[CANCER RESEARCH 61, 2343–2355, March 15, 2001]
Review
The BCR Gene and Philadelphia Chromosome-positive Leukemogenesis
Eunice Laurent, Moshe Talpaz, Hagop Kantarjian, and Razelle Kurzrock1
Departments of Bioimmunotherapy [E. L., M. T., R. K.] and Leukemia [H. K., R. K.], University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Introduction
Recent investigations have rapidly added crucial new insights into
the complex functions of the normal BCR gene and of the BCR-ABL
chimera and are yielding potential therapeutic breakthroughs in the
treatment of Philadelphia (Ph) chromosome-positive leukemias. The
term “breakpoint cluster region (bcr)” was first applied to a 5.8-kb
span of DNA on the long arm of chromosome 22 (22q11), which is
disrupted in patients with CML2 bearing the Ph translocation [t(9;
22)(q34;q11); Refs. 1–3]. Subsequent studies demonstrated that the
5.8-kb fragment resided within a central region of a gene designated
BCR (4). It is now well established that the breakpoint within BCR can
be variable, and when joined with ABL, results in a hybrid Mr 210,000
(p210Bcr-Abl) or a Mr 190,000 (p 190Bcr-Ablprotein (p190Bcr-Abl; Fig.
1; Refs. 5–13). Of interest, p190Bcr-Abl characterizes a phenotypically
acute, rather than chronic, leukemia that is often, but not always, of
lymphoid (rather than of myeloid) derivation (Refs. 10 and 14; Table
1). Both p210Bcr-Abl and p190Bcr-Abl have constitutive tyrosine kinase
activity. Furthermore, the presence of the hybrid proteins perturbs the
multiple functions of their normal counterparts. Understanding the
biological sequelae of the molecular aberrations in Ph-positive disease
has led to development of novel tyrosine kinase inhibitor therapy that
is showing remarkable success in clinical trials. Herein, we review the
current state of knowledge on the role of BCR alone or when joined
with ABL in normal and leukemic pathophysiology and the implications of this knowledge for therapy.
Genomic Structure of the BCR Gene
The BCR Gene
BCR is situated in a 5⬘ to 3⬘ orientation with the 5⬘ end closer to the
centromere (4). The entire gene spans 130 kb and contains 23 exons
(Ref. 26; Table 2 and Fig. 2). The first intron separating exons 1 and
2 was initially shown to span a distance of 68 kb (26) but is now
known to include two additional exons (an alternative exon 1 and an
alternative exon 2; Refs. 28 and 29). Two transcripts, 4.5- and 7.0-kb
long, have been found (16). The nucleotide sequence contains an open
reading frame of 3818 nucleotides, which codes for a protein 1271
amino acids in length (31, 36).
Received 8/4/00; accepted 1/12/01.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
To whom requests for reprints should be addressed, at Department of Bioimmunotherapy, Box 422, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston,
TX 77030. Phone: (713) 794-1226; Fax: (713) 745-2374.
2
The abbreviations used are: CML, chronic myelogenous leukemia; Ph, Philadelphia;
GEF, guanine nucleotide exchange factor; GTPase, guanine triphosphatase; GAP, GTPase
activating protein; XPB, xeroderma pigmentosum group B; SH2, Src homology 2; Grb2,
growth factor receptor binding protein 2; Bap-1, Bcr-associated protein 1; ALL, acute
lymphocytic leukemia; AML, acute myelogenous leukemia; M-bcr, major breakpoint
cluster region; Ship, SH2-containing phosphatidylinositol 3,4,5-triphosphate 5-phosphatase; Jak, Janus kinase.
BCR-related Genes
Several BCR-related pseudogenes (BCR2, BCR3, and BCR4) have
also been described (34). They are not translated into proteins. All of
these genes have been mapped to chromosome 22q11 by in situ
hybridization. The orientation is such that BCR2 is the most centromeric, followed by BCR4, then BCR1 (the functional gene) and BCR3.
BCR2 and BCR4 are retained on chromosome 22 during the t(9;22)
translocation. The BCR-related genes all contain 3⬘ sequences identical to those encompassing the last seven exons of the BCR1 gene
(34, 36). The 5⬘ region is highly variable, suggesting that the 3⬘ end
of the normal BCR1 gene was inserted into another locus with subsequent duplication of the new locus (36). Another BCR pseudogene,
the chromosomal location of which remains undefined, has also been
described (37). It was shown to have homology with the 3⬘ end of
exon 3 as well as the 5⬘ end of exon 4 (37).
There is an additional BCR-related gene located on chromosome
17p13.3 (35, 38, 39). This gene is functionally active and has been
designated ABR or active BCR-related gene (35). There is 68% homology between ABR and the central and COOH-terminal regions of
BCR (35, 39).
The BCR Promoter
The 5⬘ untranslated region of the BCR gene is important because
the fusion gene created by the Ph translocation is placed under the
regulation of the BCR promoter (31, 40 – 42). A region ⬃1-kb upstream of the transcription start site was demonstrated to be the
principle site of promoter activity (41, 42). Within this region, a
CAAT box (conserved sequence upstream of start point of transcription, which is recognized by transcription factors) at position ⫺644 as
well as an inverted CAAT sequence at position ⫺718 have been
localized. However, neither in vitro nor in vivo studies suggest that
these sequences are key factors for transcriptional regulation of the
BCR gene (41). There is also a TATA box [conserved sequences in the
promoter that specify the position at which transcription is initiated
(43)] 120 bp downstream of the CAAT box. This TATA box, TTTAA, is also accompanied by the consensus sequence TCATCG,
required for 5⬘ capping of the transcript (41).
DNA footprinting and gel retardation assays have also been used to
discover potential sites for DNA/protein interaction, which might
reflect transcription factor activity. Several sites were found including
ones containing the consensus sequence GGGCCGG (as well as the
inverted sequence) for the SP1 transcription factor (41, 42). A unique
sequence TAGGGCCTCAGTTTCCCAAAAGGCA, for which no
binding protein is known, was also detected (41). Deletion of that site
(versus other potential binding sites) resulted in a significant decrease
of promoter activity in BCR-ABL-transfected cells (41).
The 5⬘ untranslated region of the BCR gene is also very rich in GC
content, which makes up 80% of the nucleotides with“in this stretch
of the DNA (31, 36). Within this GC-rich region is a segment 18
nucleotides long at sites ⫺376 to ⫺393, containing the sequence
GCGGCGGCGGCGGCGGCG with its inverted repeat 363 bp down-
2343
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
Fig. 1. Schematic representation of BCR, ABL, and BCR-ABL genes and the proteins they encode. Numbers refer to exon number. In the BCR gene, exons 1⬘ and 2⬘ are alternative
exons contained within the first intron. The ABL gene has two alternative first exons denoted 1b and 1a, respectively. A series of different protein products are described based on the
fusion transcripts that have been identified. The predicted proteins are illustrated in the right-hand column. (However, not all these proteins have been demonstrated on gels and,
therefore, not all of them are given a size.)
Table 1 Molecular events associated with Philadelphia-positive leukemiasa
Diagnosis
Transcript
Normal
CMLb
ALL
AML
Neutrophilic CML
a
b
Protein product
6.0- and 7.0-kb ABL mRNA
4.5- and 6.7-kb BCR mRNA
8.5-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients)
8.5- or 7.0-kb BCR-ABL mRNA (an ABL-BCR mRNA is also expressed in some patients)
8.5- or 7.0-kb BCR-ABL mRNA
9.0-kb BCR-ABL mRNA
pl45Abl
p130Bcr and p160Bcr
p210Bcr-Abl
p210Bcr-Abl or p190Bcr-Abl
p210Bcr-Abl or p190Bcr-Abl
p230Bcr-Abl
Summarized from Refs. 4, 8 –12, and 15–25.
Rare expression of 7.0-kb BCR-ABL mRNA and p190Bcr-Abl.
stream. These sequences are apt to form secondary stem and loop
structures, with a possible role in translational regulation (36), and are
common to many housekeeping genes (43). Other possible start sites
upstream of the normal AUG codon have been found; however, these
have short open reading frames because there are stop codons downstream of these sites (31, 40). It has been suggested that these short
transcripts could also play a role in regulating protein translation (40).
Bcr Protein(s)
Table 2 BCR: Molecular features
Comments
Location
Size of gene
Number of exons
Size of transcripts
Size of proteins
BCR expression
BCR-related genes
a
Chromosome 22q11
130-kb
23 exons
(also contains alternative exon 1 and exon 2)
4.5kb and 6.7kb
Mr 130,000 and Mr 160,000a
Ubiquitously expressed
Highest levels in brain and haematopoietic cells
Pseudogenes BCR2, BCR3, and BCR4 found on
chromosome 22q11; ABR (active BCRrelated) gene on 17p13
Currently, the normal BCR gene is known to code for two major
proteins that are Mr 160,000 and Mr 130,000 in size (17, 25, 30). It is
possible that these proteins are derived from the 7.0- and 4.5-kb BCR
transcripts, respectively (15, 17, 26). In addition, Li et al. (44) have
described putative Bcr proteins of Mr 190,000/Mr 185,000, Mr
155,000, Mr 135,000, Mr 125,000, and Mr 108,000.
Refs.
2, 27
26
26
28, 29
4, 15
17, 25, 30
4, 31–33
Bcr-related Protein(s)
34, 35
Other proteins of Mr, 190,000/Mr 185,000, Mr 155,000, Mr 135,000, Mr 125,000, and
Mr 108,000 not firmly established.
The ABR gene encodes for a Mr 98,000 protein that contains both the
GEF and GAP domains of Bcr (respectively, the central and COOHterminal regions) but lacks the serine/threonine kinase domain found at
2344
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
Fig. 2. Schematic representation of the Bcr protein. Functional sites include a serine/threonine kinase domain in exon 1, a central GEF domain, and a COOH-terminal GAP domain.
SH2-binding sites are also present in exon 1. The two Abl SH2-binding sites are noted in the figure and stretch from amino acids 192–242 and 293– 413. Interaction at these sites is
mediated via phosphoserine and phosphothreonine. The 14-3-3 protein (Bap-1) also interacts with the latter site. Grb2 associates with an additional proximal SH2-binding site containing
a phosphotyrosine at position 177. The GEF domain interacts with the XPB DNA repair protein.
the NH2-terminus (39, 45). Analysis of GAP activity showed that both
Bcr and Abr acted similarly toward different G proteins, especially
members of the Rho subfamily, which includes Cdc42 and Rac (39, 46).
BCR Expression
The BCR gene is expressed ubiquitously (4, 31, 32). In chick
embryos, as well as in mouse and human tissues, mRNA levels were
found to be highest in the brain and hematopoietic cells (32, 41).
Similarly, ABR transcripts are also most prominent in hematopoietic
tissue and brain, with the highest levels in the latter (39, 45). To date,
however, the aberrant BCR-ABL gene appears to affect hematopoietic
cells. Of interest, Bcr protein is expressed primarily in the early stages
of myeloid differentiation, and levels are reduced significantly as cells
mature to polymorphonuclear leukocytes (33). Because p210Bcr-Abl is
expressed off the BCR promoter, it is not surprising that this protein
shows a similar correlation between expression pattern and myeloid
differentiation (33).
Bcr Subcellular Localization
The Bcr-Abl protein is known to be cytoplasmic (36). In addition, the
normal product of the BCR gene was initially demonstrated to be a
cytoplasmic protein by immunofluorescence staining and cell fractionation studies (17, 33, 47). A wealth of studies implicate this protein in
cellular signal transduction pathways, especially those regulated by G
proteins (discussed below; Ref. 48). Subsequent investigations have,
however, shown that the Bcr product can also associate with condensed
DNA (49). According to electron microscopic examination of immunogold-labeled cells, Bcr interacts with mitotic DNA as well as the highly
condensed heterochromatin in interphase cells (49). In some cell lines, the
Mr 130,000 Bcr protein predominates in the nucleus, and the Mr 160,000
form predominates in the cytoplasm (50). Of interest in this regard, Bcr
was found recently to be associated with the XPB protein (51, 52). XPB
plays a role in DNA repair, general transcription initiation, and cell cycle
regulation (53).
Functional Domains of BCR
The BCR gene is now known to be a complex molecule with many
different functional domains (Ref. 48; Table 3; Fig. 2). Within the first
exon of BCR resides a structurally novel protein kinase domain (25,
54). At the COOH-terminus, a GAP domain, which demonstrates
activity for the Ras-related GTP-binding protein p21Rac, has been
described (65). In addition, the central part of the BCR gene contains
sequences homologous to various GEFs (63, 64, 68). These data
Table 3 Function-related characteristics of the Bcr protein
Region
Serine/threonine kinase activity
Exon 1
Oligomerization domain
Exon 1
SH2-binding region 1
SH2-binding regions 2 and 3
Exon 1
Exon 1
Transcriptional suppressor
Within introns of M-bcr (major
breakpoint cluster region)
Exons 3–10
Comments
GTPase activity
Exons 19–22
Homology to 3BP-1, a
molecule that binds to Abl
SH3 domain
Chromatin association
COOH-terminus
Known to phosphorylate histones in vitro; self-phosphorylates
Phosphorylates and associates with 14-3-3 proteins
Can form homotetramers
May be essential for transformation by Bcr-Abl
Binds SH2 of Grb-2, a key protein of Ras signal transduction pathway
Situated within a serine-rich region
Binds to the SH2 domain of Abl in a phosphotyrosine-independent manner
Lack of this region has been postulated to play a role in the different activities of
p210Bcr-Abl and p190Bcr-Abl
Contains homology to Cdc24, Dbl, and Vav, which are guanine nucleotide
exchange factors
Binds to the XPB protein
Regulates p21Rac, a protein important for cytoskeletal reorganization
Bcr plays a role in the regulation of Rac-mediated superoxide production during
neutrophil priming and activation in a knockout mouse model
Deletion of Abl SH3 domain activates its transforming activity
Unknown
Associates with mitotic chromosomes and with heterochromatin of interphase cells
Guanine nucleotide exchange
factor domain
2345
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
Refs.
54
55, 56
57
57, 58
59
60
60, 61
62
49
63, 64
51, 52
65, 66
67
THE BCR GENE AND LEUKEMOGENESIS
implicate the participation of BCR in two major intracellular signaling
mechanisms in eukaryotic cells (phosphorylation and GTP-binding).
Table 4 ABL: Molecular features and function
Comments
Refs.
Location
Size of gene
Number of exons
Chromosome 9q34
81
⬎230 kb
82
11 exons
15
(There are two alternative exons, 1a and 1b)
7
Size of transcripts 6.0-kb and 7.0-kb
19
18
Size of protein
Mr 145,000
Abl expression
Ubiquitously expressed
33
Decreases with myeloid maturation
Cytoplasmic and nuclear localization
80, 83
Functions
Non-receptor tyrosine kinase (not constitutively active)
18
Nuclear translocation signal
79
Interacts with meiotic chromosome
84
DNA-binding domain at COOH-terminus;
80
binds to AAC motif
85, 86
F-Actin-binding domain at COOH-terminus
70
Abl inhibited through SH3 domain
87–89
Associates with cell cycle proteins Rb, p53, p73, Atm,
90–97
and cyclin D
Differentially phosphorylated during cell cycle
98
Associates with SH2/SH3 adaptor protein Crkl
99, 100
Overexpression of Abl leads to G arrest
101
Kinase activity regulated by Abelson interacting
102–105
protein
First Exon
The first exon of the BCR gene is of critical significance, because
it is the one exon of BCR included in all known Bcr-Abl fusion
proteins (e.g., the p190Bcr-Abl in acute leukemias as well as the
p210Bcr-Abl in CML; Refs. 1, 4, 8 –10, 22, 60, 69, and 70; Fig. 1).
Within this region of BCR resides the kinase domain, two serine-rich
boxes containing SH2-binding domains, and an oligomerization domain.
Serine/Threonine Kinase Domain. The Bcr protein has serine/
threonine kinase activity within its first exon (25, 30, 54, 71). A
consensus sequence homologous to the ATP-binding site of other
kinases as well as a likely phosphotransferase domain has been
identified (36, 44). Bcr can autophosphorylate on serine and threonine
residues, as well as transphosphorylate casein and histones in vitro
(54). (The latter are known substrates for serine/threonine kinases.)
In Ph-positive disease, phosphotyrosines are present on both Bcr
and Bcr-Abl (mutually p210Bcr-Abl and p190Bcr-Abl) because of the
tyrosine kinase activity of Bcr-Abl (72). The first exon of the Bcr
component of Bcr-Abl is also phosphorylated on serine/threonine
residues (54, 72). Indeed, the majority of autophosphorylation of
Bcr-Abl occurs within the Bcr rather than the Abl portion of the
protein (72).
SH2-binding Domain. There are several SH2-binding domains in
the first exon of BCR (60). [SH2 domains are highly conserved,
noncatalytic regions of ⬃100 amino acids that bind SH2-binding sites
consisting of three to five amino acids including a phosphotyrosine.
This interaction is important in the assembly of signal transduction
complexes (73–75).] Bcr is unique in that SH2 domains of other
proteins can bind to the phosphoamino acid serine, threonine, or
tyrosine (rather than only tyrosine) in two of its SH2-binding sites (60,
61). One SH2 domain that binds to Bcr is that of Abl, and this
interaction is mediated via phosphorylated serines and threonines
(60). Bcr sequences involved in this interaction lie between amino
acids 192–242 and 298 – 413 and are essential for the oncogenic
activation of Bcr-Abl (60). A third Bcr SH2-binding region has also
been found. It interacts through a phosphorylated tyrosine with the
adaptor protein Grb2 (59). The latter is an essential protein in the Ras
signal transduction pathway (Fig. 2).
Oligomerization Domain. A third functional domain found within
exon 1 of BCR is an oligomerization domain that is characterized by
a heptad repeat of hydrophobic residues between amino acids 28 and
68 (57). Bcr and Bcr-Abl have been found to coimmunoprecipitate
through this domain (76, 77). Mutations within the oligomerization
domain attenuate the tyrosine kinase enzymatic activity of Bcr-Abl
and abolish the interaction between Bcr and Bcr-Abl (57). Of interest,
TEL (an ETS family gene) can also partner with ABL [t(9;12) translocation of acute leukemia] and activate Abl tyrosine kinase activity
(78). It has been postulated that, similar to the situation with Bcr, the
Tel helix-loop-helix domain facilitates dimerization or oligomerization of the fusion partner to activate its function.
The oligomerization domain also affects Bcr-Abl localization. Abl
contains both a nuclear localization and an F-actin-binding (cytoplasmic) motif (70, 79). Although normal Abl can be found both in the
nucleus and in the cytoplasm (Refs. 33 and 80; Table 4), Bcr-Abl is
found to be cytoplasmic and partially associated with the cytoskeleton
(33, 70, 106). Deletion of the oligomerization domain results in
decreased binding of Bcr-Abl to F-actin, suggesting that this domain
of Bcr enhances the F-actin binding capacity of Bcr-Abl and is at least
partially responsible for the cytoplasmic localization of Bcr-Abl (57).
Central Domain
Central (and COOH-terminal) regions of Bcr appear to interact with
G proteins at multiple levels. These proteins are essential players in
intracellular signaling, cytoskeletal organization, cell growth, and
normal development (107, 108). G proteins cycle between an inactive
GDP-bound state and an active GTP-bound state, a process that is
regulated by GAPs and GEFs (107). GEFs activate G proteins by
exchanging GDP for GTP. In contrast, GAPs inactivate G proteins by
activating the GTPase of the protein, which in turn down-regulates the
protein by hydrolysis of GTP (107).
GEF-related Domain. The central region of the BCR gene shows
homology to the hematopoietically expressed VAV proto-oncogene (a
GEF) as well as with a CDC25 mouse homologue termed CDC25 Mm
(64, 109). [CDC25 Mm is homologous to the Ras activator CDC25 of
Saccharomyces cerevisiae (64, 109).] In addition, central BCR sequences demonstrate homology to the yeast cell division cycle gene
CDC24, as well as its human counterpart, the DBL oncogene, which
codes for a GEF (63, 68). The CDC24 gene codes for a cell division
cycle control protein and also plays a role in cytoskeletal and cytoplasmic organization, bud formation in yeast, cell polarity, and acts as
a GDP-GTP exchange factor for Ras-like G proteins (68, 110 –112).
Cdc24 interacts with the product (a GTP-binding protein) of the bud
assembly gene CDC42 and is a member of the Ras superfamily of
GTPases (113, 114). To add to the complexity of the BCR gene, the
GAP domain at the COOH-terminus contains activity toward the
product of CDC42Hs, the human homologue of CDC42 (68). Taken
together, these observations indicate that Bcr has both GAP and GEF
functions and hence suggests a dual role for this molecule in G
protein-associated signaling pathways.
Interaction with XPB Gene Product. Recent studies using the
yeast two-hybrid system were performed to identify proteins that
could interact with the central Cdc24 homologous region of Bcr (51).
The results yielded one surprising candidate, the DNA repair XPB
protein (51). Xeroderma pigmentosum is an inherited disorder characterized by increased sensitivity to sunlight, coupled with a defect in
the DNA repair machinery. The XPB protein is also a component of
the transcription factor IIH core complex, which plays a role in
initiation of transcription as well as in DNA repair (53). The XPB
protein was found to interact with both normal Bcr as well as with
p210Bcr-Abl (51, 52). Importantly, the Bcr Cdc24 homologous domain
is present in p210Bcr-Abl but absent in p190Bcr-Abl. When XPB is
2346
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
coexpressed with p210Bcr-Abl, XPB becomes phosphorylated and is
unable to correct a DNA repair defect (51). This phenomenon is not
observed in the presence of p190Bcr-Abl (51). It is therefore conceivable that the presence of p210Bcr-Abl interferes with the normal interaction between Bcr and XPB, thus leading to defective DNA repair
and subsequent genomic instability in Bcr-Abl-positive CML. This
mechanism may explain the clonal evolution that occurs in CML and
drives the inevitable progression of this disease from an easily controlled “benign” phase to a fatal blast crisis.
Table 5 Philadelphia-positive leukemias: Percentage of patients with p190 versus
p210 subtypea
Leukemia
Patients expressing
p210Bcr-Abl(%)
Patients expressing
p190Bcr-Abl (%)
⬎99
~50
~10
~50
⬍1
~50
~90
~50
CML
Adult ALL
Pediatric ALL
AML
a
Summarized from Refs. 1, 9 –12, 14, 22, 35, and 126 –143.
Structure of the BCR-ABL Gene in CML and Acute Leukemia
COOH-Terminal Domain
BCR-ABL Genes and Proteins
COOH-terminal sequences are also involved in G protein regulation. However, whereas the central sequences have GEF homology (activates G proteins), the COOH-terminal sequences have
GAP homology (inactivates G proteins). One of the best-studied G
proteins is the oncogene p21RAS (115). The RAS superfamily is
known to have multiple members (116). Members of the RHO
subfamily are critical components of signaling pathways that link
extracellular signals with reorganization of the cytoskeleton as
well as with membrane ruffling (117). A GAP protein specific for
Rho family GTPases, termed RhoGAP, has structural similarity to
the COOH-terminus of Bcr (118). The BcrGAP domain accelerates
the GTPase activity of Rac in vitro and specifically inhibits Racinduced membrane ruffling in vivo (65, 117). In BCR knockout
mice, Bcr regulates Rac-mediated superoxide production during
neutrophil priming and activation (66). A human brain protein,
chimaerin, with GAP activity also has homology to COOH-terminal Bcr sequences (119). Interestingly, another protein designated
3BP-1, which also has sequence homology to the COOH-terminus
of Bcr as well as to RhoGAP, binds the SH3 region of Abl with
high specificity (67). The Abl SH3 region has an important negative regulatory function in transformation because its deletion
activates the transforming potential of Abl.
The hallmark of CML is the Ph chromosome, which is a shortened
chromosome 22 resulting from a translocation, t(9;22)(q34;q11), between chromosomes 9 and 22 (2, 27). A cytogenetically identical
translocation also occurs in about 20% of adult ALL, 5% of pediatric
ALL, and rare cases of AML (125; Table 5). The involvement of
chromosome 9 is now known to disrupt the ABL gene (15, 20, 81,
144). The actual breakpoint on chromosome 9 may span a large
distance. In some cases, the break is 5⬘ to the two alternative first
exons of the ABL gene (exons 1a and 1b), whereas in others, the break
occurs within the first intron (1, 126, 145, 146), which extends over
200 kb (Ref. 82; Fig. 1). [Regardless, the fusion transcript almost
always includes exon 2 of ABL (a2)]. In contrast, in CML, the break
on chromosome 22 is restricted in most patients to an area of 5.8-kb
termed the M-bcr (1). M-bcr consists of five exons termed M-bcr
exons b1– b5. These exons are actually located within the central
region of the BCR gene and are equivalent to exons 11–15 (e11– e15)
of this gene. Most breaks occur immediately downstream of exon 2 or
3 of the M-bcr region (4) and result in b2a2 or b3a2 fusion transcripts.
In acute leukemia, however, the breakage can also occur outside
M-bcr in about half the cases (8, 9, 22, 135, 136, 139), usually within
the 3⬘ end of intron 1 of the BCR gene (26, 141), resulting in an e1a2
fusion transcript. The breakpoint sites in both BCR and ABL appear to
involve Alu sequences (transposable repeat elements found throughout the human genome; Refs. 141 and 147–150).
The fusion of BCR and ABL on the Ph chromosome occurs in a
head-to-tail manner, with the 3⬘ end of ABL joined to the 5⬘ end of
BCR (4). This configuration places the fusion gene under the control
of the BCR promoter. When the break occurs in the M-bcr region, the
transcript is 8.5-kb long. However, when the break occurs in the first
intron of BCR, the transcript is 7.0-kb long (4, 10, 15, 16, 20, 126).
Although it was initially felt that BCR-ABL transcripts are specific for
leukemia, surprisingly, recent experiments suggest that small amounts
of such transcripts can be found in normal individuals if very sensitive
PCR techniques are used (151, 152). It is possible that these transcripts represent “errors” that occur because of the close proximity of
chromosomes 9 and 22 during the S to G2 transition of the cell cycle
(153–155) and that immune surveillance prevents the emergence of
CML in individuals who remain healthy.
The protein encoded by the 8.5-kb BCR-ABL mRNA is Mr 210,000
and designated p210Bcr-Abl (5–7). The two most common molecular
variants of p210Bcr-Abl are generated depending on whether the break
in M-bcr is centromeric or telomeric to exon 3 of M-bcr (b2a2 versus
b3a2; Ref. 8). Therefore, p210Bcr-Abl may or may not contain the
25-amino acid sequence encoded by exon 3.
As mentioned above, in Ph-positive acute leukemia patients with
breakpoints in the first intron of BCR, an abnormal BCR-ABL transcript of about 7.0-kb in size is found (10 –12). This encodes a protein Mr 190,000 in size (9 –13, 133). p190Bcr-Abl (also designated
p185Bcr-Abl by some investigators) was initially felt to be involved
only in lymphoid lineage leukemia but was eventually also demon-
Bcr-associated Proteins
The Bcr protein has been found to complex with several proteins,
which, as discussed previously, include Abl, Bcr-Abl, the adaptor
protein Grb2, and the XPB protein (51, 52, 59, 60, 76, 77). Included
among the Bcr-associated proteins are members of a family of acidic
proteins termed 14-3-3. These proteins play a role in intracellular
signaling pathways (120), cell cycle/DNA damage checkpoint control,
and trafficking of the mitotic inducer Cdc25C from the nucleus to the
cytoplasm (121, 122). Thus far, Bcr is known to interact with two
isoforms, ␤ and ␶, of this protein family (55, 56). The latter is also
known as Bap-1 (55). Both of these proteins bind Bcr at a region
within its first exon, which is rich in serine and threonine, as well as
cysteine residues. Interaction between 14-3-3 proteins and other proteins occurs through phosphoserine association within a putative
consensus sequence RSxSxP, a sequence present at the site in Bcr
exon 1 where the 14-3-3 proteins bind (123). When complexed with
Bcr, Bap-1 is phosphorylated on its serine/threonine residues by the
kinase domain of Bcr, thus making it a substrate for Bcr (55).
Interestingly, the ␤ isoform of 14-3-3 complexes not only with Bcr but
also with the serine/threonine kinase Raf (an upstream regulator of the
mitogen-activated protein kinase; Ref. 56). It was postulated that
14-3-3␤ could act as a mediator between Bcr and Raf, possibly
through formation of homodimers, a trait associated with 14-3-3
proteins (56, 124).
2347
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
Table 6 Characteristics of p210Bcr-Abl
Comments
Refs.
Location of gene encoding p210Bcr-Abl
Chromosome 22q11
15
Size of gene
Varies according to site of breakpoint
Break is in central region of BCR gene known as 5.8-kb (M-bcr);
[Breaks occur between exons 2 and 3 or exons 3 and 4 of M-bcr (b2-a2 or b3-a2 junction)]
Breaks in ABL gene occur upstream of exon 1
132, 142
1, 4
15
Size of transcript
8.5-kb BCR-ABL transcript;
(An ABL-BCR fusion transcript of uncertain significance is also expressed)
15, 16, 20
21
Localization
Cytoplasmic protein
Localizes to cortical F-actin on vesicle-like structures
33
167
Functions
Constitutively activated tyrosine kinase
Can bind cytoskeletal actin and microfilaments
Expression decreases with myeloid differentiation
Substrates may include Ras-related signal transduction molecules
Complexes with tyrosine phosphoprotein Crkl, an SH2/SH3 adaptor protein
Interacts with docking protein p62Dok
May prevent apoptosis
Linked to Jak/Stat pathway (especially Stat5)
Linked to phosphotidylinositol 3-kinase/Akt pathway
Activates Jun kinase
Interacts with and regulates the XPB protein
Transforming activity partially mediated via Ras pathway
May induce alterations in adhesion properties
Down-regulates expression of Ship protein
5, 6
70
33
59, 168–170
99, 100
171–174
175–181
182–188
189–192
193
51
194, 195
196, 197
198
strated in Ph-positive AML (9). In acute leukemia patients with
breakpoints in the M-bcr, the mRNA (8.5-kb), and protein (p210BcrAbl) produced are identical to those in CML (10, 136).
In addition to the classic breakpoints found within the major (central 5.8-kb region) and minor (first intron of BCR) breakpoint cluster
regions of BCR (respectively termed M-bcr and m-bcr), other unique
breakpoint sites have been found. These include a micro 3⬘ site termed
␮-bcr [BCR exon 19 (c3) to BCR exon 20 (c4)], which can yield a Mr
230,000 protein (24, 156, 157). Patients with the e19a2 fusion between BCR exon 19 (e19) and ABL exon 2 (a2) were classified as
having neutrophilic CML (157). Because these cases were viewed as
being less aggressive than typical CML, it has been suggested that the
amount of BCR sequences present in the fusion transcripts correlate
with disease phenotype (23, 157). However, there have been reports of
patients with classic CML and AML phenotypes who possess the
e19a2 fusion transcript (158 –161). Reports of other BCR-ABL variants include a b3a3, an e6a2, an e2/a1a, and more recently, e8/a2 and
e13/a2 fusion transcripts/genes (Refs. 162–165; Fig. 1; Table 5).
The differences in size of BCR-ABL transcripts is not only a
reflection of variation in the sites of breakage/fusion but is also a
result of alternative splicing between BCR and ABL and within BCR
itself (19, 166). The normal ABL gene is composed of 11 exons, which
include exons 1a and the more proximal exon 1b. These exons can be
alternatively spliced, yielding two different mRNAs of 6- and 7-kb in
size (19). The distance between exon 2 and exon 1b is greater than 200
kb, demonstrating the ability of ABL exon 2 to skip over the vast
expanse of intron 1 to join to the splice donor site of exon 1b (7, 19,
82). This ability is maintained in the fusion gene, and the end results
are the joining of ABL splice acceptor site of exon 2 to the splice
donor sites of various BCR exons and the excision of ABL exons 1a
and 1b. (ABL exons 1a and 1b do not have splice acceptor sites.)
Indeed, even in CML containing breaks within M-bcr, splicing can
occasionally result in a transcript with an e1/a2 junction in addition to
transcripts with a b2a2 or b3a2 junction (143, 166).
Bcr-Abl Functional Characteristics
Kinase Activation. Tyrosine kinase activity is essential to cellular
signaling and growth, and constitutively elevated kinase activity has
been associated with oncogenic changes in several systems. The
Abl protein is a nonreceptor tyrosine kinase, which normally has very
little constitutive kinase activity (5). Both the p210Bcr-Abl and the
p190Bcr-Abl proteins have constitutively activated tyrosine kinase enzymatic activity, with higher levels of activity in the p190 protein
(Tables 6 and 7). Interestingly, most of the autophosphorylated tyrosines occur within the Bcr segment of Bcr-Abl (72). The tyrosine
kinase activity is attributable to the kinase domain found within the
Abl segment of the fusion proteins (5, 6, 8 –10, 200). Indeed, it
Table 7 Characteristics of p190Bcr-Abl
Comments
Refs.
Location of gene encoding
p190Bcr-Abl
Chromosome 22q11
8, 10–12, 135, 136, 138, 139, 199
Size of gene
Contains NH2-terminal BCR sequences (exon 1 of BCR) and COOH-terminal ABL
sequences
Breaks is in proximal 5⬘ region of BCR gene (in the first intron)
8, 10–12, 135, 136, 138, 139, 199
Size of transcript
7.0-kb
10–12
Localization
Cytoplasmic protein
33
Functions
Constitutively activated tyrosine kinase
May prevent apoptosis
Linked to Jak/Stat pathway (especially Stat5)
Linked to phosphotidylinositol 3-kinase pathway
Transforming activity mediated through Ras pathway
Induces ubiquitin-dependent degradation of the Abl tyrosine kinase inhibitor, Abelson
interacting protein
May induce alterations in adhesion properties
10, 200
181, 195
179, 185
191
194, 195, 201
103
8, 10–12, 26, 135, 136, 138, 139, 141, 199
196, 197
2348
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
appears that the degree of transforming activity of Bcr-Abl correlates
with the degree of tyrosine kinase activity (200), and this activity has
been implicated in the growth factor independence that Bcr-Abl
confers on cells (202). Furthermore, Bcr-Abl induces the tyrosine
phosphorylation of many cellular proteins including Crkl, Shc, Syp,
Fes, Vav, and paxillin (99, 100, 170, 203–208).
Interaction with Ras-related Pathways. The importance of Ras
pathways in Bcr-Abl oncogenesis is underscored by experiments
demonstrating that Ras activation is necessary for transformation by
both p210Bcr-Abl and p190Bcr-Abl (201, 209). The mechanisms by
which Bcr-Abl interacts with the Ras pathway are complex. Implicated molecules include the adapter protein Grb2, the Ras activator
SOS (son of sevenless), RasGAP, Crkl (an SH2/SH3 adapter protein),
and the docking protein, p62Dok (59, 99, 100, 168, 169, 171–174).
Crkl has also been found to interact with normal Abl (100). It was
shown recently that p210 BCR-ABL mutants with deletion of the
Grb2-binding site, the SH2 domain, as well as the tetramerization
domain within the Bcr portion do not have diminished transforming
properties in hematopoietic cells, although these mutations drastically
reduce transforming activity of BCR-ABL in fibroblasts (210). It has
been suggested that Ras activation in cells bearing these BCR-ABL
mutants was mediated by Shc proteins and was critical to transformation of hematopoietic cells (210). Finally, p21Ras is linked to
pathways that activate downstream Jun kinase, and it appears that this
molecule is also a requisite for Bcr-Abl transforming activity (193).
Interaction with Ship Proteins. The Ship proteins (Ship1 and
Ship2) are also downstream targets of Bcr-Abl (211–215). Ship1 has
been shown to regulate hematopoiesis in mice, and disruption
of murine Ship results in a myeloproliferative syndrome (216).
p210Bcr-Abl negatively regulates the expression of Ship1, in part, by
reducing its half-life (198). The Ship proteins have also been found to
interact with the adapter proteins Shc and Grb2, which, as discussed
above, play a role in Ras-mediated signal transduction pathways (211,
212, 214, 217). Finally, the Bcr-Abl-specific kinase inhibitor STI 571
(CGP 57148B) causes reexpression of Ship, further supporting the
implication that p210Bcr-Abl directly, but reversibly, regulates Ship
expression (198).
Effect on Adhesion Molecules. Other substrates of the tyrosine
kinase activity of Bcr-Abl include the focal adhesion proteins Fak
(focal adhesion kinase) and paxillin (208, 218). Clinically, an increased expansion of committed myeloid progenitors and precursors,
elevated levels of mature granulocytes, and premature release of the
progenitor/precursor cells characterize CML. This is postulated to be
attributable to defects in the adhesion properties of these cells, perhaps
because of inside-to-outside disruption of focal adhesion molecule
function and subsequent perturbation of adhesion molecules such as
integrin ␤1 (196). [Normally, hematopoietic cells can attach to extracellular matrix such as fibronectin and stroma via integrins (i.e., ␣4␤1
and ␣5␤1), which in turn interacts with cytoskeletal proteins at focal
adhesion points (196).] The salutary effect of IFN-␣ in a subset of
CML patients may be attributable to restoration of normal ␤1 integrin
function (196, 219, 220). In addition, inhibition of either the levels or
the kinase activity of Bcr-Abl can restore ␤1 integrin-mediated adhesion (221, 222). However, other investigators have disputed these
results with experiments that demonstrate that expression of Bcr-Abl
in certain cell lines leads to increased adhesion of these cells to
fibronectin-coated surfaces mediated through expression of ␣5␤1
integrin (223). It has also been shown that overexpression of Crkl, the
Bcr-Abl substrate, which can act as a mediator between Bcr-Abl and
paxillin (224), increases cell adhesion to fibronectin-coated plates
(225). At least some of these experimental disparities may be attributed to differences in cell type used and/or the use of established cell
lines versus bone marrow samples from CML patients.
Effect on Apoptosis. One proposed mechanism through which the
activity of Bcr-Abl is mediated is suppression of apoptosis, or programmed cell death. Hematopoietic growth factors are known to
suppress apoptosis, and BCR/ABL can abrogate growth factor dependence in a variety of hematopoietic cell lines (226). Suppression of
apoptosis by Bcr-Abl may be mediated by inducing the expression of
the antiapoptotic protein, Bcl-2 (perhaps through Stat pathways), by
phosphorylation of the proapoptotic protein Bad or through Rasdependent pathways (176, 195, 227).
Effect on Stat5. The growth factor independence demonstrated by
Bcr-Abl-positive cells is, to some extent, mediated through constitutive activation of the growth factor-dependent signal transducer and
activator of transcription (Stat) proteins, especially Stat5 (182, 184 –
186, 188, 228, 229). Hematopoiesis is strongly regulated by growth
factors and, in myeloid cells, cytokines such as interleukin 3 and
granulocyte/macrophage-colony stimulating factor, upon binding to
their respective receptors, can elicit the Jak/Stat signaling pathway.
[Phosphorylation on its tyrosine residues can activate the Jak protein,
and they in turn can activate the Stat proteins also through tyrosinephosphorylation. Further downstream, activated Stats are then able to
increase the transcriptional expression of cell survival genes (230).] In
cells transformed by p210Bcr-Abl, Bcr-Abl not only constitutively
phosphorylates the shared ␤c subunit of the interleukin 3 and granulocyte/macrophage-colony stimulating factor receptor in the absence
of ligand but also coimmunoprecipitates with it (183). Bcr-Abl may
also work upstream of the Stat proteins by constitutively phosphorylating, and thus activating, the Jaks, which in turn activate the Stat
proteins (183, 186, 228). However, because Bcr-Abl can directly
activate the Stat proteins, the need for the Jaks as a mediator could be
bypassed (185).
Although both p210Bcr-Abl and p190Bcr-Abl phosphorylate several
members of the Stat proteins in BCR-ABL-positive or BCR-ABLtransformed cells and cell lines, Stat5 appears to be the most prominent substrate (182, 184 –186, 228). In addition, phospho-Stat5 is
required for the growth factor-independent growth and contributed to
the transformation, as well as the antiapoptotic activity, of BCR-ABL
cell lines developed from CML patients (186 –188).
Negative Regulation of Bcr-Abl by Bcr. Bcr can form heterotetramers with Bcr-Abl through the NH2-terminal oligomerization domains of the two proteins (76, 77). In addition, Bcr binds to SH2
domains of normal Abl and coprecipitates with normal Abl (60). The
result of interaction between Bcr and Bcr-Abl may be functional
feedback regulation (71). Indeed, phosphorylation of the tyrosine 360
of Bcr by Bcr-Abl inhibits the kinase activity of Bcr, whereas serine
phosphorylation within the first exon of Bcr inhibits the kinase activity of Abl (71, 231, 232).
Therapeutic Implications and Future Directions
Recently, molecules that specifically target the BCR-ABL gene
product have been developed. One such molecule that has aroused
tremendous interest is the Bcr-Abl-specific kinase inhibitor STI 571
(CGP 57148B). STI 571 is a derivative of 2-phenylaminopyrimidine,
a class of inhibitors believed to function by competing with ATP for
the ATP-binding site of the kinases (233). This compound was shown
to be a potent inhibitor of oncogenic forms of Abl. It suppresses tumor
growth in v-Abl-transformed cells as well as in primary cells from
CML patients (233–236). In addition, long-term (2– 8 weeks) exposure of the CML progenitor cells to STI 571 results in a sustained
inhibition of these cells (236). In addition to its antiproliferative
attributes, STI 571 also induces apoptosis in Bcr-Abl-positive cells
(235, 237). Subsequent studies demonstrated that the apoptotic effect
of STI 571 may be mediated by decreased levels of phosphorylated
2349
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
Stat-5 (238, 239). This in turn leads to down-regulation of Stat-5dependent expression of the antiapoptotic protein, Bcl-XL (238, 239).
Several investigators are also examining the in vitro effect of STI 571
when used in conjunction with other established therapies for BCRABL-positive leukemias (240 –242). These studies demonstrate, for
example, that the combination of STI 571 and IFN-␣ additively
inhibited proliferation of CML cells (240, 241).
Currently, STI 571 is in early clinical trials aimed at chronic phase
CML patients who have failed IFN therapy and at blast crisis patients
(243–246). Twenty-three of 24 (96%) IFN-refractory chronic phase
patients treated with 300 –500 mg of STI 571 p.o. on a daily basis
attained complete hematological response (243). Even more striking,
many patients had cytogenetic responses, and there was little in the
way of side effects. The durability of these responses is not yet clear.
Preliminary results of a trial in 234 patients with accelerated phase
showed that 78% attained hematological responses at 4 weeks (246).
In addition, 82% of patients with Ph-positive ALL or lymphoid blast
crisis have responded. Fifty-five % of the responses were complete,
albeit short-lived. Patients with myeloid blast crisis of CML also
responded. Indeed, 55% of a group of 33 such patients attained
response, with 22% of the responses being complete (244, 245). The
latter observations are surprising because by definition, blast crisis
patients are presumed to have additional molecular defects beyond
Bcr-Abl that drive evolution of the disease and growth of the leukemic
cells. These findings therefore suggest that inactivation of Bcr-Abl
nevertheless interferes with a growth or survival signal in advanced
disease. These striking results indicate that gene-targeted therapies
have the potential to control malignant cell proliferation without host
toxicities.
Another innovative approach is to target BCR-ABL at the RNA
level. This can be accomplished by the use of antisense oligonucleotides or of catalytic RNAs called ribozymes (247, 248). One requirement for the success of these two strategies is specificity for the target
gene. In the case of BCR-ABL, the majority of antisense/ribozyme
constructed is targeted toward the junction of BCR-ABL (e.g., b3a2
junction). Theoretically, this would increase the selective binding of
the aberrant RNA and lessen the occurrence of nonspecific binding
toward normal BCR or ABL RNA. However, the incidence of nonspecific cleavage of other RNAs as well as poor uptake of the
nucleotides are some of the problems encountered with these kind of
strategies. These difficulties have led to the exploration of modified
oligonucleotides and ribozymes (248 –251), as well as alternative
forms of catalytic RNA. This includes the use of M1 RNA (the
catalytic RNA subunit of RNase P from Escherichia coli), a ribozyme
that can be easily modified to target specific mRNA sequence,
through the addition of a guide sequence against a specific site of the
target mRNA (e.g., BCR-ABL junction; Ref. 252). Targeting BCRABL at the RNA level may be best applicable to ex vivo purging of
bone marrow cells from patients with CML (253).
Another potentially unique direction using Bcr fragments as therapy is based on the observation that high levels of Bcr in Bcr-Abltransformed cells attenuate the kinase activity of Bcr-Abl (254). In
addition, a Bcr peptide fragment containing a mutated (S354 to E354)
or phosphorylated serine 354 greatly inhibits the tyrosine kinase
activity of both Abl and Bcr-Abl (231, 255). Similarly, a peptide
containing the Bcr oligomerization domain (amino acids 1–160)
has been demonstrated to reverse the transformed phenotype of
p210Bcr-Abl-positive 32D myeloid leukemia cells (58). On the basis of
these results, it has been hypothesized that these peptide fragments, or
even a truncated Bcr containing exon 1, could be used as a therapeutic
agent for Bcr-Abl-positive leukemias (58, 71).
Finally, direct suppression of Bcr-Abl by interference with downstream pathways critical to transformation merits exploration. Be-
cause of the interaction between Bcr and G proteins and the crucial
role of Ras-dependent pathways in Bcr-Abl-mediated oncogenesis
(201, 209), Ras is an apt target (256). Activation of Ras depends on
the addition of a prenyl group (generally a farnesyl), which allows it
to attach to the cell membrane. Molecules that inhibit farnesyl transferase, one of the key enzymes responsible for this reaction, are now
entering clinical trials in CML.
In summary, understanding the molecular genetics of BCR-ABL
leukemogenesis is leading rapidly toward molecular targeting as a
treatment. Indeed, several vital lessons have been learned from the
development of the Bcr-Abl tyrosine kinase inhibitor (257). These
include the importance of identifying molecular targets and the feasibility of using novel drug design technology to discover specific and
selective inhibitors, even for enzymes such as kinases that have
widespread biological impact. The success of STI 571 in the clinic
indicates that this approach can and should be used as a paradigm for
applying molecular therapeutics in other cancers.
References
1. Groffen, J., Stephenson, J. R., Heisterkamp, N., de Klein, A., Bartram, C. R., and
Grosveld, G. Philadelphia chromosomal breakpoints are clustered within a limited
region, bcr, on chromosome 22. Cell, 36: 93–99, 1984.
2. Rowley, J. D. A new consistent chromosomal abnormality in chronic myelogenous
leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature
(Lond.), 243: 290 –293, 1973.
3. Prakash, O., and Yunis, J. J. High resolution chromosomes of the t(9;22) positive
leukemias. Cancer Genet. Cytogenet., 11: 361–367, 1984.
4. Heisterkamp, N., Stam, K., Groffen, J., de Klein, A., and Grosveld, G. Structural
organization of the BCR gene and its role in the Ph⬘ translocation. Nature (Lond.),
315: 758 –761, 1985.
5. Konopka, J. B., Watanabe, S. M., and Witte, O. N. An alteration of the human c-Abl
protein in K562 leukemia cells unmasks associated tyrosine kinase activity. Cell, 37:
1035–1042, 1984.
6. Kloetzer, W., Kurzrock, R., Smith, L., Talpaz, M., Spiller, M., Gutterman, J., and
Arlinghaus, R. The human cellular ABL gene product in the chronic myelogenous
leukemia cell line K562 has an associated tyrosine protein kinase activity. Virology,
140: 230 –238, 1985.
7. Ben-Neriah, Y., Bernards, A., Paskind, M., Daley, G. Q., and Baltimore, D. Alternative 5⬘ exons in c-ABL mRNA. Cell, 44: 577–586, 1986.
8. Kurzrock, R., Kloetzer, W. S., Talpaz, M., Blick, M., Walters, R., Arlinghaus, R. B.,
and Gutterman, J. U. Identification of molecular variants of p210Bcr-Abl in chronic
myelogenous leukemia. Blood, 70: 233–236, 1987.
9. Kurzrock, R., Shtalrid, M., Talpaz, M., Kloetzer, W. S., and Gutterman, J. U.
Expression of c-Abl in Philadelphia-positive acute myelogenous leukemia. Blood,
70: 1584 –1588, 1987.
10. Kurzrock, R., Shtalrid, M., Romero, P., Kloetzer, W. S., Talpaz, M., Trujillo, J. M.,
Blick, M., Beran, M., and Gutterman, J. U. A novel c-Abl protein product in
Philadelphia-positive acute lymphoblastic leukaemia. Nature (Lond.), 325: 631–
635, 1987.
11. Chan, L. C., Karhi, K. K., Rayter, S. I., Heisterkamp, N., Eridani, S., Powles, R.,
Lawler, S. D., Groffen, J., Foulkes, J. G., Greaves, M. F., and Wiedemann, L. M. A
novel Abl protein expressed in Philadelphia chromosome positive acute lymphoblastic leukaemia. Nature (Lond.), 325: 635– 637, 1987.
12. Hermans, A., Heisterkamp, N., von Lindern, M., van Baal, S., Meijer, D., van der
Plas, D., Wiedemann, L. M., Groffen, J., Bootsma, D., and Grosveld, G. Unique
fusion of BCR and c-ABL genes in Philadelphia chromosome positive acute lymphoblastic leukemia. Cell, 51: 33– 40, 1987.
13. Walker, L. C., Ganesan, T. S., Dhut, S., Gibbons, B., Lister, T. A., Rothbard, J., and
Young, B. D. Novel chimaeric protein expressed in Philadelphia positive acute
lymphoblastic leukaemia. Nature (Lond.), 329: 851– 853, 1987.
14. Kurzrock, R., Gutterman, J. U., and Talpaz, M. The molecular genetics of Philadelphia chromosome-positive leukemias. N. Engl. J. Med., 319: 990 –998, 1988.
15. Shtivelman, E., Lifshitz, B., Gale, R. P., and Canaani, E. Fused transcript of ABL and
BCR genes in chronic myelogenous leukaemia. Nature (Lond.), 315: 550 –554,
1985.
16. Stam, K., Heisterkamp, N., Grosveld, G., de Klein, A., Verma, R. S., Coleman, M.,
Dosik, H., and Groffen, J. Evidence of a new chimeric BCR/c-ABL mRNA in
patients with chronic myelocytic leukemia and the Philadelphia chromosome.
N. Engl. J. Med., 313: 1429 –1433, 1985.
17. Dhut, S., Dorey, E. L., Horton, M. A., Ganesan, T. S., and Young, B. D. Identification of two normal BCR gene products in the cytoplasm. Oncogene, 3: 561–566,
1988.
18. Konopka, J. B., and Witte, O. N. Detection of c-Abl tyrosine kinase activity in vitro
permits direct comparison of normal and altered ABL gene products. Mol. Cell.
Biol., 5: 3116 –3123, 1985.
19. Shtivelman, E., Lifshitz, B., Gale, R. P., Roe, B. A., and Canaani, E. Alternative
splicing of RNAs transcribed from the human ABL gene and from the BCR-ABL
fused gene. Cell, 47: 277–284, 1986.
2350
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
20. Gale, R. P., and Canaani, E. An 8-kilobase ABL RNA transcript in chronic myelogenous leukemia. Proc. Natl. Acad. Sci. USA, 81: 5648 –5652, 1984.
21. Melo, J. V., Gordon, D. E., Cross, N. C. P., and Goldman, J. M. The ABL-BCR
fusion gene is expressed in chronic myeloid leukemia. Blood, 81: 158 –165, 1993.
22. Kurzrock, R., Shtalrid, M., Gutterman, J. U., Koller, C. A., Walters, R., Trujillo,
J. M., and Talpaz, M. Molecular analysis of chromosome 22 breakpoints in adult
Philadelphia-positive acute lymphoblastic leukaemia. Br. J. Haematol., 67: 55–59,
1987.
23. Melo, J. V. The diversity of Bcr-Abl fusion proteins and their relationship to
leukemia phenotype. Blood, 88: 2375–2384, 1996.
24. Saglio, G., Guerrasio, A., Rosso, C., Zaccaria, A., Tassinari, A., Serra, A., RegeCambrin, G., Mazza, U., and Gavosto, F. New type of BCR/ABL junction in
Philadelphia chromosome-positive chronic myelogenous leukemia. Blood, 76:
1819 –1824, 1990.
25. Stam, K., Heisterkamp, N., Reynolds, F. H., Jr., and Groffen, J. Evidence that the
PHL gene encodes a 160,000-dalton phosphoprotein with associated kinase activity.
Mol. Cell. Biol., 7: 1955–1960, 1987.
26. Heisterkamp, N., Knoppel, E., and Groffen, J. The first BCR gene intron contains
breakpoints in Philadelphia chromosome positive leukemia. Nucleic Acids Res., 16:
10069 –10081, 1988.
27. Nowell, P. C., and Hungerford, D. A. A minute chromosome in human chronic
granulocytic leukemia. Science (Washington DC), 132: 1197, 1960.
28. Romero, P., Beran, M., Shtalrid, M., Andersson, B., Talpaz, M., and Blick, M.
Alternative 5⬘ end of the BCR-ABL transcript in chronic myelogenous leukemia.
Oncogene, 4: 93–98, 1989.
29. National Center for Biotechnology Information. Entrez Nucleotide Query. http://
www.ncbi.nlm.nih.gov/Entrez/, 1999.
30. Amson, R. B., Marcelle, C., and Telerman, A. Identification of a 130Kda BCR
related gene product. Oncogene, 4: 243–247, 1989.
31. Hariharan, I. K., and Adams, J. M. cDNA sequence for human BCR, the gene that
translocates to the ABL oncogene in chronic myeloid leukaemia. EMBO J., 6:
115–119, 1987.
32. Collins, S., Coleman, H., and Groudine, M. Expression of BCR and BCR-ABL fusion
transcripts in normal and leukemic cells. Mol. Cell. Biol., 7: 2870 –2876, 1987.
33. Wetzler, M., Talpaz, M., Van Etten, R. A., Hirsh-Ginsberg, C., Beran, M., and
Kurzrock, R. Subcellular localization of Bcr, Abl, and Bcr-Abl proteins in normal
and leukemic cells and correlation of expression with myeloid differentiation.
J. Clin. Investig., 92: 1925–1939, 1993.
34. Croce, C. M., Huebner, K., Isobe, M., Fainstain, E., Lifshitz, B., Shtivelman, E., and
Canaani, E. Mapping of four distinct BCR-related loci to chromosome region 22q11:
order of BCR loci relative to chronic myelogenous leukemia and acute lymphoblastic
leukemia breakpoints. Proc. Natl. Acad. Sci. USA, 84: 7174 –7178, 1987.
35. Heisterkamp, N., Morris, C., and Groffen, J. ABR, an active BCR-related gene.
Nucleic Acids Res., 17: 8821– 8831, 1989.
36. Lifshitz, B., Fainstein, E., Marcelle, C., Shtivelman, E., Amson, R., Gale, R. P., and
Canaani, E. BCR genes and transcripts. Oncogene, 2: 113–117, 1988.
37. Marcelle, C., Gale, R. P., Prokocimer, M., Berrebi, A., Merle-Beral, H., and
Canaani, E. Analysis of BCR-ABL mRNA in chronic myelogenous leukemia patients
and identification of a new BCR-related sequence in human DNA. Genes Chromosomes Cancer, 1: 172–179, 1989.
38. DiSilvestre, D., Morris, C., Heisterkamp, N., and Groffen, J. A hypervariable RFLP
within the ABR gene. Nucleic Acids Res., 18: 5924, 1990.
39. Tan, E-C., Leung, T., Manser, E., and Lim, L. The human active breakpoint cluster
region-related gene encodes a brain protein with homology to guanine nucleotide
exchange proteins and GTPase-activating proteins. J. Biol. Chem., 268: 27291–
27298, 1993.
40. Muller, A. J., and Witte, O. N. The 5⬘ noncoding region of the human leukemiaassociated oncogene BCR/ABL is a potent inhibitor of in vitro translation. Mol. Cell.
Biol., 9: 5234 –5238, 1989.
41. Zhu, Q-S., Heisterkamp, H., and Groffen, J. Unique organization of the human BCR
gene promoter. Nucleic Acids Res., 18: 7119 –7125, 1990.
42. Shah, N. P., Witte, O. N., and Denny, C. T. Characterization of the BCR promoter
in Philadelphia chromosome-positive and -negative cell lines. Mol. Cell. Biol., 11:
1854 –1860, 1991.
43. Watson, J. D., Hopkins, N. H., Roberts, J. W., Steitz, J. A., and Weiner, A. M. The
functioning of higher eucaryotic genes. In: J. R. Gillen (ed.), Molecular Biology of
the Gene, Ed. 4, pp. 676 –744. Menlo Park, California: Benjamin/Cummings, 1988.
44. Li, W., Dreazen, O., Kloetzer, W., Gale, R. P., and Arlinghaus, R. B. Characterization of BCR gene products in hematopoietic cells. Oncogene, 4: 127–138, 1989.
45. Heisterkamp, N., Kaartinen, V., van Soest, S., Bokoch, G. M., and Groffen, J.
Human ABR encodes a protein with GAPRac activity and homology to the DBL
nucleotide exchange factor domain. J. Biol. Chem., 268: 16903–16906, 1993.
46. Chuang, T-H., Xu, X., Kaartinen, V., Heisterkamp, N., Groffen, J., and Bokoch,
G. M. Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein
family. Proc. Natl. Acad. Sci. USA, 92: 10282–10286, 1995.
47. Dhut, S., Chaplin, T., and Young, B. D. Bcr-Abl and Bcr proteins. Biochemical
characterization and localization. Leukemia (Baltimore), 4: 745–750, 1990.
48. Arlinghaus, R. B. Multiple BCR-related gene products and their proposed involvement in ligand-induced signal transduction pathways. Mol. Carcinog., 5: 171–173,
1992.
49. Wetzler, M., Talpaz, M., Yee, G., Stass, S. A., Van Etten, R. A., Andreeff, M.,
Goodacre, A. M., Kleine, H-D., Mahadevia, R. K., and Kurzrock, R. Cell cyclerelated shifts in subcellular localization of Bcr: association with mitotic chromosomes and with heterochromatin. Proc. Natl. Acad. Sci. USA, 92: 3488 –3492, 1995.
50. Laurent, E., Talpaz, M., Wetzler, M., and Kurzrock, R. Cytoplasmic and nuclear
localization of the 130 and 160 kDa Bcr proteins. Leukemia (Baltimore), 14:
1892–1897, 2000.
51. Takeda, N., Shibuya, M., and Maru, Y. The Bcr-Abl oncoprotein potentially interacts with the xeroderma pigmentosum group B protein. Proc. Natl. Acad. Sci. USA,
96: 203–207, 1999.
52. Maru, Y., Kobayashi, T., Tanaka, K., and Shibuya, M. Bcr binds to the xeroderma
pigmentosum group B protein. Biochem. Biophys. Res. Commun., 260: 309 –312,
1999.
53. Frit, P., Bergmann, E., and Egly, J-M. Transcription factor IIH: a key player in the
cellular response to DNA damage. Biochimie, 81: 27–38, 1999.
54. Maru, Y., and Witte, O. N. The BCR gene encodes a novel serine/threonine kinase
activity within a single exon. Cell, 67: 459 – 468, 1991.
55. Reuther, G. W., Fu, H., Cripe, L. D., Collier, R. J., and Pendergast, A-M. Association of the protein kinases c-Bcr and Bcr-Abl with proteins of the 14-3-3 family.
Science (Washington DC), 266: 129 –133, 1994.
56. Braselmann, S., and McCormick, F. Bcr and Raf form a complex in vivo via 14-3-3
proteins. EMBO J., 14: 4839 – 4848, 1995.
57. McWhirter, J. R., Galasso, D. L., and Wang, J. Y. J. A coiled-coil oligomerization
domain of Bcr is essential for the transforming function of Bcr-Abl oncoproteins.
Mol. Cell. Biol., 13: 7587–7595, 1993.
58. Guo, X. Y. D., Cuillerot, J-M., Wang, T., Wu, Y., Arlinghaus, R., Claxton, D.,
Bachier, C., Greenberger, J., Colombowala, I., and Deisseroth, A. B. Peptide
containing the BCR oligomerization domain (AA 1–160) reverses the transformed
phenotype of p210Bcr-Abl positive 32D myeloid leukemia cells. Oncogene, 17:
825– 833, 1998.
59. Pendergast, A-M., Quilliam, L. A., Cripe, L. D., Bassing, C. H., Dai, Z., Li, N.,
Batzer, A., Rabun, K. M., Der, C. J., Schlessinger, J., and Gishizky, M. L. BCRABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of
the Grb-2 adaptor protein. Cell, 75: 175–185, 1993.
60. Pendergast, A-M., Muller, A. J., Havlik, M. H., Maru, Y., and Witte, O. N. Bcr
sequences essential for transformation by the BCR-ABL oncogene bind to the Abl
SH2 regulatory domain in a nonphosphotyrosine-dependent manner. Cell, 66: 161–
171, 1991.
61. Muller, A. J., Pendergast, A-M., Havlik, M. H., Puil, L., Pawson, T., and Witte,
O. N. A limited set of SH2 domains binds Bcr through a high-affinity phosphotyrosine-independent interaction. Mol. Cell. Biol., 12: 5087–5093, 1992.
62. Stewart, M. J., Cox, G., Reifel-Miller, A., Kim, S. Y., Westbrook, C. A., and
Leibowitz, D. S. A novel transcriptional suppressor located within a downstream
intron of the BCR gene. J. Biol. Chem., 269: 10820 –10829, 1994.
63. Ron, D., Zannini, N., Levis, M., Wickner, R. B., Hunt, L. T., Graziani, G., Tronick,
S. R., Aaronson, S. A., and Eva, A. A region of proto-dbl essential for its transforming activity shows sequence similarity to a yeast cell cycle gene CDC24, and
the human breakpoint cluster gene, BCR. New Biol., 3: 372–379, 1991.
64. Adams, J. M., Houston, H., Allen, J., Lints, T., and Harvey, R. The hematopoietically expressed VAV proto-oncogene shares homology with the DBL GDP-GTP
exchange factor, the BCR gene, and a yeast gene (CDC24) involved in cytoskeletal
organization. Oncogene, 7: 611– 618, 1992.
65. Diekmann, D., Brill, S., Garrett, M. D., Totty, N., Hsuan, J., Monfries, C., Hall, C.,
Lim, L., and Hall, A. BCR encodes a GTPase-activating protein for p21Rac. Nature
(Lond.), 351: 400 – 402, 1991.
66. Voncken, J. W., van Schaick, H., Kaartinen, V., Deemer, K., Coates, T., Landing,
B., Pattengale, P., Dorseuil, O., Bokoch, G. M., Groffen, J., and Heisterkamp, N.
Increased neutrophil respiratory burst in BCR-null mutants. Cell, 80: 719 –728,
1995.
67. Cicchetti, P., Mayer, B. J., Thiel, G., and Baltimore, D. Identification of a protein
that binds to the SH3 region of Abl and is similar to Bcr and GAP-rho. Science
(Washington DC), 257: 803– 806, 1992.
68. Hart, M. J., Eva, A., Evans, T., Aaronson, S. A., and Cerione, R. A. Catalysis of
guanine nucleotide exchange on the Cdc42Hs protein by the DBL oncogene product.
Nature (Lond.), 354: 311–314, 1991.
69. Muller, A. J., Young, J. C., Pendergast, A-M., Pondel, M., Landau, N. R., Littman,
D. R., and Witte, O. N. BCR first exon sequences specifically activate the BCR/ABL
tyrosine kinase oncogene of Philadelphia chromosome-positive human leukemias.
Mol. Cell. Biol., 11: 1785–1792, 1991.
70. McWhirter, J. R., and Wang, J. Y. J. Activation of tyrosine kinase and microfilament-binding functions of c-Abl by Bcr sequences in Bcr/Abl fusion proteins. Mol.
Cell. Biol., 11: 1553–1565, 1991.
71. Arlinghaus, R. B. The involvement of Bcr in leukemias with the Philadelphia
chromosome. Crit. Rev. Oncog., 9: 1–18, 1998.
72. Liu, J., Campbell, M., Guo, J. Q., Lu, D., Xian, Y. M., Andersson, B. S., and
Arlinghaus, R. B. BCR-ABL tyrosine kinase is autophosphorylated or transphosphorylates p160 Bcr on tyrosine predominantly within the first Bcr exon. Oncogene, 8:
101–109, 1992.
73. Sadowski, I., Stone, J. C., and Pawson, T. A noncatalytic domain conserved among
cytoplasmic protein-tyrosine kinases modifies the kinase function and transforming
activity of Fujinami sarcoma virus p130Gag-Fps. Mol. Cell. Biol., 6: 4396 – 4408,
1986.
74. Koch, C. A., Anderson, D., Moran, M. F., Ellis, C., and Pawson, T. SH2 and SH3
domains: elements that control interactions of cytoplasmic signaling proteins. Science (Washington DC), 252: 668 – 674, 1991.
75. Margolis, B. Proteins with SH2 domains: transducers in the tyrosine kinase signaling
pathway. Cell Growth Differ., 3: 73– 80, 1992.
76. Pendergast, A-M., Clark, R., Kawasaki, E. S., McCormick, F. P., and Witte, O. N.
Baculovirus expression of functional p210 BCR-ABL oncogene product. Oncogene,
4: 759 –766, 1989.
2351
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
77. Campbell, M. L., Li, W., and Arlinghaus, R. B. p210 Bcr-Abl is complexed to p160
Bcr and Ph-p53 proteins in K562 cells. Oncogene, 5: 773–776, 1990.
78. Okuda, K., Golub, T. R., Gilliland, D. G., and Griffin, J. D. p210 BCR/ABL, p190
BCR/ABL, and TEL/ABL activate similar signal transduction pathways in hematopoietic cell lines. Oncogene, 13: 1147–1152, 1996.
79. van Etten, R. A., Jackson, P., and Baltimore, D. The mouse type IV c-ABL gene
product is a nuclear protein, and activation of transforming ability is associated with
cytoplasmic localization. Cell, 58: 669 – 678, 1989.
80. Kipreos, E. T., and Wang, J. Y. J. Cell cycle-regulated binding of c-Abl tyrosine
kinase to DNA. Science (Washington DC), 256: 382–385, 1992.
81. Heisterkamp, N., Groffen, J., Stephenson, J. R., Spurr, N. K., Goodfellow, P. N.,
Solomon, E., Carritt, B., and Bodmer, W. F. Chromosomal localization of human
cellular homologues of two viral oncogenes. Nature (Lond.), 299: 747–749, 1982.
82. Bernards, A., Rubin, C. M., Westbrook, C. A., Paskind, M., and Baltimore, D. The
first intron in the human c-ABL gene is at least 200 kilobases long and is a target for
translocations in chronic myelogenous leukemia. Mol. Cell. Biol., 7: 3231–3236,
1987.
83. Dhut, S., Chaplin, T., and Young, B. D. Normal c-ABL gene protein–a nuclear
component. Oncogene, 6: 1459 –1464, 1991.
84. Kharbanda, S., Pandey, P., Morris, P. L., Whang, Y., Xu, Y., Sawant, S., Zhu, L-J.,
Kumar, N., Yuan, Z-M., Weichselbaum, R., Sawyers, C. L., Pandita, T. K., and
Kufe, D. Functional role for the c-Abl tyrosine kinase in meiosis I. Oncogene, 16:
1773–1777, 1998.
85. David-Cordonnier, M-H., Hamdane, M., Bailly, C., and D’Halluin, J-C. Determination of the human c-Abl consensus DNA binding site. FEBS Lett., 424: 177–182,
1998.
86. David-Cordonnier, M-H., Hamdane, M., Bailly, C., and D’Halluin, J-C. The DNA
binding domain of the human c-Abl tyrosine kinase preferentially binds to DNA
sequences containing an AAC motif and to distorted DNA structures. Biochemistry,
37: 6065– 6076, 1998.
87. Franz, W. M., Berger, P., and Wang, J. Y. J. Deletion of an N-terminal regulatory
domain of the c-Abl tyrosine kinase activates its oncogenic potential. EMBO J., 8:
137–147, 1989.
88. Jackson, P., and Baltimore, D. N-terminal mutations activate the leukemogenic
potential of the myristylated form of c-Abl. EMBO J., 8: 449 – 456, 1989.
89. Barila, D., and Superti-Furga, G. An intramolecular SH3-domain interaction regulates c-Abl activity. Nat. Genet., 18: 280 –282, 1998.
90. Welch, P. J., and Wang, J. Y. J. A c-terminal protein-binding domain in the
retinoblastoma protein regulates nuclear c-Abl tyrosine kinase in the cell cycle. Cell,
75: 779 –790, 1993.
91. Goga, A., Liu, X., Hambuch, T. M., Senechal, K., Major, E., Berk, A. J., Witte,
O. N., and Sawyers, C. L. p53 dependent growth suppression by the c-Abl nuclear
tyrosine kinase. Oncogene, 11: 791–799, 1995.
92. Afar, D. E. H., McLaughlin, J., Sherr, C. J., Witte, O. N., and Roussel, M. F.
Signaling by ABL oncogenes through cyclin D1. Proc. Natl. Acad. Sci. USA, 92:
9540 –9544, 1995.
93. Shafman, T., Khanna, K. K., Kedar, P., Spring, K., Kozlov, S., Yen, T., Hobson, K.,
Gatei, M., Zhang, N., Watters, D., Egerton, M., Shiloh, Y., Kharbanda, S., Kufe, D.,
and Lavin, M. F. Interaction between Atm protein and c-Abl in response to DNA
damage. Nature (Lond.), 387: 520 –523, 1997.
94. Baskaran, R., Wood, L. D., Whitaker, L. L., Canman, C. E., Morgan, S. E., Xu, Y.,
Barlow, C., Baltimore, D., Wynshaw-Boris, A., Kastan, M. B., and Wang, J. Y. J.
Ataxia telangiectasia mutant protein activates c-Abl tyrosine kinase in response to
ionizing radiation. Nature (Lond.), 387: 516 –519, 1997.
95. Agami, R., Blandino, G., Oren, M., and Shaul, Y. Interaction of c-Abl and p73␣ and
their collaboration to induce apoptosis. Nature (Lond.), 399: 809 – 813, 1999.
96. Yuan, Z. M., Shioya, H., Ishiko, T., Sun, X., Gu, J., Huang, Y. Y., Lu, H.,
Kharbanda, S., Weichselbaum, R., and Kufe, D. p73 is regulated by tyrosine kinase
c-Abl in the apoptotic response to DNA damage. Nature (Lond.), 399: 814 – 817,
1999.
97. Gong, J. G., Costanzo, A., Yang, H-Q., Melino, G., Kaelin, W. G., Jr., Levrero, M.,
and Wang, J. Y. The tyrosine kinase c-Abl regulates p73 in apoptotic response to
cisplatin-induced DNA damage. Nature (Lond.), 399: 806 – 809, 1999.
98. Kipreos, E. T., and Wang, J. Y. J. Differential phosphorylation of c-Abl in cell cycle
determined by Cdc2 kinase and phosphatase activity. Science (Washington DC),
248: 217–220, 1990.
99. Nichols, G. L., Raines, M. A., Vera, J. C., Lacomis, L., Tempst, P., and Golde, P. W.
Identification of Crkl as the constitutively phosphorylated 39-kD tyrosine phosphoprotein in chronic myelogenous leukemia cells. Blood, 84: 2912–2918, 1994.
100. Oda, T., Heaney, C., Hagopian, J. R., Okuda, K., Griffin, J. D., and Druker, B. J.
Crkl is the major tyrosine-phosphorylated protein in neutrophils from patients with
chronic myelogenous leukemia. J. Biol. Chem., 269: 22925–22928, 1994.
101. Sawyers, C. L., McLaughlin, J., Goga, A., Havlik, M., and Witte, O. N. The nuclear
tyrosine kinase c-Abl negatively regulates cell growth. Cell, 77: 121–131, 1994.
102. Dai, Z., and Pendergast, A-M. Abi-2, a novel SH3-containing protein interacts with
the c-Abl tyrosine kinase and modulates c-Abl transforming activity. Genes Dev., 9:
2569 –2582, 1995.
103. Dai, Z., Quackenbush, R. C., Courtney, K. D., Grove, M., Cortez, D., Reuther,
G. W., and Pendergast, A. M. Oncogenic Abl and Src tyrosine kinases elicit the
ubiquitin-dependent degradation of target proteins through a Ras-independent pathway. Genes Dev., 12: 1415–1424, 1998.
104. Shi, Y., Alin, K., and Goff, S. P. Abl-interactor-1, a novel SH3 protein binding to
the carboxy-terminal portion of the Abl protein, suppresses v-Abl transforming
activity. Genes Dev., 9: 2583–2597, 1995.
105. Juang, J-L., and Hoffmann, F. M. Drosophila Abelson interacting protein (dAbi) is
a positive regulator of Abelson tyrosine kinase activity. Oncogene, 18: 5138 –5147,
1999.
106. McWhirter, J. R., and Wang, J. Y. J. An actin-binding function contributes to
transformation by the Bcr-Abl oncoprotein of Philadelphia chromosome-positive
human leukemias. EMBO J., 12: 1533–1546, 1993.
107. Gibbs, J. B., Schaber, M. D., Garsky, V. M., Vogel, U. S., Scolnick, E. M., Dixon,
R. A. F., and Marshall, M. S. Structure/function relationships of Ras and guanosine
triphosphatase-activating protein. In: N. M. Nathanson and T. K. Harden (eds.), G
proteins and Signal Transduction: Society of General Physiologists, 43rd Annual
Symposium, pp. 77– 85. New York: Rockefeller University Press, 1990.
108. van Aelst, L., and D’Souza-Schorey, C. Rho GTPases and signaling networks.
Genes Dev., 11: 2295–2322, 1997.
109. Cen, H., Papageorge, A. G., Zippel, R., Lowy, D. R., and Zhang, K. Isolation of
multiple mouse cDNAs with coding homology to Saccharomyces cerevisiae
CDC25: identification of a region related to BCR, VAV, DBL, and CDC24. EMBO
J., 11: 4007– 4015, 1992.
110. Sloat, B. F., Adams, A., and Pringle, J. R. Roles of the CDC24 gene product in
cellular morphogenesis during the Saccharomyces cerevisiae cell cycle. J. Cell Biol.,
89: 395– 405, 1981.
111. Chant, J., and Pringle, J. R. Budding and cell polarity in Saccharomyces cerevisiae.
Curr. Opin. Genet. Dev., 1: 342–350, 1991.
112. Ziman, M., O’Brien, J. M., Ouellette, L. A., Church, W. R., and Johnson, D. I.
Mutational analysis of CDC42Sc, a Sacchromyces cerevisiae gene that encodes a
putative GTP-binding protein involved in the control of cell polarity. Mol. Cell.
Biol., 11: 3537–3544, 1991.
113. Johnson, D. I., and Pringle, J. R. Molecular characterization of CDC42, a Sacchromyces cerevisiae gene involved in the development of cell polarity. J. Cell Biol.,
111: 143–152, 1990.
114. Ziman, M., and Johnson, D. I. Genetic evidence for a functional interaction between
Saccharomyces cerevisiae CDC24 and CDC42. Yeast, 10: 463– 474, 1994.
115. Hall, A. The cellular functions of small GTP-binding proteins. Science (Washington
DC), 249: 635– 640, 1990.
116. Hall, A. Ras-related proteins. Curr. Opin. Cell Biol., 5: 265–268, 1993.
117. Ridley, A. J., and Hall, A. The small GTP-binding protein Rho regulates the
assembly of focal adhesions and actin stress fibers in response to growth factors.
Cell, 70: 389 –399, 1992.
118. Lancaster, C. A., Taylor-Harris, P. M., Self, A. J., Brill, S., van Erp, H. E., and Hall,
A. Characterization of RhoGAP. A GTPase-activating protein for Rho-related small
GTPases. J. Biol. Chem., 269: 1137–1142, 1994.
119. Hall, C., Monfries, C., Smith, P., Lim, H. H., Kozma, R., Ahmed, S.,
Vanniasingham, V., Leung, T., and Lim, L. Novel human brain cDNA encoding a
34,000 Mr protein n-chimaerin, related to both the regulatory domain of protein
kinase C and Bcr, the product of the breakpoint cluster region gene. J. Mol. Biol.,
211: 11–16, 1990.
120. Aitken, A. 14-3-3 proteins on the MAP. Trends Biochem. Sci., 20: 95–97, 1995.
121. Ford, J. C., Al-Khodairy, F., Fotou, E., Sheldrick, K. S., Griffiths, D. J. F., and Carr,
A. M. 14-3-3 protein homologs required for the DNA damage checkpoint in fission
yeast. Science (Washington DC), 265: 533–535, 1994.
122. Lopez-Girona, A., Furnari, B., Mondesert, O., and Russell, P. Nuclear localization
of Cdc25 is regulated by DNA damage and a 14-3-3 protein. Nature (Lond.), 397:
172–175, 1999.
123. Muslin, A. J., Tanner, J. W., Allen, P. M., and Shaw, A. S. Interaction of 14-3-3 with
signaling proteins is mediated by the recognition of phosphoserine. Cell, 84:
889 – 897, 1996.
124. Jones, D. H., Ley, S., and Aitken, A. Isoforms of 14-3-3 protein can form homo- and
heterodimers in vivo and in vitro: implications for function as adapter proteins.
FEBS Lett., 368: 55–58, 1995.
125. Catovsky, D., Pittman, S., O’Brien, M., Cherchi, M., Costello, C., Foa, R., Pearce,
E., Hoffbrand, A. V., Janossy, G., Ganeshaguru, K., and Greaves, M. F. Multiparameter studies in lymphoid leukemias. Am. J. Clin. Pathol., 72: 736 –745, 1979.
126. Collins, S. J. Breakpoints on chromosome 9 and 22 in Philadelphia chromosomepositive chronic myelogenous leukemia (CML). J. Clin. Investig., 78: 1392–1396,
1986.
127. Schaefer-Rego, K., Dudek, H., Popenoe, D., Arlin, Z., Mears, J. G., Bank, A., and
Leibowitz, D. CML patients in blast crisis have breakpoints localized to a specific
region of the. BCR. Blood, 70: 448 – 455, 1987.
128. Boehm, T. L., and Drahovsky, D. Application of a BCR-specific probe in the
classification of human leukaemia. J. Cancer Res. Clin. Oncol., 113: 267–272, 1987.
129. Benn, P., Soper, L., Eisenberg, A., Silver, R. T., Coleman, M., Cacciapaglia, B.,
Bennett, L., Baird, M., Silverstein, M., Berger, C., and Bernhardt, B. Utility of
molecular genetic analysis of BCR rearrangement in the diagnosis of chronic
myeloid leukemia. Cancer Genet. Cytogenet., 29: 1–7, 1987.
130. Selleri, L., Narni, F., Emilia, G., Colo, A., Zucchini, P., Venturelli, D., Donelli, A.,
Torelli, U., and Torelli, G. Philadelphia-positive chronic myeloid leukemia with a
chromosome 22 breakpoint outside the breakpoint cluster region. Blood, 70: 1659 –
1664, 1987.
131. Hirosawa, S., Aoki, N., Shibuya, M., and Onozawa, Y. Breakpoints in Philadelphia
chromosome (Ph1)-positive leukemias. Jpn. J. Cancer Res., 78. 590 –595, 1987.
132. Shtalrid, M., Talpaz, M., Kurzrock, R., Kantarjian, H., Trujillo, J., Gutterman, J.,
Yoffe, G., and Blick, M. Analysis of breakpoints within the BCR gene and their
correlation with the clinical course of Philadelphia-positive chronic myelogenous
leukemia. Blood, 72: 485– 490, 1988.
133. Clark, S. S., McLaughlin, J., Crist, W. M., Champlin, R., and Witte, O. N. Unique
forms of the Abl tyrosine kinase distinguish Ph1-positive CML from Ph1-positive
ALL. Science (Washington DC), 235: 85– 88, 1987.
2352
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
134. Rodenhuis, S., Smets, L. A., Slater, R. M., Behrendt, H., and Veerman, A. J. P.
Distinguishing the Philadelphia chromosome of acute lymphoblastic leukemia from
its counterpart in chronic myelogenous leukemia. N. Engl. J. Med., 313: 51–52,
1985.
135. Erikson, J., Griffin, C. A., ar-Rushdi, A., Valtieri, M., Hoxie, J., Finan, J., Emanuel,
B. S., Rovera, G., Nowell, P. C., and Croce, C. M. Heterogeneity of chromosome 22
breakpoint in Philadelphia-positive (Ph⫹) acute lymphocytic leukemia. Proc. Natl.
Acad. Sci. USA, 83: 1807–1811, 1986.
136. de Klein, A., Hagemeijer, A., Bartram, C. R., Houwen, R., Hoefsloot, L., Carbonell,
F., Chan, L., Barnett, M., Greaves, M., Kleihauer, E., Heisterkamp, N., Groffen, J.,
and Grosveld, G. BCR rearrangement and translocation of the c-ABL oncogene in
Philadelphia positive acute lymphoblastic leukemia. Blood, 68: 1369 –1375, 1986.
137. Okabe, M., Matsushima, S., Morioka, M., Kobayashi, M., Abe, S., Sakurada, K.,
Kakinuma, M., and Miyazaki, T. Establishment and characterization of a cell line,
TOM-1, derived from a patient with Philadelphia chromosome-positive acute lymphocytic leukemia. Blood, 69: 990 –998, 1987.
138. Fainstein, E., Marcelle, C., Rosner, A., Canaani, E., Gale, R. P., Dreazen, O., Smith,
S. D., and Croce, C. M. A new fused transcript in Philadelphia chromosome positive
acute lymphocytic leukaemia. Nature (Lond.), 330: 386 –388, 1987.
139. ar-Rushdi, A., Negrini, M., Kurzrock, R., Huebner, K., and Croce, C. M. Fusion of
the BCR and the c-ABL genes in Ph⬘-positive acute lymphocytic leukemia with no
rearrangement in the breakpoint cluster region. Oncogene, 2: 353–357, 1988.
140. Saglio, G., Guerrasio, A., Tassinari, A., Ponzetto, C., Zaccaria, A., Testoni, P.,
Celso, B., Rege-Cambrin, G., Serra, A., Pegoraro, L., Avanzi, G. C., Attadia, V.,
Falda, M., and Gavosto, F. Variability of the molecular defects corresponding to the
presence of a Philadelphia chromosome in human hematologic malignancies. Blood,
72: 1203–1208, 1988.
141. Chen, S. J., Chen, Z., Font, M-P., d’Auriol, L., Larsen, C-J., and Berger, R.
Structural alterations of the BCR and ABL genes in Ph1 positive acute leukemias
with rearrangements in the BCR gene first intron: further evidence implicating Alu
sequences in the chromosome translocation. Nucleic Acids Res., 17: 7631–7642,
1989.
142. Popenoe, D. W., Schaefer-Rego, K., Mears, J. G., Bank, A., and Leibowitz, D.
Frequent and extensive deletion during the 9,22 translocation in CML. Blood, 68:
1123–1128, 1986.
143. Dhingra, K., Talpaz, M., Kantarjian, H., Ku, S., Rothberg, J., Gutterman, J. U., and
Kurzrock, R. Appearance of acute leukemia-associated p190Bcr-Abl in chronic
myelogenous leukemia may correlate with disease progression. Leukemia (Baltimore), 5: 191–195, 1991.
144. de Klein, A., van Kessel, A. G., Grosveld, G., Bartram, C. R., Hagemeijer, A.,
Bootsma, D., Spurr, N. K., Heisterkamp, N., Groffen, J., and Stephenson, J. R. A
cellular oncogene is translocated to the Philadelphia chromosome in chronic myelocytic leukaemia. Nature (Lond.), 300: 765–767, 1982.
145. Heisterkamp, N., Stephenson, J. R., Groffen, J., Hansen, P. F., de Klein, A., Bartram,
C. R., and Grosveld, G. Localization of the c-ABL oncogene adjacent to a translocation break point in chronic myelocytic leukaemia. Nature (Lond.), 306: 239 –242,
1983.
146. Leibowitz, D., Schaefer-Rego, K., Popenoe, D. W., Mears, G., and Bank, A.
Variable breakpoints on the Philadelphia chromosome in chronic myelogenous
leukemia. Blood, 66: 243–245, 1985.
147. Papadopoulos, P. C., Greenstein, A. M., Gaffney, R. A., Westbrook, C. A., and
Wiedemann, L. M. Characterization of the translocation breakpoint sequences in
Philadelphia-positive acute lymphoblastic leukemia. Genes Chromosomes Cancer,
1: 233–239, 1990.
148. Zhang, J. G., Goldman, J. M., and Cross, N. C. Characterization of genomic
BCR-ABL breakpoints in chronic myeloid leukaemia by PCR. Br. J. Haematol., 90:
138 –146, 1995.
149. Chissoe, S. L., Bodenteich, A., Wang, Y-F., Wang, Y-P., Burian, D., Clifton, S. W.,
Crabtree, J., Freeman, A., Iyer, K., Jian, L., Ma, Y., McLaury, H-J., Pan, H-Q.,
Sarhan, O. H., Toth, S., Wang, Z., Zhang, G., Heisterkamp, N., Groffen, J., and Roe,
B. A. Sequence and analysis of the human ABL gene, the BCR gene, and regions
involved in the Philadelphia chromosomal translocation. Genomics, 27: 67– 82,
1995.
150. Jeffs, A. R., Benjes, S. M., Smith, T. L., Sowerby, S. J., and Morris, C. M. The BCR
gene recombines preferentially with Alu elements in complex BCR-ABL translocations of chronic myeloid leukaemia. Hum. Mol. Genet., 7: 767–776, 1998.
151. Biernaux, C., Loos, M., Sels, A., Huez, G., and Stryckmans, P. Detection of major
BCR-ABL gene expression at a very low level in blood cells of some healthy
individuals. Blood, 86: 3118 –3122, 1995.
152. Bose, S., Deininger, M., Gora-Tybor, J., Goldman, J. M., and Melo, J. V. The
presence of typical and atypical BCR-ABL fusion genes in leukocytes of normal
individuals: biologic significance and implications for the assessment of minimal
residual disease. Blood, 92: 3362–3367, 1998.
153. Kozubek, S., Lukasova, E., Ryznar, L., Kozubek, M., Liskova, A., Govorun, R. D.,
Krasavin, E. A., and Horneck, G. Distribution of ABL and BCR genes in cell nuclei
of normal and irradiated lymphocytes. Blood, 89: 4537– 4545, 1997.
154. Neves, H., Ramos, C., da Silva, M. G., Parreira, A., and Parriera, L. The nuclear
topography of ABL, BCR, PML, and RAR␣ genes: evidence for gene proximity in
specific phases of the cell cycle and stages of hematopoietic differentiation. Blood,
93: 1197–1207, 1999.
155. Anastasi, J., Moinuddin, R., and Daugherty, C. The juxtaposition of ABL with BCR
and risk for fusion may come at a time of BCR replication in late S-phase. Blood,
94: 1137–1145, 1999.
156. Wada, H., Mizutani, S., Nishimura, J., Usuki, Y., Kohsaki, M., Komai, M., Kaneko,
H., Sakamoto, S., Delia, D., Kanamaru, A., and Kakishita, E. Establishment and
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
172.
173.
174.
175.
176.
177.
178.
179.
180.
181.
182.
molecular characterization of a novel leukemic cell line with Philadelphia chromosome expressing p230 Bcr/Abl fusion protein. Cancer Res., 55: 3192–3196, 1995.
Pane, F., Frigeri, F., Sindona, M., Luciano, L., Ferrara, F., Cimino, R., Meloni, G.,
Saglio, G., Salvatore, F., and Rotoli, B. Neutrophilic-chronic myeloid leukemia: a
distinct disease with a specific molecular marker (BCR-ABL with c3a2 junction).
Blood, 88: 2410 –2414, 1996.
Emilia, G., Luppi, M., Marasca, R., and Torelli, G. Relationship between Bcr/Abl
fusion proteins and leukemia phenotype. Blood, 89: 3889, 1997.
Mittre, H., Leymarie, P., Macro, M., and Leporrier, M. A new case of chronic
myeloid leukemia with c3/a2 BCR/ABL junction. Is it really a distinct disease?
Blood, 89: 4239 – 4241, 1997.
Briz, M., Vilches, C., Cabrera, R., Forès, R., and Fernández, M. N. Typical chronic
myelogenous leukemia with e19a2 junction BCR/ABL transcript. Blood, 90: 5024 –
5025, 1997.
Haskovec, C., Ponzetto, C., Polak, J., Maritano, D., Zemanova, Z., Serra, A.,
Michalova, K., Klamova, H., Cermak, J., and Saglio, G. p230 Bcr/Abl protein may
be associated with an acute leukaemia phenotype. Br. J. Haematol., 103: 1104 –
1108, 1998.
Inukai, T., Sugita, K., Suzuki, T., Ijima, K., Goi, K., Tezuka, T., Kojika, S.,
Hatakeyama, K., Kagami, K., Mori, T., Okazaki, T., Mizutani, S., and Nakazawa, S.
A novel 203 kD aberrant BCR-ABL product in a girl with Philadelphia chromosome
positive acute lymphoblastic leukaemia. Br. J. Haematol., 85: 823– 825, 1993.
Hochhaus, A., Reiter, A., Skladny, H., Melo, J. V., Sick, C., Berger, U., Guo, J. Q.,
Arlinghaus, R. B., Hehlmann, R., Goldman, J. M., and Cross, N. C. P. A novel
BCR-ABL fusion gene (e6a2) in a patient with Philadelphia chromosome-negative
chronic myelogenous leukemia. Blood, 88: 2236 –2240, 1996.
Byrne, J. L., Carter, G. I., Davies, J. M., Haynes, A. P., Russell, N. H., and Cross,
N. C. P. A novel BCR-ABL fusion gene (e2/1a) in a patient with Philadelphiapositive chronic myelogenous leukaemia and an aggressive clinical course. Br. J.
Haematol., 103: 791–794, 1998.
How, G. F., Lim, L. C., Kulkarni, S., Tan, L. T., Tan, P., and Cross, N. C. P. Two
patients with novel BCR/ABL fusion transcripts (e8/a2 and e13/a2) resulting from
translocation breakpoints within BCR exons. Br. J. Haematol., 105: 434 – 436, 1999.
Lichty, B. D., Keating, A., Callum, J., Yee, K., Croxford, R., Corpus, G.,
Nwachukwu, B., Kim, P., Guo, J., and Kamel-Reid, S. Expression of p210 and p190
BCR-ABL due to alternative splicing in chronic myelogenous leukaemia. Br. J.
Haematol., 103: 711–715, 1998.
Skourides, P. A., Perera, S. A., and Ren, R. Polarized distribution of Bcr-Abl in
migrating myeloid cells and co-localization of Bcr-Abl and its target proteins.
Oncogene, 18: 1165–1176, 1999.
Druker, B., Okuda, K., Matulonis, U., Salgia, R., Roberts, T., and Griffin, J. D.
Tyrosine phosphorylation of rasGAP and associated proteins in chronic myelogenous leukemia cell lines. Blood, 79: 2215–2220, 1992.
Simon, M. A., Dodson, G. S., and Rubin, G. M. An SH3-SH2-SH3 protein is
required for p21Ras1 activation and binds to Sevenless and Sos protein in vitro. Cell,
73: 169 –177, 1993.
Tauchi, T., Boswell, H. S., Leibowitz, D., and Broxmeyer, H. E. Coupling between
p210Bcr-Abl and Shc and Grb2 adaptor proteins in hematopoietic cells permits
growth factor receptor-independent link to Ras activation pathway. J. Exp. Med.,
179: 167–175, 1994.
Wisniewski, D., Strife, A., Wojciechowicz, D., Lambek, C., and Clarkson, B. A
62-kilodalton tyrosine phosphoprotein constitutively present in primary chronic
phase chronic myelogenous leukemia enriched lineage negative blast populations.
Leukemia (Baltimore), 8: 688 – 693, 1994.
Carpino, N., Wisniewski, D., Strife, A., Marshak, D., Kobayashi, R., Stillman, B.,
and Clarkson, B. p62Dok. A constitutively tyrosine-phosphorylated, GAP-associated
protein in chronic myelogenous leukemia progenitor cells. Cell, 88: 197–204, 1997.
Yamanashi, Y., and Baltimore, D. Identification of the Abl- and RasGAP-associated
62 kDa protein as a docking protein, Dok. Cell, 88: 205–211, 1997.
Bhat, A., Johnson, K. J., Oda, T., Corbin, A. S., and Druker, B. J. Interactions of
p62Dok with p210Bcr-Abl and Bcr-Abl-associated proteins. J. Biol. Chem., 273:
32360 –32368, 1998.
Bedi, A., Barber, J. P., Bedi, G. C., El-Deiry, W. S., Sidransky, D., Vala, M. S.,
Akhtar, A. J., Hilton, J., and Jones, R. J. BCR-ABL-mediated inhibition of apoptosis
with delay of G2/M transition after DNA damage: a mechanism of resistance to
multiple anticancer agents. Blood, 86: 1148 –1158, 1995.
Sanchez-Garcia, I., and Grutz, G. Tumorigenic activity of the BCR-ABL oncogenes
is mediated by BCL2. Proc. Natl. Acad. Sci. USA, 92: 5287–5291, 1995.
McGahon, A., Bissonnette, R., Schmitt, M., Cotter, K. M., Green, D. R., and Cotter,
T. G. BCR-ABL maintains resistance of chronic myelogenous leukemia cells to
apoptotic cell death. Blood, 83: 1179 –1187, 1994.
McGahon, A. J., Nishioka, W. K., Martin, S. J., Mahboubi, A., Cotter, T. G., and
Green, D. R. Regulation of the Fas apoptotic cell death pathway by Abl. J. Biol.
Chem., 270: 22625–22631, 1995.
Amarante-Mendes, G. P., Kim, C. N., Liu, L., Huang, Y., Perkins, C. L., Green,
D. R., and Bhalla, K. Bcr-Abl exerts its anti-apoptotic effect against diverse
apoptotic stimuli through blockage of mitochondrial release of cytochrome c and
activation of caspase-3. Blood, 91: 1700 –1705, 1998.
Dubrez, L., Eymin, B., Sordet, O., Droin, N., Turhan, A. G., and Solary, E. Bcr-Abl
delays apoptosis upstream of procaspase-3 activation. Blood, 91: 2415–2422, 1998.
Reuther, J. Y., Reuther, G. W., Cortez, D., Pendergast, A-M., and Baldwin, A. S.,
Jr. A requirement for NF-␬B activation in Bcr-Abl-mediated transformation. Genes
Dev., 12: 968 –981, 1998.
Carlesso, N., Frank, D. A., and Griffin, J. D. Tyrosyl phosphorylation and DNA
binding activity of signal transducers and activators of transcription (Stat) proteins
2353
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
183.
184.
185.
186.
187.
188.
189.
190.
191.
192.
193.
194.
195.
196.
197.
198.
199.
200.
201.
202.
203.
204.
205.
206.
207.
in hematopoietic cell lines transformed by Bcr/Abl. J. Exp. Med., 183: 811– 820,
1996.
Wilson-Rawls, J., Xie, S., Liu, J., Laneuville, P., and Arlinghaus, R. B. p210
Bcr-Abl interacts with the interleukin 3 receptor ␤c subunit and constitutively
induces its tyrosine phosphorylation. Cancer Res., 56: 3426 –3430, 1996.
Frank, D. A., and Varticovski, L. Bcr/Abl leads to the constitutive activation of Stat
proteins, and shares an epitope with tyrosine phosphorylated Stats. Leukemia
(Baltimore), 10: 1724 –1730, 1996.
Ilaria, R. L., and van Etten, R. A. p210 and p190Bcr/Abl induce the tyrosine
phosphorylation and DNA binding activity of multiple specific STAT family members. J. Biol. Chem., 271: 31704 –31710, 1996.
Shuai, K., Halpern, J., ten Hoeve, J., Rao, X., and Sawyers, C. L. Constitutive
activation of Stat5 by the BCR-ABL oncogene in chronic myelogenous leukemia.
Oncogene, 13: 247–254, 1996.
Nieborowska-Skorska, M., Wasik, M. A., Slupianek, A., Salomoni, P., Kitamura, T.,
Calabretta, B., and Skorski, T. Signal transducer and activator of transcription
(Stat)5 activation by BCR/ABL is dependent on intact Src homology (SH)3 and SH2
domains of BCR/ABL and is required for leukemogenesis. J. Exp. Med., 189:
1229 –1242, 1999.
de Groot, R. P., Raaijmakers, J. A. M., Lammers, J-W. J., Jove, R., and
Koenderman, L. Stat5 activation by Bcr-Abl contributes to transformation of K562
leukemia cells. Blood, 94: 1108 –1112, 1999.
Varticovski, L., Daley, G. Q., Jackson, P., Baltimore, D., and Cantley, L. C.
Activation of phosphatidylinositol 3-kinase in cells expressing ABL oncogene variants. Mol. Cell. Biol., 11: 1107–1113, 1991.
Skorski, T., Kanakaraj, P., Nieborowska-Skorska, M., Ratajczak, M. Z., Wen, S-C.,
Zon, G., Gewirtz, A. M., Perussia, B., and Calabretta, B. Phosphatidylinositol-3
kinase activity is regulated by BCR/ABL and is required for the growth of Philadelphia chromosome-positive cells. Blood, 86: 726 –736, 1995.
Sattler, M., Salgia, R., Okuda, K., Uemura, N., Durstin, M. A., Pisick, E., Xu, G.,
Li, J-L., Prasad, K. V., and Griffin, J. D. The proto-oncogene product p120Cbl and
the adaptor proteins Crkl and c-Crk link c-Abl, p190Bcr/Abl, and p210Bcr/Abl to the
phosphatidylinositol-3⬘ kinase pathway. Oncogene, 12: 839 – 846, 1996.
Skorski, T., Bellacosa, A., Nieborowska-Skorska, M., Majewski, M., Martinez, R.,
Choi, J. K., Trotta, R., Wlodarski, P., Perrotti, D., Chan, T. O., Wasik, M. A.,
Tsichlis, P. N., and Calabretta, B. Transformation of hematopoietic cells by BCR/
ABL requires the activation of a PI-3k/Akt-dependent pathway. EMBO J., 16:
6151– 6161, 1997.
Raitano, A. B., Halpern, J. R., Hambuch, T. M., and Sawyers, C. L. The Bcr-Abl
leukemia oncogene activates Jun kinase and requires Jun for transformation. Proc.
Natl. Acad. Sci. USA, 92: 11746 –11750, 1995.
Puil, L., Liu, J., Gish, G., Mbamalu, G., Bowtell, D., Pelicci, P. G., Arlinghaus, R.,
and Pawson, T. Bcr-Abl oncoproteins bind directly to activators of the Ras signalling
pathway. EMBO J., 13: 764 –773, 1994.
Cortez, D., Stoica, G., Pierce, J. H., and Pendergast, A-M. The Bcr-Abl tyrosine
kinase inhibits apoptosis by activating a Ras-dependent signaling pathway. Oncogene, 13: 2589 –2594, 1996.
Verfaillie, C. M., Hurley, R., Lundell, B. I., Zhao, C., and Bhatia, R. Integrinmediated regulation of hematopoiesis: do Bcr/Abl-induced defects in integrin function underlie the abnormal circulation and proliferation of CML progenitors? Acta
Haematol., 97: 40 –52, 1997.
Bhatia, R., Munthe, H. A., and Verfaillie, C. M. Role of abnormal integrincytoskeletal interactions in impaired ␤1 integrin function in chronic myelogenous
leukemia hematopoietic progenitors. Exp. Hematol., 27: 1384 –1396, 1999.
Sattler, M., Verma, S., Byrne, C. H., Shrikhande, G., Winkler, T., Algate, P. A.,
Rohrschneider, L. R., and Griffin, J. D. Bcr/Abl directly inhibits expression of Ship,
an SH2-containing polyinositol-5-phosphatase involved in the regulation of hematopoiesis. Mol. Cell. Biol., 19: 7473–7480, 1999.
van der Feltz, M. J. M., Shivji, M. K. K., Grosveld, G., and Wiedmann, L. M.
Characterization of the translocation breakpoint in a patient with Philadelphia
positive, BCR negative acute lymphoblastic leukaemia. Oncogene, 3: 215–219,
1988.
Lugo, T. G., Pendergast, A-M., Muller, A. J., and Witte, O. N. Tyrosine kinase
activity and transformation potency of BCR-ABL oncogene products. Science
(Washington DC), 247: 1079 –1082, 1990.
Sawyers, C. L., McLaughlin, J., and Witte, O. N. Genetic requirement for Ras in the
transformation of fibroblasts and hematopoietic cells by the BCR-ABL oncogene.
J. Exp. Med., 181: 307–313, 1995.
Anderson, S. M., and Mladenovic, J. The BCR-ABL oncogene requires both kinase
activity and src-homology 2 domain to induce cytokine secretion. Blood, 87:
238 –244, 1996.
ten Hoeve, J., Arlinghaus, R. B., Guo, J. Q., Heisterkamp, N., and Groffen, J.
Tyrosine phosphorylation of Crkl in Philadelphia⫹ leukemia. Blood, 84: 1731–
1736, 1994.
Ernst, T. J., Slattery, K. E., and Griffin, J. D. p210Bcr/Abl and p160v-Abl induce an
increase in the tyrosine phosphorylation of p93c-Fes. J. Biol. Chem., 269: 5764 –
5769, 1994.
Tauchi, T., Feng, G-S., Shen, R., Song, H. Y., Donner, D., Pawson, T., and
Broxmeyer, H. E. SH2-containing phosphotyrosine phosphatase Syp is a target of
p210Bcr-Abl tyrosine kinase. J. Biol. Chem., 269: 15381–15387, 1994.
Matsuguchi, T., Salgia, R., Hallek, M., Eder, M., Druker, B., Ernst, T. J., and Griffin,
J. D. Shc phosphorylation in myeloid cells is regulated by granulocyte macrophage
colony-stimulating factor, interleukin-3, and Steel factor and is constitutively increased by p210Bcr/Abl. J. Biol. Chem., 269: 5016 –5021, 1994.
Matsuguchi, T., Inhorn, R. C., Carlesso, N., Xu, G., Druker, B., and Griffin, J. D.
Tyrosine phosphorylation of p95Vav in myeloid cells is regulated by GM-CSF, IL-3,
208.
209.
210.
211.
212.
213.
214.
215.
216.
217.
218.
219.
220.
221.
222.
223.
224.
225.
226.
227.
228.
229.
230.
and Steel factor and is constitutively increased by p210Bcr/Abl. EMBO J., 14:
257–265, 1995.
Salgia, R., Li, J-L., Lo, S. H., Brunkhorst, B., Kansas, G. S., Sobhany, E. S., Sun,
Y., Pisick, E., Hallek, M., Ernst, T., Tantravahi, R., Chen, L. B., and Griffin, J. D.
Molecular cloning of human paxillin, a focal adhesion protein phosphorylated by
p210Bcr/Abl. J. Biol. Chem., 270: 5039 –5047, 1995.
Mandanas, R. A., Leibowitz, D. S., Gharehbaghi, K., Tauchi, T., Burgess, G. S.,
Miyazawa, K., Jayaram, H. N., and Boswell, H. S. Role of p21 Ras in p210 Bcr-Abl
transformation of murine myeloid cells. Blood, 82: 1838 –1847, 1993.
Tauchi, T., Okabe, S., Miyazawa, K., and Ohyashiki, K. The tetramerization domain-independent Ras activation by Bcr-Abl oncoprotein in hematopoietic cells. Int.
J. Oncol., 12: 1269 –1276, 1998.
Damen, J. E., Liu, L., Rosten, P., Humphries, R. K., Jefferson, A. B., Majerus, P. W.,
and Krystal, G. The 145-kDa protein induced to associate with Shc by multiple
cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate
5-phosphatase. Proc. Natl. Acad. Sci. USA, 93: 1689 –1693, 1996.
Lioubin, M. N., Algate, P. A., Tsai, S., Carlberg, K., Aebersold, R., and
Rohrschneider, L. R. p150Ship, a signal transduction molecule with inositol polyphosphate-5-phosphatase activity. Genes Dev., 10: 1084 –1095, 1996.
Kavanaugh, W. M., Pot, D. A., Chin, S. M., Deuter-Reinhard, M., Jefferson, A. B.,
Norris, F. A., Masiarz, F. R., Cousens, L. S., Majerus, P. W., and Williams, L. T.
Multiple forms of an inositol polyphosphate 5-phosphatase form signaling complexes with Shc and Grb2. Curr. Biol., 6: 438 – 445, 1996.
Odai, H., Sasaki, K., Iwamatsu, A., Nakamoto, T., Ueno, H., Yamagata, T., Mitani,
K., Yazaki, Y., and Hirai, H. Purification and molecular cloning of SH2- and
SH3-containing inositol polyphosphate-5-phosphatase, which is involved in the
signaling pathway of granulocyte-macrophage colony-stimulating factor, erythropoietin, and Bcr-Abl. Blood, 89: 2745–2756, 1997.
Pesesse, X., Deleu, S., de Smedt, F., Drayer, L., and Erneux, C. Identification of a
second SH2-domain-containing protein closely related to the phosphatidylinositol
polyphosphate 5-phosphatase SHIP. Biochem. Biophys. Res. Commun., 239: 697–
700, 1997.
Helgason, C. D., Damen, J. E., Rosten, P., Grewal, R., Sorensen, P., Chappel, S. M.,
Borowski, A., Jirik, F., Krystal, G., and Humphries, R. K. Targeted disruption of
SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span.
Genes Dev., 12: 1610 –1620, 1998.
Wisniewski, D., Strife, A., Swendeman, S., Erdjument-Bromage, H., Geromanos, S.,
Kavanaugh, W. M., Tempst, P., and Clarkson, B. A novel SH2-containing phosphatidylinositol 3,4,5-triphosphate 5-phosphatase (Ship2) is constitutively tyrosine
phosphorylated and associated with Src homologous and collagen gene (SHC) in
chronic myelogenous leukemia progenitor cells. Blood, 93: 2707–2720, 1999.
Gotoh, A., Miyazawa, K., Ohyashiki, K., Tauchi, T., Boswell, H. S., Broxmeyer,
H. E., and Toyama, K. Tyrosine phosphorylation and activation of focal adhesion
kinase (p125Fak) by Bcr-Abl oncoprotein. Exp. Hematol., 23: 1153–1159, 1995.
Bhatia, R., Wayner, E. A., McGlave, P. B., and Verfaillie, C. M. Interferon-␣
restores normal adhesion of chronic myelogenous leukemia hematopoietic progenitors to bone marrow stroma by correcting impaired ␤1 integrin receptor function.
J. Clin. Investig., 94: 384 –391, 1994.
Bhatia, R., McCarthy, J. B., and Verfaillie, C. M. Interferon-␣ restores normal ␤1
integrin-mediated inhibition of hematopoietic progenitor proliferation by the marrow
microenvironment in chronic myelogenous leukemia. Blood, 87: 3883–3891, 1996.
Bhatia, R., and Verfaillie, C. M. Inhibition of Bcr-Abl expression with antisense
oligodeoxynucleotides restores ␤1 integrin-mediated adhesion and proliferation
inhibition in chronic myelogenous leukemia hematopoietic progenitors. Blood, 91:
3414 –3422, 1998.
Bhatia, R., Munthe, H. A., and Verfaillie, C. M. Tyrphostin AG957, a tyrosine
kinase inhibitor with anti-Bcr/Abl tyrosine kinase activity restores ␤1 integrinmediated adhesion and inhibitory signaling in chronic myelogenous leukemia hematopoietic progenitors. Leukemia (Baltimore), 12: 1708 –1717, 1998.
Kramer, A., Horner, S., Willer, A., Fruehauf, S., Hochhaus, A., Hallek, M., and
Hehlmann, R. Adhesion to fibronectin stimulates proliferation of wild-type and
BCR/ABL-transfected murine hematopoietic cells. Proc. Natl. Acad. Sci. USA, 96:
2087–2092, 1999.
Salgia, R., Uemura, N., Okuda, K., Li, J-L., Pisick, E., Sattler, M., de Jong, R.,
Druker, B., Heisterkamp, N., Chen, L. B., Groffen, J., and Griffin, J. D. CRKL links
p210BCR/ABL with paxillin in chronic myelogenous leukemia cells. J. Biol. Chem.,
270: 29145–29150, 1995.
Uemura, N., Salgia, R., Ewaniuk, D. S., Little, M-T., and Griffin, J. D. Involvement
of the adapter protein Crkl in integrin-mediated adhesion. Oncogene, 18: 3343–
3353, 1999.
Chung, S-W., Daniel, R., Wong, B. Y., and Wong, P. M. C. The ABL genes in
normal and abnormal cell development. Crit. Rev. Oncog., 7: 33– 48, 1996.
Sanchez-Garcia, I., and Martin-Zanca, D. Regulation of BCL-2 gene expression by
Bcr-Abl is mediated by Ras. J. Mol. Biol., 267: 225–228, 1997.
Chai, S. K., Nichols, G. L., and Rothman, P. Constitutive activation of JAKs and
Stats in BCR-ABL-expressing cell lines and peripheral blood cells derived from
leukemic patients. J. Immunol., 159: 4720 – 4728, 1997.
Ahmed, M., Dusanter-Fourt, I., Bernard, M., Mayeux, P., Hawley, R. G., Bennardo,
T., Novault, S., Bonnet, M. L., Gisselbrecht, S., Varet, B., and Turhan, A. G.
BCR-ABL and constitutively active erythropoietin receptor (cEpoR) activate distinct
mechanisms for growth factor-independence and inhibition of apoptosis in Ba/F3
cell line. Oncogene, 16: 489 – 496, 1998.
Darnell, J. E., Jr. STATs and gene regulation. Science (Washington DC), 277:
1630 –1635, 1997.
2354
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
THE BCR GENE AND LEUKEMOGENESIS
231. Liu, J., Wu, Y., and Arlinghaus, R. B. Sequences within the first exon of BCR inhibit
the activated tyrosine kinase of c-Abl and the Bcr-Abl oncoprotein. Cancer Res., 56:
5120 –5124, 1996.
232. Liu, J., Wu, Y., Ma, G. Z., Lu, D., Haataja, L., Heisterkamp, N., Groffen, J., and
Arlinghaus, R. B. Inhibition of Bcr serine kinase by tyrosine phosphorylation. Mol.
Cell. Biol., 16: 998 –1005, 1996.
233. Buchdunger, E., Zimmermann, J., Mett, H., Meyer, T., Muller, M., Druker, B. J., and
Lydon, N. B. Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a
2-phenylaminopyrimidine derivative. Cancer Res., 56: 100 –104, 1996.
234. Druker, B. J., Tamura, S., Buchdunger, E., Ohno, S., Segal, G. M., Fanning, S.,
Zimmermann, J., and Lydon, N. B. Effects of a selective inhibitor of the Abl tyrosine
kinase on the growth of Bcr-Abl positive cells. Nat. Med., 2: 561–566, 1996.
235. Beran, M., Cao, X., Estrov, Z., Jeha, S., Jin, G., O’Brien, S., Talpaz, M., Arlinghaus,
R. B., Lydon, N. B., and Kantarjian, H. Selective inhibition of cell proliferation and
Bcr-Abl phosphorylation in acute lymphoblastic leukemia cells expressing Mr
190,000 Bcr-Abl protein by a tyrosine kinase inhibitor (CGP-57148). Clin. Cancer
Res., 4: 1661–1672, 1998.
236. Kasper, B., Fruehauf., S., Schiedlmeier, B., Buchdunger, E., Ho, A. D., and Zeller,
W. J. Favorable therapeutic index of a p210(Bcr-Abl)-specific tyrosine kinase
inhibitor; activity on lineage-committed and primitive chronic myelogenous leukemia progenitors. Cancer Chemother. Pharmacol., 44: 433– 438, 1999.
237. Dan, S., Naito, M., and Tsuruo, T. Selective induction of apoptosis in Philadelphia
chromosome-positive chronic myelogenous leukemia cells by an inhibitor of BcrAbl tyrosine kinase, CGP 57148. Cell Death Differ., 5: 710 –715, 1998.
238. Prosper, F., Horita, M., Andreu, E. J., Benito, A., Arbona, C., Sanz, C., Benet, I., and
Fernandez-Luna, J. L. Blockade of the Bcr-Abl kinase activity induces apoptosis of
CML cells by suppressing STAT5 dependent expression of BCL-XL. Blood, 94
(Suppl. 1): 102a, 1999.
239. Donato, N. J., Wu, J. Y., Kantarjian, H. M., and Talpaz, M. Inhibition of Bcr-Abl
induces apoptosis through effects on downstream signaling cascades: death through
abrogation of survival signals. Blood, 94 (Suppl. 1): 102a, 1999.
240. Thiesing, J. T., Ohno-Jones, S., Kolibaba, K. S., and Druker, B. J. Efficacy of an Abl
tyrosine kinase inhibitor in conjunction with other antineoplastic agents against
BCR-ABL positive cells. Blood, 94 (Suppl. 1): 100a, 1999.
241. Barteneva, N., Stiouf, I., Donato, N., Kornblau, S., Van, N., Domain, D., and Talpaz,
M. Altered interferon-␣ responsiveness in K562 cells pretreated with Abl-tyrosine
kinase inhibitor CGP57148B. Blood, 94 (Suppl. 1): 272b, 1999.
242. Topaly, J., Zeller, W. J., Ho, A. D., and Fruehauf, S. Combination therapy of chronic
myelogenous leukemia employing Bcr/Abl specific tyrosine kinase inhibition.
Blood, 94 (Suppl. 1): 281b, 1999.
243. Druker, B. J., Talpaz, M., Resta, D., Peng, B., Buchdunger, E., Ford, J., and
Sawyers, C. L. Clinical efficacy and safety of an Abl specific tyrosine kinase
244.
245.
246.
247.
248.
249.
250.
251.
252.
253.
254.
255.
256.
257.
inhibitor as targeted therapy for chronic myelogenous leukemia. Blood, 94 (Suppl.
1): 368a, 1999.
Druker, B. J., Kantarjian, H., Sawyers, C. L., Resta, D., Reese, S. F., Ford, J., and
Talpaz, M. Activity of an Abl specific tyrosine kinase inhibitor in patients with
BCR-ABL positive acute leukemias, including chronic myelogenous leukemia in
blast crisis. Blood, 94 (Suppl. 1): 697a, 1999.
Talpaz, M., Sawyers, C. L., Kantarjian, H., Resta, D., Reese, S. F., Ford, J., and
Druker, B. J. Activity of an Abl specific tyrosine kinase inhibitor in patients with
BCR-ABL positive acute leukemias, including chronic myelogenous leukemia in
blast crisis. Proc. Am. Soc. Clin. Oncol., 19: 4a, 2000.
Talpaz, M., Silver, R. T., Druker, B., Paquette, R., Goldman, J. M., Reese, S. F., and
Capdeville, R. A Phase II study of STI 571 in adult patients with Philadelphia
chromosome positive chronic myeloid leukemia in accelerated phase. Blood, 96
(Vol. 11, Part 1): 487a, 2000.
James, H. A., and Gibson, I. The therapeutic potential of ribozymes. Blood, 91:
371–382, 1998.
Galderisi, U., Cascino, A., and Giordano, A. Antisense oligonucleotides as therapeutic agents. J. Cell. Physiol., 181: 251–257, 1999.
Kuwabara, T., Warashina, M., Tanabe, T., Tani, K., Asano, S., and Taira, K. A novel
allosterically trans-activated ribozyme, the maxizyme, with exceptional specificity
in vitro and in vivo. Mol. Cell, 2: 617– 627, 1998.
Warashina, M., Kuwabara, T., Nakamatsu, Y., and Taira, K. Extremely high and
specific activity of DNA enzymes in cells with a Philadelphia chromosome. Chem.
Biol., 5: 237–250, 1999.
Wu, Y., Yu, L., McMahon, R., Rossi, J. J., Forman, S. J., and Snyder, D. S.
Inhibition of BCR-ABL oncogene expression by novel deoxyribozymes
(DNAzymes). Hum. Gene Ther., 10: 2847–2857, 1999.
Cobaleda, C., and Sanchez-Garcia, I. In vivo inhibition by a site-specific catalytic
RNA subunit of Rnase P designed against the BCR-ABL oncogenic products: a novel
approach for cancer treatment. Blood, 95: 731–737, 2000.
Kronenwett, R., and Haas, R. Specific BCR-ABL-directed antisense nucleic acids
and ribozymes: a tool for the treatment of chronic myelogenous leukemia? Recent
Results Cancer Res., 144: 127–138, 1998.
Wu, Y., Ma, G., Lu, D., Lin, F., Xu, H. J., Liu, J., and Arlinghaus, R. B. Bcr: a
negative regulator of the Bcr-Abl oncoprotein. Oncogene, 18: 4416 – 4424, 1999.
Liu, J., Hawk, N., Lin, F., Arlinghaus, R. Phosphoserine peptides from the serinerich B box of the Bcr first exon inhibit the Abl and Bcr-Abl kinases. Blood, 94
(Suppl. 1): A453, 1999.
Beaupre, D. M., and Kurzrock, R. RAS and leukemia: from basic mechanisms to
gene-directed therapy. J. Clin. Oncol., 17: 1071–1079, 1999.
Druker, B. J., and Lydon, N. B. Lessons learned from the development of an Abl
tyrosine kinase inhibitor for chronic myelogenous leukemia. J. Clin. Investig., 105:
3–7, 2000.
2355
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.
The BCR Gene and Philadelphia Chromosome-positive
Leukemogenesis
Eunice Laurent, Moshe Talpaz, Hagop Kantarjian, et al.
Cancer Res 2001;61:2343-2355.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/61/6/2343
This article cites 248 articles, 116 of which you can access for free at:
http://cancerres.aacrjournals.org/content/61/6/2343.full#ref-list-1
This article has been cited by 10 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/61/6/2343.full#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 2001 American Association for Cancer
Research.