnβ1 inhibition results in mitotic arrest and apoptosis
Fig. 2. Kpnβ1 inhibition results in a prolonged mitotic arrest and distinct mitotic defects in cervical cancer cells. (A) CaSki cells were transfected with 20 nM
control or Kpnβ1 siRNA and cell cycle analysis performed 96 h post-transfection. An increase in the percentage of cells in the G2/M phase of the cell cycle was
observed, together with an increase in the percentage of sub-G1 cells and a decrease in the percentage of cells in the G1 phase (*P < 0.05, N = 3). (B) CaSki
cells were synchronized at the G2/M boundary by a thymidine–nocodazole block and then released to progress through the cell cycle. Samples were collected
at various time points after the release of the G2/M block and examined by FACS analysis. The sub-G1 cells were gated out of the analysis. (C) Samples were
similarly collected at various time points after release of the G2/M block for western blot analyses. p38 was used as a loading control. (D, a–d) Representative
pictures are shown for mitotic abnormalities induced by the inhibition of Kpnβ1 in asynchronous CaSki cells. Cell nuclei were stained with 4′,6-diamidino2-phenylindole (panels 1 and 2) and β-tubulin (panel 3) and merged images are shown in panel 4. Multipolar spindles (a), chromosome misalignment (b) and
lagging chromosomes in anaphase/telophase (c) and metaphase (d) were observed when CaSki cells were treated with Kpnβ1 siRNA for 96 h (E) The frequency
of mitotic abnormalities was counted, in triplicate, in >70 cells, in cervical cancer cell lines HeLa and CaSki and non-cancer cell lines FG0 and WI38, treated
with control or Kpnβ1 siRNA for 72 h (*P < 0.05).
1125
L.Angus, P.J.van der Watt and V.D.Leaner
Table I. Percentage of cells in each stage of the cell cycle after release from
a G2/M block
Time after G2/M block (h)
Control siRNA
0
2
4
6
8
10
12
24
Kpnβ1 siRNA
0
2
4
6
8
10
12
24
Percentage of cells (%)
G1
S
G2/M
4.26
4.39
48.41
54.74
62.42
68.95
65.93
25.66
27.73
15.89
14.07
13.88
11.67
10.9
10.41
45.9
68.01
79.72
37.52
31.38
25.91
20.14
23.67
28.44
17.09
15.74
27.43
31.72
32.96
38.32
36.98
33.24
35.55
35.43
29.71
24.76
27.23
22.34
21.36
28.15
47.36
48.83
47.16
43.52
39.81
39.34
41.66
38.61
well as the mitochondria fractions in Kpnβ1 inhibited cells was not
restricted to the CaSki cell line, as similar changes were observed in
HeLa cells (Supplementary Figure 3A, available at Carcinogenesis
Online).
Noxa is a pro-apoptotic BH3-only member of the Bcl-2 protein
family that has been shown to be involved in the intrinsic mitochondrial apoptotic pathway. Noxa mRNA expression was measured by
real-time quantitative RT–PCR and was found to be significantly
elevated in HeLa and CaSki cells when Kpnβ1 expression was inhibited (Figure 3C). Puma, another pro-apoptotic member of the Bcl-2
protein family closely related to its family member, Noxa, has also
been reported to be involved in the intrinsic mitochondrial pathway.
In contrast to Noxa expression, Puma mRNA expression was found
at low levels and remained unchanged when cells were treated with
Kpnβ1 or control siRNA (Figure 3D).
As Noxa is commonly activated by p53 (24) and because we
observed an increase in p53 expression after Kpnβ1 knockdown
(Figure 2C), we next investigated the p53 response further. To determine whether Kpnβ1 inhibition had an impact on p53 stability, cervical cancer cells were transfected with control or Kpnβ1 siRNA
and treated with cycloheximide to inhibit de novo protein synthesis.
Protein lysates were harvested at various time intervals after cycloheximide treatment and western blot analysis performed to analyze p53
stability (Figure 3E). Control siRNA-transfected cells exhibited a
p53 half-life of ~10.71 min, whereas the half-life of p53 in Kpnβ1
siRNA-transfected cells was increased ~5-fold to 51.02 min. The halflife of 10 min measured in the control cells correlates well with that
described in published literature for p53 in cells containing the HPV
E6 protein (25,26). These results indicate that p53 is protected from
degradation when Kpnβ1 is inhibited, explaining the increase in p53
protein levels following Kpnβ1 knockdown.
To determine whether p53 was protected from degradation due to
it being excluded from the nucleus after Kpnβ1 inhibition, nuclear
and cytoplasmic protein fractions were harvested from control and
Kpnβ1 siRNA-transfected cells, and western blot analysis performed.
Interestingly, p53 protein accumulated in both the nucleus and
cytoplasm of Kpnβ1 knockdown HeLa and CaSki cells (Figure 3F,
Supplementary Figure 3B, available at Carcinogenesis Online),
suggesting that the increase in p53 levels was not due to p53 being
prevented from entering the nucleus. The minor band above p53 in
the lanes with nuclear protein is likely phosphorylated p53, which is
reported to localize in the nucleus of HPV E6-expressing cells (27).
As HPV-positive cervical cancer cells express HPV E6 and E7
oncoproteins, which function in the degradation of p53 and Rb
1126
proteins, respectively, it was possible that the increase in p53 protein levels might be due to the inhibition of HPV E6 expression after
Kpnβ1 knockdown. HPV E6 expression was analyzed in cells after
siRNA transfection yet no decrease in E6 expression was observed
(Figure 3G). Similarly, E7 levels were unchanged after Kpnβ1 inhibition (Figure 3H), as were levels of its target protein, Rb (both unphosphorylated and phosphorylated forms, Figure 3I). These results
suggest that the increase in p53 observed after Kpnβ1 knockdown
does not occur due to a decrease in E6 expression.
Kpnβ1 inhibition results in p53-independent cell death
To determine whether the increase in p53 levels was a contributor
to the induction of cell death observed when Kpnβ1 was knockeddown, p53 siRNA was co-transfected with Kpnβ1 siRNA. Kpnβ1 and
p53 knockdown was confirmed by western blot analysis (Figure 4A).
p21 expression was reliant on p53, as knockdown of p53 resulted in
a decrease in p21 protein levels (Figure 4A). MTT analysis showed
that the inhibition of p53 in Kpnβ1 knockdown cervical cancer
cells did not rescue the cells from Kpnβ1 siRNA-induced cell death
(Figure 4B).
To corroborate this finding, cytochrome C release was measured
in cells in which Kpnβ1 and p53 were both silenced. As observed
in earlier experiments, Kpnβ1 knockdown resulted in cytochrome C
release into the cytoplasm. In double knockdown cells, treated with
Kpnβ1 and p53 siRNA, the results remained unchanged compared
with Kpnβ1 only inhibited cells (Figure 4C). Similarly, caspase-3/7
assays confirmed no change in caspase-3/7 activity after simultaneous
knockdown of Kpnβ1 and p53, compared with Kpnβ1 knockdown
alone (Figure 4D). The elevated levels of Noxa mRNA expression
when Kpnβ1 expression was inhibited, as shown in Figure 3C, also
occurred in a p53-independent manner, as Noxa mRNA expression
was unaltered when cells were treated with Kpnβ1 siRNA alone
or together with p53 siRNA (Figure 4E). Finally, because p53 is
known to regulate the G2/M checkpoint, it was investigated whether
the G2/M block still occurred after concomitant Kpnβ1 and p53
knockdown. A significant increase in the percentage of cells in the
G2/M phase of the cell cycle was observed after Kpnβ1/p53 double knockdown (Figure 2F), similar to that observed after Kpnβ1
knockdown alone (Figure 2A), confirming that the G2/M arrest was a
p53-independent event.
To investigate whether p63 and p73 could compensate for the
loss of p53 after p53 knockdown, mRNA expression levels of the
pro-apoptotic isoforms of p63 and p73 were measured in the double
knockdown cells, treated with Kpnβ1 and p53 siRNA, compared with
cells treated with Kpnβ1 siRNA only. p63 and p73 levels remained
unchanged when cells were either treated with Kpnβ1 siRNA alone
or together with p53 siRNA, suggesting that p73 and p63 levels do not
increase to compensate for the loss of p53 (Supplementary Figure 4,
available at Carcinogenesis Online).
The p53-independent cell death induced by Kpnβ1 inhibition
was not restricted to HeLa cells as the same experiments were
performed using CaSki cells and similar results obtained, further
confirming that Kpnβ1 inhibition results in a p53-independent
cell death (Supplementary Figure 5, available at Carcinogenesis
Online).
Taken together, these results suggest that apoptosis induced in
Kpnβ1 knockdown cells is due to a p53-independent mechanism,
involving a prolonged G2/M arrest, the degradation of Mcl-1, induction of pro-apoptotic Noxa and translocation of Bax that together
mediate the intrinsic mitochondrial-dependent apoptotic pathway,
leading to cytochrome C release, caspase-3/7 activation and cell death
(Figure 5).
Discussion
Ectopic overexpression of Kpnβ1 has previously been shown to yield
mitotic spindles with abnormal fragmented poles in HeLa cervical
cancer cells, as well as MRC5 human fibroblast cells and NIH-3T3
murine fibroblasts (8). Interestingly, mitotic entry and spindle
Kpnβ1 inhibition results in mitotic arrest and apoptosis
Fig. 3. Kpnβ1 knockdown results in mitochondrial membrane permeabilization, elevated Noxa expression and the stabilization of p53. (A) CaSki cells were
treated with 20 nM control or Kpnβ1 siRNA for 96 h and western blot analysis confirmed that Kpnβ1 protein expression was downregulated. (B) Biochemical
subfractionation was performed after control or Kpnβ1 siRNA transfection and cytochrome C, Bax and Mcl-1 protein levels analyzed in the mitochondria
(mito) and cytoplasmic (cyto) fractions. The different size Mcl-1 proteins in the cytoplasmic and mitochondrial fractions are likely the untruncated (42 kDa)
and N-terminal truncated (40 kDa) forms of the protein, respectively (22). Anti-β-tubulin and anti-pereroxiredoxin-3 antibodies were used as loading controls
for cytoplasmic and mitochondrial fractions, respectively. (C and D) Real-time RT–PCR was performed using control or Kpnβ1 siRNA-transfected cells and a
significant increase in Noxa mRNA expression in Kpnβ1 knockdown cells was observed (*P < 0.05, N = 3). No change in Puma mRNA expression levels was
observed. Results shown are the mean ± SEM of experiments performed in triplicate and repeated at least two independent times. (E) HeLa cells were transfected
with 20 nM control or Kpnβ1 siRNA and treated with 50 µg/ml cycloheximide 72 h after siRNA transfection. Western blot analysis showed an increased
stabilization of p53 protein in cells transfected with Kpnβ1 siRNA compared with control siRNA-transfected cells. p38 was used as a protein loading control. (F)
Biochemical fractionation, 72 h post-transfection, showed that p53 accumulated in both the cytoplasmic and nuclear fraction when HeLa cells were treated with
Kpnβ1 siRNA compared with control siRNA. (G and H) Real-time RT–PCR analysis was performed using RNA harvested 72 h post-transfection, and no change
in HPV16 E6 or HPV16 E7 mRNA expression was observed after Kpnβ1 knockdown (N = 3). (I) Western blot analysis was performed using protein harvested
96 h post-transfection, and no change in Rb or phospho-Rb levels was observed.
1127
L.Angus, P.J.van der Watt and V.D.Leaner
Fig. 4. Cell death as a result of Kpnβ1 knockdown occurs in a p53-independent manner. HeLa cells were transfected with control or Kpnβ1 siRNA, with or
without p53 siRNA treatment. (A) Western blot analysis confirmed knockdown of Kpnβ1 and p53 after 72 h of post-transfection. p21 protein expression was
decreased in cells treated with p53 siRNA. (B) Relative cell viability, measured using an MTT assay, showed that the loss of cell viability as a result of Kpnβ1
siRNA knockdown was not reversed by p53 siRNA treatment (*P < 0.01, N = 3). (C) Subcellular fractionation of the mitochondrial (mito) and cytoplasmic (cyto)
fractions showed that cytochrome C release by Kpnβ1 siRNA knockdown occurred in a p53-independent manner. (D) Increased caspase-3/7 activity as a result of
Kpnβ1 inhibition was p53-independent (*P < 0.05, N = 3). (E) Elevated Noxa mRNA expression, as measured by qualitative real-time PCR, as a result of Kpnβ1
siRNA was not reversed by p53 siRNA treatment (*P < 0.05, N = 3). (F) Cell cycle analysis shows a significant increase in the percentage of cells in the G2/M
phase of the cell cycle after concomitant Kpnβ1 and p53 knockdown, together with a significant increase in the percentage of sub-G1 cells (*P < 0.05, N = 3).
1128
Kpnβ1 inhibition results in mitotic arrest and apoptosis
Fig. 5. Proposed model for the apoptotic pathway associated with inhibition of Kpnβ1. In this report, we propose that inhibition of nuclear import via Kpnβ1 in
cancer cells results in a prolonged M phase arrest, sustained degradation of Mcl-1 and elevated Noxa expression. The imbalance between anti- and pro-apoptotic
proteins results in Bax cytoplasmic-mitochondrial translocation, which results in permeabilization of the outer mitochondrial membrane, leading to cytochrome
C release and activation of associated caspases and cell death via apoptosis. Although p53 becomes stabilized in Kpnβ1 knockdown cells, apoptosis occurs in a
p53-independent manner.
assembly were inhibited when high doses of Kpnβ1 were transfected
(8,28). Here, we report that the transient inhibition of endogenous
Kpnβ1 results in a prolonged mitotic arrest and distinct mitotic defects
in cervical cancer cells. A tightly regulated expression of Kpnβ1 is,
therefore, required for successful mitotic cell division, as upregulation
or downregulation of Kpnβ1 protein levels result in defects in mitosis
and cell cycle progression. As the nuclear envelope and nuclear pore
complexes break down at the start of mitosis (29), it is unlikely that
the mitotic defects/prolonged mitotic arrest occur due to alterations in
the nuclear import pathway but rather due to the integral roles played
by Kpnβ1 in the mitotic process.
In our study, downregulation of Kpnβ1 expression levels
resulted in a significant increase in cells presented with both pole
defects and misaligned or lagging chromosomes (Figure 2D,
Supplementary Figure 2, available at Carcinogenesis Online), suggestive of defective kinetochore-microtubule attachment. Recent
work has shown that Kpnβ and Kpnα proteins can regulate spindle
assembly by binding to key spindle assembly factors (SAFs) such
as TPX2, NuMA and the kinesin XCTK2, inhibiting them except
in areas where RanGTP is present (8,28,30–32). RanGTP is present in mitotic chromosomes, as RanGEF RCC1 remains chromosome bound at mitosis. Kpnβ and Kpnα act as negative regulators
of spindle formation by sequestering SAFs, whereas RanGTP acts
as a positive regulator by counteracting Kpnβ and Kpnα binding to
SAF. The inhibition of Kpnβ1 is, therefore, likely to affect spindle
formation as the inhibition on SAFs is released and SAFs are activated. Overexpression of SAF, such as TPX2, results in a significant
increase in mitotic abnormalities, which include multipolar spindle
formation in HeLa cells (8). The inhibition of endogenous Kpnβ1
may, therefore, result in the mitotic defects due to deregulated and
activated SAFs. These observed mitotic defects may explain the
prolonged mitotic arrest observed after a G2/M block. In addition,
Kpnβ1 has been shown to be required for nuclear pore complex and
nuclear envelope reassembly in postmitotic cells, hence its inhibition like also impacts this process, contributing to the prolonged
mitotic arrest observed (33). Schmitz et al. (34) show that Kpnβ1
inhibition leads to a delay of both early and late mitotic events,
likely due to its roles in spindle assembly and nuclear envelope
reassembly, respectively.
Although Kpnβ1 inhibition resulted in a prolonged mitotic arrest,
it is interesting to note that the mitotic block itself appeared less
efficient in Kpnβ1 knockdown cells compared with control cells
(Figure 2B). As the nocodazole treatment was preceded by treatment
with thymidine to arrest the cells in G1/S, it is possible that some
of the Kpnβ1 knockdown cells were unable to progress out of the
thymidine-induced G1/S block, due to the inhibition of nuclear import
resulting in aberrations in cellular processes required for S phase progression. This might explain why fewer cells were able to become
arrested in G2/M. This, however, requires further investigation.
Associated with the observed mitotic arrest was the induction of
apoptosis after Kpnβ1 knockdown. Apoptosis is regulated by the
tight balance between antiapoptotic Bcl family proteins and their
pro-apoptotic counterparts. Mcl-1 protects mitochondrial integrity,
whereas pro-apoptotic members of the family, such as Bax, promote
the release of cytochrome C. Studies have shown that Bax, which
ordinarily resides in the cytoplasm, translocates to the mitochondrial
membrane, where it undergoes a conformational change, oligomerizes and is inserted into the membrane to facilitate the release of
cytochrome C (35–38). Nijhawan et al. (23) have shown that the
elimination of Mcl-1, which is rapidly degraded by the proteosome
upon cell death signals, is required for Bax translocation from the
cytosol to the mitochondria to induce cytochrome C release and
caspase activation. Only prolonged mitotic arrest allows for sufficient Mcl-1 phosphorylation and degradation to trigger apoptosis
(21,39,40). As we observed Mcl-1 degradation after Kpnβ1 inhibition, we propose that the cells arrested in mitosis after Kpnβ1 knockdown undergo apoptosis, via Bax translocation from the cytoplasm
to the mitochondria, ultimately resulting in cytochrome C release and
caspase activation (Figure 5).
It is interesting that although Kpnβ1 inhibition in the cervical cancer cell lines results in a prolonged mitotic arrest and the
induction of apoptosis, its inhibition in normal cells does not
1129
L.Angus, P.J.van der Watt and V.D.Leaner
(Figure 1, Supplementary Figure 1, available at Carcinogenesis
Online). During tumourigenesis, cancer cells are known to become
‘addicted’ to certain proteins that enable them to enhance cellular
processes and sustain their increased proliferative and metabolic
abilities. It could be along similar lines that cancer cells upregulate
Kpnβ1 expression and become functionally dependent on high levels of this protein. Hence, its inhibition in cancer cells is detrimental
to the cell, in this case resulting in cell death via a mitotic arrest and
the induction of intrinsic mitochondrial apoptosis. It has also been
proposed that cancer cells are inherently more sensitive to apoptosis,
due to their oncogenic lesions (41). The lack of phenotype observed
after Kpnβ1 inhibition in normal cells could be due to a reliance on
other karyopherin β family members in normal cells. Alternatively,
it could result from the fact that the siRNA does not deplete all of the
Kpnβ1 present in the cell (due to the nature of a transient transfection) and thus the low levels of Kpnβ1 still present are sufficient to
support mitosis and nuclear import. This would imply that normal
cells and cancer cells vary greatly with regards to the amount of
Kpnβ1 they require, making Kpnβ1 an attractive target for cancer
therapy.
Finally, although Kpnβ1 inhibition resulted in the stabilization and
accumulation of p53, p53 did not contribute to the apoptosis observed
when Kpnβ1 was inhibited (Figures 3 and 4). This is of particular
interest as we observed an increase in Noxa mRNA expression in
Kpnβ1 knockdown cells; a characteristically p53-dependent response
(24). However, recent evidence, as well as data obtained in this study,
has shown that Noxa expression can be induced in a p53-independent
manner (42,43). Interestingly, cell death induced by Kpnβ1 inhibition
does not involve enhanced Puma mRNA levels, a close relative of
Noxa, suggesting that Noxa and Puma levels may be activated under
different stresses. In addition to cell death induced by Kpnβ1 inhibition being p53-independent, it was also not dependent on p21, as p21
protein levels declined after p53 siRNA treatment and the same extent
of apoptotic cell death was observed (Figure 4).
Our finding that Kpnβ1 inhibition results in the accumulation of
p53 protein in the nucleus and cytoplasm (Figure 3F) is in contrast
with data published by Marchenko et al. (44). Marchenko et al. (44)
showed that after the inhibition of Kpnβ1 using siRNA in H1299
cells, p53 levels decreased in the nucleus but increased in the cytoplasm, suggesting that p53 becomes retained in the cytoplasm due to
its inability to enter the nucleus following the inhibition of its nuclear
importer (44). These authors, however, used ectopically expressed p53
in a p53 null cell line, whereas we examined endogenous p53 protein
in p53 wild-type expressing cell lines (HeLa and CaSki). It may be
that in our scenario, p53 is unable to enter the nucleus; however, the
p53 that is already in the nucleus becomes stabilized, whereas in control siRNA treated cells, p53 is constantly being degraded. In HPVpositive cells, p53 degradation occurs via E6-mediated ubiquitination
in the nucleus by the ubiquitin E3 ligase, E6-AP (45), after which E6
and p53 are co-exported to the cytoplasm, where p53 is degraded by
the 26 S proteasome (46). Although we show that HPV E6 mRNA levels were unchanged after Kpnβ1 knockdown (Figure 3G and H), thus
not accounting for the increased stabilization of p53, it is possible that
E6 is prevented from entering the nucleus upon Kpnβ1 knockdown,
thereby preventing p53 from being degraded. E6 has been shown to
utilize Kpnβ1 for its nuclear import (47), although it can also interact with the import receptor Kpnβ2 (47). Hence, inhibition of Kpnβ1
might, in part, prevent E6 nuclear import, leading to p53 stabilization in the nucleus and cytoplasm. Although our study was performed
using HPV-positive cervical cancer cells, it is important to note that
the cell killing effect after Kpnβ1 inhibition is not specific to HPVpositive cervical cancer, as Kpnβ1 inhibition in HPV-negative cervical cancer cells also results in cell death, as published by us previously
(14).
In conclusion, the inhibition of endogenous Kpnβ1 in cervical
cancer cells results in a significant increase in mitotic abnormalities
and a prolonged mitotic arrest. We propose that the prolonged mitotic
arrest results in degradation of Mcl-1, which results in an imbalance between pro-apoptotic and antiapoptotic Bcl-2 members. Bax
1130
is translocated to the mitochondria where it induces cytochrome C
release to activate the associate caspases and result in apoptotic cell
death. Even though p53 levels are stabilized in Kpnβ1 knockdown
cells, the associated cell death is p53 independent. We propose that
Kpnβ1 may be a potential anticancer therapeutic target for both p53
wild-type and mutant tumors.
Supplementary material
Supplementary Figures 1–5 can be found at http://carcin.oxfordjournals.org/
Funding
University of Cape Town; the Carnegie Corporation of New York;
the Cancer Association of South Africa (CANSA); Medical Research
Council of South Africa. UCT Faculty of Health Sciences (Cancer
Trust) to L.A.; Claude Leon Foundation Post Doctoral Fellowship
(to P.vd.W). Funders had no involvement in the study design, in
the collection, analysis and interpretation of data, in the writing of
the manuscript, and in the decision to submit the manuscript for
publication.
Conflict of Interest Statement: None declared.
References
1.Nakielny,S. et al. (1999) Transport of proteins and RNAs in and out of the
nucleus. Cell, 99, 677–690.
2.Harel,A. et al. (2004) Importin beta: conducting a much larger cellular
symphony. Mol. Cell, 16, 319–330.
3.Mitrousis,G. et al. (2008) Molecular basis for the recognition of snurportin
1 by importin beta. J. Biol. Chem., 283, 7877–7884.
4.Jäkel,S. et al. (1999) The importin beta/importin 7 heterodimer is a functional nuclear import receptor for histone H1. EMBO J., 18, 2411–2423.
5.Jullien,D. et al. (1999) Nuclear import of RPA in Xenopus egg extracts
requires a novel protein XRIPalpha but not importin alpha. EMBO J., 18,
4348–4358.
6.Chook,Y.M. et al. (2001) Karyopherins and nuclear import. Curr. Opin.
Struct. Biol., 11, 703–715.
7.Mosammaparast,N. et al. (2004) Karyopherins: from nuclear-transport mediators to nuclear-function regulators. Trends Cell Biol., 14,
547–556.
8.Ciciarello,M. et al. (2004) Importin beta is transported to spindle poles
during mitosis and regulates Ran-dependent spindle assembly factors in
mammalian cells. J. Cell Sci., 117, 6511–6522.
9.Roscioli,E. et al. (2012) Importin-β negatively regulates multiple aspects
of mitosis including RANGAP1 recruitment to kinetochores. J. Cell Biol.,
196, 435–450.
10. Kau,T.R. et al. (2003) Nuclear transport as a target for cell growth. Drug
Discov. Today, 8, 78–85.
11. Kau,T.R. et al. (2004) Nuclear transport and cancer: from mechanism to
intervention. Nat. Rev. Cancer, 4, 106–117.
12. Yashiroda,Y. et al. (2003) Nucleo-cytoplasmic transport of proteins as a
target for therapeutic drugs. Curr. Med. Chem., 10, 741–748.
13. van der Watt,P.J. et al. (2013) The nuclear import receptor Kpnβ1 and its
potential as an anticancer therapeutic target. Crit. Rev. Eukaryot. Gene
Expr., 23, 1–10.
14. van der Watt,P.J. et al. (2009) The Karyopherin proteins, Crm1 and
Karyopherin beta1, are overexpressed in cervical cancer and are critical for
cancer cell survival and proliferation. Int. J. Cancer, 124, 1829–1840.
15. van der Watt,P.J. et al. (2011) Overexpression of Kpnβ1 and Kpnα2 importin proteins in cancer derives from deregulated E2F activity. PLoS One, 6,
e27723.
16. Scheffner,M. et al. (1990) The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell, 63,
1129–1136.
17. Chellappan,S. et al. (1992) Adenovirus E1A, simian virus 40 tumor antigen, and human papillomavirus E7 protein share the capacity to disrupt the
interaction between transcription factor E2F and the retinoblastoma gene
product. Proc. Natl Acad. Sci. USA, 89, 4549–4553.
18. Smith,E.R. et al. (2010) Nuclear entry of activated MAPK is restricted in
primary ovarian and mammary epithelial cells. PLoS One, 5, e9295.
Kpnβ1 inhibition results in mitotic arrest and apoptosis
19. Kuusisto,H.V. et al. (2012) Global enhancement of nuclear localizationdependent nuclear transport in transformed cells. FASEB J., 26, 1181–1193.
20.van der Westhuizen, D.R. et al. (1984) Low density lipoprotein receptor
mutations in South African homozygous familial hypercholesterolemic
patients. Arterioscler. Thromb., 4, 238–247.
21. Harley,M.E. et al. (2010) Phosphorylation of Mcl-1 by CDK1-cyclin B1
initiates its Cdc20-dependent destruction during mitotic arrest. EMBO J.,
29, 2407–2420.
22. Warr,M.R. et al. (2011) Mitochondrion-dependent N-terminal processing of outer membrane Mcl-1 protein removes an essential Mule/Lasu1
protein-binding site. J. Biol. Chem., 286, 25098–25107.
23.Nijhawan,D. et al. (2003) Elimination of Mcl-1 is required for the initiation of apoptosis following ultraviolet irradiation. Genes Dev., 17,
1475–1486.
24. Oda,E. et al. (2000) Noxa, a BH3-only member of the Bcl-2 family and
candidate mediator of p53-induced apoptosis. Science, 288, 1053–1058.
25.Hubbert,N.L. et al. (1992) Human papillomavirus type 16 E6 increases
the degradation rate of p53 in human keratinocytes. J. Virol., 66,
6237–6241.
26. Talis,A.L. et al. (1998) The role of E6AP in the regulation of p53 protein
levels in human papillomavirus (HPV)-positive and HPV-negative cells. J.
Biol. Chem., 273, 6439–6445.
27. Zhang,G. et al. (2009) HPV-16E6 can induce multiple site phosphorylation
of p53. Oncol. Rep., 21, 371–377.
28. Nachury,M.V. et al. (2001) Importin beta is a mitotic target of the small
GTPase Ran in spindle assembly. Cell, 104, 95–106.
29. Güttinger,S. et al. (2009) Orchestrating nuclear envelope disassembly and
reassembly during mitosis. Nat. Rev. Mol. Cell Biol., 10, 178–191.
30. Gruss,O.J. et al. (2001) Ran induces spindle assembly by reversing the
inhibitory effect of importin alpha on TPX2 activity. Cell, 104, 83–93.
31. Wiese,C. et al. (2001) Role of importin-beta in coupling Ran to downstream targets in microtubule assembly. Science, 291, 653–656.
32. Ems-McClung,S.C. et al. (2004) Importin alpha/beta and Ran-GTP regulate XCTK2 microtubule binding through a bipartite nuclear localization
signal. Mol. Biol. Cell, 15, 46–57.
33. Ryan,K.J. et al. (2007) The karyopherin Kap95 regulates nuclear pore
complex assembly into intact nuclear envelopes in vivo. Mol. Biol. Cell,
18, 886–898.
34. Schmitz,M.H. et al. (2010) Live-cell imaging RNAi screen identifies
PP2A-B55alpha and importin-beta1 as key mitotic exit regulators in human
cells. Nat. Cell Biol., 12, 886–893.
35. Nomura,M. et al. (1999) Apoptotic cytosol facilitates Bax translocation
to mitochondria that involves cytosolic factor regulated by Bcl-2. Cancer
Res., 59, 5542–5548.
36. Eskes,R. et al. (2000) Bid induces the oligomerization and insertion of Bax
into the outer mitochondrial membrane. Mol. Cell. Biol., 20, 929–935.
37. Suzuki,M. et al. (2000) Structure of Bax: coregulation of dimer formation
and intracellular localization. Cell, 103, 645–654.
38.Antonsson,B. (2001) Bax and other pro-apoptotic Bcl-2 family “killerproteins” and their victim the mitochondrion. Cell Tissue Res., 306,
347–361.
39. Inuzuka,H. et al. (2011) Mcl-1 ubiquitination and destruction. Oncotarget,
2, 239–244.
40. Wertz,I.E. et al. (2011) Sensitivity to antitubulin chemotherapeutics is
regulated by MCL1 and FBW7. Nature, 471, 110–114.
41. Evan,G.I. et al. (2001) Proliferation, cell cycle and apoptosis in cancer.
Nature, 411, 342–348.
42.Qin,J.Z. et al. (2004) p53-independent NOXA induction overcomes
apoptotic resistance of malignant melanomas. Mol. Cancer Ther., 3,
895–902.
43. Armstrong,J.L. et al. (2007) Role of Noxa in p53-independent fenretinideinduced apoptosis of neuroectodermal tumours. Apoptosis, 12, 613–622.
44. Marchenko,N.D. et al. (2010) Stress-mediated nuclear stabilization of p53
is regulated by ubiquitination and importin-alpha3 binding. Cell Death
Differ., 17, 255–267.
45. Scheffner,M. et al. (1993) The HPV-16 E6 and E6-AP complex functions
as a ubiquitin-protein ligase in the ubiquitination of p53. Cell, 75, 495–505.
46. Stewart,D. et al. (2005) Involvement of nuclear export in human papillomavirus type 18 E6-mediated ubiquitination and degradation of p53. J. Virol.,
79, 8773–8783.
47. Le Roux,L.G. et al. (2003) Nuclear entry of high-risk human papillomavirus type 16 E6 oncoprotein occurs via several pathways. J. Virol., 77,
2330–2337.
Received August 5, 2013; revised December 9, 2013;
accepted December 19, 2013
1131