Ipomoea (sweet potato/kumara) testing manual

Ipomoea
(Sweetpotato/Kumara)
Post-Entry Quarantine
Testing Manual
November 2012
Plant Health and Environment Laboratory
Investigation and Diagnostic Centres and Response
PO Box 2095, 231 Morrin Road, Saint Johns,
Auckland 1140, New Zealand
Telephone: +64-9-909 3015, Facsimile: +64-9-909 5739
www.mpi.govt.nz
Ipomoea Post-Entry Quarantine Testing Manual
Contents
1.
2.
3.
4.
SCOPE................................................................................................................................................. 1
INTRODUCTION ............................................................................................................................... 1
IMPORT REQUIREMENTS.............................................................................................................. 3
PESTS.................................................................................................................................................. 3
4.1
5.
Regulated pests for which generic measures are required ........................................................ 3
4.2
Regulated pests for which specific tests are required ................................................................ 4
PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE.................... 4
5.1
Whole plants............................................................................................................................... 4
5.2
Plants in tissue culture ............................................................................................................... 5
5.3
Pollen .......................................................................................................................................... 5
6.
INSPECTION...................................................................................................................................... 5
7.
TESTING ............................................................................................................................................ 6
7.1
Specific tests for nursery stock ................................................................................................... 7
7.1.1
Graft inoculation ................................................................................................................... 8
7.1.2
Herbaceous indexing............................................................................................................ 10
7.1.3
Serological and molecular assays ........................................................................................ 11
7.1.3.1
Enzyme-linked immunosorbent assay (ELISA) ....................................................... 11
7.1.3.2
Polymerase chain reaction (PCR) ............................................................................. 12
7.1.3.2.1 Virus reverse transcription-PCR ........................................................................... 14
7.1.3.2.1.1 Sweet potato chlorotic stunt virus ..................................................................... 18
7.1.3.2.1.2 Sweetpotato leaf curl virus ................................................................................ 18
7.1.3.2.1.3 Sweetpotato mild speckling virus ...................................................................... 18
7.1.3.2.1.4 Sweetpotato vein mosaic virus .......................................................................... 18
7.1.3.2.1.5 Tobacco streak virus ......................................................................................... 18
7.1.3.2.2 Phytoplasma PCR .................................................................................................. 19
7.1.3.2.2.2 Sweetpotato little leaf phytoplasma................................................................. 21
7.1.3.2.3 Bacteria PCR.......................................................................................................... 21
7.1.3.2.3.1 Dickeya chrysanthemi ...................................................................................... 21
7.1.4
Bacterial isolation on media ................................................................................................ 22
7.1.4.1
Dickeya chrysanthemi (basonym. Erwinia chrysanthemi) ......................................... 22
7.1.5
Microscopic inspection for mites ......................................................................................... 23
7.1.5.1
Tetranychus evansi..................................................................................................... 23
8.
CONTACT POINT ........................................................................................................................... 24
9.
ACKNOWLEDGEMENTS............................................................................................................... 24
10. REFERENCES .................................................................................................................................. 24
Appendix 1. Symptoms of significant regulated pests of Ipomoea batatas ................................................ 27
1.1
Meliodogyne incognita .............................................................................................................. 27
1.2
Rotylenchulus reniformis .......................................................................................................... 27
1.3
Tetranychus evansi .................................................................................................................... 27
1.4
Plant damage caused by mites ................................................................................................. 27
1.5
Streptomyces ipomoea ............................................................................................................... 28
1.6
Elsinoë batatas .......................................................................................................................... 28
1.7
Dickeya chrysanthemi ............................................................................................................... 28
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
ii
1.8
Ipomoea batatas infected with a mixture of viruses ................................................................. 29
1.9
Sweetpotato chlorotic stunt virus ............................................................................................... 29
1.10
Sweetpotato leaf curl virus......................................................................................................... 29
1.11
Sweetpotato little leaf phytoplasma ......................................................................................... 29
Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa............................................................. 30
2.1
Sweetpotato chlorotic stunt virus + Sweetpotato feathery mottle virus ....................................... 30
2.2
Sweetpotato virus 2 .................................................................................................................... 30
2.3
Sweetpotato virus C6 ................................................................................................................. 30
2.4
Sweetpotato leaf curl virus......................................................................................................... 31
2.5
Sweetpotato leaf curl virus + Sweetpotato virus 2 ...................................................................... 31
2.6
Sweetpotato leaf curl virus + Sweetpotato feathery mottle virus................................................. 31
Appendix 3. Protocols referenced in manual ............................................................................................. 32
3.1
Silica-milk RNA extraction protocol ........................................................................................ 32
3.2
Phytoplasma DNA enrichment CTAB extraction protocol ..................................................... 32
©Ministry for Primary Industries, November, 2012
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
iii
1.
SCOPE
The scope of this manual is limited to Ipomoea batatas and Ipomoea setosa nursery stock
(whole plants and plants in tissue culture), seed for sowing and pollen of Ipomoea species
permitted entry into New Zealand as listed in the Ministry for Primary Industries (MPI)
Plants Biosecurity Index (http://www.maf.govt.nz/cgi-bin/bioindex/bioindex.pl). At the date
of publication of this manual, these species were as follows:
Ipomoea alba
Ipomoea aquatica
Ipomoea arborescens
Ipomoea batatas
Ipomoea brasiliensis
Ipomoea cairica
Ipomoea carnea
Ipomoea horsfalliae
Ipomoea imperialis
Ipomoea lobata
Ipomoea minuta
Ipomoea nil
Ipomoea noctiflora
Ipomoea palmata (syn. Ipomoea cairica)
Ipomoea pes-caprae
Ipomoea platensis
Ipomoea purpurea
Ipomoea quamoclit
Ipomoea sepacuitensis
Ipomoea setosa
Ipomoea sloteri
Ipomoea tricolor
Ipomoea tuberosa (syn. Merremia
tuberosa)
Note: The importation of Ipomoea caerulea, Ipomoea hederacea, Ipomoea indica,
Ipomoea learii (syn. Ipomoea indica), Ipomoea plebeia and Ipomoea triloba is prohibited.
This manual describes the testing requirements specified in the import health standards for
Ipomoea. The manual also provides an introduction to the crop and guidance on the
establishment and maintenance of healthy plants in quarantine.
2.
INTRODUCTION
Sweetpotato (Ipomoea batatas (L.) Lam.), a member of the family Convolvulaceae, probably
originated in Central or South America, where it has been a food source for over 55,000
years. Sweetpotato was taken to Spain and early Spanish explorers are believed to have taken
it to the Philippines and East Indies; from there it was soon carried to India, China, and
Malaysia by Portuguese voyagers. It is not fully known how sweetpotato arrived in
Polynesia, but it has been used on many of the islands in the South Pacific Ocean for at least
2000 years (Clark & Moyer, 1988).
Sweetpotato is grown in a wide range of environments under a range of farming systems,
from the humid tropics to mild temperate zones, and from sea level to 2700 m altitude.
Annual global production of sweetpotato currently exceeds 124 million tonnes. More than
95% of the global sweetpotato crop is grown in developing countries. China is the world's
largest producer, accounting for more than 90%. Vietnam, Indonesia, and Uganda all grow
more than two million tonnes per year. India and Rwanda each harvest more than a million
tonnes annually. Of the 82 developing countries where sweetpotatoes grow, 36 are in Africa,
22 in Asia, and 24 in Latin America. Around 40 countries count sweetpotato among the five
most important food crops produced on an annual basis.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
1
The per capita income provided by sweetpotato is one of the lowest among the major food
crops. Its potential benefit to poor farm households and urban consumers is only now being
considered. Sweetpotato actually produces more edible energy per hectare per day than any
other major food crop.
Sweetpotato is a perennial plant cultivated as an annual crop and propagated vegetatively.
The sweetpotato plant is a prostrate vine system that expands horizontally and develops a
shallow canopy. The sweetpotato plant produces several different types of thick and thin
roots. Thick roots can differentiate into either „pencil roots‟ or „storage roots‟, the latter
being used for human consumption. Sweetpotatoes are not tubers as they are initiated at the
first stem node below the soil line, to which they are attached by a stalk of thinner root (Clark
& Moyer, 1988).
Although known for its tolerance to drought and its sensitivity to saturated soil condition,
sweetpotato requires sufficient water and nutrients to produce good yield. Non-rooted stem
cuttings (20-40 cm) with 5-8 nodes are harvested from storage roots laid out in nursery beds,
and transplanted into the field. Sweetpotato can be cultivated continuously throughout the
year in tropical regions, but in temperate regions the crop is planted in spring when the risk of
frost is reduced. The crop requires a minimum frost-free period of 120-150 days and average
daily temperatures of 22-24ºC along with good rainfall and good drainage (Clark & Moyer,
1988).
The flesh of sweetpotato can be white, purple, orange or yellow. Yellow and orange-fleshed
varieties are valuable for their carotene (provitamin A) content. Skin colour ranges from
nearly white through shades of buff to brown, or through pink to copper, even magenta and
purple.
In New Zealand, sweetpotato (known as kumara) is a crop of cultural importance and an
important food source. Kumara was introduced by Maori when they settled in New Zealand
from Polynesia. Cultivation of this crop was undertaken on a large scale because of its
importance as a food source. With the arrival of European settlers, other carbohydrate crops
such as potato, wheat, and corn displaced sweetpotato in dietary importance but not the
crop‟s place in Maori culture. Since the 1950s, after efforts to select improved clones,
production has steadily increased along with consumption as people rediscover kumara.
The local cultivar Owairaka Red, released in 1954, comprises 80% of the crop. Other
cultivars include Toka Toka Gold, selected in 1972 (14%) and Beauregard (introduced in
1993). A range of other local varieties are also grown, usually in garden plots.
The area around Dargaville in the Kaipara district produces 85% of the national crop.
Smaller plantings of approximately 5% are found around Auckland and Bay of Plenty. The
area planted annually is approximately 1,100 hectares producing about 26,500 tonnes, with
yields averaging 20 t/ha. Plantings range in area from garden plots to 30 ha, averaging 10 ha.
Most of New Zealand‟s production is for local fresh consumption although increasing
amounts are processed and/or exported. A thorough review of this crop and its place in New
Zealand agriculture is presented by Lewthwaite (1997).
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
2
3.
IMPORT REQUIREMENTS
The import requirements for I. batatas and I. setosa nursery stock (whole plant and plants in
tissue culture) are set out in MPI‟s import health standard “Importation of Nursery Stock”
(http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf). Imported nursery stock must meet
the general requirements (sections 1-2) and the specific requirements detailed in the
“Ipomoea batatas” schedule. On arrival in New Zealand, the nursery stock must be grown
for a minimum period of 3 months in a Level 3 post-entry quarantine facility where it will be
inspected, treated and/or tested for regulated pests.
The import requirements for Ipomoea seed for sowing are set out in MPI‟s import health
standard “Importation of Seed for Sowing” (http://www.biosecurity.govt.nz/files/ihs/155-0205.pdf). Imported seed is only required to meet the general requirements (sections 1-2) and
there are no specific requirements for the genus. An import permit is not required and seed
meeting the import requirements is given biosecurity clearance at the border without the need
for post-entry quarantine.
The import requirements for pollen are stated in section 2.2.3 in MPI‟s import health standard
“Importation of Nursery Stock” (http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf) and
further details can be found in section 5.3 of this manual.
4.
PESTS
The following section lists regulated pests of I. batatas and I. setosa nursery stock that
require generic or specific measures.
4.1
Regulated pests for which generic measures are required
Insects:
Cylas formicarius
Cylas puncticollis
Euscepes postfasciatus
Nematodes:
Meliodogyne incognita
Rotylenchulus reniformis
Pratylenchus coffeae
Pratylenchus brachyurus
[Fig. 1.1]
[Fig. 1.2]
Fungi:
Elsinoë batatas
Helicobasidium mompa
[Fig. 1.6]
Bacteria:
Pseudomonas batatas
Streptomyces ipomoea
Xanthomonas batatae
Xylella fastidiosa
[Fig. 1.5]
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
3
Viruses:
Sweetpotato chlorotic fleck virus
Sweetpotato latent virus
Sweetpotato ringspot virus
Sweetpotato virus C6
4.2
[Fig. 1.8]
[Fig. 1.8, 2.3]
Regulated pests for which specific tests are required
Mites:
Tetranychus evansi
[Fig. 1.3, 1.4]
Bacteria:
Dickeya chrysanthemi
[Fig. 1.7]
Phytoplasma:
Sweetpotato little leaf phytoplasma
[Fig. 1.11]
Viruses:
Sweetpotato caulimo-like virus
Sweetpotato chlorotic stunt virus
Sweetpotato leaf curl virus
Sweetpotato leaf speckling virus
Sweetpotato mild speckling virus
Sweetpotato vein mosaic virus
Sweetpotato yellow dwarf virus
Tobacco streak virus
[Fig. 1.9, 2.1]
[Fig. 1.10, 2.4, 2.5, 2.6]
5.
PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY
QUARANTINE
5.1
Whole plants
Sweetpotato plants can be grown in the glasshouse all year round as long as a day-time
temperature between 18-26ºC is maintained. Night-time temperatures should not fall below
12ºC to avoid chilling injury. Supplementary lighting may be required in winter.
Sweetpotatoes require free-draining planting which is initially only moistened to avoid
development of rots in quiescent storage roots. The plants can be watered more freely when
the canopy has established and the plants are actively growing. The sweetpotato is a
perennial plant and harvesting takes place when storage roots reach the desired size.
Harvesting may be plant destructive, but if larger storage roots are removed with minimal
plant disturbance, the remaining storage roots will continue to grow and new plants will form.
Harvested roots should be stored in the dark at 13ºC. Storage temperatures should not fall
below 12ºC which can cause chilling injury. Relative humidity during storage should be
maintained at 80 to 90%. Roots stored in multi-walled paper bags can respire and maintain
their own humid environment. Hessian or net bags should be avoided as they can cause
abrasive injury and allow moisture and pathogen entry.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
4
Whole plants should be planted into sufficiently sized pots (eg 3 L minimum) containing
50:50 (v/v) pasteurised peat:pumice planting media and a few grams of slow-release fertiliser
with trace elements (e.g. Osmocote®). Nodal cuttings should be taken from growing vines to
maintain the clone and facilitate quarantine examination and testing. Cuttings with one or
two leaves and at least two nodes can be rooted directly in pasteurised pumice sand or perlite
before transferring to planting media. It would be worth preserving clonal material in tissue
culture as a back-up resource, and to preserve any established virus-free status.
5.2
Plants in tissue culture
Tissue culture plantlets can be sub-cultured after arrival by cutting into nodal sections and
placing into new tissue culture vessels with fresh nutrient media (e.g. Murashige and Skoog
media).
Plantlets to be tested are carefully excised from the tissue culture vessel and washed to
remove any remaining agar and planted into pots of planting media containing 50:50 (v/v)
pasturised peat:perlite or 50:50 (v/v) peat:vermiculite. The plantlets must be protected from
desiccation for approximately three weeks by covering initially with a vented plastic tub or
bag. Alternatively, the plants can be misted regularly to keep the planting media moist, and
to maintain a high relative humidity. Pots should be placed in bright light, but not direct
sunlight during the three weeks. After this period, any coverings should be removed and the
plants moved to higher light intensity.
5.3
Pollen
Anthers can be collected from mature but unopened flowers and dried in warm, light
conditions. Following this drying period, pollen should be collected into a centrifuge vial or
into gel capsules and stored at 4°C in a sealed container in the presence of a strong desiccant
such as calcium chloride.
6.
INSPECTION
The inspection requirements for the operator of the facility are set out in the “MPI
Biosecurity Authority Standard PBC-NZ-TRA-PQCON”
(http://www.biosecurity.govt.nz/files/regs/stds/pbc-nz-tra-pqcon.pdf )
Photographs of symptoms caused by significant regulated diseases can be found in Appendix
1. However, please note that pot-grown sweetpotato plants can be prone to nutrient
deficiencies if not adequately fertilised and nutrient deficiencies can resemble virus infection,
e.g. chlorosis and necrosis. Symptoms related to nutrient deficiencies can be found in
Appendix 2. Further information on nutrient deficiencies is described in Clark & Moyer
(1988).
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
5
7.
TESTING
Each of the specific tests required in the import health standard (as described in section 4 and
summarised in Table 1) must be done irrespective of whether plants exhibit symptoms. This
testing is required to detect latent infections.
Samples should be tested as soon as possible after removal from the plant. If samples have to
be stored before testing, the plant material must be kept whole, all surface water must be
removed, and the material stored in a plastic bag at 4oC. Samples that become partially
decayed or mouldy must not be tested, and further samples should be collected.
Inspection for mites
Inspection for mites is performed once whole plants or tissue culture plants have established
successfully in planting media and have produced stems with at least 10-15 nodes.
Inspection should take place before samples are taken for other testing methods. Using a
hand lens, the underside of all leaves must be inspected for mite eggs, nymphs, adults and
symptoms of mite presence. Following this, the 3 youngest leaves of each plant, plus any
suspect leaves showing the presence of mites must be collected for further examination under
a binocular microscope. See section 7.1.5 for further details.
Indexing tests
Graft inoculation: Grafting can begin when the whole plants or tissue culture plants have
established successfully in planting media and have produced stems with at least 10-15
nodes. Grafting should take place before leaf samples are collected for other testing methods.
See section 7.1.1 for further details. Each plant in the glasshouse must be tested individually
by graft indexing.
Herbaceous indexing: Virus testing should be done in spring (or under spring-like
conditions) when new growth has occurred. At least two fully expanded leaves must be
sampled from each of two different branches of the main stem, one a younger leaf and one an
older leaf from a mid-way position. Each plant in the glasshouse must be tested individually
by herbaceous indexing. See section 7.1.2 for further details.
PCR and ELISA testing
Viruses: For virus-testing of I. batatas by PCR and ELISA, it is recommended to test the
graft-inoculated indicator plants rather than the original test plants. However, original I.
setosa plants can be tested directly. Virus testing should be done in spring (or under springlike conditions) when new growth has occurred. At least two fully expanded leaves must be
sampled from each of two different branches of the main stem, one a younger leaf and one an
older leaf from a mid-way position. The sampled leaves from each plant must be bulked
together and tested as soon as possible after removal from the host. See section 7.1.3 for
further details.
Bacteria and phytoplasma: Bacteria and phytoplasma testing must be carried out using the
original I. batatas and I. setosa plants and should be done in summer (or under summer-like
conditions). For each plant, at least two fully expanded leaves must be sampled from each of
two different branches of the main stem, one a younger leaf and one an older leaf from a midway position. Detection of both bacteria and phytoplasma requires testing of leaf petioles
and mid-veins. The sampled leaves from each plant must be bulked together and tested as
soon as possible after removal from the host. See section 7.1.3 for further details.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
6
Bacterial isolation on media
Isolation of regulated bacteria testing must be carried out using the original I. batatas and I.
setosa plants and should be done in summer (or under summer-like conditions). For each
plant, at least two fully expanded leaves must be sampled from each of two different branches
of the main stem, one a younger leaf and one an older leaf from a mid-way position.
Detection of bacteria requires plating vascular tissue from petioles mid-veins. Each plant in
the glasshouse must be tested individually. See section 7.1.4 for further details.
Table 1: Summary of the regulated pests for I. batatas and I. setosa indicating the
specific tests that are required (■), alternative (□) or optional ()
Organism Type
Mites
Tetranychus evansi
Bacterium
Dickeya chrysanthemi
Phytoplasma
Sweetpotato little leaf
phytoplasma
Viruses
Sweetpotato caulimo-like virus
Sweetpotato chlorotic stunt
virus
Sweetpotato leaf curl virus2
Sweetpotato leaf speckling
virus
Sweetpotato mild speckling
virus
Sweetpotato vein mosaic virus
Sweetpotato yellow dwarf virus
Tobacco streak virus
1
Graft
Inoculation1
Herbaceous
Indexing
ELISA
PCR
Isolation
on media
Inspection
■
□
□
■
■
■
■
■
■
■
■
■
■
■
■


□
□
□
□
Not required for I. setosa; 2ssDNA Geminivirus
7.1
Specific tests for nursery stock
Each plant must be tested separately with the following exceptions, samples from up to 5
plants may be bulked for testing provided that either:
(a) the plants are derived from a single imported plant or plant established from a storage
root from which separate cuttings have been taken upon arrival in New Zealand, in
the presence of a MPI inspector; or
(b) in the case of tissue culture where plants are clonal, and this is confirmed by evidence
from the national plant protection organisation in the exporting country.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
7
7.1.1
Graft inoculation
Each I. batatas plant must be tested by graft inoculation using a minimum of 3 replicate
indicator plants of either I. setosa or I. nil „Scarlet O‟ Hara‟. Indicator plants must be
maintained in a healthy, vigorous state, as symptoms associated with abiotic stresses, such as
water and nutrient deficiencies, may mask and interfere with observations of disease
symptoms. The indicator plants can be grown from seed or from young cuttings. If using
seed, sow 3-4 weeks before grafting.
Sweetpotato seed requires scarification prior to germination. Indicator seeds are soaked in
concentrated sulphuric acid (98%) for 20 minutes (I. nil) or 60 minutes (I. batatas). Seeds
are then rinsed in running tap water 3-4 times prior to planting in moist planting media.
The method for propagating sweetpotato plants from seed is described in full by Saladaga et
al. (1991).
The indicator plants are ready for grafting when they have two or more fully expanded
leaves.
To avoid cross-contamination of plants during the grafting process, use a sterile scalpel for
each sweetpotato plant to be tested.
Recommended method
1. Begin grafting by cutting indicator plants back to 2 true leaves.
2. Sweetpotato plants are tested by wedge-grafting. Each sweetpotato plant that is to be
used for indexing should be established with a minimum of five nodes. Remove a branch
from the sweetpotato plant to be indexed and cut the branch into 5 sections, each
containing a node with a fully expanded leaf attached.
3. Wedge-graft each node section onto a separate indicator plant.
4. To prevent desiccation, wrap the graft with parafilm, or similar.
5. Cover the whole plant with a plastic bag to reduce airflow around the graft.
6. Remove the plastic bag 5-7 days after grafting.
7. Fertilise the indicator plant with a slow-release fertiliser (e.g. Osmocote®) and insert a
bamboo-stake into the pot to support the growth of the plant.
8. Grow the indicator plants to at least 10-15 nodes; this will take approximately 3-5 weeks.
During the growth period, monitor the indicator plants daily for virus symptoms which
may only show for a short period of time.
9. Some sweetpotato grafts may grow faster than the indicator plant, cut any sweetpotato
growth back to ensure the indicator plant grows well.
10. At the end of the 3-5 week growth period, cut the indicator plants back to 1-2 buds and
re-grow for 3-5 weeks. Re-growth should again be closely monitored daily for virus
symptoms.
11. A positive control must be included with each batch of inoculations. For the positive
control, graft a sweetpotato plant known to be infected with a non-regulated virus, e.g.
Sweetpotato feathery mottle virus (SPFMV).
12. It is recommended to include a negative control with each batch of inoculations. For the
negative indicator, cut back to 2 true leaves, as for grafted plants, but do not graft.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
8
Note: Sweetpotato plants are sensitive to some pesticides and spray damage can induce
mosaic-like symptoms. In addition, plants suffering from nutrient deficiencies can show
leaf chlorosis and necrosis.
Interpretation of results
Symptoms on I. setosa usually appear within 2-4 weeks, and on I. nil around one week.
However, the severity of virus symptoms and length of time before they appear on the
indicator plants depends upon the virus and the amount of virus inoculum present in the
scion. The graft inoculation results will only be considered valid if:
(a) no symptoms are produced on the negative control (non-grafted) indicator plant; and
(b) the expected symptoms are produced on the indicator hosts with the positive control
(non-regulated virus). If SPFMV was used as the positive control, the following
symptoms will be produced on the indicator plants:
I. setosa – vein clearing followed by remission.
I. nil – systemic vein clearing, vein banding, ringspots.
The symptoms produced by each of the regulated viruses on the indicator species I. setosa
and I. nil are described below.
Sweetpotato caulimo-like virus:
I. setosa – chlorotic flecks along the secondary veins and interveinal chlorotic spots on
leaves.
Sweetpotato chlorotic stunt virus:
I. setosa – stunting, yellowing and leaf deformation, although symptoms maybe mild
depending on isolate.
I. nil – stunting, yellowing and leaf deformation, although symptoms maybe mild
depending on isolate.
Sweetpotato leaf curl virus:
I. setosa – curling of young leaves.
I. nil – curling of young leaves.
Sweetpotato leaf speckling virus:
I. setosa – chlorotic and necrotic spotting, dwarfing and leaf curling.
I. nil – chlorotic and necrotic spotting, dwarfing and leaf curling.
Sweetpotato mild speckling virus:
I. setosa – mild mosaic sometimes observed in first two true leaves.
Sweetpotato vein mosaic virus:
I. setosa – systemic vein-clearing and mosaic.
I. nil – systemic vein-clearing and mosaic.
Sweetpotato yellow dwarf virus:
I. setosa – chlorotic leaf mottling.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
9
7.1.2
Herbaceous indexing
Each I. batatas and I. setosa plant must be tested for mechanically-transmitted regulated
viruses using herbaceous indicators, this is in addition to graft inoculation. Sap must be
inoculated onto two plants of each herbaceous species as follows: Chenopodium quinoa,
Nicotiana benthamiana, N. clevelandii and N. tabacum.
It is important that the pre- and post-inoculation growing conditions of the herbaceous
indicator plants promote their susceptibility. Plants must be grown at 18-25oC. The stage of
development to ideally inoculate the indicator plants is 4-6 fully expanded true leaves for
Chenopodium spp., and 4 fully expanded leaves for Nicotiana spp.
Recommended method
1. Place indicator plants in dark for 16-24 hours prior to inoculation to increase
susceptibility.
2. Grind leaf tissue (approximately 1/4; w/v) in 0.1 M sodium phosphate buffer (pH 7.5),
containing 5% (w/v) polyvinylpyrrolidone (PVP-40) and 0.12% (w/v) sodium sulphite
(Na2SO3). A negative (inoculation buffer only) and a positive control must be included in
each batch of inoculations. The positive control is a non-regulated virus which is
moderately transmissible and produces clear symptoms on the herbaceous indicators, (e.g.
Arabis mosaic virus). The plants must be inoculated in the following order:
(a) inoculation buffer only; then
(b) imported plants to be tested; then
(c) positive control (non-regulated virus).
3. Select two young fully expanded leaves preferably opposite leaves, to be inoculated on
each plant and mark them by piercing holes with a pipette tip.
4. Lightly dust the leaves with Celite or carborundum powder. Alternatively, a small
amount of Celite or carborundum powder may be mixed with the sap extract.
5. Using a gloved finger gently apply the sap to the marked leaves of the indicator plants,
stroking from the petiole towards the leaf tip while supporting the leaf below with the
other hand.
6. After 3-5 minutes rinse inoculated leaves with water.
7. Grow inoculated plants for a minimum of 4 weeks. Inspect and record plants twice per
week for symptoms of virus infection.
The Arabis mosaic virus positive control may be obtained from:
1. ATCC Cat. No. PV-192, PV-589, PV-590 (http://www.atcc.org).
2. DSMZ Cat. No. PV-0045, PV-0046, PV-0215, PV-0216, PV-0217, PV-0230, PV-0232
(http://www.dsmz.de).
3. The MPI (see the Contact Point, section 8) (available as freeze-dried leaf material or
nucleic acid). A charge may be imposed to recover costs.
Interpretation of results
The herbaceous indexing results will only be considered valid if:
(a) no symptoms are produced on the indicator hosts with the negative control
(inoculation buffer only); and
(b) the correct symptoms are produced on the indicator hosts with the positive control
(non-regulated virus). If Arabis mosaic virus was used as the positive control, the
following symptoms will be produced on the herbaceous indicators:
C. quinoa – local lesions, and systemic chlorotic mottling.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
10
N. benthamiana – not susceptible.
N. clevelandii – local lesions, systemic chlorotic spots, rings and lines.
N. tabacum – local lesions, systemic chlorotic spots, rings and lines.
The virus symptoms produced on herbaceous indicators are described below.
Sweetpotato yellow dwarf virus:
C. quinoa – susceptible, but no information is available on symptoms.
Tobacco streak virus:
N. tabacum – systemic vein clearing, then downward curling of the leaf and its margins.
7.1.3
Serological and molecular assays
ELISA OR PCR MUST be carried out for the following viruses:
Sweetpotato vein mosaic virus
Tobacco streak virus
ELISA OR PCR is OPTIONAL for the following virus:
Sweetpotato mild speckling virus
PCR MUST be carried out for the following organisms:
Sweetpotato chlorotic stunt virus
Sweetpotato leaf curl virus
Sweetpotato little leaf phytoplasma
PCR OR selective media MUST be carried out for the following bacterium:
Dickeya chrysanthemi
7.1.3.1 Enzyme-linked immunosorbent assay (ELISA)
Recommended method
1. Perform the ELISA according to the manufacturer‟s instructions. The following controls
must be included on each ELISA plate:
(a) positive control: infected leaf tissue or equivalent (Table 2); and
(b) negative control: sweetpotato tissue that is known to be healthy; and
(c) buffer control: extraction buffer only.
2. Add each of the samples and controls to the ELISA plate as duplicate wells. It is not
recommended to perform ELISA with plant samples or sap that has been frozen.
3. Measure the optical density 60 minutes after addition of the substrate (or as per
manufacturer‟s instructions).
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
11
Table 2: Source of antisera and positive controls for ELISA
Pathogen
Antisera
Sweetpotato vein mosaic virus
and
Sweetpotato mild speckling
virus
Tobacco streak virus
Agdia Cat No. PSA27200 (Potyvirus
group: Pathoscreen kit) 1,2
Agdia Cat No. PSA25500
(Pathoscreen kit) 1,2
Positive/negative
control2
Agdia Cat No.
LNC 27200
Agdia Cat No.
LNP 27200
Agdia Cat No.
LPC25500
1
Catalogue numbers for the complete reagent sets are given, the antisera and reagents can
also be purchased separately.
2
The positive control is included if the Pathoscreen set is purchased.
Further information about the kits and the supplier listed in Table 2 can be found at the
following website:
Agdia Incorporated, USA (http://www.agdia.com).
Interpretation of results
A result is considered positive if the mean absorbance of the two replicate wells is greater
than 2 times the mean absorbance of the negative control. The test will only be considered
valid if:
(a) the absorbance for the positive and negative controls are within the acceptable range
specified by the manufacturer; and
(b) the coefficient of variation (standard deviation / mean × 100), between the duplicate
wells is less than 20%.
If the test is invalid, it must be repeated with freshly-extracted sample. Samples that are close
to the cut-off must be retested or tested using an alternative method recommended in the
import health standard (see Table 1).
7.1.3.2 Polymerase chain reaction (PCR)
The following section describes the molecular tests required for regulated pests listed on the
import health standard for I. batatas and I. setosa. The recommended published PCR primers
for these tests are listed in Table 3 along with plant internal control primers for RNA and
DNA. The inclusion of an internal control assay is recommended to eliminate the possibility
of PCR false negatives due to extraction failure, nucleic acid degradation or the presence of
PCR inhibitors.
It is strongly recommended to extract nucleic acid from indicator plants (I. setosa or I. nil),
3 to 5 weeks after grafting rather than extracting directly from I. batatas test plants. Viruses
present in I. batatas can be unevenly distributed in the plant and virus titre can fluctuate over
time. Virus levels in grafted indicator plants have been found to be higher in comparison
with I. batatas (Kokkinos & Clark, 2006).
The PCR reagents listed for the methods described in this section have been tested by the
Plant Health & Environment Laboratory, MPI. Alternative reagents may give similar results
but will require validation.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
12
Table 3: PCR primers used for the detection of regulated pests of I. batatas and I. setosa,
and plant internal controls
Target
organism
Bacterium
Dickeya chrysanthemi
(Use both assays to
detect all pathovars)
Primer
name
Sequence (5´-3´)
ADE1
ADE2
GATCAGAAAGCCCGCAGCCAGAT
CTGTGGCCGATCAGGATGGTTTTGT
CGTGC
GGTAAAGGGTCTATCATGCG
CCTTCACCATACATAATTTGGA
72
420
Nassar et al.,
1996
47
760
Waleron et al.,
2002
AAGAGTTTGATCCTGGCTCAGGATT
53
1800 Deng & Hiruki,
1991;
Schneider et al.,
1995
1248 Lee et al., 1993
recAF
recAR
Phytoplasma
Sweetpotato little leaf P1
phytoplasma
P7
R16F2
R16R2
Phyto-F
Sweetpotato leaf curl
virus1
Sweetpotato mild
speckling virus and
Sweetpotato vein
mosaic virus
Tobacco streak virus
Internal Control
Plant DNA control
Plant RNA control
Plant NA control
50
60
75
Christensen et
al., 2004
CGAATCAACGGATCGGAATT
CCACCGACTATTACATCACCACTCT
(MGB)FAM-ATCCCAACGTGTTTATCT
A-NFQ3
EASPCSV-38F GGAGTTTATTCCCACCTGTYTATCT
EASPCSV-126R GTAATTGCGAAGAATCYAAAACCT
EASPCSV-67P2 FAM-CGGCTACAGGCGACGTGGTTG
TTG-NFQ3
SPG1
ATCCVAAYWTYCAGGGAGCTAA
SPG2
CCCCKGTGCGWRAATCCAT
SPLCV-F
GGCGCCTAAGTATGGCTGAA
SPLCV-R
AACCGTATAAAGTATCTGGGAGT
GGT
SPLCV-P2
(MGB)FAM-GTGGGACCCTTTGCNFQ3
Oligo1n
ATGGTHTGGTGYATHGARAAYGG
Oligo2n
TGCTGCKGCYTTCATYTG
60
71
Kokkinos &
Clark, 2006
60
90
N. Boonham
(Unpublished)
58
934
Li et al., 2004
66
60
Kokkinos &
Clark, 2006
50
327
Marie-Jeanne et
al., 2000
48
300
Untiveros et al.,
2010
SPCSV-F
SPCSV-R
SPCSV-P2
IlarlF5
IlarlR7
GCNGGWTGYGGDAARWCNAC
AMDGGWAYYTGYTYNGTRTCACC
Gd1
Berg54
ACGGAGAGTTTGATCCTG
50-62 1500 Andersen et al.,
AAAGGAGGTGATCCAGCCGCACCTT
1998
C
GATGCTTCTTGGGGCTTCTTGTT
50-60 180 Menzel et al.,
CTCCAGTCACCAACATTGGCATAA
2002
CGTCGCATTCCAGATTATCCA
60
74 Weller et al.,
CAACTACGGATATATAAGAGCCAA
2000
AACTG
FAM-TGCTTACGCTGGATGGAATG
CCCT- NFQ3
Nad5-s
Nad5-as
COX-F
COX-R
COX- P2
1
CGTCCTTCATCGGCTCTT
Band Reference
(bp)
ACGACTGCTAAGACTGG
TGACGGGCGGTGTGTACAAACCCCG
CGTACGCAAGTATGAAACTTAAAG
GA
TCTTCGAATTAAACAACATGATCCA
FAM-TGACGGGACTCCGCACAAGCG
-NFQ3
Phyto-R
Phyto-P2
Viruses
Sweetpotato chlorotic
stunt virus
(Use both assays to
detect East & West
African strains)
TM
(ºC)
Single stranded DNA virus; 2Real-time probe; 3NFQ = Non-fluorescent quencher.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
13
7.1.3.2.1
Virus reverse transcription-PCR
Recommended method for RNA viruses: conventional RT-PCR
1. Extract total RNA from leaf tissue according to a standard protocol. Successful RT-PCR
amplification can be achieved using the following RNA extraction procedures:
(a) Qiagen RNeasy® Plant Mini Kit (Qiagen Cat. No. 74904); or
(b) a silica-based method as described by Menzel et al. (2002); or
(c) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL
workstation.
Commercial kits are used as described by the manufacturer. See Appendix 3 for details
of other extraction methods. Alternative methods may also be used after validation.
2. Optional: Perform a one-step RT-PCR on the RNA with the Nad5 internal control
primers (Table 3) using the components and concentrations listed in Table 4 and cycle
under the conditions listed in Table 6. The Nad5 primers amplify mRNA from plant
mitochondria.
3. Perform a one-step RT-PCR on the RNA with the pathogen-specific primers (Table 3)
using the components and concentrations listed in Table 4 and cycle under the conditions
listed in Table 6. The following controls must be included for each set of RT-PCR
reactions:
(a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and
(b) no template control: water is added instead of RNA template.
When setting up the test initially, it is advised that a negative control (RNA extracted
from healthy Ipomoea leaf tissue) is included. Please note that the Nad5 internal control
primers do not reliably amplify a product from RNA extracted from freeze-dried material.
We therefore recommend mixing fresh healthy Ipomoea leaf material with freeze-dried
positive control material (3:1 w/w) prior to carrying out the extraction.
4. Analyse the PCR products by agarose gel electrophoresis.
Recommended method for DNA viruses: conventional PCR
1. Extract total DNA from leaf tissue according to a standard protocol. Successful PCR
amplification can be achieved using
(a) Qiagen DNeasy® Plant Mini Kit (Qiagen Cat. No. 69104); or
(b) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL
workstation.
Commercial kits are used as described by the manufacturer. Alternative methods may
also be used after validation.
2. Optional: Perform a PCR on the DNA with the Gd1/Berg54 internal control primers
(Table 3) using the components and concentrations listed in Table 5 and cycle under the
conditions listed in Table 6. The Gd1/Berg54 primers amplify the 16S rRNA gene from
most prokaryotes as well as from chloroplasts.
3. Perform a PCR on the DNA with the pathogen-specific primers (Table 3) using the
components and concentrations listed in Table 5 and cycle under the conditions listed in
Table 6. The following controls must be included for each set of PCR reactions:
(a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and
(b) no template control: water is added instead of DNA template.
When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy Ipomoea leaf tissue) is included.
4. Analyse the PCR products by agarose gel electrophoresis.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
14
Interpretation of results for conventional (RT) PCR
The RT-PCR or PCR test will only be considered valid if:
(a) the positive control produces the correct size product as indicated in Table 3; and
(b) no bands are produced in the negative control (if used) and the no template control.
If the Nad5 or Gd1/Berg54 internal control primers are also used, then the negative control (if
used), positive control and each of the test samples must produce a 181 bp (Nad5) or 1500 bp
(Gd1/Berg54) band. Failure of the samples to amplify with the internal control primers
suggests that the nucleic acid extraction has failed or compounds inhibitory to PCR are
present in the nucleic acid extract, or the nucleic acid has degraded.
Table 4: RT-PCR reaction components for RNA templates using Invitrogen
SuperScript® III One-step RT-PCR System with Platinum® Taq DNA polymerase
Reagent
Nuclease-free water
10 × Reaction mix (Invitrogen 12574-026)
5 µM Forward primer (250 nM)
5 µM Reverse primer (250 nM)
SuperScript® III/ RT/ Platinum® Taq Mix
10 mg/ml Bovine Serum Albumin (BSA) (Sigma A7888)
RNA template
Total volume
Volume per reaction (µl)
4.2
10.0
1.0
1.0
0.8
1.0
2.0
20.0
Table 5: PCR reaction components for DNA templates using
Promega GoTaq® Green Master Mix
Reagent
Nuclease-free water
GoTaq® Green Master Mix (Promega M7122)
50 mM MgSO4 (4 mM final)*
5 µM Forward primer (250 nM)
5 µM Reverse primer (250 nM)
10 mg/ml Bovine Serum Albumin (BSA) (Sigma A7888)
DNA template
Total volume
Volume per reaction (µl)
4.0
10.0
1.0*
1.0
1.0
1.0
2.0
20.0
*Li et al. (2004) PCR only, for all other primers, adjust water volume accordingly
Table 6: Generic PCR cycling conditions
Step
RT step only
Initial denaturation
Denaturation
Annealing
Temperature
50oC
94oC
94oC
See Table 3
Elongation
72oC
Final elongation
72oC
Time
30 min
2 min
30 sec
30 sec
30 to 45 sec (virus/bacteria)
1 min (phytoplasma)
7 min
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
No. of cycles
1
1
40
1
15
Recommended method for RNA viruses: real-time RT-PCR
1. Extract total RNA from leaf tissue according to a standard protocol (as described above).
2. Set-up a one-step RT-PCR using pathogen-specific primers (Table 3) and the components
and concentrations listed in Table 7 and cycle under the conditions listed in Table 8.
Please note that reaction and cycling conditions can be changed depending on the realtime machine used, but this would require validation.
3. Optional: Perform a one-step RT-PCR on the nucleic acid using the COX internal control
primers (Table 3) and the components and concentrations listed in Table 7 and cycle
under the conditions listed in Table 8. The COX primers amplify the constitutive
cytochrome oxidase 1 gene found in plant mitochondria (note: this assay is not RNA
specific).
4. The following controls must be included for each set of reactions:
(a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and
(b) no template control: water is added instead of RNA template.
5. When setting up the test initially, it is advised that a negative control (RNA extracted
from healthy Ipomoea leaf tissue) is included.
6. Analyse real-time amplification data according to the manufacturer‟s instructions
accompanying the real-time PCR machine.
Recommended method for DNA viruses: real-time PCR
1. Extract total DNA from leaf tissue according to a standard protocol (as described above).
2. Set-up the PCR using pathogen-specific primers (Table 3) and the components and
concentrations listed in Table 9 and cycle under the conditions listed in Table 10. Please
note that reaction and cycling conditions can be changed depending on the real-time
machine used, but this would require validation.
3. Optional: Perform PCR on the nucleic acid using the COX internal control primers
(Table 3), and using the components and concentrations listed in Table 9 and cycle under
the conditions listed in Table 10.
4. The following controls must be included for each set of reactions:
(a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and
(b) no template control: water is added instead of DNA template
5. When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy Ipomoea leaf tissue) is included.
6. Analyse real-time amplifcation data according to the manufacturer‟s instructions
accompanying the real-time PCR machine.
Table 7: Real-time RT-PCR reaction components for RNA templates using
Invitrogen Superscript® III One-step qRT PCR system
Reagent
Nuclease-free water
2 × Reaction Mix (Invitrogen 11730-017)
10 µg/µl Bovine Serum Albumin (BSA) (Sigma A7888)
5 µM Forward primer (300 nM)
5 µM Reverse primer (300 nM)
5 µM Dual-labelled fluorogenic probe (100 nM)
Superscript® III RT/Platinum® Taq Mix
RNA
Total volume
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
Volume per reaction (µl)
4.3
10.0
0.5
1.2
1.2
0.4
0.4
2.0
20.0
16
Table 8: Generic cycling conditions for RNA real-time RT-PCR
Step
RT-Step
Initial denaturation
Denaturation
Annealing & elongation
Temperature
50ºC
95oC
95oC
See Table 3
Time
30 min
2 min
10 sec
40 sec
No. of cycles
1
1
40
Table 9: Real-time PCR reaction componnets for DNA templates using
Invitrogen Platinum® qPCR SuperMix-UDG
Reagent
Nuclease-free water
Platinum® Quantitative PCR Supermix-UDG (Invitrogen 11730-017)
10 µg/µl Bovine Serum Albumin (BSA) (Sigma A7888)
5 µM Forward primer (300 nM)
5 µM Reverse primer (300 nM)
5 µM Dual-labelled fluorogenic probe (100 nM)
DNA
Total volume
Volume per reaction (µl)
4.6
10.0
0.6
1.2
1.2
0.4
2.0
20.0
Table 10: Generic cycling conditions for DNA real-time PCR
Step
UDG incubation hold
(Invitrogen only)
Initial denaturation
Temperature
50ºC
Time
2 min
95ºC
Denaturation
Annealing & elongation
95ºC
See Table 3
2 min (Invitrogen)
5 min (Roche)
10 sec
40 sec
No. of cycles
1
1
40
Interpretation of results for real-time PCR
The real-time PCR or RT-PCR test will only be considered valid if:
(a) the positive control produces an amplification curve with the pathogen-specific
primers; and
(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative
control (if used) and the no template control.
If the COX internal control primers are also used, then the negative control (if used), positive
control and each of the test samples must produce an amplification curve. Failure of the
samples to produce an amplification plot with the internal control primers suggests that the
nucleic acid extraction has failed or compounds inhibitory to PCR are present in the nucleic
acid extract, or the nucleic acid has degraded.
Virus positive controls for PCR
Tobacco streak virus positive control controls may be obtained from the following sources:
1. American Type Culture Collection (ATCC; http://www.atcc.org): No. PV-276, PV-31,
PV-352, PV-353, PV-360.
2. DSMZ Culture Collection (http://www.dsmz.de): PV-0309, PV-0612, PV-0738.
3. The commercial source listed in Table 2.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
17
Positive control material, in the form of nucleic acid, for Sweetpotato chlorotic stunt virus
and Sweetpotato leaf curl virus and Tobacco streak virus may be obtained from MPI (see the
Contact Point, section 8). Positive control material for Sweetpotato vein mosaic virus and
Sweetpotato mild speckling virus is currently unobtainable; however, an alternative Potyvirus
may be used for the PCR. Potyvirus positive controls in the form of nucleic acid may also be
obtained from the MPI. A charge may be imposed to recover costs.
7.1.3.2.1.1 Sweet potato chlorotic stunt virus
Plants must be tested for Sweetpotato chlorotic stunt virus by real-time PCR using the primer
pairs listed in Table 3. See section 7.1.3.2.1 for details of test methods and interpretation of
results. Please note that SPCSV should be tested with both sets of primers listed in Table 3 in
order to detect both East and West African strains.
7.1.3.2.1.2 Sweetpotato leaf curl virus
Plants must be tested for Sweetpotato leaf curl virus by PCR or real-time PCR using the
primer pairs listed in Table 3. See section 7.1.3.2.1 for details of test methods and
interpretation of results. Please note the Li et al., (2004) PCR should be cycled as shown in
Table 11
Table 11: Cycling conditions for SPLCV PCR
Step
Initial denaturation
Denaturation
Annealing
Elongation
Final elongation
Temperature
94oC
94oC
58ºC
68oC
68oC
Time
2 min
30 sec
30 sec
90 sec
3 min
No. of Cycles
1
40
1
7.1.3.2.1.3 Sweetpotato mild speckling virus
Plants can be tested for Sweetpotato mild speckling virus by RT-PCR using the primer pairs
listed in Table 3. Please note that a suitable positive control is not available for Sweetpotato
mild speckling virus, however, the PCR has been validated with other potyviruses. See
section 7.1.3.2.1 for details of test methods and interpretation of results.
7.1.3.2.1.4 Sweetpotato vein mosaic virus
Plants must be tested for Sweetpotato vein mosaic virus by RT-PCR using the primer pairs
listed in Table 3. Please note that a suitable positive control is not available for Sweetpotato
vein mosaic virus, however, the PCR has been validated with other potyviruses. See section
7.1.3.2.1 for details of test methods and interpretation of results.
7.1.3.2.1.5 Tobacco streak virus
Plants must be tested for Tobacco streak virus by RT-PCR using the primer pair listed in
Table 3. See section 7.1.3.2.1 for details of test methods and interpretation of results.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
18
7.1.3.2.2
Phytoplasma PCR
Recommended method phytoplasma: conventional PCR
1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol.
Successful PCR amplification can be achieved using the following DNA extraction
procedures:
(a) Qiagen DNeasy® Plant Mini Kit (Qiagen Cat. No. 69104); or
(b) phytoplasma enrichment procedure as described by Kirkpatrick et al. (1987) and
modified by Ahrens & Seemüller (1992); or
(c) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL
workstation.
Commercial kits are used as described by the manufacturer. See Appendix 3 for details
of other extraction methods. Alternative methods may also be used after validation.
2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers (Table 3) using
the components and concentrations listed in Table 5 (section 7.1.3.2.1) and cycle under
the conditions listed in Table 6 (section 7.1.3.2.1). The Gd1/Berg54 primers amplify the
16S rRNA gene from most prokaryotes as well as from chloroplasts.
3. Perform a nested PCR on the purified DNA using the universal phytoplasma primer pair
P1/P7 (Table 3), for the first-stage PCR, followed by the R16F2/R16R2 primer pair
(Table 3) for the second-stage PCR.
4. Set-up the first-stage and second-stage PCR reactions using the components and
concentrations listed in Table 5 (section 7.1.3.2.1) and cycle under the conditions listed in
Table 6 (section 7.1.3.2.1). The first-stage PCR products are diluted 1:25 (v/v) in water
prior to re-amplification using the second-stage PCR primers.
5. The following controls must be included for each set of PCR reactions:
(a) positive control: total DNA or a cloned fragment from the appropriate organism may
be used. If the internal control primers are not used, then the DNA must be mixed
with healthy Ipomoea DNA to rule out the presence of PCR inhibitors; and
(b) no template control: water is added instead of DNA template.
When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy Ipomoea leaf tissue) is included.
6. Analyse the PCR products (second-stage PCR products only) by agarose gel
electrophoresis.
Interpretation of results
The pathogen-specific PCR test will only be considered valid if:
(a) the positive control produces the correct size product as indicated in Table 3; and
(b) no bands are produced in the negative control (if used) and the no template control.
If the Gd1/Berg54 internal control primers are also used, then the negative control (if used),
positive control and each of the test samples must produce a 1500 bp band. Failure of the
samples to amplify with the control primers suggests that either the DNA extraction has
failed or compounds inhibitory to PCR are present in the DNA or the DNA has degraded. An
effective method to further purify the DNA is by using MicroSpin™ S-300 HR columns (GE
Healthcare Cat. No. 27-5130-01).
Recommended method for phytoplasma: Real-time PCR
1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol (as
described above).
2. Set-up the real-time PCR using pathogen-specific primers (Table 3) and the components
and concentrations listed in Table 12 and cycle under the conditions listed in Table 10.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
19
3.
4.
5.
6.
The reaction and cycling conditions can be changed depending on the real-time reagents
and machine used, but this would require validation.
Optional: Perform PCR on the nucleic acid using the COX internal control primers
(Table 3), and using the components and concentrations listed in Table 12 and cycle
under the conditions listed in Table 10.
The following controls must be included for each set of reactions:
(a) Positive control: total DNA or a cloned fragment from the appropriate organism
may be used. If the internal control primers are not used, then the DNA must be
mixed with healthy Ipomoea DNA to rule out the presence of PCR inhibitors; and
(b) no template control: water is added instead of DNA template
When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy Ipomoea leaf tissue) is included.
Analyse real-time amplification data according to the real-time thermocycler
manufacturer‟s instructions.
Table 12: Real-time PCR reaction components for phytoplasma using
Roche LightCycler 480 Probes Mastermix
Reagent
Nuclease-free water
2 × Reaction Mix (Roche 04707494001)
10 µg/µl Bovine Serum Albumin (BSA) (Sigma A7888)
5 µM Forward primer (300 nM)
5 µM Reverse primer (300 nM)
5 µM Dual-labelled fluorogenic probe (100 nM)
DNA
Total volume
Volume per reaction (µl)
4.3
10.0
0.8
1.2
1.2
0.5
2.0
20.0
Interpretation of results for real-time PCR
The real-time PCR test will only be considered valid if:
(a) the positive control produces an amplification curve with the pathogen-specific
primers; and
(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative
control (if used) and the no template control.
If the COX internal control primers are also used, then the negative control (if used), positive
control and each of the test samples must produce an amplification curve. Failure of the
samples to produce an amplification plot with the internal control primers suggests that the
DNA extraction has failed or compounds inhibitory to PCR are present in the DNA extract or
the DNA has degraded. The effect of inhibitors may be overcome by adding Bovine Serum
Albumin (BSA) to a final concentration of 0.5µg/µl. Alternatively, DNA may be further
purified using MicroSpin™ S-300 HR columns (GE Healthcare Cat. No. 27-5130-01).
Phytoplasma positive controls for PCR
Positive control material for Sweetpotato little leaf phytoplasma (available as DNA) may be
obtained from MPI (see the Contact Point, section 8). A charge may be imposed to recover
costs.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
20
7.1.3.2.2.2 Sweetpotato little leaf phytoplasma
Plants must be tested for Sweetpotato little leaf phytoplasma using the universal primers
listed in Table 3. See section 7.1.3.2.1.2 for details of test methods and interpretation of
results.
7.1.3.2.3 Bacteria PCR
Recommended method bacteria: conventional PCR
1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol.
Successful PCR amplification can be achieved using the following DNA extraction
procedures:
(a) Qiagen DNeasy® Plant Mini Kit (Qiagen Cat. No. 69104); or
(b) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL
workstation.
2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers listed in Table 3
using the components and concentrations listed in Table 5 and cycled as shown in table 6.
3. Perform a PCR with bacteria-specific primers on the purified DNA using the components
and concentrations listed in Table 5. See Table 13, section 7.1.3.2.3.1 for details of PCR
cycling conditions. The following controls must be included for each set of PCR
reactions:
(a) positive control: total DNA or a cloned fragment from the appropriate organism may
be used. If the internal control primers are not used, then the DNA must be mixed
with healthy Ipomoea DNA to rule out the presence of PCR inhibitors;
(b) no template control: water is added instead of DNA template.
When setting up the test initially, it is advised that a negative control (DNA extracted
from healthy Ipomoea tissue) is included.
4. Analyse the PCR products by agarose gel electrophoresis.
Interpretation of results
The pathogen-specific PCR test will only be considered valid if:
(a) the positive control produces the correct size product as indicated in Table 3; and
(b) no bands are produced in the negative control (if used) and the no template control.
If the Gd1/Berg54 internal control primers are also used, then the negative control (if used),
positive control and each of the test samples must produce a 1500 bp band. Failure of the
samples to amplify with the control primers suggests that either the DNA extraction has
failed or compounds inhibitory to PCR are present in the DNA or the DNA has degraded. An
effective method to further purify the DNA is by using MicroSpin™ S-300 HR columns (GE
Healthcare Cat. No. 27-5130-01).
Bacterial positive controls for PCR
Positive control material for Dickeya chrysanthemi (available as DNA) may be obtained from
MPI (see the Contact Point, section 8). A charge may be imposed to recover costs.
7.1.3.2.3.1 Dickeya chrysanthemi
Plants must be tested for Dickeya chrysanthemi using the primer pairs ADE1/ADE2 and
recAF/recAR (Table 3). See section 7.1.3.2.3 for details of test methods and interpretation of
results. Please note that PCRs are cycled as shown in Tables 13 and 14.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
21
(a) Primers recAF/recAR (Waleron et al., 2002) detects bacteria at the generic level belonging
to the former Erwinia genus; however, sequencing of the resulting recA PCR product will
provide resolution to the sub-species level.
(b) Primers ADE1/ADE2 (Nassar et al., 1996) will detect pectinolytic strains of Dickeya
spp.
Table 13: Cycling conditions for Waleron et al., 2002 PCR
Step
Initial denaturation
Denaturation
Annealing
Elongation
Final elongation
Temperature
94oC
94oC
47ºC
72oC
72oC
Time
3 min
1 min
1 min
2 min
5 min
No. of cycles
1
35
1
Table 14: Cycling conditions for Nassar et al., 1996 PCR
Step
Initial denaturation
Denaturation
Annealing
Elongation
Final elongation
7.1.4
Temperature
94oC
94oC
72ºC
72oC
72oC
Time
3 min
1 min
1 min
2 min
5 min
No. of cycles
1
25
1
Bacterial isolation on media
Isolation of regulated bacteria from plants is a required test on the Ipomoea IHS. Plants
should be tested separately. Aseptic techniques should be used throughout the test procedure.
7.1.4.1 Dickeya chrysanthemi (basonym. Erwinia chrysanthemi)
Dickeya chrysanthemi primarily occurs on storage roots but the bacteria can also move into
the vascular tissues of the aerial parts of the plant and become systemic. For testing the aerial
parts of sweetpotato plants, leaf petioles and mid-veins (vascular strands) should be tested in
summer or under summer-like conditions. At least two fully expanded leaves must be
sampled from the indicator plant, one young leaf from the top of the plant and one older leaf
from a mid-way position. Leaves should be tested as soon as possible after removal from the
plant.
Recommended method
Macerate a small amount of tissue in 500 µl of sterile distilled water. Pipette 100 µl of
macerate into 5 ml of PT (pectate tergitol) broth and incubate anaerobically at 27°C for 48 h.
Undiluted broth (100 µl) and a 10-fold serial dilution of broth are spread onto crystal violet
pectate agar plates and incubated at 27°C for 3 days. Suspected pectolytic Dickeya can be
transferred to Potato Dextrose Agar (PDA) and colony morphology examined.
Interpretation of results
D. chrysanthemi bacteria are mottled, gram-negative, non-sporing, straight rods with rounded
ends. The bacteria can occur as single cells or in pairs. The average cell size is 1.8 × 0.6 µm
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
22
and the average number of peritichous flagellae is 8-11. On PDA media, depending on the
moisture content, young colonies can be circular, convex, smooth and entire, or sculptured
with irregular margins. After 4-5 days, both types of colonies resemble a fried egg, with a
pinkish, round, raised centre and a lobed periphery, which later becomes feathery.
7.1.5
Microscopic inspection for mites
Microscopic examination of plants for regulated mites is a required test on the Ipomoea IHS.
7.1.5.1 Tetranychus evansi
Recommended method
For each plant, use a hand lens to inspect the underside of all leaves for mite eggs, nymphs,
adults and symptoms of mite presence. Following this, for each plant, the 3 youngest leaves
of each plant plus any suspect leaves showing the presence of mites must be collected for
further examination using a binocular microscope. For species identification, both male and
female mites must be collected. Male mites should be mounted laterally onto a microscope
slide and female mites should be mounted dorsally to expose the diagnostic characters. To
improve transparency, the mites can be cleared in lactic acid under a table lamp prior to
mounting.
Interpretation of results
If mites are present the following symptoms may be observed on the underside of leaves;
webbing, distinct small yellow spots (which get larger over time), leaf browning and in
extreme cases the leaves may shrivel up and die. Overall, plant vigour and growth may be
affected (Fig. 1.4).
Mites of the Tetranychus genus can be green, yellow, orange or red in colour. Adult males
are smaller than the females for all Tetranychus spp. T. evansi female mites are reddish in
colour and the males are straw-coloured with a more pointed abdomen (Fig. 1.3).
Species level identification requires examination of the male aedeagus (i.e. the male
genitalia). For T. evansi, the male adeagus will appear upright at a 90ºC angle.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
23
8.
CONTACT POINT
This manual was developed by:
Dr Lisa Ward
Plant Health & Environment Laboratory,
Investigation and Diagnostic Centres and Response,
Ministry for Primary Industries (MPI),
231 Morrin Road,
St Johns,
PO Box 2095,
Auckland 1140
Tel: +64 9 909 3015
Fax: +64 9 909 5739
Email: [email protected]
Website: http://www.biosecurity.govt.nz/regs/imports/plants/high-value-crops
9.
ACKNOWLEDGEMENTS
We would like to acknowledge the following people who contributed to the preparation of
this manual:
Mr John Fletcher (The New Zealand Institute for Plant & Food Research Ltd, Lincoln,
New Zealand) for drafting the introduction and propagation sections of the manual, for
valuable discussion and advice on sweetpotato viruses, and for providing photographs of
virus-infected sweetpotato.
Dr Chris Clark and Ms Mary Hoy (Louisiana State University, USA) for valuable
discussion on sweetpotato viruses, for supplying isolates of SPV2 and SPLCV, and for
supplying several photographs of virus-infected I. batatas and I. setosa.
Dr Steve Lewthwaite (The New Zealand Institute for Plant & Food Research Ltd,
Pukekohe, New Zealand) for providing the front cover image of the sweetpotato cultivar
'Radical' (the first New Zealand sweetpotato cultivar to receive plant variety rights) and
for providing information on seed propagation.
Dr Segundo Fuentes (International Potato Centre (CIP), Peru) for valuable discussion on
sweetpotato viruses.
Ms Susan Sim (Foundation Plant Services, University of California, Davis, USA) for
valuable advice on graft inoculation.
Dr Karen Gibb (Charles Darwin University, Australia) for supplying phytoplasma DNA
and the photograph of the Sweetpotato little leaf phytoplasma.
The American Phytopathological Society (APS) for permission to use images from the
Diseases of Root and Tuber Crops CD-Rom, 2000, St Paul, MN, USA.
10.
REFERENCES
Ahrens, U; Seemüller, E (1992) Detection of DNA of plant pathogenic mycoplasma-like
organisms by a polymerase chain reaction that amplifies a sequence of the 16S rRNA gene.
Phytopathology 82: 828-832.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
24
Andersen, M T; Beever, R E; Gilman, A C; Liefting, L W; Balmori, E; Beck, D L;
Sutherland, P W; Bryan, G T; Gardner, R C Forster, R L S (1998) Detection of Phormium
yellow leaf phytoplasma in New Zealand flax (Phormium tenax) using nested PCRs. Plant
Pathology 47: 188-196.
Chen, J; Chen, J; Adams, M J (2001) A universal PCR primer to detect members of the
Potyviridae, and its use to examine the taxonomic status of several members of the family.
Archives of Virology 146: 757-766.
Christensen, N M; Nicolaisen, M; Hansen, M; Schulz, A (2004) Distribution of phytoplasmas
in infected plants as revealed by real-time PCR and bioimaging. Molecular Plant Microbe
Interactions 17: 1175-1184.
Clark, C A; Moyer, J W (1988) Compendium of sweetpotato diseases. The American
Phytopathological Society Press.
Deng, S; Hiruki, D (1991) Amplification of 16S rRNA genes from culturable and
nonculturable mollicutes. Journal of Microbiological Methods 14: 53-61.
Fletcher, J D; Lewthwaite, S L; Fletcher, P J; Dannock, J (2000) Sweetpotato (Kumara) virus
disease surveys in New Zealand. International Workshop on Sweetpotato Cultivar Decline
Study, Miyakonojo, Japan.
Kirkpatrick, B C; Stenger, D C; Morris, T J; Purcell, A H (1987) Cloning and detection of
DNA from a nonculturable plant pathogenic mycoplasma-like organism. Science 238: 197200.
Kokkinos, C D; Clark, C A (2006) Real-time PCR assays for detection and quantification of
sweetpotato viruses. Plant Disease 90:783-788.
Lee, I M; Hammond, R W; Davis, R E; Gundersen, D E (1993) Universal amplification and
analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike
organisms. Phytopathology 83: 834-842.
Lewthwaite, S L (1997) Commercial sweetpotato production in New Zealand: foundations
for the future. In: Proceedings of the International Workshop on Sweetpotato production
System toward the 21st Century, Miyakonojo, Miyazaki, Japan, (eds, D R La Bonte;
Yamashita, M; Mochida, H), Kyushu National Agricultural Experiment Station, Japan. p. 3350.
Li, R; Salih, S; Hurtt, S (2004) Detection of geminiviruses in sweetpotato by polymerase
chain reaction. Plant Disease 88: 1347-1351.
Marie-Jeanne, V; Ioos, R; Peyre, J; Alliot, B; Signoret, P (2000) Differentiation of Poaceae
Potyviruses by reverse transcription-polymerase chain reaction and restriction analysis.
Journal of Phytopthaology 148: 141-151.
Menzel, W; Jelkmann, W; Maiss, E (2002) Detection of four apple viruses by multiplex RTPCR assays with coamplification of plant mRNA as internal control. Journal of Virological
Methods 99: 81-92.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
25
Nassar, A; Darrasse, A; Lemattre, M; Kotoujansky, M;. Dervin, A; Vedel, R; Bertheau, Y
(1996) Characterisation of Erwinia chrysanthemi by pectinolytic isozyme polymorphism and
restriction fragment length polymorphism analysis of PCR-amplification fragments of pel
genes. Applied and Environmental Microbiology 62: 2228-2235.
Saladaga, F A; Takagi, H; Cherng, S J; Opena, R T (1991) Handling and selecting improved
clones from true seed populations of sweetpotato. Asian Vegetable Research and
Development Centre International Cooperator’ Guide 91: 384.
Schneider, B; Seemüller, E; Smart, C D; Kirkpatrick, B C (1995) Phylogenetic classification
of plant pathogenic mycoplasma-like organisms or phytoplasmas. In Razin, S & Tully, J G
(eds) Molecular and Diagnostic Procedures in Mycoplasmology, Vol. 1. Academic Press,
San Diego, CA; p. 369-380.
Univertos, M; Perez-Egusquiza, Z; Clover, G R (2010) PCR assays for the detection of
members of the genus Ilarvirus and family Bromoviridae. Journal of Virological Methods
165: 97-104
Waleron, M; Waleron, K; Podhajska, A.J; Kojkowska, E (2002) Genotyping of bacteria
belonging to the former Erwinia genus by PCR-RFLP analysis of a recA gene fragment.
Microbiology 148: 583-595.
Weller, S A; Elphinstone, J G; Smith, N C; Boonham, N; Stead, D E (2000) Detection of
Ralstonia solanacearum strains with a quantitative multiplex real-time, fluorogenic PCR
(TaqMan) assay. Applied and Environmental Microbiology 66: 2853-2858.
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
26
Appendix 1. Symptoms of significant regulated pests of Ipomoea batatas
(a)
1.1 Meliodogyne incognita
(b)
(a) Galls and egg masses produced by M. incognita on fibrous roots; (b) cracking of fleshy storage roots
associated with injury by M. incognita. (Courtesy W.J. Martin (a) & G.W. Lawrence (b) reproduced with
permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA).
1.2
Rotylenchulus reniformis
Cracking of fleshy storage roots associated with injury by R. reniformis (Courtesy C.A. Clark reproduced with
permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA).
1.3 Tetranychus evansi
T. evansi mites, male (left) and female (right).
(Courtesy EcoPort http://www.ecoport.org
: image 13039, E.A. Ueckerman).
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
1.4 Plant damage caused by mites
Plant damage caused by feeding Tetranychus
evansi (Courtesy EcoPort http://www.ecoport.org
: image 13043, ARC-PPRI)
27
.
1.5 Streptomyces ipomoea
(a)
(b)
(a) Soil pox lesions caused by S. ipomoea on storage roots of I. batatas clone L4-89 (b) I. batatas rootlet rot on
sweetpotato fibrous roots, caused by S. ipomoea. (Courtesy W.J. Martin (a) & (b) reproduced with permission
from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA).
1.6 Elsinoë batatas
1.7 Dickeya chrysanthemi
Petiole and stem lesions on I. batatas caused by
Elsinoë batatas. (Courtesy R. Gapsin reproduced
with permission from the Diseases of Root and
Tuber Crops CD-ROM, 2002, APS, St Paul, MN,
USA).
Bacterial rot on I. batatas „Jewel‟ storage root
caused by Dickeya chrysanthemi. (Courtesy C. A.
Clark reproduced with permission from the
Diseases of Root and Tuber Crops CD-ROM, 2002,
APS, St Paul, MN, USA).
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
28
1.8 Ipomoea batatas infected with a mixture of viruses
Leaf symptoms on I. batatas „Toka Toka Gold‟ infected with Sweetpotato feathery mottle virus, Sweetpotato
chlorotic fleck virus, and Sweetpotato virus C6. (Courtesy J. Fletcher, The New Zealand Institute for Plant &
Food Research Ltd, Lincoln, New Zealand).
1.9 Sweetpotato chlorotic stunt virus
1.10
Interveinal purpling on Regal sweetpotato infected
with the „White Bunch‟ or „US‟ strain of
Sweetpotato chlorotic stunt virus (Courtesy C.
Clark, Louisiana State University., USA).
Sweetpotato leaf curl virus symptoms in plant bed
on sweetpotato line W-359 (Courtesy C. Clark,
Louisiana State University, USA).
1.11
Sweetpotato leaf curl virus
Sweetpotato little leaf phytoplasma
Sweetpotato little leaf phytoplasma infecting I.
batatas „LO323‟. (Courtesy K. Gibb, Charles
Darwin University, Australia).
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
29
Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa
2.1 Sweetpotato chlorotic stunt virus +
Sweetpotato feathery mottle virus
2.2 Sweetpotato virus 2
Symptoms on Ipomoea setosa inoculated with the
„White Bunch‟ or „US‟ strain of Sweetpotato
chlorotic stunt virus and the russet crack strain of
Sweetpotato feathery mottle virus (Courtesy C.
Clark, Louisiana State University, USA).
Initial symptoms of Sweetpotato virus 2 in Ipomoea
setosa (Courtesy C. Clark, Louisiana State
University, USA).
2.3 Sweetpotato virus C6
Symptoms induced in Ipomoea setosa by C6 virus
(Courtesy C. Clark, Louisiana State University, USA).
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
30
2.4 Sweetpotato leaf curl virus
2.5 Sweetpotato leaf curl virus + Sweetpotato
virus 2
Ipomoea setosa infected with SWFT-1 showing leaf
curling (Courtesy C. Clark, Louisiana State University,
USA).
Ipomoea setosa infected with SPLCV (SWFT-1) and
SPV-2 (LSU-2) showing prominent leaf curling
(Courtesy C. Clark, Louisiana State University, USA).
2.6 Sweetpotato leaf curl virus + Sweetpotato feathery mottle virus
Ipomoea setosa showing leaf rolling, chlorosis and
interveinal necrosis after being grafted with a sweetpotato, infected
with SPLCV and SPFMV-Russet Crack
(Courtesy C. Clark, Louisiana State University, USA).
31
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
Appendix 3. Protocols referenced in manual
3.1
Silica-milk RNA extraction protocol (Menzel et al., 2002)
1. Grind 0.2-0.5 g leaf tissue (1/10; w/v) in RNA extraction buffer (6 M guanidine
hydrochloride, 0.2 M sodium acetate, 25 mM EDTA, 2.5% [w/v] PVP-40 adjusted to pH 5
with acetic acid).
2. Transfer 500 µl of the homogenised extract to a micro-centrifuge tube containing 100 µl of
10% (w/v) SDS.
3. Incubate at 70oC for 10 minutes with intermittent shaking, and then place on ice for 5
minutes.
4. Centrifuge at 13,000 rpm for 10 minutes.
5. Transfer 300 µl supernatant to a new micro-centrifuge tube and add 300 µl high salt buffer
(6 M sodium iodide, 0.15 M sodium sulphite), 150 µl absolute ethanol and 25 µl silica milk
(1 g/ml silicon dioxide, 1-5 µM size particles, suspended in 100 mM glycine, 100 mM NaCl,
100 mM HCl, pH 2).
6. Incubate at room temperature for 10 minutes with intermittent shaking.
7. Centrifuge at 3,000 rpm for 1 minute and discard the supernatant.
8. Resuspend the pellet in 500 µl of wash buffer (10 mM Tris-HCl pH 7.5, 0.05 mM EDTA, 50
mM NaCl, 50% [v/v] absolute ethanol), centrifuge at 3,000 rpm for 1 minute and discard the
supernatant. Repeat this wash step.
9. Centrifuge at 3,000 rpm for 1 minute and remove any remaining wash buffer from the pellet.
10. Resuspend the pellet in TE buffer (10mM Tris-HCl pH 7.5, 0.05 mM EDTA).
11. Incubate at 70oC for 4 minutes then centrifuge at 13,000 rpm for 5 minutes.
12. Transfer 100 µl of the supernatant to a sterile nuclease-free micro-centrifuge tube, being
careful not to disturb the pellet. Store at -80oC.
3.2
Phytoplasma DNA enrichment CTAB extraction protocol (Kirkpatrick et al., 1987 and
modified by Ahrens & Seemüller, 1992)
1. Grind approximately 0.3 g tissue (petioles, veins) in 3 ml ice-cold isolation buffer (0.1 M
Na2HPO4, 0.03 M NaH2PO4, 10 mM EDTA (pH 8.0), 10% (w/v) sucrose, 2% (w/v) PVP-40;
Adjust pH to 7.6 and filter sterilise. Just prior to use add 0.15% (w/v) Bovine Serum
Albumin (BSA) and 1 mM ascorbic acid).
2. Transfer crude sap to a cold 2 ml micro-centrifuge tube.
3. Centrifuge at 4ºC for 5 min at 4500 rpm.
4. Transfer supernatant into a clean 2 ml micro-centrifuge tube.
5. Centrifuge at 4ºC for 15 min at 13000 rpm.
6. Discard the supernatant.
7. Resuspend the pellet in 750 µl of hot (55º C) CTAB buffer (2% (w/v) CTAB, 100 mM TrisHCl [pH 8.0], 20 mM EDTA [pH 8.0], 1.4 M NaCl, 1% (w/v) PVP-40). The pellet is
easier to resuspend in a smaller volume of CTAB buffer (e.g. 100 µl) then the remaining
volume of CTAB buffer is added (e.g. 650 µl).
8. Incubate tubes at 55 ºC for 30 min with intermittent shaking.
9. Cool the tubes on ice for 30 sec.
10. Add 750 µl chloroform:octanol (24:1 v/v) and vortex thoroughly.
11. Centrifuge at 4ºC or at room temperature for 4 min at 13000 rpm.
12. Carefully remove upper aqueous layer into a clean 1.5 ml micro-centrifuge tube.
13. Add 1 volume ice-cold isopropanol and vortex thoroughly.
14. Incubate on ice for 4 min.
15. Centrifuge at 4ºC or at room temperature for 10 min at 13000 rpm.
16. Discard supernatant.
32
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012
17. Wash DNA pellets with 500 µl ice-cold 70% (v/v) ethanol, centrifuge at 4oC or at room
temperature for 10 min at 13000 rpm.
18. Dry DNA pellets in the DNA concentrator or air-dry.
19. Resuspend in 20 µl sterile distilled water. Incubating the tubes at 55 oC for 10 min can aid
DNA resuspension.
20. Store DNA at -20ºC for short-term storage or -80ºC for long-term storage.
33
Ipomoea Post-Entry Quarantine Testing Manual ∙ November 2012