High Light-Dependent Phosphorylation of Photosystem II
Inner Antenna CP29 in Monocots Is STN7 Independent and
Enhances Nonphotochemical Quenching1
Nico Betterle, Matteo Ballottari, Sacha Baginsky, and Roberto Bassi*
Dipartimento di Biotecnologie, Università di Verona, 37134 Verona, Italy (N.B., M.B., R.B.); and Institute of
Biochemistry and Biotechnology, Martin Luther University Halle-Wittenberg, 06120 Halle (Saale), Germany (S.B.)
Phosphorylation of the photosystem II antenna protein CP29 has been reported to be induced by excess light and further enhanced
by low temperature, increasing resistance to these stressing factors. Moreover, high light-induced CP29 phosphorylation was
specifically found in monocots, both C3 and C4, which include the large majority of food crops. Recently, knockout collections have
become available in rice (Oryza sativa), a model organism for monocots. In this work, we have used reverse genetics coupled to
biochemical and physiological analysis to elucidate the molecular basis of high light-induced phosphorylation of CP29 and the
mechanisms by which it exerts a photoprotective effect. We found that kinases and phosphatases involved in CP29 phosphorylation
are distinct from those reported to act in State 1-State 2 transitions. In addition, we elucidated the photoprotective role of CP29
phosphorylation in reducing singlet oxygen production and enhancing excess energy dissipation. We thus established, in monocots,
a mechanistic connection between phosphorylation of CP29 and nonphotochemical quenching, two processes so far considered
independent from one another.
In eukaryotic photosynthesis, light-dependent reactions are performed by two supramolecular complexes,
PSII and PSI, which catalyze light harvesting and electron
transport from water to NADP+. To this aim, water is
oxidized by PSII, which, in turn, is oxidized by PSI, which
becomes a reductant for ferredoxin-NADP(1) oxidoreductase and NADP+ (Nelson and Ben-Shem, 2004). The
two photosystems are functionally connected by the plastoquinone (PQ) and cytochrome (cyt) b6/f, which catalyze
the building of the transthylakoid proton gradient, which is
dissipated by ATP synthase (ATPase) activity for ATP
synthesis from ADP and inorganic phosphate (Pi). PSII and
PSI have clearly distinct absorption spectra, with PSI-lightharvesting complex I (LHCI) complexes being enriched in
red-shifted absorption forms (Gobets and van Grondelle,
2001). Within canopies, this leads to differential excitation
depending on available light quality. This effect needs to be
compensated to avoid imbalance of electron transport
rates, yielding into either photoinhibition or decrease of
photon use efficiency. Two major regulatory mechanisms
counteract these effects. (1) State 1-State 2 transitions are
active in limiting light conditions (Rintamäki et al., 2000)
and inhibited by reduction of a disulfide bridge in high
1
This work was supported by the Italian Ministry of Agriculture
(BioMassVal, grant no. 2/01/140), the Marie Curie Actions Initial
Training Networks ACCLIPHOT (PITN–GA–2012–316427), the Land
Sachsen-Anhalt (grant no. W21004490), and a Valeria and Vincenzo
Landi 2014 grant issued by the Accademia dei Lincei.
* Address correspondence to [email protected].
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is:
Roberto Bassi ([email protected]).
www.plantphysiol.org/cgi/doi/10.1104/pp.114.252379
light (HL; Lemeille et al., 2009). This mechanism is activated by overreduction of PQ to plastoquinol (PQH2)
through activation of a thylakoid bound kinase, STN7,
acting on LHCII (Depège et al., 2003; Bellafiore et al.,
2005). This causes a fraction of PSII antenna system,
mainly Lhcb2 (Leoni et al., 2013), to be transferred to PSI
in stroma-exposed membranes. The consequent increase
in PSI antenna size (Galka et al., 2012) bursts the electron
transfer rate and reequilibrates PQ/PQH2 redox poise,
thus causing feedback inactivation of kinase activity. A
phosphatase, PPH1-TAP38 (Pribil et al., 2010; Shapiguzov
et al., 2010), dephosphorylates LHCII, allowing for its
return to PSII in grana partitions. (2) The process of nonphotochemical quenching (NPQ) is rather aimed to photoprotection from excess light (Horton and Ruban, 2005;
de Bianchi et al., 2010). In this condition, saturation of
downstream metabolic reactions causes depletion of ADP
and Pi and inhibition of ATPase activity, which normally
brings back protons from lumen to the stromal compartment. This causes accumulation of protons in the lumen,
triggering dissipation into heat of the energy absorbed in
excess by PSII (de Bianchi et al., 2010; Niyogi and Truong,
2013). Thus, the synergic, although independent, activities of State-1-State 2 transitions and NPQ cover the needs
for regulation of photosynthesis over the wide dynamic
range of light intensity experienced by plants when shaded
or by daily light changes. However, a number of experimental results do not fit within this scheme: phosphorylation of PSII antenna proteins, namely CP29 (LHCB4) has
been reported to be induced in very HL and further enhanced by low temperature (Bergantino et al., 1995), implying inhibition of LHC protein phosphorylation by HL is
not a general feature of plant photosynthesis. Moreover,
CP29 phosphorylation has been shown to be protective in
Plant PhysiologyÒ, February 2015, Vol. 167, pp. 457–471, www.plantphysiol.org Ó 2014 American Society of Plant Biologists. All Rights Reserved.
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
457
Betterle et al.
condition of HL combined with low temperature (Mauro
et al., 1997), a major stressing factor limiting crop productivity. HL-induced CP29 phosphorylation has been
specifically found in monocots, either C3 or C4 (Bergantino
et al., 1998), which include the large majority of food
crops, thus making the study of this process of interest
for both basic and applied research. In dicots, CP29
phosphorylation has been detected at very low level
(Fristedt and Vener, 2011) and targeted to different sites
within the N-terminal domain with respect to monocots
(Testi et al., 1996). Although early research focused on
biochemical and physiological characterization of CP29
phosphorylation (Croce et al., 1996; Mauro et al., 1997;
Hwang et al., 2003), genetic dissection of this regulation
process has been hampered by lack of genetic resources.
More recently, rice (Oryza sativa) has become a model
organism for monocots, and knockout collections have
become available. In this study, we have used reverse
genetics coupled to biochemical and physiological analysis to elucidate the molecular basis of HL-induced
phosphorylation of CP29 and the mechanisms by which
it exerts a photoprotective effect. We found that a different set of kinases and phosphatases is involved in
CP29 reversible phosphorylation with respect to that
reported to act in State 1-State 2 transitions and that the
photoprotection effect is mediated by an enhancement
of excess energy dissipation. These results establish, for
the first time, a mechanistic connection between thylakoid protein phosphorylation and NPQ, so far believed
to be independent processes.
RESULTS
Kinetics of CP29 Phosphorylation and Recovery
Rice leaves from plants grown in a greenhouse for
8 weeks and incubated in the dark for 6 h were exposed to white light of 1,000 mmol photons m–2 s–1 for
different periods. After 15- or 30-min of illumination,
leaves were further incubated in the dark. Samples
were harvested at different times and cooled in ice
water slurry, and chloroplasts were isolated. SDSPAGE analysis of thylakoid proteins, followed by
immunoblots with anti-CP29 antibody, detected two
bands with apparent molecular mass of 30 and 34 kD
(Fig. 1A). At t = 0, only the faster migrating band was
detected. Upon light exposure, a slow migrating
band appeared and accumulated with time, while the
intensity of the fast-migrating band decreased. Densitometric analysis showed that the 34-kD band was accumulated to 30% and 40% upon 15 and 30 min of light
Figure 1. CP29 phosphorylation kinetic in rice. A, Immunoblot of rice-isolated chloroplasts assayed with anti-CP29 polyclonal
antibody. Before chloroplast isolation, leaves have been treated with HL (1,000 mmol photons m–2 s–1) for different time lengths
(Tx indicates minutes of illumination after 6-h dark adaptation) and then dark incubated (Rx indicates minutes of dark incubation upon HL treatment). Tris-Gly SDS-PAGE 15% plus Urea 3M; 1 mg of total chlorophyll (Chl) per lane. B, Densitometrical
analysis of immunoblot in A, determining the amount of P-CP29 with respect to the total amount of CP29 (totCP29). Average
values have been obtained considering two independent biological replicates. C, Alkaline phosphatase (AlkPh) treatment on
rice-isolated monomeric antenna complexes (obtained according to Betterle et al., 2009) from HL-treated samples. P-CP29
dephosphorylation has been evaluated as in A. One-quarter microgram of Chl per lane.
458
Plant Physiol. Vol. 167, 2015
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
CP29 Phosphorylation Enhances NPQ in Rice
exposure, respectively (Fig. 1B). Upon dark recovery, the
relative amplitude of the 34-kD band decreased by 7% to
8% in the first 15 min, after which the decay was slower.
Alkaline phosphatase-treated thylakoids only showed
the 30-kD band (Fig. 1C), implying that the change in
mobility of CP29 was due to phosphorylation, as previously shown in corn (Zea mays) and barley (Hordeum
vulgare; Bergantino et al., 1998). These results show that
rice CP29 was rapidly phosphorylated in HL and slowly
dephosphorylated in the dark.
Identification of the CP29 Phosphorylation Site
Previous work with the monocot corn (Testi et al.,
1996) showed HL-dependent phosphorylation of CP29
occurring at Thr-83 of the mature protein, a conserved
site in many plant species (Chen et al., 2013). Different
phosphorylation sites were reported for Arabidopsis
(Arabidopsis thaliana) CP29 (AtCP29; Fristedt and Vener,
2011). To verify whether rice CP29 (OsCP29) was phosphorylated in corn- or Arabidopsis-like site(s) upon HL
treatment, we analyzed the two CP29-reactive polypeptides by mass spectrometry (MS) analysis for the detection of phosphopeptides. To this aim, thylakoids from
dark-adapted and HL-treated wild-type rice leaves were
solubilized by n-Dodecyl b-D-maltoside and fractionated
by Suc gradient ultracentrifugation (Supplemental
Fig. S1A). The Suc bands 2 (B2) containing monomeric
LHCB subunits, including CP29, was further fractionated by SDS-PAGE, and the presence of Phosphorylated
CP29 (P-CP29) was verified by western blot (Supplemental
Fig. S1B). Densitometry of the Coomassie Blue-stained
gel yielded consistent results with western-blot analysis,
implying that the antibody had similar reactivity for
the phosphorylated and unphosphorylated forms of
the polypeptide (Supplemental Fig. S2). The SDS-PAGE
bands corresponding to CP29 (from both dark-adapted
and HL-treated samples) and P-CP29 were excised and
analyzed by liquid chromatography-MS analysis in triplicate. No phosphorylated fragments were detected from
the 30-kD band (CP29), while a phosphorylated Thr
residue was detected in a fragment from the 34-kD band
(Supplemental Table S1). This phosphorylated site, Thr-82
in the sequence of the mature protein, was the same site
previously identified on corn P-CP29 as Thr-83. Any
other HL-related phosphorylated residues were not detected in rice P-CP29 from fractions isolated from the wild
type. In low and HL, we found no evidence of phosphorylation at Thr-112 or Thr-114, which were previously
identified as phosphorylation sites in the dicot Arabidopsis (Hansson and Vener, 2003), or the Thr-33 and
Ser-103 residues identified as phosphorylation sites in
Chlamydomonas reinhardtii (Lemeille et al., 2009). These
results, together with the recovery of the 30-kD apparent
molecular mass upon alkaline phosphatase treatment
(Fig. 1C), imply that OsCP29 is phosphorylated into Thr82 upon HL treatment only. Also, this posttranslational
modification was responsible for the change in mobility of
CP29 in SDS-PAGE gels and was the same modification
occurring in corn (Testi et al., 1996). Moreover, we show
that quantitative assessment of phosphorylated versus
unphosphorylated forms of a specific protein, often difficult, becomes accessible in the case of CP29 because a single
phosphorylation event causes change of SDS-PAGE mobility, thus allowing quantitative detection of phosphorylation based on Coomassie Blue stain or immunoblotting.
Roles of STN7 Kinase and PPH1 Phosphatase in CP29
Phosphorylation and Dephosphorylation
Previous work with Arabidopsis and C. reinhardtii
showed that the LHC antenna proteins of PSII are phosphorylated by the STN7 kinase and dephosphorylated by
the PPH1 phosphatase during State 1-State 2 transitions
and that these gene products control the physiological
changes associated, including the far-red light-induced
changes of room temperature fluorescence, changes in
77-K emission spectra, and binding of LHCII to the PSILHCI complex (Depège et al., 2003; Bellafiore et al., 2005;
Pribil et al., 2010; Shapiguzov et al., 2010).
To investigate the possible involvement of STN7 kinase
and PPH1 phosphatase in rice CP29 phosphorylation, we
identified a mutant of rice lacking STN7 from Oryza Tag
Line (Centre de Coopération Internationale en Recherche
Agronomique pour le Développement [CIRAD]; rice ssp.
japonica ‘Nipponbare,’ no. AJTH05) by screening the
seeds by western blot using anti-STN7 antibody. In Figure
2A, we compared selected stn7 mutant with the wild type
by immunoblotting analysis at different dilution: The signal
for STN7 protein was detectable in the wild type but not in
the mutant lanes even upon 20-fold dilution, suggesting
that the level of STN7 kinase in the stn7 mutant was at
least 20 times lower than in the wild type. The insertion
site in this stn7 mutant was within an intronic region
(OryGenesDB rice mutant database, http://orygenesdb.
cirad.fr/; LOC_Os05g47560; Supplemental Fig. S3). We
then proceeded to assess whether there was any level
of leakiness in this genotype by analyzing the transcription of STN7 gene (Fig. 2B). It is shown that no
Stn7 mRNA could be amplified in the mutant, while it
was evident in the wild type. The phenotype of the stn7
mutant (Fig. 2C) was also characterized by a stable fluorescence level upon removal of far-red light. When
compared to the contrasting behavior of the wild type,
undergoing a fast fluorescence decline in the same conditions, this result strongly supports the mutant phenotype corresponded to the original stn7 mutant (Bellafiore
et al., 2005). In addition, stn7 mutant exhibited a higher
stationary fluorescence, implying plastoquinone pool
was overreduced with respect to the wild type, likely due
to a decreased excitation of PSI compared with the wild
type. A knockout PPH1 (TAP38) mutant was obtained
from Rice Mutant Database (rice ssp. japonica ‘Zhonghua
15,’ no. 04Z11OK94). In the absence of an antibody able
to recognize rice PPH1 protein, we screened lines by
pulse amplitude-modulated fluorometry (Fig. 3A). Mutant plants were characterized by a faster fluorescence
decrease upon exposure to blue light with respect to the
Plant Physiol. Vol. 167, 2015
459
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Betterle et al.
wild type (Fig. 3A) and by a stable level of fluorescence
upon removal of far-red light, implying that State 1-State 2
transitions, once induced by blue light, did not relax
within the time of the measurement. Even in the case of
pph1 mutant, the insertion site was mapped in an intronic
sequence (Supplemental Fig. S3; http://orygenesdb.cirad.
fr/; Loc_Os01g37130), and the analysis of the transcription of the gene, however, revealed the mutant level of the
mRNA below detection (Fig. 3B).
The relation between the fluorescence phenotype
and the phosphorylation pattern in the two mutants
was assessed by using antiphospho-Thr antibodies to
detect changes in polypeptide phosphorylation pattern
upon treatments with light conditions either favoring
PQ reduction or oxidation and HL (stn7, Fig. 2D; pph1,
Fig. 3C).
In dark-adapted wild-type leaves, P-LHCII could not
be detected, while a clear signal appeared upon treatment
with PSII light. An excess light treatment (1,000 mmol
photons m–2 s–1) made P-LHCII signal disappear again
(Fig. 2D). In addition to P-LHCII signal, two more P-Thr
reactive bands were detected in all samples with mobility
corresponding to CP43 and D1/D2 proteins. While the
level of P-CP43 was high in all conditions, the P-D1/D2
signal was lower in the dark-adapted samples and highest
in those treated with PSII light and excess light. Consistent
with the role of STN7 and PPH1 gene products assessed
in Arabidopsis, the stn7 mutant lacked P-LHCII signal in
all conditions (Fig. 2D), while the pph1 mutant had constitutive levels of P-LHCII (Fig. 3C).
The above results show that stn7 mutation was effective in preventing the onset of State 1-State 2 transitions of LHCII phosphorylation, while pph1 mutation
prevented the State 2-State 1 reversion, implying no
redundancy of their respective enzymatic activities
occurred in rice as previously reported in Arabidopsis.
On this basis, we proceeded to assess the effect of these
Figure 2. Isolation and characterization of rice stn7 mutant. A, Immunoblot analysis using anti-STN7 antibody (aSTN7). Thylakoids have
been isolated from wild-type (WT) and stn7 rice plants and then
loaded on Tris-Tricine SDS-PAGE 10%. Wild-type 100% and stn7 100%
correspond to 2 mg of Chl. An immunoblot analysis using anti-LHCII
antibody aLHCII has been performed as an internal control. B, Reverse
transcription (RT)-PCR measurement of gene-specific transcripts. Sequences of the oligonucleotides used are reported in “Materials and
Methods.” The expected sizes of the PCR products are as follows: Stn7,
866 bp; and bactin, 707 bp. M indicates molecular mass marker (1-kb
Plus Ladder, Thermo Scientific). C, Analysis of state transition in stn7 mutant. Chlorophyll fluorescence emission was measured upon treatment with
blue light and blue light supplemented with far-red (FR) light, which induce
transition to State 2 and State 1, respectively. a.u., Arbitrary unit. D, Analysis
of thylakoid phosphoproteins using anti P-Thr (Cell Signaling) antibody.
Rice wild-type and stn7 mutant leaves were either dark adapted (D) or
treated with HL (1,500 mmol photons m–2 s–1, 30 min) or PSII-specific light
(PSII; 100 mmol photons m–2 s–1, 1 h, orange filter), and then thylakoids
have been collected (Suorsa et al., 2004). Tris-Gly SDS-PAGE 15% plus
Urea 3M; 0.75 mg of Chl per lane. E, Evaluation of rice stn7 mutant
capacity to phosphorylate CP29 upon HL induction (1,500 mmol
photons m–2 s–1, 30 min). Wild-type and stn7 rice leaves were illuminated, and then thylakoids have been collected and loaded on SDSPAGE. Immunoblot analysis as in Figure 1A. One microgram of Chl per
lane.
460
Plant Physiol. Vol. 167, 2015
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
CP29 Phosphorylation Enhances NPQ in Rice
two mutations in CP29 phosphorylation. Figures 2E
and 3D show the results of anti-CP29 immunoblotting
of thylakoids from wild-type, stn7, and pph1 rice plants
incubated in the dark, treated with excess light, or further
recovered in the dark for 30 min. The three genotypes
showed the same behavior as for the CP29 immunoreactive band pattern, implying that STN7 and PPH1 were
not involved in CP29 phosphorylation in HL and recovery in the dark. Because the effect of stn7 and pph1
mutations had a complete control over LHCII phosphorylation and de-phosphorylation (Figs. 2D and 3C), this
implies that these two phosphorylation/dephosphorylation
events are controlled by distinct kinase/phosphatase
systems.
An in Vitro Assay for LHCB4 Phosphorylation
To gain additional information of the mechanisms controlling CP29 phosphorylation, we verified the possibility
of reproducing phosphorylation in vitro. To this aim, we
isolated fully active chloroplasts from dark-adapted wildtype rice leaves that were incubated in the dark or exposed
to HL (1,000 mmol m–2 s–1) for 30 min with or without
the addition of ATP. Aliquots were then submitted to
SDS-PAGE and immunoblotting for detection of CP29
versus P-CP29 (Fig. 4A). Dark and HL-ATP samples
only showed the unphosphorylated CP29 band, while
HL plus ATP conditions led to the appearance of the
34-kD band corresponding to P-CP29. Similar results
could be obtained in HL in presence of ADP plus Pi
rather than ATP (Fig. 4B). The level of P-CP29 obtained
was similar among functional chloroplasts and thylakoids, suggesting the kinase responsible for this reaction was associated with the thylakoid membranes.
We then utilized the in vitro assay for performing a
pharmacological analysis of CP29 phosphorylation on
isolated chloroplasts. We first proceeded to verify the
effect of controlling the redox state of the PQ pool and
cyt b6/f complex. To this aim, chloroplasts isolated
from dark-adapted rice leaves were illuminated (1,000
mmol m–2 s–1, 30 min) in the presence of 50 mM 3-(3,4dichlorophenyl)-1,1-dimethylurea (DCMU; Fig. 5A),
leading to a strong reduction of P-CP29 accumulation.
Also, the addition of 50 mM 2,5-dibromo-6-isopropyl-3methyl-1,4-benzoquinone (DBMIB) yielded a strong reduction of P-CP29 level, which became undetectable
Figure 3. Isolation and characterization of rice pph1/tap38 mutant.
A, Analysis of state transition in pph1 mutant. Chlorophyll fluorescence
emission was measured upon treatment with blue light and blue light
supplemented with far-red (FR) light, which induce transition to State 2
and State 1, respectively. a.u., Arbitrary unit. B. RT-PCR measurement
of gene-specific transcripts. Sequences of the oligonucleotides used
are reported in “Materials and Methods.” The expected sizes of the
PCR products are as follows: Pph1, 803 bp, and bactin, 707 bp.
M indicates molecular mass marker (1-kb Plus Ladder, Thermo Scientific).
C, Analysis of thylakoid phosphoproteins using anti P-Thr (Cell Signaling) antibody. Rice wild-type (WT) and pph1 mutant leaves were
either dark adapted (D) or treated with PSII-specific light (PSII;
50 mmol photons m–2 s–1, 1 h, orange filter) or PSII-specific light followed by far-red illumination (PSI; 30 min), and then thylakoids have
been collected (Suorsa et al., 2004). Tris-Gly SDS-PAGE 15% plus
Urea 3M; 0.75 mg of Chl per lane. D, Evaluation of rice pph1 mutant
capacity to dephosphorylate P-CP29 upon dark incubation. Wild-type
and pph1 rice leaves, before thylakoid isolation, were illuminated
(1,000 mmol photons m–2 s–1, 30 min) and then dark incubated for
P-CP29 dephosphorylation (30 min) and loaded on SDS-PAGE. Immunoblot analysis as in Figure 1A. One microgram of Chl per lane.
Plant Physiol. Vol. 167, 2015
461
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Betterle et al.
control sample, treated with HL but without inhibitor
(Fig. 5B). Differently, in the presence of k252a, no P-CP29
was detected, irrespective from light conditions, implying
this alkaloid is a strong inhibitor of the CP29 kinase in
agreement with previous results (Chen et al., 2009). We
used 25 mM for U0126, 100 mM W7, and 20 mM K252a (Chen
et al., 2009). The inhibitory concentration value for CP29
phosphorylation in rice chloroplast (chlorophyll concentration of 40 mg mL–1) by k252a was determined at 2 mM
(Supplemental Fig. S4). It is interesting to note that in the
presence of k252a, P-CP29 level is even lower than in darkadapted thylakoids, implying that, upon blocking of the
CP29 kinase, a phosphatase specific for CP29 can proceed.
It is also interesting to note that k252a strongly reduces the
intensity of the two high molecular mass bands in the
immunoblotting with antiphospho-Thr (Supplemental
Fig. S5), suggesting this is also an inhibitor of the kinase
(s) involved in PSII core complex phosphorylation.
PSII Photoprotection and P-CP29
The availability of an inhibitor for P-CP29 accumulation allows for experimental verification of the physiologic effect of this phosphorylation event. Previously, a
photoprotective effect was suggested based on the differential behavior of near-isogenic lines (Bergantino et al.,
1995). To this aim, we exposed isolated chloroplasts at
Figure 4. In vitro assay for CP29 phosphorylation. A, In vitro phosphorylation of CP29 in isolated functional chloroplasts (Casazza et al.,
2001) illuminated with white light of 1,000 mmol photons m–2 s–1 for
30 min and in the presence of exogenous ATP. Immunoblot analysis as
in Figure 1A. One microgram of Chl per lane. B, Determination of
CP29 kinase localization by inducing CP29 phosphorylation in isolated functional chloroplasts or thylakoids, illuminated with white light
of 1,000 mmol photons m–2 s–1 for 30 min in the presence of exogenous ADP and P+. Immunoblot analysis has been performed using antiCP29 and anti-Rubisco antibody. One microgram of Chl per lane.
when increasing the inhibitor concentration to 200 or
500 mM. Because DCMU and DBMIB respectively decrease and increase the redox state of PQH2, these results
indicate that the CP29 kinase is activated by the reduction PQH2 and/or cyt b6/f.
The study of P-CP29 function requires a system for
selective inhibition of CP29 phosphorylation or the
availability of a mutant lacking the CP29 kinase, so far
not identified. Alternatively, selective prevention of
P-CP29 accumulation could be obtained by the use of
kinase inhibitors (Chen et al., 2009) that could be tested
in the in vitro phosphorylation assay, thus avoiding the
problems of permeability often encountered in vivo. As
described by Chen et al. (2009), we tested different kinase
inhibitors: U0126, an inhibitor of Mitogen-activated protein kinase (MAPK), W7, an inhibitor of Ca2+-dependent
protein kinase, and k252a, an alkaloid kinase inhibitor
derived from the fungus Nocardiopsis spp. (Ruegg et al.,
1989). When rice chloroplasts from dark-adapted leaves
were treated with HL in the presence of U0126 and W7
inhibitors, we obtained the same P-CP29 level as in the
Figure 5. Pharmacological analysis of CP29 kinase activation. A, In vitro
redox regulation of CP29 phosphorylation by DCMU and DBMIB and
chemicals controlling plastoquinone reduction state (Casazza et al., 2001).
Functional chloroplasts were illuminated for 30 min with white light of
1,000 mmol photons m–2 s–1 in the presence of these redox regulators
and then loaded on SDS-PAGE. Immunoblot analysis as in Figure 1A.
Three-quarter microgram of Chl per lane. D, Dark-adapted samples.
B, Effect of kinase inhibitors on CP29 phosphorylation in isolated chloroplasts. Inhibitors used were W7 (CDPK inhibitors), U0126 (MAPK inhibitor), and k252a (Ser/Thr kinase inhibitor; Chen et al., 2009). Functional
chloroplasts were illuminated for 30 min with white light of 1,000
mmol photons m–2 s–1 in the presence of these chemicals and then
loaded on SDS-PAGE. Immunoblot analysis as in Figure 1A. Threequarter micrograms of Chl per lane. WT, Wild type.
462
Plant Physiol. Vol. 167, 2015
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
CP29 Phosphorylation Enhances NPQ in Rice
1,000 mmol m–2 s–1 in the presence of and without k252a
assessing photoinhibition by measuring the maximum
photochemical efficiency of PSII in the dark-adapted state
(Fv/Fm). As reported in Figure 6A, the inhibitor caused a
faster decrease of Fv/Fm during HL treatment, supporting
the idea of a photoprotective activity for P-CP29. Photoinhibition is induced by ROS accumulation (Havaux et al.,
2007; Dall’Osto et al., 2010): we measured the production
of singlet oxygen during illumination of isolated chloroplasts by using a fluorescent probe (Flors et al., 2006;
Dall’Osto et al., 2007; Betterle et al., 2010) and observed
that the presence of k252a led to an increased production
of 1O2 (Fig. 6B). NPQ dissipates light energy absorbed in
excess, thus decreasing the production of 1O2 while CP29
was shown to have a major role in NPQ (de Bianchi et al.,
2011) by activating zeaxanthin radical cation (Holt et al.,
2005; Ahn et al., 2008). To verify the hypothesis that accumulation of P-CP29 was correlated to an increased
NPQ activity, we measured NPQ in isolated chloroplasts
in the presence or absence (control [CTR]) of k252a inhibitor (Fig. 7A). The chloroplast preparation obtained
from rice showed a PSII quantum yield of 0.795 6 0.05.
NPQ measured in CTR was reproducible, yielding
values of 1.15 6 0.04 with an energy quenching (qE)
component of 0.65 6 0.03, as measured after 10-min
recovery in the dark. Maximum NPQ amplitude was
only slightly lower in presence of k252a (1.06 6 0.04),
while a strong effect was observed on dark relaxation
kinetics, twice as faster in k252a-treated samples compared with CTR. Thus, the presence of P-CP29 could be
associated with an increased inhibitory quenching (qI).
Because the difference in NPQ activity increased with
time during light exposure, we repeated the 15-min actinic light treatment three times with 10-min dark intervals in between. Upon three cycles of exposure to actinic
light, CTR chloroplasts reached an NPQ value of 2.0
compared with an NPQ value of 1.25 in k252a-treated
samples (Fig. 7C), implying that CP29 phosphorylation
led to a 60% increase in NPQ activity, due to both an
increase of qI and qE. It should be noticed that the increase of qI cannot be ascribed to photoinhibition because Fv/Fm was higher in CTR with respect to the k252a
sample (Fig. 7D). It is interesting to note that the comparison between the inhibition of CP29 phosphorylation and the reduction in NPQ and qI yielded k252a
concentration-dependent curves with a similar behavior
(Supplemental Fig. S4).
Is LHCII/PSII Core Phosphorylation or Zeaxanthin
Accumulation Involved in Quenching Reactions?
Figure 6. Effect of CP29 kinase inhibitor on photoprotection of intact
chloroplasts. A, Fv/Fm in functional rice wild-type (WT) chloroplasts
during illumination with white light of 1,000 mmol photons m–2 s–1.
These chloroplasts have been treated in the presence or absence of
Ser/Thr inhibitor k252a, and two independent batches of them have
been analyzed. Ctr, Control samples. B, Singlet oxygen production in
functional chloroplasts in the presence or absence of Ser/Thr inhibitor
k252a. Functional chloroplasts have been treated with red light of
1,500 mmol photons m–2 s–1, and singlet oxygen production has been
measured at different time points using the fluorescent probe Singlet
Oxygen Sensor Green (SOSG; Betterle et al., 2010). a.u., Arbitrary unit.
In rice, thylakoid protein phosphorylation involves
not only CP29 but also LHCII and PSII core. To dissect
the effect of these different phosphorylation events, we
first considered the case of LHCII. In principle, the
light intensity used in our experiments was well above
the inhibition level for STN7 kinase (Rintamäki et al.,
2000; Lemeille et al., 2009), suggesting P-LHCII should
not be involved. NPQ measurements with Os-stn7
mutant showed no difference with respect to the wild
type, irrespective from whether the measurement was
performed in isolated chloroplasts or in vivo (Fig. 7, A
and B). This was consistent with Figure 3C showing no
P-LHCII signal in HL-treated wild-type samples.
The case of PSII core phosphorylation was more
difficult to tackle because, as reported in Supplemental
Figure S5, k252a significantly decreased phosphorylation
of PSII core subunits, in addition to preventing P-CP29,
potentially leading to a (still unknown) quenching effect.
To verify whether this was the case, we studied the k252a
effect on Arabidopsis, a species where CP29 is not phosphorylated or to a very low level under the control of
Plant Physiol. Vol. 167, 2015
463
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Betterle et al.
Figure 7. Effect of the CP29 kinase inhibitor k252a on NPQ activity of chloroplasts from wild-type (WT) and stn7 rice genotypes. A, Measurements of NPQ kinetics on rice chloroplasts in the presence or absence of Ser/Thr inhibitor k252a. Chloroplasts
have been isolated from wild-type and stn7 rice dark-adapted leaves and then illuminated with actinic white light of 1,000
mmol photons m–2 s–1 at 23˚C. Symbols and error bars show means 6 SD (n = 4). Ctr, Control samples. B, Measurements of NPQ
kinetics on wild-type and stn7 rice leaves illuminated with actinic white light of 1,000 mmol photons m–2 s–1 at 23˚C. Symbols
and error bars show means 6 SD (n = 4). C, NPQ kinetics of wild-type and stn7 rice chloroplasts during three consecutive
periods of illumination with white light (1,000 mmol photons m–2 s–1, 15 min, 23˚C) with a 10-min period of darkness in
between, as indicated by the yellow and black bars. Chloroplasts have been treated in the presence or absence of Ser/Thr
inhibitor k252a. Symbols and error bars show means 6 SD (n = 4). D, Fv/Fm in functional chloroplasts before (Fv /Fm) and after
(Fv’/Fm’) the treatment with actinic light 1,000 mmol m–2 s–1 for 1.5 h.
STN7 kinase (Bergantino et al., 1998; Bellafiore et al.,
2005; Tikkanen et al., 2006; Wunder et al., 2013) and for
which knockout mutants are available for both Stn7 and
Stn8 genes encoding kinases involved in LHCII and
PSII core phosphorylation, respectively (Bellafiore et al.,
2005; Bonardi et al., 2005). Supplemental Figure S6
shows the NPQ kinetics during three consecutive actinic
light exposures (1,000 mmol m–2 s–1) separated by dark
recovery, as for rice in Figure 7C. The kinetics of NPQ
rise and recovery were identical for chloroplasts from
wild-type, stn7, and stn8 plants, and the addition of
k252a did not produce any change in quenching activity
in any of these genotypes, none of which is active in
CP29 phosphorylation. It was important to verify that
k252a was effective in blocking STN7 and STN8 kinases
in Arabidopsis (Supplemental Fig. S7), leading to a reduction of CP43, D1, D2, and LHCII phosphorylation
level in HL-treated functional chloroplasts alike in rice
samples shown in Supplemental Figure S5. The results
in Supplemental Figure S7 show that HL treatment led
to an increased level of CP43 and D1/D2 phosphorylations, which were instead prevented in the presence of
k252a to a larger extent with time of treatment. Another
PSII core subunit well known to be phosphorylated, PSII
reaction center protein H (PsbH; Aro et al., 2004) was
not resolved in our gel system due to its low Mr (approximately 10 kD). These results are consistent with the
differences in quenching activities of CTR versus k252atreated rice (Fig. 7) being caused by differences in CP29
phosphorylation only, without contribution by phosphorylation of PSII core subunits.
We finally considered the hypothesis that differences
in accumulation of zeaxanthin could be involved in HLdependent NPQ enhancement. An enhancing effect of
464
Plant Physiol. Vol. 167, 2015
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
CP29 Phosphorylation Enhances NPQ in Rice
zeaxanthin on quenching reactions has been reported
(Niyogi et al., 1998; Dall’Osto et al., 2005; Nilkens et al.,
2010; Ruban and Johnson, 2010), thus opening the
possibility that k252a-dependent differences in zeaxanthin accumulation during HL might cause at least part
of the differences in quenching reported in Figure 7A
for rice. To verify this hypothesis, we measured both
P-CP29 accumulation and zeaxanthin accumulation
in control and k252-treated rice chloroplasts during
15-min HL treatment and subsequent dark relaxation
(Supplemental Figs. S5 and S8). We observed that a
low level of P-CP29 was present in the dark (percentage P-CP29 per total CP29), which then increased in
HL. The level of P-CP29 in k252a-treated sample, instead, decreased in the light and remained low over
the subsequent dark treatment, suggesting that the
CP29 kinase was active in the dark in the presence of
added ATP, while its inhibition allowed for phosphatase activity to proceed. Zeaxanthin accumulation was
the same in CTR and in the presence of k252a, implying the difference in zeaxanthin accumulation was
not the reason for differential quenching in rice chloroplasts (Supplemental Fig. S8).
Localization of P-CP29 in Thylakoid Domains
Previous work in C. reinhardtii has shown that CP29
phosphorylation leads to its migration from grana
membranes, where it participates to PSII supercomplexes and stroma membranes to become part of a
PSI-LHCI-LHCII-CP29 supercomplex (Kargul et al.,
2005; Drop et al., 2014). In rice, dissociation of PSII
supercomplexes with migration of P-CP29 to stromaexposed membranes was also reported (Liu et al., 2009;
Chen et al., 2013). To verify whether phosphorylation
changed the localization of CP29 in the rice photosynthetic apparatus, we isolated thylakoid membranes
from rice plants either dark adapted or exposed to HL
(1,000 mmol m–2 s–1, 30 min). These thylakoids were
then fractionated into grana membranes and stroma
lamellae by detergent treatment and differential centrifugation (Barbato et al., 2000; Sirpiö et al., 2007;
Figure 8. Localization of P-CP29 in thylakoid membranes. A, Fractionation of
thylakoid membranes for the isolation
of grana and stroma lamellae membranes
(see “Materials and Methods”). Thylakoids (Thyl) have been collected from
dark-adapted and HL-treated rice leaves
(white light, 1,000 mmol photons m–2 s–1,
30 min). These fractions have been loaded
on Tris-Gly SDS-PAGE for Coomassie Blue
gel staining or immunoblot analysis using
anti-CP29 antibody. PsaA, PSI-A core
protein of PSI. B, PSII supercomplex fractionation from grana membranes according to Caffarri et al. (2009). Thylakoids
have been collected from dark-adapted
and HL-treated rice leaves (white light,
1,000 mmol photons m–2 s–1, 30 min).
C, Thylakoids, grana membranes, PSIIC2S2, and monomeric antenna fractions
have been loaded on Tris-Gly SDSPAGE for Coomassie Blue gel staining or
immunoblot analysis using anti-CP29
antibody.
Plant Physiol. Vol. 167, 2015
465
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Betterle et al.
Morosinotto et al., 2010) and analyzed by SDS-PAGE
and immunoblotting (Fig. 8A). Figure 8A shows the
Coomassie Blue-stained SDS-PAGE gel loaded with the
thylakoid, grana, and stroma lamellae preparations: a
small portion of PSI contaminants is present in grana
membranes, although a strong enrichment of PSII and
PSI/ATPase in, respectively, grana membranes and
stroma lamellae is evident. P-CP29 was detected in
whole thylakoids and the grana fraction with P-CP29
per total CP29 ratio of 30% in both fractions. Instead, no
P-CP29 could be detected in the stroma membrane
fraction. Pigment analysis showed that the chlorophyll
a/b ratio of thylakoids, grana membranes, and stroma
lamellae was, respectively, 3.25 6 0.03, 2.35 6 0.05, and
6.70 6 0.1, irrespective of whether the samples derived
from dark-adapted or HL-treated plants. Also, the Chl
amount recovered in the fraction from the two conditions was equal. With the aim of verifying whether
CP29 phosphorylation did affect association of CP29
with PSII core, we solubilized the grana membrane obtained above with n-Dodecyl a-D-maltoside and fractionated the pigment-binding complexes by Suc gradient
ultracentrifugation (Caffarri et al., 2009). This procedure
yielded a free carotenoid upper band (B1) and three green
bands containing, respectively, monomeric Lhcb proteins
(B2), trimeric LHCII (B3), and the CP29-CP24 (LHCII)3
supercomplex (B4; Fig. 8B). Higher apparent molecular
mass bands contained PSII core (B5) and PSII-LHCII
supercomplexes of different size (Caffarri et al., 2009).
Clearly, the abundance of larger PSII supercomplexes (B9
and B10/B11) was lower in HL-treated samples. When
bands were harvested and analyzed by SDS-PAGE and
immunoblotting, P-CP29 was found to be enriched in the
fraction B2, while its level in the B9 supercomplex was
low: 7.3% versus 45% observed in grana membranes (Fig.
8C). These results show that while P-CP29 remained in
grana membranes, its phosphorylation caused dissociation
of large supercomplexes into complexes with smaller size.
DISCUSSION AND CONCLUSION
P-CP29 has been previously reported in several
species from green algae to monocots. In the case of
C. reinhardtii, CP29 phosphorylation is dependent on
State Transition7 Kinase (STT7) kinase and has been
reported to be involved in state transitions (Kargul et al.,
2005; Allorent et al., 2013). In Arabidopsis, a dicot,
P-CP29 is weakly detectable upon treatment with PSII
light, and its phosphorylation is under the control of
STN7 kinase, homologous to STT7 (Tikkanen et al.,
2006; Fristedt and Vener, 2011). Within monocots, CP29
phosphorylation has been reported in rice (C3; Hwang
et al., 2003), barley (Bergantino et al., 1998), and corn
(C4; Mauro et al., 1997; Bergantino et al., 1998), and yet in
these species, no association was established with State 1State 2 transitions. Rather, a photoprotective effect was
reported against cold stress (Bergantino et al., 1995) and,
more recently, to other environmental stresses, such as
water and salt stresses in monocots (Chen et al., 2009; Liu
et al., 2009). Also, an effect in modulating the size of PSII-
LHCII supercomplexes was suggested (Chen et al., 2009;
Fristedt and Vener, 2011).
In this study, we investigated whether the HL-induced
reversible phosphorylation of CP29 in monocots is catalyzed by the same set of enzymes that were previously
found to be active in the major PSII antenna LHCII.
Moreover, we assessed the nature of the photoprotective
activity consequent to CP29 phosphorylation.
CP29 Kinase and Phosphatase Activities
Isolation of rice insertional mutants inactivating stn7
and pph1 genes was instrumental in assessing the dependence of CP29 phosphorylation on the activity of
LHCII kinase and phosphatase involved in State 1-State 2
transitions. stn7 and pph1 mutations were effective in
preventing LHCII phosphorylation and dephosphorylation in rice (Figs. 2D and 3C) as well as fluorescence
changes associated with this process (Figs. 2C and 3A), in
agreement with previous reports in the dicot Arabidopsis
(Bellafiore et al., 2005; Pribil et al., 2010; Shapiguzov et al.,
2010). However, these mutations were ineffective in
preventing the accumulation of P-CP29 or its dephosphorylation in the dark (Figs. 2E and 3D).
We conclude that neither STN7 nor PPH1 are involved in reversible CP29 phosphorylation in rice. This
is likely the case with corn and barley, as suggested by
the similar behavior of P-CP29 in these species in being
promoted by excess light conditions and enhanced by
concomitant stress conditions rather than inhibited at
relatively low irradiance (Rintamäki et al., 1997). These
results imply that, in addition to regular State 1-State 2
transitions active in green algae (Allorent et al., 2013) and
dicots (Bellafiore et al., 2005), an additional phosphorylationdependent regulation mechanism evolved in monocots
for response to excess light conditions. Thus, reversible
phosphorylation of the two subunits of PSII antenna
system, LHCII and CP29, are independent in rice, at
variance with the case of Arabidopsis, where STN7
activity was responsible for both LHCII phosphorylation and the low level of CP29 phosphorylation found
(Tikkanen et al., 2006; Fristedt and Vener, 2011). In
C. reinhardtii, CP29 was strongly phosphorylated (Kargul
et al., 2005; Allorent et al., 2013) and yet was found to be
STT7 dependent. Thus, the lack of STT7/STN7 involvement in monocot CP29 phosphorylation is consistent
with the different conditions activating this process:
STN7 activity is up-regulated by a reduced plastoquinone pool (Zito et al., 1999; Tikkanen et al., 2011) induced by PSII light or unbalanced excitation of PSII and
PSI. However, STN7 activity is also inhibited by reduced ferrodoxin/thioredoxin (Vainonen et al., 2005;
Lemeille et al., 2009), leading to the inhibition of LHCII
phosphorylation in HL (Fig. 2D). We show that CP29
kinase is associated with thylakoid membranes (Fig. 4B)
and is activated upon reduction of cyt b6/f (Fig. 5A),
similar to STN7 kinase in Arabidopsis (Wunder et al.,
2013). Although sharing with STN7 the activation by reduced PQ, CP29 kinase is not inactivated by HL, which is
required for CP29 phosphorylation. This strongly suggests
466
Plant Physiol. Vol. 167, 2015
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
CP29 Phosphorylation Enhances NPQ in Rice
involvement of a kinase different from STN7, consistent
with the results by Pursiheimo et al. (2003; Fig. 2E). The
alignment of STN7 kinase sequences from Arabidopsis
and rice (Supplemental Fig. S9) showed high level of
conservation. The one CP29 sequence from rice and the
three CP29 isoforms (LHCB4) from Arabidopsis are
reported in Supplemental Figure S9: apart from some
differences at the chloroplast transit peptide domains, the
four sequences were highly conserved, with the exception
of the C terminus for LHCB4.3, which was significantly
shorter. Supplemental Table S1 shows that the phosphorylation site in rice P-CP29 was at Thr-82 in the mature
protein: this residue is conserved in Arabidopsis LHCB4.1
and LHCB4.2 but not in LHCB4.3, suggesting that the
different phosphorylation behavior of CP29 in rice and
Arabidopsis depends on the kinase rather than to differences in the substrate sequence. At present, the identity of
CP29 kinase is still unknown. One candidate is STN8. This
hypothesis is supported by the report that STN8 activity is
not inhibited by HL (Bonardi et al., 2005; Vainonen et al.,
2005) and is the only Ser/Thr kinase enzyme associated
with thylakoid in corn through MS analysis, in addition to
STN7 (Friso et al., 2010). Moreover, the highest P-CP29
accumulation level was reported in cold and HL
(Bergantino et al., 1995), a condition known to induce
overreduction of electron transport chain due to a decreased demand for reducing equivalent by the CalvinBenson cycle (Savitch et al., 2011). The alignment of
STN8 protein of Arabidopsis and rice (Supplemental Fig.
S9) shows that the rice homolog has a significant longer N
terminus compared with the Arabidopsis one, consistent
with a different substrate binding activity. Although we
could not have access to a monocot stn8 mutant, the STN8
hypothesis is supported by the results of the pharmacological analysis using intact isolated chloroplasts. This approach was attempted before (Bergantino et al., 1995; Chen
et al., 2009) using drug delivery by leaf infiltration, yielding results of difficult interpretation likely due to problems
with diffusion of the chemicals in the leaf tissue to the
target site. We found the isolated chloroplast method
much more reliable, and among the three kinase inhibitors
assayed in this work, only one, namely k252a (an alkaloid
kinase inhibitor), was effective in preventing CP29 phosphorylation in HL (Fig. 5B), in agreement with previous
results (Chen et al., 2009). K252a also caused a decreased
CP43 phosphorylation level (Supplemental Fig. S5), suggesting the two reactions were caused by the same kinase,
while phosphorylation of PSII core subunits has been
shown to be catalyzed by STN8 (Bonardi et al., 2005; Nath
et al., 2013). Interestingly, k252a treatment shows that the
effect of CP29 phosphatase was complete when CP29 kinase has been inactivated. The level of P-CP29 decreased
upon direct (by k252a; Fig. 5B) or indirect (see DCMU and
DBMIB; Fig. 5A) kinase inactivation during HL treatment
with respect to the starting level in dark samples.
Physiological Effect of CP29 Phosphorylation
Previous work with near-isogenic lines in corn reported
an increased resistance to photoinhibitory treatment in the
presence of P-CP29 (Mauro et al., 1997). Moreover, dissociation of PSII supercomplexes and migration of CP29
from grana to stroma-exposed membranes has been
reported (Liu et al., 2009), which might potentially increase PSI activity and alleviate PQ overreduction, similar
to previous reports with Chlamydomonas spp. (Kargul
et al., 2005; Drop et al., 2014). Our results with rice are in
contrast with these latter reports and strongly indicate
that CP29 does not migrate to stroma lamellae upon
phosphorylation but remains in the grana partitions. Although we cannot offer a clear explanation for the discrepancy of our results with respect to those reported (Liu
et al., 2009), we notice that properties of fractions putatively deriving from grana partitions, grana margins, and
stroma lamellae in Liu et al. (2009) only exhibit small
differences in the content of D1 and LHCII, which is unexpected in the light of the extreme lateral heterogeneity
of thylakoid membranes (Anderson et al., 2012), possibly
as a consequence of the drought stress applied in that
study. In our hands, extreme lateral separation was
obtained for PSII plus LHCII versus PSI plus ATPase,
respectively, in grana versus stroma lamellae (Fig. 8A).
CP29 signal in stromal fraction was very low and did
not increase upon HL treatment, irrespective from its
phosphorylation state (Fig. 8A). Further analysis of grana
membranes showed that PSII-LHCII supercomplexes
were maintained (Fig. 8B, bands B6–B9), even in presence of P-CP29 in HL-treated samples, with the exception of the larger complexes (Fig. 8B, bands B10/B11),
which are composed by C2S2M and C2S2M2 PSII dimers,
as previously reported (Caffarri et al., 2009). These results imply that while P-CP29 caused dissociation of
largest supercomplexes into complexes with smaller size,
it remained in grana membranes. This suggests that
whatever the physiological effect of P-CP29, it is exerted
within grana domains and within the inner layer of the
PSII antenna system close to the PSII core. It is worth
noting that upon HL treatment, a phosphorylation of
PSII core subunits was also observed, as reported in
Supplemental Figure S5, thus we cannot exclude that
CP43, D1/D2, and/or PsbH phosphorylation might also
have a role in PSII destabilization upon HL as, previously reported for Arabidopsis (Tikkanen et al., 2008).
Figure 1 shows that P-CP29 accumulation is a very
rapid process upon exposure to excess light. In these
conditions, NPQ is also activated, allowing for fast heat
dissipation of the excess energy absorbed (Li et al., 2000;
Külheim et al., 2002; Horton et al., 2008). A relation between NPQ and CP29 phosphorylation has been previously suggested (Mauro et al., 1997). Here, we exploited
the k252a inhibitor for studying the relation between
accumulation of P-CP29 and NPQ in fully functional
isolated chloroplasts exposed to excess light. A clear
effect was detected on NPQ rise kinetic and relaxation
kinetic in the dark (Fig. 7, A and B). Dark-adapted,
P-CP29-depleted chloroplast underwent a small NPQ
increase and a strong delay in its relaxation. Due to the
slow dephosphorylation kinetic (Fig. 1), repeated light
exposures led to progressively increasing NPQ amplitude (Fig. 7C). Thus, these NPQ kinetic changes in both
Plant Physiol. Vol. 167, 2015
467
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Betterle et al.
the rise and decay were abolished by k252a and were
absent in the Arabidopsis wild type as well as in stn7
and stn8 mutants (Supplemental Fig. S6), where CP29
did not accumulate. Because k252a did not affect the
synthesis of zeaxanthin (Supplemental Fig. S8), an NPQ
enhancer (Niyogi et al., 1998), we conclude that P-CP29
had an enhanced quenching capacity versus CP29 and
that this process is physiologically active in monocots,
but not in the dicot Arabidopsis plants. The photoprotective effect of the additional NPQ induced in P-CP29 is
evident from the slower rate of NPQ dark relaxation of
both the wild type and stn7 rice mutants (Fig. 7A) and by
the decreased rate of singlet oxygen produced (Fig. 6B).
The use of the Arabidopsis wild type and stn7 and stn8
mutants as controls for the treatment with k252a inhibitor
allowed us to correlate NPQ and photoprotection phenotypes with the phosphorylation of CP29 in rice. Exposure of Arabidopsis chloroplasts to k252a did not induce
any significant NPQ variation. We cannot exclude that in
monocots, phosphorylation of CP29 and PSII core subunits cooperatively yields the increased photoprotection
phenotype observed, and a deeper investigation of PSII
core phosphorylation is required. However, the comparison of the Arabidopsis wild type and stn7/stn8 mutants
and the rice wild type treated or untreated with k252a
inhibitors strongly suggests a peculiar role of P-CP29 in
photoprotection.
The Mechanism of Quenching in P-CP29
Enhanced quenching in the presence of P-CP29 is
consistent with the decrease in amplitude and slower
NPQ kinetic in plants lacking CP29 (de Bianchi et al.,
2011) and with the rate-limiting activity of CP29 in
transferring excitation energy from outer antenna to
PSII core complex (Caffarri et al., 2011). It is interesting
to consider the consequences of CP29 phosphorylation:
MS analysis showed that mature rice CP29 is phosphorylated at the Thr-82 residue (Supplemental Table
S1), located at the N terminus, exposed to the stromal
surface of thylakoids. This position is homologous
to Thr-83, previously reported for ZmCP29. No other
phosphorylated residues were detected in OsCP29, implying that the changes in conformation previously detected (Testi et al., 1996) are specially associated with this
phosphorylation event. CP29 spectral properties are also
modulated by zeaxanthin binding (Croce et al., 1996;
Crimi et al., 2001). Previous work on the isolated P-CP29
demonstrated that phosphorylation does not induce the
protein to undergo a dissipative state in detergent solution (Crimi et al., 2001): on the basis of this result, we
propose that phosphorylation-dependent conformational
change of CP29 in monocots affects the overall PSII
supercomplexes conformation, as evidenced by the partial disassembly of PSII-LHCII supercomplexes in smaller
complexes (Fig. 8C), leading to formation of quenched
states in a zeaxanthin-like long-living mechanism. In this
context, we cannot exclude that protein-protein interaction in PSII-LHCII supercomplexes leads to formation
of some specific quenching sites in P-CP29, which are
inactivated when the protein is extracted by detergent
treatment. For example, previous work in thylakoid
membranes purified from Arabidopsis showed the
formation of carotenoid radical cations responsible for
energy dissipation upon NPQ induction in a high
fraction (33%) of monomeric proteins (Holt et al., 2005):
upon investigation of isolated proteins, the yield of carotenoid radical cation formation dramatically decreased
to less than 1% (Avenson et al., 2008). A similar protein
environment-dependent activation of quenching sites in
P-CP29 cannot be excluded.
Among monomeric LHCB proteins, CP26 and CP24
showed the highest rates of zeaxanthin binding upon
exposure to HL (Betterle et al., 2010), while CP29 has
lower binding rates (Morosinotto et al., 2002). We propose
that monocots developed an additional response to fast
and repeated exposure to excess light by pretriggering the
energy-dissipative activity through a change of conformation in CP29, caused by N-terminal phosphorylation.
This mechanism adds to the zeaxanthin-dependent NPQ
mechanisms, which have its preferential target in CP26
(Dall’Osto et al., 2005) and CP24 (Betterle et al., 2010)
and is likely to be more efficient than violaxanthin-tozeaxanthin exchange in conditions of low temperature
when the rate of the lipid diffusion step required for
violaxanthin deepoxidation and binding to the L2 site of
Lhc proteins is decreased. Also, zeaxanthin formation requires ascorbate, a reducing cofactor, which is also involved in a number of redox reactions and might become
limiting due to its use in concomitant pathways such as
the water-water cycle (Asada, 1999). In the cold, ATP
level is strongly increased by reduced requirement by the
Calvin-Benson cycle, a condition favoring kinase activity.
MATERIALS AND METHODS
Plant Materials and Growth Condition
Rice (Oryza sativa) lacking STN7 was obtained from Oryza Tag Line
(CIRAD; rice japonica ‘Nipponbare,’ no. AJTH05; Larmande et al., 2008),
whereas rice lacking PPH1/TAP38 was obtained from the Rice Mutant
Database (rice japonica ‘Zhonghua 15,’ no. 04Z11OK94; Zhang et al., 2006).
Plants were grown in a greenhouse at 28°C/35°C with natural light during
warmer seasons or artificial light (400 mmol photons m–2 s–1) during late autumn and winter (14-h-day/10-h-night photoperiod).
RT-PCR Analysis
For RT-PCR, total RNA was isolated from 10-week-old plants with the Spectrum
Plant Total RNA Kit (Sigma-Aldrich). RT was performed using M-MLV reverse
transcriptase with oligo(dT) primer and 1 mg of total RNA and was followed by 37
cycles of PCR amplification. In parallel, amplification of the housekeeping gene
bactin transcript with primers collected from the literature (Bi et al., 2011) has been
performed from the same complementary DNAs as the loading control. The
primers used for Stn7 (LOC_Os05g47560) and Pph1 (Loc_Os01g37130) genes were
as follows: STN7 (forward) AACGGACAGCAGCCTCATAC; STN7 (reverse)
TGTGCCATGGGTTTCTTGTA; PPH1 (forward) CTTGTTGTCTCGCACATTGG;
and PPH1 (reverse) AATATCTTGGCCAGCAGGAG.
Pigment Analysis
Pigments were extracted and then separated and quantified by HPLC as
previously described (Gilmore and Yamamoto, 1991).
468
Plant Physiol. Vol. 167, 2015
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
CP29 Phosphorylation Enhances NPQ in Rice
Membrane Isolation
In Vivo Fluorescence and NPQ Measurements
Functional chloroplasts/thylakoids were isolated as previously described
(Casazza et al., 2001). Experiments with functional chloroplasts/thylakoids
were performed at a chlorophyll concentration of 40 mg mL–1 in the presence of 10 mM methylviologen, 0.5 mM ATP, and 15 mM Na-ascorbate. To
investigate the mechanism of CP29 phosphorylation, functional chloroplasts were treated with U0126 (MAPK inhibitor, Sigma-Aldrich), W7
(Calcium-Dependent Protein Kinases inhibitor, Sigma-Aldrich), and K252a
(Ser/Thr protein kinases inhibitor, LC Laboratories), using the same concentrations previously indicated for in vivo experiments by Chen et al.
(2009).
Grana membranes have been prepared according to Morosinotto et al.
(2010), and stroma lamellae have been prepared according to Sirpiö et al.,
2007) and Barbato et al. (2000). PSII supercomplexes have been prepared from
grana membranes according to Caffarri et al. (2009). Sodium fluoride (10 mM)
was added to all the buffers used for preparation of grana membranes, stroma
lamellae, and PSII supercomplexes.
State transition experiments were performed on leaves according to established protocols (Jensen et al., 2000). Preferential PSII excitation was provided by
illumination with blue light (40 mmol photons m–2 s–1), and excitation of PSI was
achieved using far-red light from a light-emitting diode light source (HeinzWalz, 102-FR) applied for 15 min simultaneously with blue light.
NPQ was measured through chlorophyll fluorescence on whole leaves or
functional chloroplasts at room temperature with a PAM 101 fluorimeter
(Heinz-Walz; Andersson et al., 2001), a saturating light pulse of 4,500 mmol
photons m–2 s–1 for 0.8 s, and white actinic light of 1,000 mmol photons m–2 s–1 supplied by a KL1500 halogen lamp (Schott). For NPQ measurements, intact
chloroplasts were dissolved immediately before analysis in an optimized
hypotonic buffer containing 100 mM sorbitol, 5 mM MgCl2, 10 mM NaCl, 20 mM
KCl, 30 mM HEPES, and 0.03% (w/v) agarose (40 mg mL–1 chloroplasts final
chlorophylls concentration, supplemented with cofactors as previously discussed below). NPQ was calculated according to the following equations
(Baker, 2008): NPQ = (Fm/Fm9)/Fm9, where Fm/Fm9 is the maximal fluorescence
from dark-adapted/light-adapted leaves measured after the application of a
saturating flash. For NPQ measurements on functional chloroplasts, final
0.05% (w/v) agarose was added to avoid chloroplasts sedimentation. NPQ
kinetics during three consecutive periods of illumination were measured using
Fluorcam FC-800 (PSI) fluorescence imaging system (PSI), allowing contemporary analysis of multiple samples and preventing chloroplasts deterioration
during such long analyses.
For measurements of the PSII photoinhibition, functional chloroplasts were
illuminated with white light of 1,000 mmol photons m–2 s–1, and then Fv/Fm
ratios were subsequently followed at irradiances of 20 mmol photons m–2 s–1 at
48°C (Aro et al., 1994), using Fluorcam FC-800 fluorescence imaging system.
Gel Electrophoresis and Immunoblotting
SDS-PAGE analysis was performed with the Tris-Gly buffer system
(Laemmli, 1970) and 15% (w/v) acrylamide concentration, with the addition
of 3 M urea to the running gel to separate phosphorylated and unphosphorylated CP29 polypeptides.
For western-blot analysis, chloroplast or thylakoid samples were loaded on
SDS-PAGE and electroblotted on nitrocellulose membranes, and proteins
were detected with homemade anti-CP29 (Bergantino et al., 1995), anti-STN7
(Lemeille et al., 2009), or anti-Rubisco serum, using alkaline phosphataseconjugated secondary antibody (Sigma-Aldrich). For detection of phosphoproteins, antiphospho-Thr polyclonal antibody (Cell Signaling) was used.
Signal amplitude was quantified using GelPro version 3.2 software (BioRad).
Phosphopeptide Detection
For MS analysis, rice thylakoids have been isolated upon dark adaption or
HL treatment (1,000 mmol m–2 s–1 white light for 30 min), and then monomeric antenna complexes, containing CP29, have been isolated upon thylakoid
solubilization with n-Dodecyl b-D-maltoside and Suc gradient centrifugation
(Betterle et al., 2009). Polypeptides have been separated through Tris-Gly SDSPAGE, bands of interest, corresponding to CP29 and P-CP29, were cut from
the gel, and proteins were digested with trypsin. Peptides were separated on
an Acquity UPLC System (Waters) equipped with a 200-mm 3 180-mm fused
silica trap column packed with 5 mm of Symmetry C18 material (Waters) as
well as a 200-mm 3 75-mm fused silica separation column packed with 1.8
mm of BEH130 C18 material (Waters). After injection, peptides were trapped
for 5 min at 1% B (A, 0.1% [v/v] trifluoroacetic acid in water; B, 0.1% [v/v]
formic acid in acetonitrile) and subsequently separated at a flow rate of
300 nL min–1 with a linear gradient developed from 3% to 35% B (A, 0.1%
[v/v] formic acid in water; B, 0.1% [v/v] formic acid in acetonitrile) within
120 min. Nanoliquid chromatography-high definition MS coupled with ion
mobility separation data were acquired in three technical replicates. Eluted
peptides were ionized at 2.1 kV and 80°C in a Waters nanoelectrospray
ionization source using a precut PicoTip Emitter with the cone voltage set to
40 V. Intact peptide mass spectra and fragmentation spectra were acquired
on a SYNAPT G2-S mass spectrometer (Waters) in resolution mode with
positive ionization. Glu-1-fibrinopeptide B (250 fmol mL–1 and 0.5 mL min–1)
was used as lock mass (mass-to-charge ratio = 785.8426 and ion = 12), and
mass correction was applied to the spectra during data processing. Data
analysis was carried out with ProteinLynx Global Server (PLGS 2.5.3,
Apex3D algorithm version 2.128.5.0, 64 bit, Waters) with automated determination of chromatographic peak width as well as MS-time-of-flight resolution. Low and high energy thresholds were set to 200 and 20 counts,
respectively. Elution start time was 5 min, and intensity threshold was set to
750 counts. In databank searches, peptide and fragment tolerances were set
to automatic. We set carbamidomethyl on Cys as fixed and oxidation on Met
and phosphorylation on Ser, Thr, and Tyr as variable modifications. MSE
data were searched against the rice database (ftp://ftp.plantbiology.msu.
edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs/) containing
common contaminants such as keratin (ftp://ftp.thegpm.org/fasta/cRAP/
crap.fasta).
Singlet Oxygen Production
Singlet oxygen production in isolated functional chloroplasts was measured
using Singlet Oxygen Sensor Green dye (Flors et al., 2006), as described
(Betterle et al., 2010), illuminating the samples with red light of 1,500 mmol
photons m–2 s–1.
Sequence data from this article can be found in the GenBank/EMBL data
libraries under accession numbers AtSTN7 (AT1G68830), AtSTN8 (AT5G01920),
AtLHCB4.1 (AT5G01530), AtLHCB4.2 (AT3G08940), and AtLHCB4.3 (AT2G40100).
Supplemental Data
The following supplemental materials are available.
Supplemental Figure S1. Identification of the HL-dependent phosphorylated residues of P-CP29.
Supplemental Figure S2. Analysis of anti-CP29 antibody sensitivity compared with Coomassie Blue gel staining.
Supplemental Figure S3. Transfer DNA insertion mutagenesis sites in stn7
and pph1 mutants.
Supplemental Figure S4. Inhibition of CP29 phosphorylation and NPQ
components upon treatment with different concentrations of kinase inhibitor k252a.
Supplemental Figure S5. Analysis of rice thylakoid phosphoproteins upon
NPQ induction in HL.
Supplemental Figure S6. NPQ kinetics of wild-type, stn7, and stn8 Arabidopsis chloroplasts during three consecutive periods of illumination.
Supplemental Figure S7. Analysis of Arabidopsis thylakoid phosphoproteins upon NPQ induction.
Supplemental Figure S8. Time course of CP29 phosphorylation and zeaxanthin production in the presence or absence of inhibitor k252a.
Supplemental Figure S9. Sequence comparison of STN7, STN8, and CP29
(LHCB4) of Arabidopsis and rice.
Supplemental Table S1. Identification of the phosphorylation site in
LOC_Os07g37240.1.
Plant Physiol. Vol. 167, 2015
469
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
Betterle et al.
ACKNOWLEDGMENTS
We thank Drs. Paolo Pesaresi and Michela Osnato for helpful information
on rice growth procedures, Luca Dall’Osto for help with NPQ measurements
on isolated chloroplasts, Dr. Alessandro Alboresi for helpful suggestions during mutant isolation, and Dr. Stefan Helm for MS analysis.
Received October 22, 2014; accepted December 8, 2014; published December
10, 2014.
LITERATURE CITED
Ahn TK, Avenson TJ, Ballottari M, Cheng YC, Niyogi KK, Bassi R,
Fleming GR (2008) Architecture of a charge-transfer state regulating
light harvesting in a plant antenna protein. Science 320: 794–797
Allorent G, Tokutsu R, Roach T, Peers G, Cardol P, Girard-Bascou J,
Seigneurin-Berny D, Petroutsos D, Kuntz M, Breyton C, et al (2013) A
dual strategy to cope with high light in Chlamydomonas reinhardtii. Plant
Cell 25: 545–557
Anderson JM, Horton P, Kim EH, Chow WS (2012) Towards elucidation of
dynamic structural changes of plant thylakoid architecture. Philos Trans
R Soc Lond B Biol Sci 367: 3515–3524
Andersson J, Walters RG, Horton P, Jansson S (2001) Antisense inhibition
of the photosynthetic antenna proteins CP29 and CP26: implications for
the mechanism of protective energy dissipation. Plant Cell 13: 1193–1204
Aro E, Mccaffery S, Anderson JM (1994) Recovery from photoinhibition in
peas (Pisum sativum L.) acclimated to varying growth irradiances. Plant
Physiol 104: 1033–1041
Aro EM, Rokka A, Vener AV (2004) Determination of phosphoproteins in
higher plant thylakoids. Methods Mol Biol 274: 271–285
Asada K (1999) The water-water cycle in chloroplasts: scavenging of active
oxygens and dissipation of excess photons. Annu Rev Plant Physiol
Plant Mol Biol 50: 601–639
Avenson TJ, Ahn TK, Zigmantas D, Niyogi KK, Li Z, Ballottari M, Bassi
R, Fleming GR (2008) Zeaxanthin radical cation formation in minor
light-harvesting complexes of higher plant antenna. J Biol Chem 283:
3550–3558
Baker NR (2008) Chlorophyll fluorescence: a probe of photosynthesis in
vivo. Annu Rev Plant Biol 59: 89–113
Barbato R, Bergo E, Szabò I, Dalla Vecchia F, Giacometti GM (2000)
Ultraviolet B exposure of whole leaves of barley affects structure and
functional organization of photosystem II. J Biol Chem 275: 10976–
10982
Bellafiore S, Barneche F, Peltier G, Rochaix JD (2005) State transitions and
light adaptation require chloroplast thylakoid protein kinase STN7.
Nature 433: 892–895
Bergantino E, Dainese P, Cerovic Z, Sechi S, Bassi R (1995) A posttranslational modification of the photosystem II subunit CP29 protects
maize from cold stress. J Biol Chem 270: 8474–8481
Bergantino E, Sandonà D, Cugini D, Bassi R (1998) The photosystem II
subunit CP29 can be phosphorylated in both C3 and C4 plants as suggested by sequence analysis. Plant Mol Biol 36: 11–22
Betterle N, Ballottari M, Hienerwadel R, Dall’Osto L, Bassi R (2010)
Dynamics of zeaxanthin binding to the photosystem II monomeric antenna protein Lhcb6 (CP24) and modulation of its photoprotection
properties. Arch Biochem Biophys 504: 67–77
Betterle N, Ballottari M, Zorzan S, de Bianchi S, Cazzaniga S, Dall’osto L,
Morosinotto T, Bassi R (2009) Light-induced dissociation of an antenna
hetero-oligomer is needed for non-photochemical quenching induction.
J Biol Chem 284: 15255–15266
Bi FC, Zhang QF, Liu Z, Fang C, Li J, Su JB, Greenberg JT, Wang HB,
Yao N (2011) A conserved cysteine motif is critical for rice ceramide
kinase activity and function. PLoS ONE 6: e18079
Bonardi V, Pesaresi P, Becker T, Schleiff E, Wagner R, Pfannschmidt T,
Jahns P, Leister D (2005) Photosystem II core phosphorylation and
photosynthetic acclimation require two different protein kinases. Nature
437: 1179–1182
Caffarri S, Broess K, Croce R, van Amerongen H (2011) Excitation energy
transfer and trapping in higher plant photosystem II complexes with
different antenna sizes. Biophys J 100: 2094–2103
Caffarri S, Kouril R, Kereïche S, Boekema EJ, Croce R (2009) Functional
architecture of higher plant photosystem II supercomplexes. EMBO J 28:
3052–3063
Casazza AP, Tarantino D, Soave C (2001) Preparation and functional
characterization of thylakoids from Arabidopsis thaliana. Photosynth Res
68: 175–80
Chen YE, Yuan S, Du JB, Xu MY, Zhang ZW, Lin HH (2009) Phosphorylation of photosynthetic antenna protein CP29 and photosystem II
structure changes in monocotyledonous plants under environmental
stresses. Biochemistry 48: 9757–9763
Chen YE, Zhao ZY, Zhang HY, Zeng XY, Yuan S (2013) The significance of
CP29 reversible phosphorylation in thylakoids of higher plants under
environmental stresses. J Exp Bot 64: 1167–1178
Crimi M, Dorra D, Bösinger CS, Giuffra E, Holzwarth AR, Bassi R (2001)
Time-resolved fluorescence analysis of the recombinant photosystem II
antenna complex CP29. Effects of zeaxanthin, pH and phosphorylation.
Eur J Biochem 268: 260–267
Croce R, Breton J, Bassi R (1996) Conformational changes induced by
phosphorylation in the CP29 subunit of photosystem II. Biochemistry 35:
11142–11148
Dall’Osto L, Caffarri S, Bassi R (2005) A mechanism of nonphotochemical
energy dissipation, independent from PsbS, revealed by a conformational change in the antenna protein CP26. Plant Cell 17: 1217–1232
Dall’Osto L, Cazzaniga S, Havaux M, Bassi R (2010) Enhanced photoprotection by protein-bound vs. free xanthophyll pools: a comparative
analysis of chlorophyll b and xanthophyll biosynthesis mutants. Mol
Plant 3: 576–593
Dall’Osto L, Cazzaniga S, North H, Marion-Poll A, Bassi R (2007) The
Arabidopsis aba4-1 mutant reveals a specific function for neoxanthin in
protection against photooxidative stress. Plant Cell 19: 1048–1064
de Bianchi S, Ballottari M, Dall’osto L, Bassi R (2010) Regulation of plant
light harvesting by thermal dissipation of excess energy. Biochem Soc
Trans 38: 651–660
de Bianchi S, Betterle N, Kouril R, Cazzaniga S, Boekema E, Bassi R,
Dall’Osto L (2011) Arabidopsis mutants deleted in the light-harvesting
protein Lhcb4 have a disrupted photosystem II macrostructure and are
defective in photoprotection. Plant Cell 23: 2659–2679
Depège N, Bellafiore S, Rochaix JD (2003) Role of chloroplast protein kinase Stt7 in LHCII phosphorylation and state transition in Chlamydomonas. Science 299: 1572–1575
Drop B, Yadav KN S, Boekema EJ, Croce R (2014) Consequences of state
transitions on the structural and functional organization of photosystem I
in the green alga Chlamydomonas reinhardtii. Plant J 78: 181–191
Flors C, Fryer MJ, Waring J, Reeder B, Bechtold U, Mullineaux PM,
Nonell S, Wilson MT, Baker NR (2006) Imaging the production of
singlet oxygen in vivo using a new fluorescent sensor, Singlet Oxygen
Sensor Green. J Exp Bot 57: 1725–1734
Friso G, Majeran W, Huang M, Sun Q, van Wijk KJ (2010) Reconstruction
of metabolic pathways, protein expression, and homeostasis machineries across maize bundle sheath and mesophyll chloroplasts: large-scale
quantitative proteomics using the first maize genome assembly. Plant
Physiol 152: 1219–1250
Fristedt R, Vener AV (2011) High light-induced disassembly of photosystem II supercomplexes in Arabidopsis requires STN7-dependent phosphorylation of CP29. PLoS ONE 6: e24565
Galka P, Santabarbara S, Khuong TTH, Degand H, Morsomme P, Jennings
RC, Boekema EJ, Caffarri S (2012) Functional analyses of the plant photosystem I-light-harvesting complex II supercomplex reveal that light-harvesting
complex II loosely bound to photosystem II is a very efficient antenna for
photosystem I in state II. Plant Cell 24: 2963–2978
Gilmore AM, Yamamoto HY (1991) Zeaxanthin formation and energydependent fluorescence quenching in pea chloroplasts under artificially mediated linear and cyclic electron transport. Plant Physiol 96:
635–43
Gobets B, van Grondelle R (2001) Energy transfer and trapping in photosystem I. Biochim Biophys Acta 1507: 80–99
Hansson M, Vener AV (2003) Identification of three previously unknown
in vivo protein phosphorylation sites in thylakoid membranes of Arabidopsis thaliana. Mol Cell Proteomics 2: 550–559
Havaux M, Dall’osto L, Bassi R (2007) Zeaxanthin has enhanced antioxidant capacity with respect to all other xanthophylls in Arabidopsis
leaves and functions independent of binding to PSII antennae. Plant
Physiol 145: 1506–1520
Holt NE, Zigmantas D, Valkunas L, Li XP, Niyogi KK, Fleming GR (2005)
Carotenoid cation formation and the regulation of photosynthetic light
harvesting. Science 307: 433–436
470
Plant Physiol. Vol. 167, 2015
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.
CP29 Phosphorylation Enhances NPQ in Rice
Horton P, Johnson MP, Perez-Bueno ML, Kiss AZ, Ruban AV (2008)
Photosynthetic acclimation: does the dynamic structure and macroorganisation of photosystem II in higher plant grana membranes regulate light harvesting states? FEBS J 275: 1069–1079
Horton P, Ruban A (2005) Molecular design of the photosystem II lightharvesting antenna: photosynthesis and photoprotection. J Exp Bot 56:
365–373
Hwang H, Xu C, Moon B, Lee C (2003) Recovery from low-temperature
photoinhibition is related to dephosphorylation of phosphorylated CP29
rather than zeaxanthin epoxidation in rice leaves. J Plant Biol 46: 122–
129
Jensen PE, Gilpin M, Knoetzel J, Scheller HV (2000) The PSI-K subunit of
photosystem I is involved in the interaction between light-harvesting
complex I and the photosystem I reaction center core. J Biol Chem 275:
24701–24708
Kargul J, Turkina MV, Nield J, Benson S, Vener AV, Barber J (2005)
Light-harvesting complex II protein CP29 binds to photosystem I of
Chlamydomonas reinhardtii under State 2 conditions. FEBS J 272: 4797–
4806
Külheim C, Agren J, Jansson S (2002) Rapid regulation of light harvesting
and plant fitness in the field. Science 297: 91–93
Laemmli UK (1970) Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227: 680–685
Larmande P, Gay C, Lorieux M, Périn C, Bouniol M, Droc G, Sallaud C,
Perez P, Barnola I, Biderre-Petit C, et al (2008) Oryza Tag Line, a
phenotypic mutant database for the Genoplante rice insertion line library. Nucleic Acids Res 36: D1022–D1027
Lemeille S, Willig A, Depège-Fargeix N, Delessert C, Bassi R, Rochaix JD
(2009) Analysis of the chloroplast protein kinase Stt7 during state
transitions. PLoS Biol 7: e45
Leoni C, Pietrzykowska M, Kiss AZ, Suorsa M, Ceci LR, Aro EM, Jansson
S (2013) Very rapid phosphorylation kinetics suggest a unique role for
Lhcb2 during state transitions in Arabidopsis. Plant J 76: 236–246
Li XP, Björkman O, Shih C, Grossman AR, Rosenquist M, Jansson S,
Niyogi KK (2000) A pigment-binding protein essential for regulation of
photosynthetic light harvesting. Nature 403: 391–395
Liu WJ, Chen YE, Tian WJ, Du JB, Zhang ZW, Xu F, Zhang F, Yuan S, Lin
HH (2009) Dephosphorylation of photosystem II proteins and phosphorylation of CP29 in barley photosynthetic membranes as a response
to water stress. Biochim Biophys Acta 1787: 1238–1245
Mauro S, Dainese P, Lannoye R, Bassi R (1997) Cold-resistant and coldsensitive maize lines differ in the phosphorylation of the photosystem II
subunit, CP29. Plant Physiol 115: 171–180
Morosinotto T, Baronio R, Bassi R (2002) Dynamics of chromophore
binding to Lhc proteins in vivo and in vitro during operation of the
xanthophyll cycle. J Biol Chem 277: 36913–36920
Morosinotto T, Segalla A, Giacometti GM, Bassi R (2010) Purification of
structurally intact grana from plants thylakoids membranes. J Bioenerg
Biomembr 42: 37–45
Nath K, Poudyal RS, Eom JS, Park YS, Zulfugarov IS, Mishra SR, Tovuu
A, Ryoo N, Yoon HS, Nam HG, et al (2013) Loss-of-function of OsSTN8
suppresses the photosystem II core protein phosphorylation and interferes with the photosystem II repair mechanism in rice (Oryza sativa).
Plant J 76: 675–686
Nelson N, Ben-Shem A (2004) The complex architecture of oxygenic
photosynthesis. Nat Rev Mol Cell Biol 5: 971–982
Nilkens M, Kress E, Lambrev P, Miloslavina Y, Müller M, Holzwarth AR,
Jahns P (2010) Identification of a slowly inducible zeaxanthin-dependent
component of non-photochemical quenching of chlorophyll fluorescence
generated under steady-state conditions in Arabidopsis. Biochim Biophys
Acta 1797: 466–475
Niyogi KK, Grossman AR, Björkman O (1998) Arabidopsis mutants define
a central role for the xanthophyll cycle in the regulation of photosynthetic energy conversion. Plant Cell 10: 1121–1134
Niyogi KK, Truong TB (2013) Evolution of flexible non-photochemical
quenching mechanisms that regulate light harvesting in oxygenic photosynthesis. Curr Opin Plant Biol 16: 307–314
Pribil M, Pesaresi P, Hertle A, Barbato R, Leister D (2010) Role of plastid
protein phosphatase TAP38 in LHCII dephosphorylation and thylakoid
electron flow. PLoS Biol 8: e1000288
Pursiheimo S, Martinsuo P, Rintamäki E, Aro E (2003) Photosystem II protein
phosphorylation follows four distinctly different regulatory patterns induced
by environmental cues. Plant Cell Environ 26: 1995–2003
Rintamäki E, Martinsuo P, Pursiheimo S, Aro EM (2000) Cooperative
regulation of light-harvesting complex II phosphorylation via the plastoquinol and ferredoxin-thioredoxin system in chloroplasts. Proc Natl
Acad Sci USA 97: 11644–11649
Rintamäki E, Salonen M, Suoranta UM, Carlberg I, Andersson B, Aro EM
(1997) Phosphorylation of light-harvesting complex II and photosystem
II core proteins shows different irradiance-dependent regulation in vivo.
Application of phosphothreonine antibodies to analysis of thylakoid
phosphoproteins. J Biol Chem 272: 30476–30482
Ruban AV, Johnson MP (2010) Xanthophylls as modulators of membrane
protein function. Arch Biochem Biophys 504: 78–85
Ruegg UT, Burgess GM (1989) Staurosporine, K-252 and UCN-01: potent
but nonspecific inhibitors of protein kinases. Trends Pharmacol Sci 10:
218–220
Savitch LV, Ivanov AG, Gudynaite-Savitch L, Huner NP, Simmonds J
(2011) Cold stress effects on PSI photochemistry in Zea mays: differential
increase of FQR-dependent cyclic electron flow and functional implications. Plant Cell Physiol 52: 1042–1054
Shapiguzov A, Ingelsson B, Samol I, Andres C, Kessler F, Rochaix JD,
Vener AV, Goldschmidt-Clermont M (2010) The PPH1 phosphatase is
specifically involved in LHCII dephosphorylation and state transitions
in Arabidopsis. Proc Natl Acad Sci USA 107: 4782–4787
Sirpiö S, Allahverdiyeva Y, Suorsa M, Paakkarinen V, Vainonen J,
Battchikova N, Aro EM (2007) TLP18.3, a novel thylakoid lumen protein
regulating photosystem II repair cycle. Biochem J 406: 415–425
Suorsa M, Regel RE, Paakkarinen V, Battchikova N, Herrmann RG, Aro
EM (2004) Protein assembly of photosystem II and accumulation of
subcomplexes in the absence of low molecular mass subunits PsbL and
PsbJ. Eur J Biochem 271: 96–107
Testi MG, Croce R, Polverino-De Laureto P, Bassi R (1996) A CK2 site is
reversibly phosphorylated in the photosystem II subunit CP29. FEBS
Lett 399: 245–250
Tikkanen M, Grieco M, Aro EM (2011) Novel insights into plant lightharvesting complex II phosphorylation and ‘state transitions’. Trends
Plant Sci 16: 126–131
Tikkanen M, Nurmi M, Kangasjärvi S, Aro EM (2008) Core protein
phosphorylation facilitates the repair of photodamaged photosystem II
at high light. Biochim Biophys Acta 1777: 1432–1437
Tikkanen M, Piippo M, Suorsa M, Sirpiö S, Mulo P, Vainonen J, Vener
AV, Allahverdiyeva Y, Aro EM, Paula M, et al (2006) State transitions
revisited: a buffering system for dynamic low light acclimation of Arabidopsis. Plant Mol Biol 62: 779–793
Vainonen JP, Hansson M, Vener AV (2005) STN8 protein kinase in Arabidopsis thaliana is specific in phosphorylation of photosystem II core
proteins. J Biol Chem 280: 33679–33686
Wunder T, Liu Q, Aseeva E, Bonardi V, Leister D, Pribil M (2013)
Control of STN7 transcript abundance and transient STN7 dimerisation are involved in the regulation of STN7 activity. Planta 237: 541–
558
Zhang J, Li C, Wu C, Xiong L, Chen G, Zhang Q, Wang S (2006) RMD: a
rice mutant database for functional analysis of the rice genome. Nucleic
Acids Res 34: D745–D748
Zito F, Finazzi G, Delosme R, Nitschke W, Picot D, Wollman FA (1999)
The Qo site of cytochrome b6f complexes controls the activation of the
LHCII kinase. EMBO J 18: 2961–2969
Plant Physiol. Vol. 167, 2015
471
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2015 American Society of Plant Biologists. All rights reserved.