SINGAPORE Home › Products › pTK-CLuc Vector pTK-CLuc Vector This product has been discontinued on 1/1/17 and replaced by N0317. This product was discontinued on 01/01/2017 Catalog # Product Information Size FAQs & Tech Tips Protocols & Manuals Other Tools & Resources Description Properties and Usage References Concentration Quality & Safety Legal Information Advantages and Features Related Products Description The pTK-CLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a reporter, under the control of the constitutive HSV thymidine kinase promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1,2). Because it is secreted CLuc can be detected in the culture medium of mammalian cells expressing the reporter gene. pTK-CLuc has a multiple cloning site (MCS) between the CLuc stop codon and the polyadenylation site. pTK-CLuc contains a selectable marker that is suited for creating stable integrants in the mammalian cell genome. Recommended sequencing primers for pTK-CLuc Vector (not available from NEB) pBasic Reverse Primer (25-mer) TCAGAAGCCATAGAGCCCACCGCAT (2827-2803) CLuc 3´ end Forward Primer (23-mer) GAGTTCAAGAAAGAATGCTACAT (2397-2419) CLuc 5´ End Reverse Primer (24-mer) GTAAGGACAGTCCTGGCAATGAAC (869-846) Figure 1: Cypridina Luciferase (CLuc) activity obtained from different CLuc plasmids HeLa cell supernatants (20 μl) and lysates (5 μl) were assayed with the BioLux CLuc Assay Kit (NEB #E3309). HeLa cells were seeded in 12-well plates and transfected with 50 ng of CLuc-expressing plasmid per well. At 24 hr post-transfection, supernatants were collected and cell lysed in 100 μl per well using Luciferase Cell Lysis Buffer (NEB #B3321). The CLuc activity was measured in a Mithras LB940 (Berthold Technologies) luminometer set to: 50 μl of injection, 2 seconds of delay and 2 seconds of integration. Figure 2: pTK-CLuc multiple cloning site (MCS) DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful. Highlights TK promoter (BglII-HindIII): 18-776 Start codon of CLuc: 801-803 Stop codon: 2460-2462 CLuc coding: 801-2462 Signal peptide: 801-854 Polylinker downstream of CLuc 2463-2489 NotI, AgeI, XhoI, XbaI Poly-A site (from SV40): 2490-2733 NeoR promoter (SV40): 3318-3653 NeoR: 3705-4499 NeoR poly-A(SV40): 4673-4803 Bacterial replication ori (pMB1) 5833-5245 Amp Resistance gene 6864-6004 Advantages and Features Features Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points). 90–95% of CLuc activity is found in the cell culture medium, with the remaining 5-10% detectable in cell lysates (Figure 1). This allows flexibility when assaying CLuc along with other co-transfected reporters. The activity of CLuc is high and the CLuc assay is sensitive enough to detect very small amounts of CLuc enzyme activity. CLuc does not use the same substrate as other marine luciferases (e.g. Renilla, Gaussia). Therefore, it is possible to assay both CLuc and GLuc independently in cell culture medium from cells expressing both reporters (3). The pTK-CLuc Vector can be transfected into cells using any standard transfection protocol. Applications The pTK-CLuc Vector can be used as a control for assessing the efficiency of transfection in mammalian cells. pTK-CLuc Vector has a multiple cloning site (MCS) between the CLuc stop codon and the polyadenylation signal. This allows the cloning of sequences that will be part of the CLuc mRNA, such as 3´ UTR sequences, that can be used for RNA stability or RNAi or miRNA target evaluation. Plasmids containing other constitutive promoter elements are also available (see Related Products). Properties and Usage Storage Temperature -20°C Related Products Companion Products BioLux® Cypridina Luciferase Assay Kit pCMV-CLuc 2 Control Plasmid pSV40-CLuc Control Plasmid pCLuc-Basic 2 Vector pCLuc Mini-TK 2 Vector BioLux® Gaussia Luciferase Assay Kit pCMV-GLuc 2 Control Plasmid pSV40-GLuc Control Plasmid pGLuc-Basic 2 Vector pTK-GLuc Vector pGLuc Mini-TK 2 Vector References 1. Nakajima, et al. (2004). Biosci. Biotechnol. Biochem. 68, 565-570. 2. Otsuji, et al. (2004). 329, 230-237. 3. Wu, et al. (2007). Biotechniques. 42, 290-292. FAQs FAQs 1. 2. 3. 4. 5. 6. Where can I find the sequence of this plasmid? Can I make a stable cell line with pTK-CLuc Vector? Can I transfect this plasmid into mammalian cells? How do I assay for CLuc expression? Can I use assay kits designed for other reporters (Gaussia, Renilla & Firefly luciferases) to assay CLuc activity? Is there another secreted reporter that can be used with CLuc? Datacards Datacards The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at [email protected] or fill out the Technical Support Form for appropriate document. N0322Datasheet-Lot0041402 N0322Datasheet-Lot0051505 Selection Charts Interactive Tools Selection Charts Reporter Systems Interactive Tools DNA Sequences and Maps Tool Safety Data Sheet Datacards Safety Data Sheet The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely. pTK-CLuc Vector Datacards The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at [email protected] or fill out the Technical Support Form for appropriate document. N0322Datasheet-Lot0041402 N0322Datasheet-Lot0051505 Legal and Disclaimers Legal and Disclaimers This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain additional third party intellectual property rights for certain applications. For more information about commercial rights, please contact NEB's Global Business Development team at [email protected]. This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals. Licenses Licensed under certain patents and patent applications from the National Institute of Advanced Industrial Science and Technology ("AIST") for Research and Development Purposes. For use of the Biolux Cypridina Luciferase Assay Kit, or associated assay reagents, in human diagnosis and measurement in relation to human health, contact [email protected].
© Copyright 2026 Paperzz