1632-1636
© 1994 Oxford University Press
Nucleic Acids Research, 1994, Vol. 22, No. 9
Heteroduplex molecules formed between allelic sequences
cause nonparental RAPD bands
Michael A.Ayliffe*, Greg J.Lawrence, Jeff G.Ellis and Anthony J.Pryor
CSIRO Division of Plant Industry, PO Box 1600 and Plant Science Centre, PO Box 475, Canberra,
ACT 2601, Australia
Received January 28, 1994; Revised and Accepted April 8, 1994
ABSTRACT
Primers (10-mers) of random sequence were used to
amplify RAPD bands from genomic DNA of an F1 strain
of flax rust (Melampsora lini) and its two parent strains.
One primer out of 160 tested was unusual in that it
amplified a product from F1 DNA that was not amplified
from either parental DNAs. The same primer also
generated two RAPD bands that segregated as
codominant alleles amongst F2 progeny. The
nonparental band was only generated from DNAs of F2
individuals that were heterozygous for these two allelic
sequences. Sequence analysis of the two RAPD alleles
demonstrated greater than 99% sequence identity,
although the larger allele possessed an additional 38bp
relative to the smaller. Mixing of the two allelic
sequences followed by denaturation and annealing in
the absence of polymerase activity resulted in the
formation of the nonparental band. Thus the
nonparental band present in some RAPD reactions
consisted of a heteroduplex molecule formed between
two allelic sequences of different size. These data
demonstrate that heteroduplex molecules formed
between allelic RAPD products are a potential source
of artifactual polymorphism that can arise during RAPD
analysis.
markers. Often RAPD markers are derived from repetitive DNA
sequences making them unsuitable as locus specific hybridization
probes without more substantial analysis. Furthermore
reproducability between RAPD reactions can be difficult to
maintain as minor changes in reaction conditions can significantly
affect the amplification products.
A disturbing aspect of RAPD analysis is the amplification of
RAPD bands from progeny DNA that are not amplified from
parental DNAs. Such nonparental RAPD bands were first
reported in offspring from both baboon and human CEPH
pedigrees (10). Subsequently RAPD analysis in honey bees
identified bands present in diploid workers and queens that were
absent in haploid drones (11). Mixing amplification products
obtained from haploid drones in the absence of polymerase
activity resulted in the formation of 'diploid specific' bands,
suggesting the formation of sequence heteroduplexes between
allelic PCR products (11).
In this paper we describe the PCR amplification of a RAPD
band from an Fl progeny DNA of the flax rust fungus,
Melampsora lini (Ehrenb.) Lev., that was not amplified from
either parental DNAs. Subsequently we show that this nonparental
product is a heteroduplex molecule formed by the annealing of
two amplified allelic sequences which differ in length.
Heteroduplex molecules therefore represent a PCR artifact
potentially capable of confusing RAPD based analysis.
INTRODUCTION
Random amplification of polymorphic DNA (RAPD) analysis
( 1 , 2 ) has emerged as a powerful technique for detection of
sequence polymorphism. Consequently it has found use in a
variety of applications including mapping (3, 4, 5), species and
varietal identification (6, 7, 8) and parentage analysis (9). The
RAPD technique is fast, technically simple to perform and
requires minimal amounts of DNA. A single primer generally
identifies multiple loci and prior sequence knowledge is not a
prerequisite.
However this technology does have some limitations. In general
RAPD markers are dominant (1) thereby decreasing information
ascertainment during linkage analysis, when compared with
codominant restriction fragment length polymorphism (RFLP)
*To whom correspondence should be addressed
MATERIALS AND METHODS
Materials
Taq DNA polymerase was obtained from Boehringer-Mannheim
and deoxynucleoside triphosphates obtained from Pharmacia.
Mung bean nuclease was obtained from Promega and digestions
carried out as recommended by the supplier.
RAPD primers
Oligonucleotide primers 10 bases in length were obtained from
Operon Technologies Inc. (Alameda, California). Primer F-05
used in this study has a 5' to 3' sequence of CCGAATTCCC.
The iscoRI site in this primer is underlined.
Nucleic Acids Research, 1994, Vol. 22, No. 9 1633
1
2
3
4
S
6
7
8
9 10 11 12 13 14 I S 16 17
18 19
202122232425262728293031323334
1 2 3
Figure 1. a. 1.5% agarose gel of PCR products amplified from M.lini DNAs using Operon RAPD primer F-05. Lanes (1), (2) and (3) contain PCR products amplified
from genomic DNA of strains C, CH5 (Fl) and H respectively. Lanes (4)-(34) contain PCR products amplified from 31 individual F2 DNAs. The PCR reaction
shown in lane (16) was unsuccessful. No amplification products were made from a PCR reaction lacking template DNA (not shown). Bands x, y and z described
in the text are indicated. (NB. band y appears faintly in lane 17). b. Autoradiograph showing hybridization of the nonparental band (band x) to a Southern blot
of bands x, y and z shown in the first three lanes of figure la.
Fungal strains
A detailed description of the origin and pathogenicity of
Melampsora lini strains used in this analysis is provided by
Lawrence et al. (12). Briefly two M.lini strains, C and H, were
crossed to give an Fl strain, designated CH5. Subsequently strain
CH5 was self fertilized to generate an F2 family of 80 individuals.
DNA was extracted from both parental strains, CH5 and 30 of
the F2 individuals and subsequently used for RAPD analysis.
DNA extraction
Urediospores were germinated overnight on the surface of a tray
of water at a temperature less than 22 °C. Germinated spores were
frozen in liquid nitrogen, ground in a mortar and pestle and
thawed in several volumes of 250mM Tris-HCl pH 8.0, 200mM
NaCl, 25mM EDTA, 1% SDS and 200/tM /3-mercaptoethanol.
The crude lysate was phenol/chloroform/isoamyl alcohol
extracted several times and nucleic acids ethanol precipitated (13).
Following proteinase K and RNAse A treatment the DNA was
passed through a 1 ml sepharose CL-4B column (Sigma Chemical
Co.), ethanol precipitated and dissolved in sterile distilled water
at a concentration of approximately 20jtg/ml.
PCR conditions
PCR reactions were carried out in a final volume of 10/xl and
contained 20ng of genomic DNA, 0.125/iM dNTPs, 50mM KC1,
lOmM Tris-HCl pH 8.3, 1.8mM MgCl2, 0.5/iM of RAPD
primer and 1U of Taq DNA polymerase. Reactions were
performed in a Corbett FTS-1S capillary fast thermocycler
(Corbett Research, Australia) under the following regime: cycle
1; 95°C for 5 minutes, 40°C for 2 minutes, 72°C for 3 minutes;
cycle 2 - 4 4 : 95°C for 10 seconds, 40°C for 10 seconds, 72°C
for 50 seconds; cycle 45: 95°C for 10 seconds, 40°C for 10
seconds, 72°C for 5 minutes.
Cloning and sequencing
RAPD products amplified by primer F-05 were restricted with
EcoRl and separated by agarose gel electrophoresis. Bands of
interest were cut out of the gel and fragments isolated by the
1634 Nucleic Acids Research, 1994, Vol. 22, No. 9
h
c
GAATTOCCAOAAATaQXTOAOOOCTTOOTAOCOOCACTTCAAOCCCTAaA
h CAAAOAA
TAAOC
C
ACTCQAACTATCCaAAGCTOAAQOQTOCOTACTTCCTCTT
h
c
CACCTOQAOTCATCATTSAOTTCATTCACAACOOCAAAAATATAAOACOC
h
C
TCOCOOATCCAOOOaCCQAAATC3VTTCTCTTAACAOAACAOOCOOCAOAT
C
h
TOTCTTSAOCTCCOAAACCCOAAACTCATOAAACCAATOCAOCTTAOCCT
c
h
c
COCOOTCAACACTOAOTCACCaOCTCCCACCCTOATACACTTCACCACCO
h
TCQACCTOOTTOAACAAACTTCACAAAAAATATTCACCAOOACOTACTOC
c
h
AAOCTOOOOOAATTC
C
Figure 2. DNA sequence comparisions between allelic PCR products amplified
with primer F-05 from genomic DNA of strains C and H. Identical nucleotides
are indicated by ' - ' in the strain C sequence. The allele from strain C can be
seen to contain an additional 38bp relative to the strain H allele. Four base pair
inverted repeats flanking these additional nucleotides are marked with arrows.
Two clones of each allele were sequenced.
freeze squeeze method of Thuring et al. (14). Purified inserts
were cloned into the EcoKL site of pUC19 and double stranded
DNA templates sequenced using a PRISM™ dye primer cycle
sequencing kit (Applied Biosystems) and Applied Biosystems
373A automated DNA sequencer.
RESULTS
M.lini, the causal agent of rust in flax, is a dikaryotic
basidiomycete fungus whose lifecycle includes both a sexual and
asexual cycle. During work aimed at identifying molecular
markers linked to avirulence genes in this species 160 random
10-mer primers were used to amplify PCR fragments from
genomic DNA of an Fl rust strain (CH5) and the parental strains
(C and H) from which CH5 was derived (manuscript in
preparation). Fifty two of these primers detected one or more
RAPD polymorphisms between the parental DNAs that were
inherited by the Fl. These fifty two primers produced 98 RAPD
markers that segregated within an F2 family.
One primer (Operon primer F-05) produced an unexpected
result. This primer amplified a conspicuous RAPD band from
F l DNA that was not amplified from either of the parental DNAs
(Fig. la, band x). This was the sole instance amongst the 160
primers employed where a nonparental band was amplified from
Fl DNA. The production of this nonparental band was
independent of magnesium concentration as the band was present
in PCR reactions containing 1.5, 1.8, 2 and 2.5mM MgCl2(not
shown). Magnesium ions can affect a variety of PCR reaction
parameters including product specificity and the formation of
primer-dimer artifacts (1). The presence of the nonparental band
under a range of magnesium concentrations suggests that it was
likely to be derived from bona fide amplification products.
Primer F-05 also detected two other polymorphisms between
the parental DNAs (Fig. la, bands y and z). Band y was amplified
from DNA of strain C (Fig. la, lane 1) and not from strain H
DNA (Fig. la, lane 3) while for band z a reciprocal pattern of
1
2
3
x
y
z
X
y
• z
Figure 3. a. A heteroduplex molecule with an altered electrophoretic mobility
is shown on a 2% agarose gel. Allelic RAPD sequences cloned into pUC19 were
amplified using the M13 universal foward and reverse sequencing primers. A
portion of the PCR product derived from the cloned large and small allele were
loaded into lanes (1) and (3) respectively. Upon phenol/chloroform/isoamyl alcohol
extraction of these amplification products equal amounts of each were pooled,
denatured and annealed as described in the text. A sample of the annealing reaction
was loaded into lane (2). b. Mung bean nuclease treatment eliminates the
heteroduplex band. PCR products amplified from the cloned large (lane 1, band
y) and small (lane 3, band z) allelic sequences were denatured and reannealed
to form the heteroduplex molecule (lane 2, band x). After treatment of the annealed
sample with 5U of mung bean nuclease for 20 minutes at 37°C the heteroduplex
molecule (band x) can no longer be observed (lane 4).
amplification was observed amongst parental DNAs (Fig. la,
lanes 1 and 3). Both bands y and z were inherited by the Fl.
The segregation of of each of these RAPD products was
analysed amongst 30 F2 progeny. Band y segregated 20:10
(presence versus absence of band) while band z segregated 23:7.
Both these segregation patterns are consistent with the 3:1 ratio
expected for dominantly inherited RAPD products, with x2
values of 1.11 (0.2<p<0.3) and 0.04 (0.8<p<0.9) obtained
for each band respectively. Bands y and z showed a cosegregation
ratio of 7:14:9 (y:yz:z) which fits a 1:2:1 ratio (x 2 =0.4,
0.8<p<0.9) suggesting that these products are allelic.
However the segregation pattern of band x was unusual as this
band was amplified from only 14 of the 30 F2 DNA samples
analysed. This segregation pattern differs significantly from a
3:1 ratio (x2 = 12.84, p<0.01) but fits a 1:1 ratio (x 2 =0.13,
0.7<p<0.8). Analysis of the segregation pattern showed that
band x only occurred when both bands y and z were also present
(Fig. la). The genetic data therefore supports the hypothesis that
bands y and z are allelic and that band x results from a physical
interaction between these two alleles.
Sequence similarity between these three bands (x, y and z) was
confirmed by Southern hybridization. Band x was radioactively
labelled and used as a hybridization probe to a Southern blot of
the agarose gel shown in figure la. All three bands were detected
by the probe (Fig. lb).
Bands y and z were cloned into the EcoKL site of pUC19.
Sequence analysis revealed greater than 99% sequence homology
between these two products consistent with allelism (Fig. 2). The
larger product inherited from strain C (band y) contained an
additional 38bp relative to the smaller allele derived from strain
H (band z) (Fig. 2). Flanking the additional 38bp in band y are
a pair of 4bp inverted repeats (Fig. 2). Short repeat motifs are
often implicated in sequence rearrangement suggesting that a
deletion event may have been responsible for the evolution of
the smaller allele (band z) (16, 17)
Both cloned sequences were amplified by PCR using the M13
universal forward and reverse sequencing primers and the
resultant products were extracted with phenol/chloroform/isoamyl
alcohol to remove polymerase activity. PCR products derived
from each clone were mixed and subjected to a single PCR
Nucleic Acids Research, 1994, Vol. 22, No. 9 1635
amplification cycle consisting of: 94°C for 1 minute, 40°C for
1 minute and 72 °C for 5 minutes in the absence of Taq DNA
polymerase. After agarose gel electrophoresis it was apparent
that these two allelic sequences could form a heteroduplex
molecule with a reduced electrophoretic mobility (Fig. 3a).
Reduced mobility was presumably the result of the heteroduplex
molecule containing a single stranded loop produced by the
additional 38bp present in band y. The presence of a single
stranded loop in the heteroduplex molecule was confirmed by
mung bean nuclease treatment which eliminated band x while
bands y and z were essentially unaffected (Fig. 3b).
DISCUSSION
Heteroduplex formation between allelic RAPD products was
responsible for the nonparental band identified in this study. The
formation of nonparental bands in RAPD based PCR reactions
is likely to be infrequent because several criteria must be met
to enable a heteroduplex molecule to be observed. Firstly, in
general RAPD markers are dominant and only rarely are allelic
sequences of different length both amplified to produce
codominant markers (1) thereby decreasing the likelihood of
heteroduplex formation. For a heteroduplex molecule to be
observable it must be derived from relatively abundant
amplification products as the heteroduplex is formed from only
a proportion of these products. In addition the heteroduplex
molecule must have an altered electrophoretic mobility relative
to the allelic sequences from which it is derived. Presumably this
altered mobility is a function of the total length difference existing
between the allelic sequences. Alternatively two allelic sequences
identical in length but differing by an inversion could potentially
produce a heteroduplex molecule with a unique electrophoretic
mobility. The amount of sequence similarity existing between
allelic amplification products would also affect the stability of
the heteroduplex and hence the likelihood of its formation.
The heteroduplex molecule identified in this study was
occasionally absent in some experiments. However in those
experiments where this band was present, it was always found
in the same individuals (ie. strain CH5 and heterozygous F2
individuals) and always occurred in all of these individuals during
the same experiment. Presumably very minor changes in reaction
conditions influence the formation and/or stability of this
molecule.
Only a single nonparental band was amplified from the 160
RAPD primers screened against the M.lini pedigree. Assuming
that on average four PCR products were amplified per primer,
of the 640 bands generated only 0.16% were detected as
nonparental. A low frequency of nonparental bands was also
generated amongst siblings of Nicrophorus tomentosus (burying
beetles) and Fragaria vesca (strawberries) (9). However in this
latter study nonparental bands, when observed, occurred in very
few siblings and did not show a 1:1 segregation ratio as would
be expected if they arose from heteroduplexes formed between
allelic sequences in heterozygous individuals. In contrast, an
average of 2.7 and 4.4 nonparental bands were generated per
primer from five 10-mer primers of random sequence screened
against baboon and human pedigrees respectively (10). A lower
frequency of such bands was identified amongst honey bee
progeny where 10% of segregating markers examined appeared
to arise from heteroduplex formation (11).
RAPD analysis of honey bee progeny demonstrated that a
'diploid specific' RAPD band could be generated by annealing
RAPD products derived from haploid drones that possessed
alternate RAPD alleles (11). Three other RAPD primers produced
nonparental bands in diploid female progeny that were absent
in both parental strains and haploid male drones (11). These
anomalous bands were suggested to be heteroduplex molecules
formed between alternate RAPD alleles (11). We have taken this
observation further by cloning two RAPD alleles putatively
responsible for the formation of a nonparental band and
demonstrated that these two alleles can produce a heteroduplex
molecule that is identical to the nonparental band observed in
RAPD reactions of total genomic DNA. Furthermore the reduced
electrophoretic mobility of the nonparental band was shown to
be due to the presence of a single stranded loop in the
heteroduplex molecule that could be removed with mung bean
nuclease treatment.
The amount of heterozygosity existing between parental strains
could presumably account for the observed frequency variation
of nonparental bands amongst different species. However one
third of all primers screened against the M. lini pedigree in this
study detected at least one sequence polymorphism that segregated
in the F2 family, suggesting a reasonable amount of sequence
heterogeneity between the two parental strains. Consequently the
variable frequency of nonparental bands, observed amongst
pedigrees of different species, may reflect differences in the
frequency of minor deletions and insertions in these species that
give rise to length polymorphisms in allelic RAPD products.
Alternatively other as yet undetermined mechanisms could give
rise to nonparental RAPD products. Potentially nonallelic
amplification products with high sequence homology could also
form heteroduplex structures. These structures may occur more
frequently in polyploid species and in organisms with a high level
of repeated DNA.
The production of nonparental RAPD bands from progeny
DNAs has raised questions about the suitability of this technique
for some analyses. The presence of such artefacts could obviously
affect conclusions regarding parentage. Heteroduplex bands could
also significantly affect RAPD based calculations of genetic
distance between species and varieties (18), particularly amongst
outcrossing, highly polymorphic species. In cases where the
frequency of heteroduplex formation is low (eg. M.lini) the
RAPD technique would seem applicable for such analyses.
However when the frequency of these aberrant products is high,
as found in baboon and human pedigrees (10), RAPD products
should be separated on denaturing gels to ensure the accuracy
of the analysis.
REFERENCES
1. Williams,J.G.K.. Kubelik.A.R., Livak.K.J., Rafalski.J.A., Tingey.S.V.
(1990) Nucleic Acids Res., 18, 6531-6535.
2. Welsh.J., McClelland.M. (1990) Nucleic Acids Res., 18, 7213-7218.
3. Carlson,J.E., Tulsieram.L.K., Glaubitz,J.C, Luk.V.W.K., Kauffeldt.C,
Rutledge.R. (1991) Theor. Appl. Genet., 83, 194-200.
4. Echt.C.S., Erdahl.L.A., McCoy,T.J. (1992) Genome, 35, 84-87.
5. Reiter.R.S., Williams.J.G.K., Feldmann.K.A., Rafalski.J.A., Tingey.S.V.,
Scolnik.P.A. (1992) Pro. Nail. Acad. Set. USA, 98, 1477-1481.
6. Harrison.S.P., Mytton,L.R., Skot,L., Dye.M., Cresswell.A. (1992) Can.
J. Microbiol., 38, 1009-1015.
7. Guthrie,P.A.I., Magill,C.W., Frederiksen,R.A., Odvody.G.N. (1992)
Phytopathology, 82, 832-835.
8. Cenis.J.L. (1993) Phytopathology, 83, 76-78.
9. Scott.M.P., Haymes,K.M., Williams,S.C. (1992) Nucleic Acids Res., 20,
5493.
10. Reidy.M.F., HamiIton,W.J., Aquadro.C.F. (1992) Nucleic Acids Res., 20,
918.
1636 Nucleic Acids Research, 1994, Vol. 22, No. 9
11. Hunt,G.J., Page.R.E. (1992) Theor. Appl. Genet., 85, 15-20.
12. Lawrence,G.J., Mayo.G.M.E., Sheperd.K.W. (1981) Phytopathology, 71,
12-19.
13. Maniatis.T., Fritsch,E.F., Sambrook.J. (1982) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbour University Press, Cold Spring
Harbour.
14. Thuring.R.W.J., Sanders,J.P.M., Borst,P. (1975) Anal. Biochem., 66,
213-220.
15. Innis.M.A., Gelfand.D.H. (1990) In Innis,M.A., Gelfand,D.H., Sninsky,J.J.,
White,T.J. (ed.) PCR Protocols - A guide to methods and applications.
Academic Press,Inc, San Diego.
16. Albertini,A.M., Hofer.M., Calos,M.P., Miller,J.H. (1982) Cell, 29,
319-328.
17. Nags.D.K., Petes.T.D. (1991) 77G, 7, 1-4.
18. Demeke.T., Adams,R.P., Chibbar,R. (1992) Potential taxonomic use of
random amplified polymorphic DNA (RAPD): a case study in Brassica.
Theor. Appl. Genet., 84, 990-994.