Journal
of General Virology (1997), 78, 1227–1234. Printed in Great Britain
...............................................................................................................................................................................................................
SHORT COMMUNICATION
Secondary structure-dependent evolution of Cymbidium
ringspot virus defective interfering RNA
Zolta! n Havelda, Tama! s Dalmay and Jo! zsef Burgya! n
Agricultural Biotechnology Center, Plant Science Institute, PO Box 411, 2101 Go$ do$ llo% , Hungary
Mutational analysis of defective interfering (DI)
RNAs of Cymbidium ringspot virus (CymRSV) was
used to study the mechanism of DI RNA evolution. It
was shown that a highly base-paired structure in
the 3« region of the longer DI RNA directed the
formation of smaller DI RNA molecules. Mutations
which increased the stability of the computerpredicted, highly structured 3« region of the longest
DI RNA of CymRSV significantly enhanced the
generation and accumulation of the smaller derivatives. Sequence analysis of smaller progeny molecules revealed that the highly base-paired region
was deleted from the precursor DI RNA. Moreover,
sites of recombination were found in other regions
of the DI RNA progenies due to transposition of the
highly base-paired structure. It is likely that the
deletion event was structure- and not sequencespecific, and operated when a foreign sequence
containing a 37-nt-long base-paired stem was
inserted at the appropriate position of DI RNA.
Defective interfering (DI) RNAs are shortened forms of
viral genomes that have frequently lost all the essential viral
genes required for movement, replication and encapsidation.
DI RNAs require the presence of a helper virus for trans-acting
factors necessary for replication and, in general, accumulate at
the expense of the helper virus from which they are derived.
Interference with the helper genome often results in remarkable
symptom attenuation (Roux et al., 1991). DI RNAs are
commonly found associated with both animal and plant virus
infections ; however, the presence of DI RNAs in plant virus
systems is less prevalent. The family Tombusviridae may be an
exception because an increasing number of DI RNAs are found
associated with it. The most extensively studied plant virus DI
Author for correspondence : Jo! zsef Burgya! n.
Fax ­36 28 430 482. e-mail burgyan!hubi.abc.hu
The nucleotide sequence of TBSV-P genomic RNA has been deposited
in the EMBL and GenBank nucleotide databases under accession
number U80935.
RNA systems are those found in association with tombus- and
carmoviruses (Simon & Bujarski, 1994 ; Russo et al., 1994).
Cymbidium ringspot virus (CymRSV) DI RNAs are among
the most extensively studied. DI RNAs are incapable of
autonomous replication but contain all the necessary cis-acting
elements for replication (Havelda et al., 1995). Trans-acting
products required for CymRSV DI RNA replication are
expressed from ORFs 1 and 2 of the CymRSV genome
(Dalmay et al., 1993 ; Kolla! r & Burgya! n, 1994). During the
replication of CymRSV genomic RNA a series of DI RNAs are
generated de novo, ranging in size from approximately 0±4 to
0±7 kb (Burgya! n et al., 1991). The largest DI RNA (DI-13) of
679 nt is made up of three blocks of sequence (A, B and C)
derived from the CymRSV genome (Burgya! n et al., 1989,
1991). Block A contains the first 164 nt of the genomic RNA ;
block B consists of the central 112 nt of the polymerase gene ;
block C is 403 nt long and corresponds to 49 nt of the
carboxyl terminus of the 22 kDa protein gene and the entire 3«
noncoding region of 354 nucleotides (Fig. 1 a). Smaller DI
RNAs essentially have the same sequence blocks, but with
progressive deletions in blocks A and C, whereas block B is
mostly unaffected, showing only minor variations at the
termini (Burgya! n et al., 1991). Based on sequence data, it has
been suggested that the smaller DI RNAs (e.g. DI-2, 403 nt)
are derived from the larger ones (e.g. DI-13) by deletion of the
highly structured central region of block C (Burgya! n et al.,
1991). Similar observations have been made in the related
tombusviruses cucumber necrosis virus (CNV ; Finnen &
Rochon, 1993) and tomato bushy stunt virus (TBSV ; White &
Morris, 1994 a, b).
Several replicase-mediated mechanisms for DI RNA generation in tombusviruses have been described and most are
related to the secondary structure of the replicating RNA
molecules (White & Morris, 1994 a, b, 1995). It is likely that
one model suggested for TBSV RNA (White & Morris, 1995)
may also operate for CymRSV RNA. In this model, a local
intramolecular base-paired region mediates the deletions in
TBSV DI RNA as the replicase bypasses this highly structured
region. This mechanism was originally described for brome
mosaic virus (BMV) RNA as heteroduplex-mediated recombination (Nagy & Bujarski, 1993).
The aim of the present study was to investigate the role of
the computer-predicted secondary structure in the 3«-terminal
0001-4447 # 1997 SGM
BCCH
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32
Z. Havelda, T. Dalmay and J. Burgya! n
(a)
(b)
(c)
(d)
Fig. 1. For legend see facing page.
BCCI
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32
Evolution of CymRSV defective interfering RNA
region (Fig. 1 a) in the evolution of CymRSV DI RNAs. The
DI-13 cDNA clone described above (Burgya! n et al., 1991) was
used for the mutational studies. Since the replication of
CymRSV DI-13 is supported by a related tombusvirus, TBSV
pepper isolate (TBSV-P) from Hungary, and the genomic RNA
sequence of TBSV-P is sufficiently different from CymRSV (Z.
Havelda, unpublished observation), this virus was chosen as
helper. Progeny molecules of DI-13 RNA could then be
distinguished from DI RNAs generated de novo from the helper
genome, or from recombinants between DI-13 and helper
TBSV-P RNAs. The preparation of a full-length cDNA clone
and infectious transcripts of TBSV-P will be described in a
future report (G. Szittya, personal communication).
The first series of experiments tested our suggestion that
naturally occurring DI-13 RNA is the precursor of smaller DI
RNAs generated de novo during the replication of CymRSV
(Burgya! n et al., 1991). Ten Nicotiana clevelandii plants were
inoculated simultaneously with in vitro transcripts of DI-13 and
TBSV-P genomic RNA. Preparation of infectious transcripts
and plant inoculation were as described by Dalmay et al. (1993,
1995). Northern blot analysis (Sambrook et al., 1989) of RNA
extracted from the non-inoculated leaves of these plants
showed that there was no detectable accumulation of DI RNA
species other than the input molecule (Fig. 1 b). This result
indicates that no smaller RNA(s) was formed or that it was not
sufficiently competitive with the input DI-13 RNA. However,
when a second series of plants were inoculated with the total
RNA extracts shown in Fig. 1 (b), accumulation of small de novo
DI RNAs, together with input DI-13 RNA, were observed in
nine out of ten infected plants (Fig. 1 c). The progeny molecules
of DI-13 RNA were RT-PCR-amplified, cloned into pUC18
(Dalmay et al., 1995) and sequenced. Three or four progeny
molecules were sequenced from each plant and the nucleotide
sequence of the small DI RNAs revealed that, except in one
case (plant number 7), each plant contained only one type of
deletion mutant. Moreover, they were all derived from the
input DI-13 RNA, but the highly structured central region of
block C was deleted with different portions of flanking
sequences (Fig. 1 a, d). These results indicate that the formation
and accumulation of the smaller DI RNAs above a detectable
level (by RT-PCR) requires at least one additional passage.
The recombination sites of the smaller DI RNAs were
distributed upstream and downstream of the highly structured
central region of block C (motif 1) (Fig. 1 a, d), suggesting that
the viral replicase bypassed this tract during synthesis of the
negative strand. Moreover, the smaller molecules generated
de novo must be highly competitive with their progenitor.
To test the competitiveness of the smaller DI RNAs, N.
clevelandii protoplasts and plants were co-infected (Dalmay et
al., 1993) with different molar ratios of DI-13 transcript and the
de novo-generated, smaller DI-2 RNA (Burgya! n et al., 1991).
The results (Fig. 2) show that the accumulation of DI-13 in
protoplasts was reduced, compared with its accumulation
when inoculated alone with the helper genome. The accumulation of the two DI RNAs was similar even when the
larger molecules were in a 10 : 1 molar excess (Fig. 2). These
results suggest that the smaller RNAs, once formed, are likely
to accumulate to detectable levels. Similar results were obtained
with whole plants (data not shown).
To analyse the role of the predicted secondary structure of
block C (Fig. 1 a) in the de novo generation of smaller DI
molecules, mutations were designed to modify the stability of
this structure. Four constructs were prepared enhancing the
stability of motif 1 by extending the base-paired region up to
18 (M1-18), 24 (M1-24), 27 (M1-27) or 33 nt (M1-33). Mutants
were prepared by site-directed mutagenesis (Kunkel et al.,
1987) using the following oligonucleotides : M1-18, GTTCGCGTGCAC------TCAGGTCGGGC (386–413) and CTATGCCTG----AGTCACGCGA---GCCACCACTA (505–540) ;
M1-24, CTATGCCTGACTCGTCATCACGCGAA--CCACCACTAT (505–541) ; M1-27, GTTACTCTTACATAGTGGTGGTTCGCGTG (366–394) ; M1-33, CTATGCCT G A C T C G TC A T C A C G C G A A --- C C A C C A C T A T
(505–541) and GTTACTCTTACATAGTGGTGGTTCGCGTG (366–394). Boldface letters indicate the substituted nucleotides and underlined bases represent insertions. Dashes show
the positions of deleted nucleotides. Numbers in parentheses indicate the positions of oligonucleotides according
Fig. 1. (a) Schematic representation of the CymRSV DI-13 RNA ‘ genome ’ and a secondary structure prediction for the last
403 nt (residues 277–679 ; boxed) at the 3« terminus. The structure was generated using the program MFOLD of the UWGCG.
Genomic RNA sequences conserved in DI RNAs are represented as blocks and deleted regions are depicted as lines. Total
numbers of conserved nucleotides are shown above the blocks. Total numbers of deleted bases are shown below the lines.
Boxes with dashed lines indicate the different regions of the predicted secondary structure. Numbered arrowheads indicate
pairwise recombination sites resulting in the smaller sized molecules derived from DI-13 RNA in each inoculated plant analysed
(see text) and refer directly to the lane numbers of the Northern blot shown in Fig. 1 (c). The b following the number 7
indicates that more than one type of recombinant molecule was found in this sample. (b, c) Northern blot analyses of RNAs
extracted from plants inoculated with DI-13 and TBSV-P RNA transcripts (b), or with total nucleic acid isolated from each plant
in blot b (c). The lanes correspond to individual plants. G, and sg1 and sg2 indicate the positions of helper genomic and
subgenomic RNAs, respectively. DI-13 indicates the position of both wild-type and mutant DI-13 RNAs. R indicates the smaller
sized recombinant RNAs. Hybridization was done using a 32P-labelled, nick-translated probe of a clone containing only the
central block B (blot b) of DI-2 RNA, or the whole DI RNA sequence (blot c). (d) Sequence alignments of wild-type DI-13 RNA
and its progeny molecules. The first row shows the wild-type DI-13 RNA sequence around structural motif 1. Numbers above
the sequence indicate the positions of nucleotides in the DI-13 RNA sequence. The nucleotide sequences of the de novogenerated progeny molecules are shown below the DI-13 sequence. Dashes indicate deleted nucleotides. Numbers in brackets
refer to plant RNA extracts shown in blot c and indicate the origin of the deletion mutant.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32
BCCJ
Z. Havelda, T. Dalmay and J. Burgya! n
Fig. 2. Accumulation of DI RNA progeny
in N. clevelandii protoplasts inoculated
with TBSV-P transcript RNA as a helper
genome. Approximately 106 protoplasts
were inoculated with DI-13 and DI-2
alone or together in different molar ratios,
as indicated above the lanes. G indicates
the position of TBSV-P genomic RNA.
to the original DI-13 sequence (Burgya! n et al., 1991). In
vitro transcripts from each mutant were used to infect ten N.
clevelandii plants in the presence of helper TBSV-P. Total RNA
was extracted from systemic, symptomatic leaves of each
inoculated plant. Northern blots of these RNA extracts and
sequence analysis of progeny molecules indicated that the
modifications made in M1-18 and M1-24 mutants marginally
increased the formation and accumulation of the smaller
molecules (Fig. 3 a, lanes 4 and 9 ; Fig. 3 b, lanes 1, 2 and 6). The
majority of the sequenced progeny of mutants M1-18 and M124 were the same as the input RNA. The recombination sites
of deletion mutants were found in the expected locations
(upstream and downstream of motif 1 ; Fig. 3 a, b) except one
progeny DI RNA (number 6 of M1-24), which still contained
the modified motif 1.
The mutant M1-27 contains motif 1 with an extension of
27 bp which is interrupted in two positions (Fig. 3 c). The result
of this modification was similar to the previous two mutants.
The accumulation of new deletion mutants was observed in
five infected plants (Fig. 3 c, lanes 4, 5, 7, 8 and 10) and had
recombination sites in similar locations to those DI RNAs
derived from M1-18 and M1-24. Among progeny molecules
of the mutant M1-27 we found a deletion mutant (number 5)
which was similar to number 6 of M1-24, suggesting that this
site may be a rare site of recombination. The presence of this
molecule also indicates that it is highly competitive once
formed.
Further extension of the base-paired region of motif 1 up to
33 nt dramatically enhanced the generation and accumulation
of deletion mutants. Total RNA extracted from each plant
inoculated with M1-33 and helper TBSV-P transcripts con-
BCDA
tained smaller DI RNAs derived from the M1-33 mutant (Fig.
3 d) and, in two cases, only the deletion mutants were
detectable (Fig. 3 d, lanes 6 and 10). The recombination sites
were located upstream and downstream of the 33-nt-long
base-paired stem suggesting that the replicase was frequently
unable to unwind the 33-nt-long base-paired structure and
bypass it. Without exception, the sequenced recombination
sites of the smaller recombinant DI RNAs were found close
to the predicted double-stranded tract. The distribution of
intramolecular recombination sites suggests that higher order
structure rather than a specific sequence motif is involved in
this mechanism, as demonstrated for turnip crinkle virus (TCV)
recombination (Simon & Bujarski, 1994 ; Carpenter et al., 1995).
To test whether sequence or structure was specifically
involved in these deletion events, 39 nt of foreign sequence
derived from potato virus Y, Hungarian strain (PVY-H ; Thole
et al., 1993) were inserted as an inverted head-to-head repeat
between the C1 and C2 blocks of DI-22 RNA (Dalmay et al.,
1995) to create the mutant designated DI-22Y78. The two
complementary sequences in this mutant can form a 37-nt-long
base-paired stem at exactly the same position as motif 1 of DI13 RNA (Fig. 1 a). This mutant was viable and accumulated in
the presence of helper genome, but sequence analysis of
progeny molecules revealed that the inserted, base-paired
structure was almost completely deleted and only a few
nucleotides (1–6) were retained from the inserted sequence
(not shown). However, if the original 39 nt (or a longer, up to
238 nt) foreign PVY-H sequence, without a predicted secondary structure, was inserted into the same position, these
mutants were stable and replicated to similar levels as wildtype DI-22 RNA (Dalmay et al., 1995).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32
Evolution of CymRSV defective interfering RNA
(a)
(b)
Fig. 3. For legend see p 1233.
This experiment further demonstrated that structure and
not a specific sequence was important in the evolution of
smaller DI RNAs from the larger progenitors. Analysis of the
sequence composition of progeny molecules derived from
either wild-type or mutant DI-13 RNAs showed that they
have a very similar primary structure, which suggests that
these molecules have a selective advantage during RNA
replication and that their accumulation is a result of their
competitiveness and not because they were specifically
generated by the presence of a highly base-paired region, as
suggested.
To resolve whether the accumulation of these progeny
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32
BCDB
Z. Havelda, T. Dalmay and J. Burgya! n
(c)
(d)
Fig. 3. For legend see facing page.
BCDC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32
Evolution of CymRSV defective interfering RNA
(e)
Fig. 3. Schematic representation of the predicted secondary structures and the accumulation of progeny of DI-13 RNA mutants.
Stars indicate the position of substituted nucleotides and " symbols indicate inserted nucleotides. ∆3, ∆4 and ∆6 indicate the
numbers and positions of deleted nucleotides. Arrowheads indicate the junction sites in the smaller sized molecules derived
from the different DI-13 RNA mutants. The numbers beside the arrowheads indicate the origin of the recombinant molecules
and refer directly to the lane numbers of the adjacent Northern blots. Numbers followed by b or c indicate that more than one
type of recombinant molecule was found in the same RNA sample. Northern blots were prepared from RNA extracted from
plants inoculated with wild-type (wt) or mutant DI-13 RNAs in the presence of TBSV-P RNA transcripts. G, and sg1 and sg2
indicate the positions of helper genomic and subgenomic RNAs, respectively. DI-13 indicates the position of both wild-type
(wt) and mutant DI-13 RNAs. R indicates the smaller sized recombinant RNAs and D indicates the dimeric form of this smaller
DI RNA (Dalmay et al., 1995). Hybridization was done with a 32P-labelled nick-translated probe of a clone containing only the
central block B (panels b, d) or the complete sequence of DI-2 RNA (panels a, c, e). Lanes correspond to individual plants.
molecules was due to the specific structure of their progenitor,
or to the competitiveness of the resultant progenies, another
mutant, M2-30, was constructed using the oligonucleotides 5«
GGATCTCGTGTCTGCTCGAAGTCTAACGAGAGATCTGTTGAGCTTG 3« (456–494) and 5« AGGTCTAACGAGATCTCGTTAGACTTCGAGCAGACACGAGATCCATGCC 3« (472–511). The modified nucleotides are indicated as
above. In this mutant, another region (Fig. 1 a, motif 2) of wildtype DI-13 molecule was modified. The internal loop and
bulges were eliminated from this region by site-directed
mutagenesis generating a 30-nt-long perfectly base-paired
structure (Fig. 3 e). These modifications did not affect the
replication of the molecule, but resulted in the accumulation of
smaller DI RNAs (derived from M2-30) in each inoculated
plant (Fig. 3 e). Sequence analysis of these smaller M2-30
derivatives clearly indicated that transposition of the strong
secondary structure to another region was followed by
transposition of the recombination sites (Fig. 3 e). Again, the
majority of recombination sites were found close to the basepaired region and distributed upstream and downstream of the
modified motif 2.
It is important to note that small, naturally formed DI
RNAs with a sequence composition similar to the DI RNAs
derived from M2-30 are rare (less than 5 % of natural CymRSV
DI RNAs sequenced so far ; J. Burgya! n, unpublished observation). However, once formed, they replicate efficiently
(e.g. progeny 6 and 5 derived from M1-24 and M1-27,
respectively ; Fig. 3 b, c).
These results provide evidence that the appearance of the
unusual DI RNAs derived from M2-30 are related to the
intramolecular secondary structure which dictates the deletion
mechanism, and not to a selection of replicating molecules.
Deletion junctions were perfectly matched in most of the
clones sequenced (not shown). This can be taken as an
indication that smaller DI RNAs are formed by ‘ continuous ’
transcription without any replicase error (addition or subtraction of bases), rather than by discontinuous transcription,
which is a characteristic of recombinant satellite RNAs of TCV
(Simon & Bujarski, 1994). A similar conclusion was drawn from
sequence analyses of progeny molecules derived from
CymRSV satellite-DI hybrids (Burgya! n et al., 1992).
More recently, a similar result was obtained with an
artificially constructed TBSV DI RNA mutant DI-82XP191(®) in which a 191-nt-long double-stranded tract could
form between two complementary sequences (White & Morris,
1995). However, this 191-nt-long base-paired stem was far
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32
BCDD
Z. Havelda, T. Dalmay and J. Burgya! n
from the natural structure of the tombusvirus genome and the
role of competitiveness in the accumulation of progeny
molecules was not analysed.
Our results agree with heteroduplex-mediated recombination, which was first described in BMV (Nagy & Bujarski,
1993) and suggest that a very similar intramolecular secondary
structure-dependent deletion mechanism also operates in
CymRSV. This deletion mechanism does not involve any
particular primary sequence, which is also a characteristic of the
heteroduplex-mediated recombination mechanism, but contrasts with the recombination mechanism described for TCV
(Cascone et al., 1993 ; Simon & Bujarski, 1994 ; Carpenter et al.,
1995). The minimum length of double-stranded RNA structure
which can promote efficient recombination in BMV was
estimated at between 20 and 30 nt (Nagy & Bujarski, 1993).
When the base-paired structures in CymRSV DI RNAs were
up to 30 or 32 nt long, deletions in progeny molecules were
very frequent in each inoculated plant. However, 18- and 24nt-long base-paired structures in mutants M1-18 and M1-24,
respectively, were not very efficient at promoting deletions.
Thus it can be concluded that BMV and CymRSV replicase
complexes have similar unwinding capacities, in spite of the
fact that the RNA polymerases in the family Tombusviridae do
not contain any identifiable helicase-like motifs (Koonin &
Dolja, 1993). It is unlikely, therefore, that the presumed lack of
helicase activity alone causes frequent DI RNA generation.
We thank Dr Yvonne Pinto for critical reading of this manuscript.
This research was supported by a grant from the Hungarian OTKA
(T020943). Z. H. was supported by the PhD education programme
headed by Professor Miha! ly Sajgo! of the Agricultural University of
Go$ do$ llo4 .
References
Burgya! n, J., Grieco, F. & Russo, M. (1989). A defective interfering RNA
molecule in cymbidium ringspot virus infections. Journal of General
Virology 70, 235–239.
Burgya! n, J., Rubino, L. & Russo, M. (1991). De novo generation of
cymbidium ringspot virus defective interfering RNA. Journal of General
Virology 72, 505–509.
Burgya! n, J., Dalmay, T., Rubino, L. & Russo, M. (1992). The replication
of cymbidium ringspot tombusvirus defective interfering-satellite RNA
hybrid molecules. Virology 190, 579–586.
Carpenter, C. D., Oh, J. W., Zhang, C. & Simon, A. E. (1995).
Involvement of a stem-loop structure in the location of junction sites in
viral RNA recombination. Journal of Molecular Biology 245, 608–622.
Cascone, P. J., Haydar, T. & Simon, A. E. (1993). Sequences and
BCDE
structures required for recombination between virus associated RNAs.
Science 290, 801–805.
Dalmay, T., Rubino, L., Burgya! n, J., Kolla! r, A. & Russo, M. (1993).
Functional analysis of cymbidium ringspot virus genome. Virology 194,
697–704.
Dalmay, T., Szittya, G. Y. & Burgya! n. J. (1995). Generation of defective
interfering RNA dimer of cymbidium ringspot tombusvirus. Virology
207, 510–517.
Finnen, R. L. & Rochon, D. M. (1993). Sequence and structure of
defective interfering RNAs associated with cucumber necrosis virus
infections. Journal of General Virology 74, 1715–1720.
Havelda, Z., Dalmay, T. & Burgya! n, J. (1995). Localization of cis-acting
sequences essential for cymbidium ringspot tombusvirus defective
interfering RNA replication. Journal of General Virology 76, 2311–2316.
Kolla! r, A. & Burgya! n, J. (1994). Evidence that ORF 1 and 2 are the only
virus encoded replicase genes of cymbidium ringspot tombusvirus.
Virology 201, 169–172.
Koonin, E. & Dolja, V. V. (1993). Evolution and taxonomy of positivestrand viruses : implications of comparative amino acid sequences. Critical
Reviews in Biochemistry and Molecular Biology 28, 375–430.
Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient
site-specific mutagenesis without phenotypic selection. Proceedings of the
National Academy of Sciences, USA 82, 488–492.
Nagy, P. D. & Bujarski, J. J. (1993). Targeting the site of RNA–RNA
recombination in brome mosaic virus with antisense sequences. Proceedings of the National Academy of Sciences, USA 90, 6390–6394.
Roux, L., Simon, A. E. & Holland, J. J. (1991). Effects of defective
interfering viruses on virus replication and pathogenesis in vitro and in
vivo. Advances in Virus Research 40, 181–211.
Russo, M., Burgya! n, J. & Martelli, G. P. (1994). The molecular biology
of Tombusviridae. Advances in Virus Research 44, 321–428.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : A
Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring
Harbor Laboratory.
Simon, A. E. & Bujarski, J. J. (1994). RNA–RNA recombination and
evolution in virus-infected plants. Annual Review of Phytopathology 32,
337–362.
Thole, V., Dalmay, T., Burgya! n, J. & Bala! zs, E. (1993). Cloning and
sequencing of potato virus Y (Hungarian isolate) genomic RNA. Gene
123, 149–156.
White, K. A. & Morris, T. J. (1994 a). Nonhomologous RNA recombination in tombusviruses : generation and evolution of defective
interfering RNAs by stepwise deletions. Journal of Virology 68, 14–24.
White, K. A. & Morris, T. J. (1994 b). Enhanced competitiveness of
tomato bushy stunt virus defective interfering RNAs by segment
duplications or nucleotide insertion. Journal of Virology 68, 6092–6096.
White, K. A. & Morris, T. J. (1995). RNA determinants of junction site
selection in RNA virus recombinants and defective interfering RNAs.
RNA 1, 1029–1040.
Received 2 October 1996 ; Accepted 14 January 1997
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:05:32