Journal of Antimicrobial Chemotherapy (2006) 57, 865–871
doi:10.1093/jac/dkl085
Advance Access publication 20 March 2006
Effect of different iodine formulations on the expression and activity
of Streptococcus mutans glucosyltransferase and fructosyltransferase
in biofilm and planktonic environments
Avshalom Tam1, Moshe Shemesh1, Uri Wormser2, Amnon Sintov3 and Doron Steinberg1*
1
Institute of Dental Sciences, Faculty of Dentistry, Hebrew University-Hadassah, Jerusalem, Israel;
Department of Pharmacology, School of Pharmacy, Faculty of Medicine, Institute of Life Sciences,
The Hebrew University of Jerusalem, Jerusalem, Israel; 3Department of Pharmacology and
School of Pharmacy, Ben Gurion University of the Negev, Beer-Sheva, Israel
2
Received 19 January 2006; returned 10 February 2006; revised 15 February 2006; accepted 21 February 2006
Objectives: The glucosyltransferase (GTF) and fructosyltransferase (FTF) enzymes play a pivotal role in
dental biofilm formation as they synthesize polysaccharides that act as the extracellular matrix of the
biofilm. Iodine is a unique antibacterial agent that has distinct properties from other conventional antibacterial agents. In this study we have examined the effect of iodine and povidone iodine (PI) on gtf and ftf
expression in biofilm and planktonic environments and on immobilized and unbound GTF and FTF activity.
Methods: Real-time reverse transcription–PCR was used to investigate the effect of iodine and PI on ftf,
gtfB and gtfC expression. The effect of iodine and PI on GTF and FTF activity was tested using radioactive
assays.
Results: Our results indicate that iodine and PI in a tetraglycol carrier cause enhancement of expression of
gtfB in Streptococcus mutans in biofilms but not in planktonic bacteria. PI in water induced expression
of gtfB and gtfC in planktonic bacteria. However, iodine and PI strongly inhibit polysaccharide production by GTF and to a lesser extent by FTF activity. The inhibitory effect on GTF activity was similar in
solution compared to its activity in the immobilized environment. This unique effect may be attributed to
the distinct chemical properties of iodine compared with other antibacterial agents.
Conclusions: This study indicates that iodine at sub-bactericidal concentrations demonstrates molecular
and enzymatic effects that are highly associated with biofilm formation.
Keywords: povidone iodine, gene expression, enzymatic activity, S. mutans
Introduction
Dental caries is a microbial disease that continues to pose a
worldwide health problem. Streptococcus mutans, harbouring
the dental biofilm, is the principal aetiological factor of this
disease. Its ability to adhere to teeth surfaces is paramount for
the progression of the disease.1 The bacterial adhesion mechanism is mediated by several means of which the synthesis of
extracellular polysaccharides such as glucans and fructans is
cardinal in dental biofilm formation. The above polysaccharides
are synthesized by extracellular enzymes glucosyltransferase
(GTF) and fructosyltransferase (FTF).2,3
Iodine has long been known as an antibacterial agent.4,5
Several clinical studies have also shown the efficacy of iodine
(I2) and povidone iodine (PI) in oral hygiene.6–8 However, limited
studies have been performed on iodine’s effect on dental biofilm
constituents
One of the drawbacks of using iodine is its low solubility
in water, as well as its potential staining of teeth. One
avenue to overcome these disadvantages is changing the drug
delivery of iodine. Iodine complexed with polyvinyl pyrrolidone (PVP), to form PI, increases water solubility, reduces
irritation and decreases the staining caused by pure iodine.
Apart from their antibacterial activity, PI and iodine are effective in protecting skin damage against chemical9 and thermal10
stimuli. It was shown that iodine or PI formulated in
tetraglycol (TG) was more effective than the water-based
formulations.
.............................................................................................................................................................................................................................................................................................................................................................................................................................
*Corresponding author. Tel: +972-2-6757633; Fax: +972-2-6758561; E-mail: [email protected]
.............................................................................................................................................................................................................................................................................................................................................................................................................................
865
The Author 2006. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: [email protected]
Tam et al.
Since formulation plays a crucial role in the pharmacological
activity of a drug, the purpose of this study was to investigate the
effect of iodine and PI, in a novel carrier, on enzymatic and
molecular factors associated with dental biofilm formation.
Materials and methods
Materials
We have formulated several iodine- and PI-containing pharmaceutical formulations: (i) PI/H2O, 10% PI dissolved in water; (ii) PI/TG,
10% PI dissolved in TG; (iii) I2/TG, 2% iodine dissolved in TG;
(iv) I2 + KI/H2O, 2% iodine + 2.4% KI dissolved in water. Each
formulation was compared with a control (the formulation without
the iodine or PI). These formulations served as stock solutions from
which PI or iodine were diluted with the reaction medium to form
the concentrations indicated in the text.
Bacterial strains and culture conditions
S. mutans UA 159, used in the present study, was grown overnight at
37 C in brain heart infusion (BHI) (Difco, MD, USA) in an atmosphere enriched with 5% CO2.
For biofilm generation, 20 mL of S. mutans culture was placed in
20 mm diameter, 15 mm deep polystyrene multidishes (six wells) and
cultivated with 5 mL of BHI supplemented with 2% sucrose at 37 C
under anaerobic conditions enriched with 5% CO2. After 18 h of
incubation, the spent medium was aspirated from the wells and the
biofilm was incubated again in fresh BHI with 2% sucrose, supplemented with the tested formulations (iodine formulations at concentrations of 0.007% iodine or the equivalent iodine in 0.035% PI).
After 4 h of incubation, the cells of the biofilms were dislodged into
a 2 mL microcentrifuge tube containing 40 mg of glass beads
(106 mm diameter; Sigma-Aldrich, St Louis, MO, USA) and 1 mL
of TRI Reagent (Sigma).
For planktonic experiments, S. mutans UA 159 was inoculated in
BHI supplemented with 2% sucrose. The tubes were incubated in
a 5% CO2 atmosphere at 37 C for 18 h supplemented with the
above-tested iodine solutions. After incubation, the suspension
was centrifuged and the pellet was placed in a 2 mL microcentrifuge
tube containing 0.4 mL of glass beads and 1 mL of TRI Reagent
(Sigma).
Extraction of total RNA
The above bacterial cells obtained after incubation were disrupted
with the aid of a Fast Prep Cell Disrupter (Bio 101; Savant Instruments, Inc., NY, USA), centrifuged and RNA-containing supernatant
was supplemented with 1-bromo-3-chloropropane (BCP) (Molecular
Research Center, Cincinnati, OH, USA). The upper aqueous phase
was precipitated with isopropanol. After centrifugation, the resulting
RNA pellet was washed with 75% ethanol and resuspended in diethyl
pyrocarbonate (DEPC)-treated water (Invitrogen, Carlsbad, CA,
USA). Because of the sensitivity of PCR, residual contaminating
DNA was eliminated by incubation of the sample with RNasefree DNase (Promega, Madison, WI, USA). The DNase was then
inactivated by incubation at 65 C for 10 min, and the RNA was
precipitated with ethanol and suspended in DEPC-treated water. The
RNA concentration was determined spectrophotometrically with the
aid of a Nanodrop Instrument (ND-1000, Nanodrop Technologies,
Wilmington, DE, USA). The integrity of the RNA was assessed by
agarose-gel electrophoresis (data not shown).
Reverse transcription
A reverse transcription (RT) reaction mixture (20 mL) containing
50 ng of random hexamers, 10 mM dNTPs mix and 2 mg of total
RNA sample was incubated at 65 C for 5 min to remove any secondary structure and placed on ice. Then 10· RT buffer, 25 mM
MgCl2, 0.1 M DTT, 40 U of RNaseOUT Recombinant Ribonuclease
Inhibitor and 50 U of Super Script II RT (Invitrogen, Life Technologies, Carlsbad, CA, USA) were added to each reaction mixture.
After incubation at 25 C for 10 min, the mixture was incubated at
42 C for 50 min. The reaction was terminated by heating the mixture
at 70 C for 15 min, and the cDNA samples were stored at 4 C until
they were used.
Real-time quantitative PCR
Amplification, detection and analysis of mRNA were performed
using the ABI-Prism 7000 Sequence Detection System (Applied
Biosystems, Foster City, CA, USA) with an SYBR Green PCR
Master Mix (Applied Biosystems). All primers were designed
using the algorithms provided by Primer Express (Applied Biosystems) for uniformity in size (100 bp) and melting temperature. For
each set of primers, a standard amplification curve was plotted and
only those with slope –3 were considered reliable primers. Primers
and sequences are provided in Table 1.
The reaction mixture (20 mL) contained 1· SYBR Green PCR
Master Mix (Applied Biosystems), 1 mL of the cDNA sample and
the appropriate forward (0.5 mM) and reverse PCR primers. PCR
conditions included an initial denaturation at 95 C for 10 min, followed by a 40 cycle amplification consisting of denaturation at 95 C
for 15 s and annealing and extension at 60 C for 1 min. All primer
pairs were checked for primer–dimer formation by using the two-step
protocol described above without the addition of RNA template. As
an additional control for each primer pair and each RNA sample, the
cDNA synthesis reaction was carried out in the absence of reverse
Table 1. Nucleotide sequences of primers
Primer
Sequence (50 –30 )
Fragment location
Accession number
Ftf-F
Ftf-R
GtfB-F
GtfB-R
GtfC-F
GtfC-R
16S-F
16S-R
AAATATGAAGGCGGCTACAACG
CTTCACCAGTCTTAGCATCCTGAA
AGCAATGCAGCCAATCTACAAAT
ACGAACTTTGCCGTTATTGTCA
CTCAACCAACCGCCACTGTT
GGTTTAACGTCAAAATTAGCTGTATTAGC
CCTACGGGAGGCAGCAGTAG
CAACAGAGCTTTACGATCCGAAA
1358–1379
1435–1458
1150–1172
1224–1245
434–453
496–524
243–262
321–343
M18954
M18954
M17361
M17361
M22054
M22054
X58303
X58303
866
Effect of iodine on GTF and FTF
transcriptase in order to identify whether the RNA samples were
contaminated by residual genomic DNA. The critical threshold
cycle (Ct) was defined as the cycle in which fluorescence becomes
detectable above the background fluorescence and is inversely
proportional to the logarithm of the initial number of template
molecules. A standard curve was plotted for each primer set with
Ct values obtained from amplification of known quantities of
S. mutans cDNA. The standard curves were used for transformation
of the Ct values to the relative number of cDNA molecules. The
contamination of genomic DNA was determined from control
reactions, devoid of reverse transcriptase. The same procedure was
repeated for all of the primers.
18
*
ftf
16
gtfB
*
Normalized expression
14
gtfC
12
10
8
6
*
4
Effect of iodine formulations on the activity of immobilized
GTF and FTF
2
The effect of iodine formulations on the activity of cell-free GTF and
FTF immobilized on hydroxyapatite (HA) was conducted according
to an assay described previously11,12 Briefly, 40 mg of HA beads
(diameter 80 mm, surface area 40 m2/g; Bio-Rad Laboratories, Hercules, CA, USA) was equilibrated by three washes in buffered KCl,
pH = 6.5. The beads were incubated with GTF or FTF prepared as
described by Steinberg et al.11 After 2 h of incubation, the HA beads
were washed with KCl buffer. The enzyme-coated HA beads were
incubated with 200 mM sucrose supplemented with 0.25 mCi/mL
[3H-fructose]sucrose for FTF activity, or with [14C-glucose]sucrose
(American Radiolabeled Chemicals, Inc., St Louis, MO, USA) for
GTF activity, as described above, for 3 h in the absence and presence
of various concentrations of the tested iodine formulations. Fructans
or glucans synthesized on the HA beads were washed three times
with KCl buffer, dried with 4 mL of EtOH and measured in a scintillation counter (Beta-counter, Kontron Basel, Switzerland). Results
are presented as percentage enzymatic activity with respect to control
(absence of iodine).
Effect of iodine formulations on the activity of unbound
GTF and FTF
The effect of iodine formulations on cell-free unbound GTF,
prepared as described previously, was tested as follows. The isolated
GTF was incubated with 200 mM sucrose, supplemented with [14Cglucose]sucrose (American Radiolabeled Chemicals, Inc.) in 10 mM
phosphate buffer (pH 6.5). Iodine formulations at tested concentrations were added to the GTF solution. The reaction was terminated
after 3 h of incubation at 37 C by adding ice-cold ethanol to a final
concentration of 70%. The ethanol-insoluble polysaccharides were
allowed to precipitate overnight at 4 C. The precipitate was collected
and washed over a glass fibre filter (GF/C, Whatman, Maidstone,
UK) using a multi-sample vacuum manifold (Millipore Corporation,
Bedford, MA, USA). The filters were dried, and the radioactively
labelled glucans collected on the glass filter were counted in a scintillation counter (Beta-counter, Kontron). Results are presented as
percentage enzymatic activity with respect to control (absence of
iodine).
The effect of iodine formulations on FTF activity in solution was
studied as described above but changing the enzymatic substrate to
[3H-fructose]sucrose (NEN, Boston, MA, USA) at 0.25 mCi/mL.
Statistical analysis
Student’s t-test was used to calculate the significance of the difference between the mean effect of a given formulation of iodine
or PI compared with a placebo. A P value of <0.05 was considered
statistically significant.
0
Control
I2/TG
PI/TG
PI/H2O
Figure 1. Effect of iodine (I2) and povidone iodine (PI), in tetraglycol (TG)
or H2O, on gtfB/C and ftf expression in biofilm immobilized S. mutans. The
mRNA expression levels were calibrated relative to the control group. The results
are expressed as the means and standard errors of triplicate experiments
using primers specific for ftf and 16S rRNA (normalizing gene). *Statistical
differences (P < 0.05) between gene expression levels in the presence of iodine
or PI and the control group.
Results
Effect of iodine on gtf and ftf expression
All isolated RNA samples contained negligible amounts of
double-stranded DNA. An equal amount of total RNA (2 mg)
from each phase culture was used for quantification of the transcript levels of the tested genes. Dissociation curves revealed that
there were no non-specific products in any amplification reaction.
The expression levels of all genes were normalized by using
amplification of the 16S rRNA gene of S. mutans as an internal
standard.
Real-time PCR was used to quantify the effect of iodine on
gtfB, gtfC and ftf gene expression (Figures 1 and 2). In the biofilm
environment; PI/TG and I2/TG significantly induced gtfB expression (P < 0.05). Their effect on gtfC was much less and no
effect on ftf expression was demonstrated. PI/H2O had little effect
on expression of gtfB and no effect on gtfC and ftf expression in
biofilm (Figure 1). A different expression profile was observed
with planktonic S. mutans. The most profound effect on gene
expression in the planktonic environment was demonstrated
by PI/H2O, which significantly increased expression of gtfC
(P < 0.05), but had less influence on gtfB, while the effect
on ftf expression was minor. The other iodine formulations
had a minute influence on gtfB, gtfC and ftf expression (Figure 2).
Effect of iodine formulations on GTF and FTF activity
Iodine and PI in aqueous solutions caused a sharp decrease in the
activity of the unbound GTF in solution and of HA-immobilized
GTF (P < 0.05) (Figure 3a and b). Both iodine and PI in TG
carrier also demonstrated a very sharp inhibitory effect on the
immobilized and unbound GTF in solution (P < 0.05) (Figure 4a
and b). At the lowest tested concentration of each formulation,
the effect on immobilized GTF activity was minor compared with
the effect on the unbound GTF in solution.
867
Tam et al.
(a) 120
ftf
700
gtfB
Unbound
Immobilized
100
*
gtfc
500
80
% Activity
Normalized expression
600
*
400
300
60
40
200
*
20
100
*
*
* *
0
*
*
* *
PI/TG
* *
* *
*
*
0.53
0.83
* *
0.0175 0.035 0.067 0.13 0.267
PI/H2O
*
1.167
% PI
Figure 2. Effect of iodine (I2) and povidone iodine (PI), in tetraglycol (TG)
or H2O, on expression of gtfB/C and ftf in unbound planktonic S. mutans.
The mRNA expression levels were calibrated relative to the control group.
The results (P < 0.05) are expressed as the means and standard errors of triplicate
experiments using primers specific for ftf and 16S rRNA (normalizing gene).
*Statistical differences (P < 0.05) between gene expression in the presence of
iodine or PI and the control group.
(b) 120
Unbound
Immobilized
100
80
% Activity
I2/TG
* *
0
0
Control
*
*
However, compared with the effect on GTF, the effect of
aqueous iodine and PI formulations on FTF activity was less
profound. In general, I2/H2O had a marked inhibitory effect on
unbound FTF activity in solution (P < 0.05) but its effect was less
than on the HA-immobilized FTF. The same trend was also
observed for PI/H2O where the effect was less profound at higher
concentrations of iodine (Figure 5). A similar mode of action was
also recorded with iodine or PI in TG carrier (Figure 6), although
the inhibition of unbound FTF in the presence of iodine in TG
was less than in iodine in water.
60
*
40
*
*
20
*
*
* *
*
*
*
*
0
0
0.0035 0.007 0.013 0.0267 0.053
0.1
*
*
*
*
0.167 0.23
% Iodine
Figure 3. Effect of (a) aqueous povidone iodine (PI) and (b) aqueous iodine (I2)
on GTF activity. The results (P < 0.05) are expressed as the means and standard
deviation of triplicate experiments. *Statistical differences (P < 0.05) between
GTF activity in the presence of iodine or PI and the control group.
Discussion
Most of the work on enzymatic inhibitors associated with dental
plaque has focused on their effect in the unbound state in a solution environment. However, studying the influence of inhibitors
on these biofilm-building enzymes on a surface is of great interest, as this immobilized environmental condition reflects more
closely the one on the tooth surface.
Iodine is a well-known antibacterial agent.4 In this study we
explored potential effects of iodine on gene expression and
the activity of enzymes that are associated with dental biofilm
formation.
Both formulations of iodine and PI in TG carrier induced
expression of gtfB and gtfC in biofilm, while no effect on ftf
expression was observed. However, while PI/H2O formulations
induced expression of gtfB and gtfC in planktonic S. mutans, the
TG-based iodine and PI compounds had a minor effect on ftf, gtfB
and gtfC expression. These differences in the effect of iodine on
the tested gene expression imply that bacteria in the immobilized
environment of the biofilm are less sensitive to induction by
PI/H2O but are most sensitive to this iodine formulation in the
planktonic environment. In addition, the selectivity of the
effect of iodine on gene expression may also be attributed to
the different pharmaceutical carrier in which the iodine is
formulated.
The sharp increase in gtf expression, especially gtfB, indicates
that iodine may have an adverse effect on the adhesion process.
On the one hand iodine inhibits GTF and FTF activity, but on the
other hand it may also indirectly induce adhesion by enhancing
expression of gtf and ftf. However, it should be noted that expression of GTF and FTF is not an indication of an adhesion process,
because their activity requires the presence of sucrose, and
without this substrate the adhesion process is strongly reduced.
Clearly, the effect of agents on expression of genes that are
heavily involved in biofilm formation is of interest. Using
real-time reverse transcription–PCR13 has shown that sucrose,
which is the obligate substrate of GTF, affects expression of
gtf by enhancing gtfD expression, whereas it reduces expression
of gtfB and gtfC. Sato et al.14 have shown that xylitol activates
the expression of gbp, a gene encoding the glucans binding protein, an enzyme involved in the glucan adhesion pathway of oral
bacteria. According to the results, xylitol, a sugar alcohol not
868
Effect of iodine on GTF and FTF
120
Unbound
Immobilized
100
100
80
80
% Activity
% Activity
(a) 120
60
Unbound
Immobilized
*
*
*
40
*
40
20
* *
*
0
0
* *
**
0.0175 0.035 0.067
* *
0.13
0.267
0.53
20
*
*
0.83
1.167
0
(b) 120
*
0.0175 0.035 0.0675 0.1325 0.275 0.5375 0.8375
% PI
120
Unbound
Immobilized
Unbound
Immobilized
100
80
80
% Activity
% Acivity
*
*
0
% PI
100
*
*
*
*
**
* *
60
60
40
*
*
*
*
*
*
20
*
*
*
*
*
0
*
40
*
0
60
*
*
*
*
*
*
0.0035 0.007 0.013 0.0267 0.053
% Iodine
*
0.1
*
20
*
*
*
*
*
*
*
*
0
0.167
0
0.0035 0.007 0.0135 0.0265 0.055 0.1075 0.167
% Iodine
Figure 4. Effect of (a) povidone iodine (PI) and (b) iodine (I2), in tetraglycol
(TG) carrier, on GTF activity. The results (P < 0.05) are expressed as the
means and standard deviations of triplicate experiments. *Statistical differences
(P < 0.05) between GTF activity in the presence of iodine or PI and the control
group.
Figure 5. Effect of (a) aqueous povidone iodine (PI) and (b) aqueous iodine (I2)
on FTF activity. The results (P < 0.05) are expressed as the means and standard
deviations of triplicate experiments. *Statistical differences (P < 0.05) between
FTF activity in the presence of iodine or PI and the control group.
involved in sugar metabolism and pH reduction of oral bacteria,
may have an indirect effect on the cariogenic pathway.
It is conceivable that the effect of anti-plaque agents on
GTF and FTF activity in solution may differ from their effect
on immobilized enzymes.15–17 Most studies on the enzymatic
inhibitors of GTF or FTF were conducted using unbound
enzymes. In most studies that did compare the effect of an
agent on the unbound GTF or FTF activity in solution with
the immobilized state it was found that the inhibitory effect
was much more pronounced in solution than in the immobilized
state.18–21 This difference in activity between the unbound and
the immobilized states was attributed mostly to the low diffusion/
permeability capability of the agents into the immobilized
enzymes and to the change of enzymatic conformation due to
the adsorption process.
Our study shows that the inhibitory effect of iodine on
unbound GTF activity was similar in the immobilized state.
This surprising finding may be attributed to the unique molecular
size of iodine compared with all of the other agents reported
above. Owing to its small molecular weight, the diffusion
capability of iodine is high; therefore, the effective concentration
of the iodine in situ in the biofilm microenvironment may be
similar to that in solution. This results in a similar inhibitory
effect on GTF in solution and in the immobilized state. In addition, iodine is a unique molecule, which, unlike many other
antibacterial agents, does not possess a positive charge; thus it
may bind to different sites from the cationic antibacterial agents.
Binding of an enzyme to the surface causes a conformational
change. As a result, additional sites that may act as targets for
active agents may be exposed, facilitating easier binding of the
iodine to the enzyme and therefore preventing GTF activity.
Similarly, an amino alcohol molecule, delmopinol, has been
shown to have an even more profound inhibitory effect on
immobilized GTF compared with GTF in solution.12
The effect of iodine and PI on FTF activity was not similar to
their effect on GTF activity. Unlike GTF, the inhibitory effect
of iodine and PI on FTF activity was less profound and their
effect on immobilized FTF was not similar to the unbound FTF.
This result indicates the specificity of action of iodine and PI on
enzymatic activity.
869
Tam et al.
perceived by a counter effect of iodine and PI that inhibits the
activity of those enzymes.
(a) 120
Unbound
Immobilized
100
Acknowledgements
% Activity
80
This study was partially sponsored by the Horowitz Applied
Research Foundation of the Hebrew University. This study is
part of A. T.’s MSc studies.
*
*
60
*
*
*
*
*
40
*
*
Transparency declarations
*
None to declare.
20
0
0
0.0175 0.035
0.067 0.13
% PI
0.275
0.537
References
0.837
(b) 120
Unbound
Immobilized
100
*
% Activity
80
*
*
*
*
*
*
60
40
20
*
*
*
*
*
*
0
0
0.0035 0.007 0.0135 0.0265 0.055 0.1075 0.167
% Iodine
Figure 6. Effect of (a) povidone iodine (PI) and (b) iodine (I2), in tetraglycol
(TG) carrier, on FTF activity. The results (P < 0.05) are expressed as the
means and standard deviations of triplicate experiments. *Statistical differences
(P < 0.05) between FTF activity in the presence of iodine or PI and the control
group.
Clearly, agents that possess the same inhibitory effect on
immobilized enzymes as on enzymes in solution bear a strong
potential antibiofilm effect. The carrier in which the drug is
embedded may also affect the bioavailability of iodine and
thus may alter its biological activity. Comparison between the
effects of PI dissolved in water and PI in TG revealed that
the MIC of the latter formulation was four times lower than
that of the former (data not shown). The superiority of the
TG-containing formulation was also observed in the counterirritation effect of iodine against chemical9 and thermal10
burns. The TG-related effects may be due to its ability to dissolve
molecular iodine in the presence of water, while ethanolic solutions of iodine precipitate in the presence of water unless iodide
salt is added to the solution to form the water soluble I–3 ion. The
association between the physical and pharmacological properties
of the TG-containing iodine formulation is under investigation.
Environmental stress conditions may trigger expression of
genes.22–24 It may be assumed that iodine may act as a stress
factor for bacteria, which in turn evokes a molecular response of
high expression of genes such as gtfB, gtfC and ftf. This effect is
1. Loesche WJ. Role of Streptococcus mutans in human dental
decay. Microbiol Rev 1986; 50: 353–80.
2. Schilling KM, Bowen WH. Glucans synthesized in situ in
experimental salivary pellicle function as specific binding sites for
Streptococcus mutans. Infect Immun 1992; 60: 284–95.
3. Rozen R, Bachrach G, Bronshteyn M et al. The role of fructans on
dental biofilm formation by Streptococcus sobrinus, Streptococcus
mutans, Streptococcus gordonii and Actinomyces viscosus. FEMS
Microbiol Lett 2001; 195: 205–10.
4. Gottardi W. Iodine and iodine compounds. In: Seymour SB, ed.
Disinfection, Sterilization, and Preservation. Philadelphia, PA: Lea &
Febiger, 1991; 152–66.
5. Vratsanos SM. On the structure and function of polyvinyl pyrrolidone-iodine complex. In: Degenes G, ed. Proceedings of International
Symposium on Povidone-Iodine. Lexington, KY: University of Kentucky,
1983; 289–01.
6. Rosling B, Hellstrom MK, Ramberg P et al. The use of PVP-iodine
as an adjunct to non-surgical treatment of chronic periodontitis. J Clin
Periodontol 2001; 28: 1023–31.
7. Hoang T, Jorgensen MG, Keim RG et al. Povidone-iodine as
a periodontal pocket disinfectant. J Periodontal Res 2003; 38: 311–7.
8. Cigana F, Kerebel B, David J et al. A clinical and histological
study of the efficacy of betadine on gingival inflammation. J Biol Buccale
1991; 19: 173–84.
9. Wormser U, Sintov A, Brodsky B et al. Topical iodine preparation
as therapy against sulfur mustard-induced skin lesions. Toxicol Appl
Pharmacol 2000; 169: 33–9.
10. Wormser, U, Sintov, A, Brodsky B et al. Protective effect of
topical iodine preparations upon heat-induced and hydrofluoric acidinduced skin lesions. Toxicol Pathol 2002; 30: 552–8.
11. Steinberg D, Bachrach G, Gedalia I et al. Effects of various
antiplaque agents on fructosyltransferase activity in solution and
immobilized onto hydroxyapatite. Eur J Oral Sci 2002; 110: 374–9.
12. Steinberg D, Beeman D, Bowen WH. The effect of delmopinol
on glucosyltransferase adsorbed on to saliva-coated hydroxyapatite.
Arch Oral Biol 1992; 37: 33–8.
13. Fujiwara T, Hoshino T, Ooshima T et al. Differential and quantitative analyses of mRNA expression of glucosyltransferases from
Streptococcus mutans MT8148. J Dent Res 2002; 81: 109–13.
14. Sato Y, Yamamoto Y, Kizaki H. Xylitol-induced elevated
expression of the gbpC gene in a population of Streptococcus mutans
cells. Eur J Oral Sci 2000; 108: 538–45.
15. Schilling KM, Bowen WH. The activity of glucosyltransferase
adsorbed onto saliva-coated hydroxyapatite. J Dent Res 1988; 67: 2–8.
16. Steinberg D. Studying plaque biofilms on various dental surfaces. In:
An YH, Friedman RJ, eds. Handbook of Bacterial Adhesion: Principles,
Methods, and Applications. New Jersey: Humana Press, 2000; 353–70.
870
Effect of iodine on GTF and FTF
17. Hannig C, Hannig M, Attin T. Enzymes in the acquired enamel
pellicle. Eur J Oral Sci 2005; 113: 2–13.
18. Steinberg D, Feldman M, Ofek I et al. Effect of a high-molecularweight component of cranberry on constituents of dental biofilm.
J Antimicrob Chemother 2004; 54: 86–9.
19. Koo H, Vacca Smith AM, Bowen WH et al. Effects of Apis mellifera
propolis on the activities of streptococcal glucosyltransferases in
solution and adsorbed onto saliva-coated hydroxyapatite. Caries Res
2000; 34: 418–26.
20. Duarte S, Koo H, Bowen WH et al. Effect of a novel type of propolis
and its chemical fractions on glucosyltransferases and on growth and
adherence of mutans streptococci. Biol Pharm Bull 2003; 26: 527–31.
21. Wunder D, Bowen WH. Action of agents on glucosyltransferases
from Streptococcus mutans in solution and adsorbed to experimental
pellicle. Arch Oral Biol 1999; 44: 203–14.
22. Len AC, Harty DW, Jacques NA. Stress-responsive proteins are
upregulated in Streptococcus mutans during acid tolerance. Microbiology
2004; 150: 1339–51.
23. Lemos JA, Abranches J, Burne RA. Responses of cariogenic
streptococci to environmental stresses. Curr Issues Mol Biol 2005; 7:
95–107.
24. Wen ZT, Suntharaligham P, Cvitkovitch DG et al. Trigger factor
in Streptococcus mutans is involved in stress tolerance, competence
development, and biofilm formation. Infect Immun 2005; 73: 219–25.
871