Mitochondrial myopathy with
tRNALeu(uuR)mutation and complex
deficiency responsive to riboflavin
Robert F. Ogle, FRACOG, John Christodoulou, FRACP, PhD,
Elizabeth Fagan, FRACP, Rozanne B. Blok, PhD,
Denise M. Kirby, BSc(Hons), Kaye L. Seller, BAppsci,
Hans-Henrik M. Dahl, PhD, a n d David R. Thorburn, PhD
From the Departments of Medical Genetics, Paediatrics, and Neurology, Royal Alexandra
Hospital for Children, Westmead, New South Wales, Australia,and the Murdoch Institutefor
Research into Birth Defects, Royal Children's Hospital, Parkville, Victoria, Australia
Deficiency of complex I (reduced nicotinamide adenine dinucleotide dehydrogenase-ubiquinone oxidoreductase) of the mitochondrial respiratory chain may
be seen as a pure myopathy or as a neuromuscular disorder at presentation. Efficacy of Iong- term therapy for these disorders is yet to be established. We report
the case of a female patient with complex I deficiency and skeletal myopathy,
who has had a sustained clinical response to riboflavin during 3 years of therapy.
Molecular studies found no mutations in the putative flavin mononucleotide binding site in the 51 kd subunit of complex I, but a T-to-C transition at nucleotide 3250
in the mitochondrial DNA tRNA Leu(uuR)gene was identified. This mutation has been
reported in one other family in that five members had fatigue with or without muscle weakness. There were also five cases of unexplained infant deaths in that
family and two cases in the family reported here. Riboflavin therapy should be attempted in all patients with complex I deficiency when the clinical presentation
is one of isolated skeletal myopathy. (J Pediatr 1997; 130:138-45)
Disorders of the mitochondrial respiratory chain m'e heterogeneous in terms of clinical phenotype and biochemical
abnormalities. Complex I (reduced nicotinamide adenine
dinucleotide dehydrogenase-ubiquinone oxidoreductase) is
one of the five enzyme complexes in the respiratory chain
involved in the generation of adenosine triphosphate by oxidative phosphorylation. Studies of bovine complex I suggest that it is composed of at least 41 individual subunits, 34
of which are nuclear encoded and 7 encoded by mitochondrial DNA. 1
Complex I deficiency can occur in a number of ways, reflecting the genetic heterogeneity of this disorder. As an isolated defect, the presentation includes fatal infantile lactic
Submitted for publication Feb. 7, 1996; accepted Aug. 6, 1996.
Reprint requests: John Christodoulou, FRACP, PhD, University
Department of Paediatrics and Child Health, New Children's Hospital, PO Box 3515, Parramatta, NSW 2132, Australia.
Copyright © 1997 by Mosby-Year Book, Inc.
0022-3476/97155.00 + 0 9/21/77131
138
acidosis,2 a pure skeletal myopathy with varying age at onset, 3 a skeletal myopathy associated with cardiomyopathy,4
and Leigh disease. 5 Complex I deficiency has also been deCoQ1
FMN
MELAS
mtDNA
NADH
PCR
SIDS
tRNA
Coenzyme QI
Flavin mononucleotide
Mitochondrialencephalomyopathy,lactic
acidosis, and stroke-like episodes
Mitochondrialdeoxyribonucleicacid
Reduced nicotinamide adenine dinucleotide
dehydrogenase
Polymerase chain reaction
Sudden infant death syndrome
Transfer ribonucleic acid
scribed in combination with other respiratory chain defects,
such as complex IV deficiency6 or in association with
mtDNA defects, such as mitochondrial encephalomyopathy,
lactic acidosis, stroke-like episodes,7 and Leber hereditary
optic neuropathy. 8
The Journal of Pediatrics
Volume !30, Number 1
Ogle et aL
13 9
BI:
B
II
/
BI: 2%
~
3
31: 43%
4
~
III
BI: 25%
%
Skeletal Myopathy
B
SuddenInfant Death Syndrome
N
SensorineuralDeafness
Mu:
Li:
He:
Br:
3
34%
54%
43%
58%
Fig, 1. Family pedigree and heteroplasmic load of the nt3250 T-to-C mutation in tissues of family members. Tissues
smdied were as follows: blood (Bl), skeletal muscle (Mu), fibroblasts (Fb), liver (Li), heart muscle (He), and brain (Br).
Treatment of the mitochondrial myopathies in general has
been disappointing. Correction of acidosis with compounds
such as dichloroacetate does not necessarily result in clinical improvement. It has been suggested that the use of precursors of coenzymes in the form of vitamins may result in
a clinical response by stimulation of enzyme activity. 9
Riboflavin has been reported to be effective in 11 patients
with complex I deficiency. 1°-17 In three of those patients a
defect in complex I activity was associated with normal carnitine levels in serum but decreased carnitine content of
muscle, and four patients had low serum camitine levels. In
those circumstances, camitine was added to the treatment
regimen. There has been considerable criticism of these anecdotal reports because the namral history of these disorders
is basically unknown, so improvement may not necessarily
be attributed to therapeutic maneuvers.
We describe an additional patient with the myopathic form
of complex I deficiency who was subsequently found to have
a tRNA Leu(UUR)mutation and has had sustained clinical improvement initially with riboflavin and carnitine, and then
with riboflavin alone for a 3-year period. Despite the
unequivocal clinical response at the outset, resolution of
lactic acidemia did not occur.
CASE REPORTS
The proband (III-2 in Fig. 1) is the second child of nonconsanguineous Australian parents. Birth weight was 3317 gm (25th to
50th percentile). Early developmental milestones were normal. The
girl smiled at 2 months of age, sat independently at 5 months, and
was walking unaided at 13 months. By 2 years of age, she was
speaking in two-word sentences. She has a sister (III-1), now 8 years
of age, who is physically and intellectually normal.
From 13 months of age the proband's parents had noted that when
she was walking, her head was held in the flexed position. At 2 years
of age she required assistance in standing from the seated position,
frequently complained of tiredness after walking short distances,
and often stumbled. Speech development was normal. There was
14 0
Ogle et al.
The Journal of Pediatrics
January 1997
Table. Respiratory chain enzyme activities in isolated muscle mitochondria
Enyme activity
Complex I
Complex II
Complex II + IlI
Complex IV
Cila'ate synthase
Citrate synthase ratio (x1000)
Sample
Normal*
Range (n)'l"
Sample
Normal*
Range
17
262
270
13.6
670
152
161
144
12.2
238
130-470 (7)
120-350(17)
95-530(17)
7-55 (17)
270-880(17)
25
391
403
20
--
639
676
605
51
--
270-890
250-600
310-1030
19-83
--
Units for enzyme activity are nanomoles per minute per milligram protein, except for compIex IV, which is expressed as an apparent first-order rate constant
(per minute per milligram protein).
*"Normal" values are the activities found in a normal control muscle sample assayed at the same time as the patient sarrlple.
?Range is the observed range for n normal control biopsy specimens.
severe weakness of neck extensors, but she was able to extend her
head against gravity. There was marked lumbar lordosis, mild
proximal weakness, a mild decrease in tone pefipherally, and normal deep tendon reflexes. Muscle bulk was normal. She had a
modifled Gower sign on standing. There was no ptosis, ophthalmoplegia, or hepatosplenomegaly.
An open muscle biopsy specimen was taken from the quadriceps
when the patient was 2~ä years of age. Results (see below) of light
microscopy and electron microscopy were suggestive of a mitochondrial myopathy. Results of electromy0graphy and nerve conduction studies were consistent with a myopathy. The blood lactate
concentration was 12.2 mmol/L (normal range, 0.7 to 2.0), pymvate
concentration 0.14 mmol/L (normal range, 0.03 to 0.1), plasma total camitine concentration 32 mmol/L (normal range, 35 to 65), and
free camitine concentration 22 mmol/L (normal range, 30 to 60),
whereas the creatine phosphokinase value was 264 U/L (normal,
<200). The urinary amino acid pattern showed a slight increase in
alanine and [3-aminoisobutyric acid values. The plasma amino acid
profile was normal. The urinary organic acid profile by gas chromatography-mass spectrometry showed a gross increase in lactate
concentration, a moderate increase in 3-hydroxybutyrate and 2-hydroxyisovalerate concentrations, and a slight increase in acetoacetate concentration, with no other abnormality. Oxidation of palmitic and myristic acids, by intact skin fibroblasts from the patient,
Was normal (NSW Biochemical Genetics Service). Respiratory
chain enzymes, assayed in muscle, showed an isolated defect of
complex I (see Table).
By 2 years 8 months of age the patient was weaker. She was reluctant to walk, had frequent falls, could no longer climb stairs, and had
markedly weak neck extensors. Results of cardiovascular examination
and echocardiography were normal. There was no pigmentary retinopathy. Repeated blood lactate determination at this time showed a concentration of 4.0 mmol/L. Magnetic resonance imaging of the brain
showed delayed myelination in the T2-weighted images, parficularly
in the occipital region. Therapy with carnitine ( 100 mg/kg per day) and
riboflavin (20 mg twice daily) was commenced. At examination 2
months later there was significant clinical improvement. The patient
was able to walk longer distances and to rise from the floor without
difficulty. On examination she had mild proximal weakness, heCk extensors were still weak, the lumbar lordosis had increased, and her tone
and reflexes were normal. The blood lactate concentration was 10.7
mmol/L. During the next 16 months there was sustained improvement,
with only mild limb and neck extensor weakness, mad normal intellecmal development.
When the patient was 4 years 4 months of age, carnitine therapy
was discontinued in an attempt to define the role of riboflavin in the
response to therapy. The blood lactate concentration before cessation of carnitine therapy was 2.46 mmol/L, with the pyruvate concentration being 0.11 mmol/L. The plasma total carnitine concentration at this time was 105 gmol/L, with the free carnitine concentration being 71 pmol/L. During the 5 months after the cessation of
camitine therapy, there was no significant deterioration, but an obvious worsening occurred during a 4-week period coinciding with
a failure to take riboflavin, manifesting as worsening of muscle tone,
particularly involving the heck extensors. In addition, exercise tolerance deteriorated during this period when fiboflavin was not used.
The neuromuscular deterioration was reversed by reinstatement of
the riboflavin at a dosage of 25 mg twice daily. At 5 years 8 months
of age the patient exhibited no deterioration in muscle power. The
blood lactate concentration was 11.3 mmol/L. The clinical and biochemical courses of patient III-2 are summarized in Fig. 2.
Subsequently a healthy female sibling (III-3) was bom. She was
developmentally and physically normal until 4 months of age, when
she died suddenly of presumed sudden infant death syndrome.
Analysis of enzymes of the respiratory chain in skeletal muscle and
iiver taken within 6 hours of death showed normal activities of all
the respiratory chain enzymes. Postmortem histochemical examination of muscte was not possible because of ice crystal artifacts.
The proband's family history was also of potential significance in
that a matemal uncle (Il-l) died of presumed SIDS at age 4 months
of age, and a second matemal uncle (II-2) has progressive sensorineural deafness with onset in childhood.
METHODS
Muscle histochemistry, electron microscopy, and enzymology. A n open muscle biopsy was performed initially
on the left quadriceps. Sections of muscle were stained with
hematoxylin-eosin, modified Gomori trichrome, oil red O,
läctate dehydrogenase succinate dehydrogenase, and cytochrome c oxidase. Electron microscopy was also performed.
A repeated open quadriceps biopsy was performed w h e n
the patient was 2fi years of age for respiratory chain e n z y m e
analysis and repeated enzyme histochemistry study. Respi-
The Journal of Pediatrics
VoIume 130, Number 1
Ogle et al.
14 1
Weakness
++÷
++
+
riboflavin
(mg/day)
Carnitine
(lOOmg/kg/day)
10
"~~
laetate (mM)
25
~o
;~
4o
;5
so
ss
~o
~5
age (months)
Figù 2. Pictorial representation of clinical and biochemical course in the proband. Muscle weakness grading: + = mild;
++ = moderate; +++ = severe.
ratory chain Complexes I (rotenone-sensitive NADH-coenzyme Q1 reductase), II (succinate-CoQ1 reductase), II + III
(succinate-cytochrome c reductase), IV (cytochrome c oxidase), and citrate synthase were assäyed in skeletal muscle
mitochondria, as described previouslyJ 8
DNA sequencing. The region corresponding to amino
acids 160 to 254 of the human complex I 51 kd subunit
gene 19 was amplified from patient fibroblast complementary
DNA. The polymerase chain reaction fragment was sequenced with a Sequenase version 2.0 kit (United States
Biochemical, Cleveland, Ohio).
Skeletal muscle DNA from the patient was studied for the
presence of mtDNA rearrangements by Southem blot as
described,2° and for mtDNA point mutations at nucleofides
3243 (A to G), 8344 (A to G), and 8993 (T to G and T to C). is
The mtDNA tRNA Leu(UUR) gene was amplified with
primers 3130F (5'-AGGACAAGAGAAATAAGGCC) and
3558R (5'-TAGAAGAGCGATGGTGAGAG). PCR conditions were 35 cycles consisting of 30 seconds at 95 ° C, 30
seconds at 55 ° C, and 40 seconds at 72 ° C. The fragment was
purified and sequenced as described above.
The nt3250 T-to-C mutation in other DNA samples was
detected after amplification with primers 3225F (5'-GGTTTGTTAAGATGGCAGAGGCCGG) and 3455R (5'GCGAAGGGTTGTAGTAGCCGGCAGGGGCCT). The
PCR consisted of 35 cycles, 1 minute at 95 ° C, 1 minute at
57 ° C, and 1 minute at 72 ° C. The expected PCR product is
231 base pairs. After digestion with NaeI the largest
fragment is 212 bp if the nt3250 T-to-C mutation is absent
and 187 bp if the mutation is present.
Quantitation of the nt3250 T-to-C mutation was done by
adding 10 ~tCi 32P-«-deoxycytidine triphosphate to a 50 pl
PCR reaction at the beginning of cycle 26. After this cycle
was finished, the product was digested with NaeI and a 3 ~tl
aliquot tun on a 5% nondenaturing polyacrylamide gel. The
212 bp and 187 bp bands were quantitated on a Molecular
Dynamics phosphor imager.
RESULTS
Muscle histochemistry and electron microscopy. A
muscle biopsy performed at when the patient was 2~ years
of age showed type I fibers to have an increase in lipid droplets. The mitochondrial stains were abnormal, with increased
numbers of subsarcolemmal mitochondria in the modified
Gomori trichrome, succinic dehydrogenase, and cytochrome
c oxidase stains. The staining pattern was not sufficiently
abnormal, however, to be called true ragged red fibers
(Fig. 3). Cytochrome c oxidase histochemistry showed
checkerboard staining with pale- staining fibers but no definite cytochrome c oxidase-negative fibers. Electron microscopy showed a marginal increase in subsarcolemmal
aggregation of mitochondria. There were isolated enlarged
mitochondria with complex patterns of cristae that were
concentric, branching, or anastomosing. Dense granules
were mildly increased in a few mitochondria, though a large
majority of mitochondria were within normal limits.
Muscle enzymology. Enzyme activities of complexes I,
Il, II + IlI, and IV were assayed and expressed relative to
protein and citrate synthase (Table). Respiratory chain
enzymes in isolated muscle mitochondria were severely de-
142
Ogle et al.
The Journal of Pediatrics
January 1997
Fig. 3. Histopathologicfeatures of muscle biopsy specimen obtained when patient was 2~ years of age. A, Succinate dehydrogenase stain shows an increased mitochondrial density within the fibers and subsm'colemmalaccumulation of mitochondria. Though this accumulationis extremely abnormal, the appearance is not the classic appearance of tme ragged red
fibers. B, Oil red O stain shows a marked increase in lipid droplets in the type I fibers. (Magnification: A = x1200;
B = x1100.)
ficient in complex I (6% of control mean) and normal for
other enzymes, though complex IV was at the lower end of
the normal range (47% of control mean). Relative to citrate
synthase, complex I activity was 5% of control mean.
DNA studies. Neither deletions, duplications, nor any of
four common mtDNA point mutations (see Methods secüon,
above) were found in skeletal muscle DNA from the patient.
It has been suggested that amino acids 200 to 230 of the bovine 51 kd subunit may represent the flavin-binding site. 21
This region corresponds to amino acids 180 to 210 of the
human 51 kd sequenceJ 9 We sequenced this region of the
51 kd subunit gene of the patient and a normal control sam-
ple. There were no sequence differences between these
samples and the normal human 51 kd sequence.
The family history prompted sequencing of the mtDNA
tRNA ~u(trua) gene, which revealed a T-to-C transition
at nt3250 that has been described in one other family with
mitochondrial myopathy.22 Fig. 1 shows that the proportion
of total mtDNA with the nt3250 T-to-C mutation (i.e., the
mutant load) was greater than 80% in tissues from the
proband and ranged from 2% to 43% in healthy family
members. An intermediate load (34% to 58%) was found
in four tissues from the sibling who died of presumed
SIDS.
The Journal of Pediatrics
Volume 130, Number I
DISCUSSION
There have been only a few reports of the pure myopathic
form of complex I deficiency that have been responsive to
treatment. However, there has been no systematic reporting
of unresponsive paüents. At initial diagnosis, our patient was
presumed to have an isolated complex I defect, becanse all
other enzymes were in the normal range and no definite cytochrome c oxidase-negative fibers were found. Clinically
she had an unequivocally positive response to riboflavin
during a 3-year period. Some authors have reported normalization of the blood lactate concentration during this treatment 13 or normalization both of complex I activity in skeletal muscle mitochondria and of lactate concentrations in
blood and cerebrospinal fluid. 15 The latter authors reported
orte patient who had a clear fall in blood lactate levels but
no change in complex I activity, and another patient who had
normal blood lactate levels before and after treatment but an
increase in complex I activity. These results are difficult to
interpret with respect to correlation between clinical effect
and activity of complex I after treatment. It is apparent,
however, from the cases treated with carnitine and riboflavin, that the encephalomyopathic form of complex I deficiency is uN[ikely to be responsiye to this form of therapy.
The role of riboflavin in complex I function has been investigated at the molecular level. Complex I is the largest of
the respiratory chain enzymes, with more than 40 subunits. 1
It removes el[ectrons from NADH and passes them, via a sefies of enzyme-bound redox centers (flavin mononucleotide
and iron-sulfer clusters), to the electron acceptor ubiquinone.
Analysis of the structure o f the bovine enzyme has shown
that there is a flavoprotein fraction of complex I, which contains NADH dehydrogenase activity and a variety of electron
acceptors. 23 This fraction consists of one molecule each of
the 51, 24, and 10 kd subunits, one molecule of FMN, and
six atoms of bound iron per complex I molecule. I There is
some evidence to suggest that the FMN binding site is within
the 51 kd subunit, though this is yet to be established. 24 Our
patient had no demonstrable alteration in DNA sequence in
the putative FMN binding site.
Camitine deficiency has been reported in a number of patients with mitochondrial myopathy and may be apparent
only in muscle, with the concentration being normal in
plasma. Deficiency is presumed to be secondary rather than
primary. In cultured skin fibroblasts from patients with cytochrome c oxidase deficiency, maximal rates of carnitine
uptake were decreased to 20% to 47% of normal control
maximal velocity, with normal Km values, leading the
authors to suggest that binding of carnitine to the transporter
was normal but that the uptake process was impaired. 25 The
proposed mechanism for this observation was that the
reduction in intracellular adenosine triphosphate caused by
cytochrome c oxidase deficiency may interfere with optimal
Ogle et aL
14 3
functioning of the carnitine transporter, thereby resulting in
a reduction in intracellular camitine levels. A similar mechanism could be invoked in complex I deficiency.
The sustained clinical response after the withdrawal of
camitine suggests that, at least in our patient, the clinical
improvement can be attributed solely to riboflavin. This
possibility is supported by the significant deterioration after
riboflavin treatment was discontinued in our patient for a
period of 1 month. The mechanism of riboflavin responsiveness without biochemical correction, as estimated by the
blood lactate concentration, is unclear. Stirnulation of alternative pathways, such as via complex II, may be sufficient
to sustain clinical improvement without correction of the
primary biochemical defect. Alternatively, there could be
another mutation in either the nuclear or the mitochondrial
genomes, resulting in a mutant protein whose function is
enhanced by therapeutic doses of riboflavin, although this is
less likely.
As a result of the direct sequencing of the mtDNA
tRNA Leu(Ut~) gene, a heteroplasmic T-to-C transition was
found at nt3250. This mutation has been reported once previously22 in a pedigree with five members that had fatigue
with or without muscle weakness. There were also five siblings who died in early childhood of unknown causes. The
finding of this mutation in a second family, in that the heteroplasmic mutant load correlates with clinical symptoms,
conflrms that the mutation causes disease.
The proband in the first family had myopathy and complex I deficiency at presentation, as did our patient, although
treatment was not described. The mechanism by which this
and other tRNA I"eu(utrR~mutations affect mainly complex I
activity is unclear. One proposal is that the coding sequence
of ND 1 (a subunit of complex I), which is adjacent to the
tRNALeu(UUR) coding region, is processed inaccurately,
which leads to a truncated protein and causes instability in
the complex I assembly and consequent deficiency. This
may also explain why many patients with MELAS have relative complex I deficiency. 26 A simpler explanation may lie
in the fact that of all the mitochondrial respiratory chain
complexes, complex I has the largest molecular weight, with
the highest number of subunits encoded by the mitochondrial
genome, 1 potentially making it the most vulnerable of the
complexes when there is a mutation affecting an mtDNAencoded tRNA.
The mtDNA-encoded subunits of complex I appear to be
located in the membrane domain rather than in the flavoprotein fraction. There is thus no obvious mechanism by which
a mutation expected to affect synthesis of mtDNA-encoded
subunits would result in clinical responsiveness to riboflavin.
It should also be pointed out that riboflavin responsiveness
associated with a tRNA defect has been reported previously
in a patient with MELAS because of the A3243G mutation
14 4
Ogle et aL
in the same tRNA Leu(UUR) gene. 27 This patient was also
treated with nicotinamide, and therapeutic efficacy was
based on clinical criteria, 31P-magnetic resonance spectroscopy, and nerve conduction studies. One possible explanation for apparent riboflavin responsiveness could be that high
riboflavin levels may make the entire compIex I assembly
more resistant to proteolysis, leading to a longer enzyme
half-life. This could ameliorate the effect of a decreased rate
of synthesis of complex I subunits. Enhanced resistance to
proteolysis by high concenlJ:ations of substrates or coenzymes has been described for a variety of erlzymes (reviewed
in Goldberg and Dice28).
It is striking that there have been seven instances of unexplained death in childhood in the two families reported to
have the nt3250 mutation. SIDS cases have been described
previously in families with mitochondrial myopathy, 29, 30
and we have identified two families with the mtDNA nt8993
T-to-G mutation in which matemal relatives of the proband
have been regarded as having had SIDS (unpublished
results). The sibling who died of SIDS in this family had a
mutant load of 34% to 58% in the four tissues examined,
which was not substantially higher than that of the
symptom-free mother. An adjacent mutation at nt3251 in
the tRNA Leu(uUR) gene has been implicated in sudden death
of adults from respiratory arrest. 31 The load of such mutations may also vary between muscle fibers (and perhaps
neurons), so it is possible, for example, that some bundles of
muscle fibers in the sibling's heart or diaphragm may have
had a higher mutant load. Thus the normal respiratory chain
enzyme activities and moderate mutant load in her tissues do
not provide sufficient evidence to regard her SIDS-type
death as being definitely caused by the mtDNA mutation, but
the combined family histories make this seem likely.
In conclusion, this is only the second report of an individual with an mtDNA mutation who is responsive to riboflavin. We recommend that all individuals with the myopathic
form of complex I deficiency have a therapeutic trial of riboflavin. Mitochondrial DNA mutations should be considered as a possible canse of death in families with multiple
occurrences of unexplained infant death.
We thank Dr. John Walsh, Department of Neurology, Royal
Prinee Alfred Hospital, Camperdown, for reporting on the microscopy of the muscle biopsy specimen, Prof. David Sillence, Head of
Department of Clinical Genetics, Royal Alexandra Hospital for
Children, Westmead, for his assistance in the photography of the
muscle biopsy specimen, Dr. Xenia Dennett for her examination of
postmortem muscle samples from the sibling, and Dr. Alex Karl,
Depat~nent of Histopathology, Royal Alexandra Hospital for Children, Westmead, for performing electron microscopy on the muscle biopsy specimen. R.B.B. is the Helen M. Schutt Postdoctoral
Fellow at the Murdoch Institute. H.-H.M.D. is a National Health and
Medical Research Council Senior Research Fellow.
The Journal of Pediatrics
January 1997
REFERENCES
1. Walker JE. The NADH:ubiquinone oxidoreductase (complex I)
of respiratory chains. Q Rev Biophys 1992;25:253-324.
2. Hoppel CL, KeITDS, Dahms B, Roessmann U. Deficiency of
the reduced nicotinamide adenine dinucleotide dehydrogenase
component of complex I of mitochondrial electron transport:
fatal infantile lactic acidosis and hypermetabolism with skeletal-cardiac myopathy and encephalopathy. J Clin Invest 1987;
80:71-7,
3. Morgan-Hughes JA, Darveniza P, Landon DN, Land JM, Clark
JB. A mitochondrial myopathy with deficiency of respiratory
chain NADH-CoQ reductase activity. J Neurol Sei 1979;43:2746.
4. Morgan-Hughes JA, Hayes DJ, Cooper M, Clark Iß. Mitochondrial myopathies: defieiencies localised to complex I and
complex III of the mitochondrial respiratory chain. Biochem
Soc Trans 1985;13:648-50.
5. Robinson BH, De Meirleir L, Glerum M, Sherwood G, Becker
L. Clinical presentation of mitochondfial respiratory ehain defects in NADH-coenzyme Q reductase and cytochrome oxidase: clues to pathogenesis of Leigh disease. J Pediatr 1987;
110:216-22.
6. Korenke GC, Bentlage HACM, Ruitenbeek W, et al. Isolated
and combined deficiencies of NADH dehydrogenase (complex
I) in muscle tissue of children with mitochondfial myopathies.
Eur J Pediatr 1990;150:104-8.
7. Koo B, Becker LE, Chuang S, et al. Mitochondrial encephalomyopathy, lactic acidosis, stroke-like episodes (MELAS):
clinical, radiologieal, pathological, and genetic observations.
Ann Neurol 1993;34:25-32.
8. Larsson N-G, Andersen O, Holme E, Oldfors A, Wahlström J.
Leber's hereditary optic neuropathy and complex I deficiency
in muscle. Arm Neurol 1991;30:701-8.
9, Valle D. An overview of eurrent therapy. Hosp Pract
1987;22:167-82.
10, Arts WFM, Scholte HR, Bogaard JM, Kerrebjin KF, LuytHouwen IEM. NADH-CoQ reductase deficient my0pathy:
successful treatment with riboflavin. Lancet 1983;2:581-2.
11. Clark Iß, Hayes DJ, Morgan-Hughes JA, Byrne E. Mitochondrial myopathies: disorders of respiratory chain and oxidative phosphorylation. J Inher Metab Dis 1984;7(suppl 1):
62-8.
12. Roodhooft AM, Van Acker Kl, Martin JJ, Ceuterick C, Scholte
HR, Luyt-Houwen EM. Benign rnitochondrial myopathy with
deficiency of NADH-CoQ reductase and cytochrome c oxidase. Neuropaediatr 1986;17:221-6.
13. Griebel V, Krägeloh-Mann I, Ruitenbeek W, Trijbels JMF,
Paulus W. A mitochondrial myopathy in an infant with lactic
acidosis. Dev Med Child Neurol 2990;32:528-31.
14. Bernsen PLJA, Gabreëls FJM, Ruitenbeek W, Sengers RCA,
Stadhouders AD, Reiner WO. Successful treatment of pure
myopathy, associated with complex I deficiency, with riboflavin and camitine. Arch Neurol 1991;48:334-8.
15. Bemsen PLJA, Gabreëls FJM, Ruitenbeek W, Hamburger HL.
Treatment of complex I deficiency with riboflavin. J Neurol Sci
1993;118:181-7.
16. Bakker HD, Scholte HR, Jeneson JAL, Busch I-IFM, Abeling
NGGM, van Gennip AH. Vitamin-responsive complex I deficiency in a myopathic patient with increased activity of the terminal respiratory chain and lactic acidosis. J haher Metab Dis
1994; 17:196-204.
17. Scholte HR, Busch HFM, Bakker HD, Bogaard JM, Luyt-
The JournaI of Pediatrics
Volume 130, Number 1
18.
19.
20.
21.
22.
23.
24.
Houwen IEM, Kuyt LP. Riboflavin-responsive complex I deficiency. Biochim Biophys Acta 1995;1271:75-83.
Rahman S, Dahl H-HM, Blok RB, Danks DM, Kirby DM,
Chow CW, et al. Leigh syndrome: clinical feamres and
biochemical and DNA abnormalities. Ann Neuro11996;39:34351.
Ali ST, Duncan AMV, Schappert K, et al. Chromosomal
localization of the human gene encoding the 51-kDa subunit of
mitochondrial complex I (NDUFVI) to llq13. Genomics
1993;18:435-9.
Blok RB, Thorburn DR, Thompson GN, Dahl HHM. A topoisomerase II cleavage site is associated with a novel mitochondrial DNA deletion. Hum Genet 1995;95:75-81.
Patel SD, Aebersold R, Attardi G. cDNA-derived amino acid
sequence of the NADH-binding 51-kDa subunit of the bovine
respiratory NADH dehydrogenase reveals striking similarities
to bacterial NAD+-reducing hydrogenase. Proc Natl Acad Sci
(USA) 1991;88:4225-9.
Goto Y, Tojo M, Tohyama J, Horai S, Nonaka I. A novel point
mutation in the mitochondrial tRNALeu(tmR) gene in a family
with mitochondrial myopathy. Ann Neurol 1992;31:667-72.
Chomyn A, Patel SD, Cleeter MWJ, Ragan I, Attardi G. The
site of synthesis of the iron sulfur subunits of the flavoprotein
and iron-protein fractions of human NADH dehydrogenase. J
Biol Chem 1988;263:16395-400.
Yamaguchi M, Hatefi Y. Mitochondrial NADH:ubiquinone
oxidoreductase (complex I): proximity of the subunits of the
flavoprotein and the iron-sulfur protein subcomplexes. Biochemistry 1993;32:1935-9.
Ogle et aL
145
25. Tein I, DeVivo DC, Ranucci D, DiMauro S. Skin fibroblast
camitine uptake in secondary camitine deficiency disorders. J
Inher Metab Dis 1993;16:135-46.
26. King MP, Koga Y, Davidson M, Schon E. Defects in
mitochondrial protein synthesis and respiratory chain activity
segregate with the tRNAI~u(~JvR)mutation associated with mitochondrial myopathy, encephalomyopathy, lactic acidosis and
strokelike episodes. Molec Cell Biol 1992;12:480-90.
27. Penn AMW, Lee JWK, Thuillier P, et al. MELAS syndrome
with mitchondrial tRNALeu0~R) mutation: correlation of clinical state, nerve conduction, and muscle 31p magnetic resonance spectroscopy during treatment with nicotinamide and riboflavin. Neurology 1992;42:2147-52.
28. Goldberg AL, Dice JF. Intracellular protein degradation in
mammalian and bacterial cells. Annu Rev Biochem 1974;
43:835-69.
29. Pastores GM, Santorelli FM, Shanske S, et al. Leigh syndrome
and hypertrophic cardiomyopathy in an infant with a mitochondrial DNA point mutation (T8993). Am J Med Geriet
1994;50:265-71.
30. Silvestri G, Santorelli FM, Shanske S, Whitley CB, Schimmenti LA, Smith S, et al. A new mtDNA mutation in the tRNA
(Leu[UUR]) gene associated with matemal inherited cardiomyopathy. Hum Mutat 1994;3:37-43.
31. Sweeney MG, Bunday S, Brockington M, Poulton KR, Winer
JB, Harding AE. Mitochondrial myopathy associated with
sudden death in young adults and a novel mutation in the mitochondrial DNA leucine transfer RNA (UUR) gene. Q J Med
1993;86:709-13.