Arch Iranian Med 2004; 7 (2): 84 – 88
Original Article
APPLICATION OF THE POLYMERASE CHAIN
REACTION TO THE DIAGNOSIS OF
SICKLE CELL DISEASE IN IRAN
•**
Maryam Ayatollahi MSc*, Mansour Haghshenas MD
Background – Sickle cell anemia is one of the most common heritable hematologic diseases
affecting humans. Detection of the single base pair mutations at codon 6 of the beta-globin gene is
important for the prenatal diagnosis of sickle cell anemia and sickle cell disease. We applied the
polymerase chain reaction technology to detect sickle cell patients and heterozygous carriers in a
group of patients suspected of sickle cell disease.
Methods – The sample was composed of 45 normal individuals and 45 unrelated sickle cell
disease out-patients from Hematology Research Center, Shiraz University of Medical Sciences,
Shiraz, Iran. All patients were interviewed. Results of their medical histories, physical examination,
and the hematologic analysis were recorded. The blood samples were collected in EDTA and
genomic DNA was extracted from leucocytes. An amplified 110 base pair fragment of beta-globin
gene containing codon 6 was digested with the restriction enzyme MS II, and electrophoresed in
3% agarose.
Results – We have established the technical condition for detection of sickle cell disease using
a PCR assay. Thirteen patients having hemoglobin SS (Hb SS) and 32 patients in the heterozygous
state (Hb AS) were identified. We confirmed that the normal controls had the Hb AA genotype.
Conclusion – This amplification method is rapid, sensitive, and simple, and has the application
which is important for the prenatal diagnosis of sickle cell disease.
Archives of Iranian Medicine, Volume 7, Number 2, 2004: 84 – 88.
Keywords • beta-globin gene • Iran • polymerase chain reaction • sickle cell disease
Introduction
S
ickle cell disease (SCD) is a major health
problem in many countries with a wide
spectrum of clinical severity. The SCD
can cause numerous disorders that vary with
respect to degree of anemia, frequency of crises,
extent of organ injury, and duration of survival.
This disease affects over 2 million people in
Nigeria with a generally severe clinical course. 1 In
some parts of Africa as many as 45% of population
have sickle cell trait, approximately 8% of blacks
carry the sickle gene, and in the United States, the
Authors affiliations: *Transplant Research Center, **Hematology
Research Center, Shiraz University of Medical Sciences, Shiraz,
Iran.
•Corresponding author and reprints: Mansour Haghshenas,
MD, Hematology Research Center, Shiraz University of Medical
Sciences, P. O. Box: 71935-1119, Shiraz, Iran. Telefax: +98-7116276211, E-mail: [email protected].
84
Archives of Iranian Medicine, Volume 7, Number 2, April 2004
incidence of sickle cell anemia is around 1 in 625
births.2 The sickle cell gene has also been reported,
though with lower frequency, in southern India,
Saudi Arabia, the Mediterranean basin, and the
Middle-East.2 In Iran the frequency of sickle cell
gene, though with less severity than thalassemia,
has been reported.3 Iranians and some Indians, had
different DNA structure not encountered in
Africa.4 Some genetic factors affecting the clinical
severity of SCD, including fetal hemoglobin (HbF) level5 and β-gene haplotypes are associated with
the chromosomes.6 This haplotype is associated
with much higher Hb F level (15 – 40%), fewer
vasoocclusive sickle crisis, lower complications
rate, and mild clinical condition. 7 Iranian patients
with SCD, on account of their higher level of Hb F
compared to Afro-American patients, present a less
severe clinical picture. However, they need
sustainable
life-long
medical
attention. 8
Accordingly, screening for the sickle cell gene
M. Ayatollahi, M. Haghshenas
carriers would be of great benefit. 9, 10
Diagnosis depends upon documentation of the
presence of sickle cell hemoglobin, preferably by
electrophoresis.11 Rapid methods that are less
reliable for the detection of sickle cell hemoglobin
include the observation of sickling of red cells
containing sickle cell hemoglobin microscopically
under a coverslip by suspending the cells in a
droplet of a 2% solution of sodium metabisulfite
and solubility tests.12 However, such tests do not
detect hemoglobin C or β-thalassemia and do not
reliably distinguish between sickle trait and sickle
disease and are therefore of limited value. With the
refinement and automation of techniques, it has
also been possible to detect sickle hemoglobin
accurately and economically by high-pressure
liquid chromatography and by isoelectric
focusing.13
Advances in molecular techniques have allowed
elucidation of the molecular basis of some genetic
diseases that affect people. Use of the polymerase
chain reaction (PCR) to detect the sickle mutation
is the method of choice for prenatal diagnosis. This
paper describes a technique of DNA amplification
in vitro and its application on detection of sickle
cell (Hb S) gene.
1/m
2/p 3/p
4 5 6/n 7/n
500 bp
250 bp
100 bp
50 bp
500 bp
250 bp
100 p
50 bp
Figure 1. Line 1 is the molecular marker (50 – 750
bp), Lines 2 and 6 show the PCR products of the
amplified DNA from a patient in the homozygous
state (p) and a normal (n) subject, Lines 3 and 7 are
the enzyme digested products corresponding to the
amplified DNA on its left line. Lines 4 and 5 show
the PCR and the digested product of a sample
without DNA for negative control.
Materials and Methods
Clinical samples
Blood samples from 45 unrelated sickle cell
disease patients were obtained from Hematology
Research Center of Shiraz University of Medical
Sciences between November 2001 and September
2002. SCD was identified by positive sickling test
and confirmed by hemoglobin electrophoresis at
pH 9.2 on cellulose acetate and application of a
300-volt current for 35 minutes. Forty-five normal
individuals with no signs or symptoms of SCD
were selected from the laboratory personnel.
Patients and normal controls were randomly
selected from both males and females.
Hematologic analysis
Complete blood count was carried out using a
counter Model LUTON BEDS, (Sysmex,
England). Sickle cell hemoglobin was quantitated
after elution from a microcolumn of
diethylamineethyl cellulose (DE 52) resin as
described earlier.14 Fetal hemoglobin quantitation
was performed by alkaline denaturation
procedure.15
DNA extraction
One mL of cold lysis buffer, containing 0.2 g
Tris, 21 g sucrose, 0.2 g MgCl2, and 2 mL Triton
100X in 200 mL of distilled water, was added to
500 µL of EDTA-treated peripheral blood and
centrifuged. The precipitate was washed three
times and genomic DNA was extracted by adding
100 mL of 50 mM NaOH. Subsequently the tube
was heated in a boiling waterbath to solublize the
DNA.
Polymerase chain reaction
Target DNA sequence of all samples was
amplified with the standard PCR condition, 16 using
the following pair of primers (from TIB, Molbiol,
Berlin, Germany) 5'- ACACAACTGTGTTCAC
TAGC, and 5'- CAACTTCATCCACGTTCACC,
that primed amplification of an 110 base pair (bp)
segment of beta-globin gene containing codon 6.
The amplified DNA was digested with the
restriction endonuclease MS II, which has a
recognition site at codon 6 in normal beta-globin
gene.
Archives of Iranian Medicine, Volume 7, Number 2, April 2004
85
Application of the PCR to the diagnosis of SCD
Table 1. Identification of the sickle cell gene in
patients compared with normal controls.
Studied individuals
No. tested
Total (%)
Heterozygous patients
32
35.5
Homozygous patients
13
14.4
Normal controls
45
50.0
Restriction endonuclease analysis of the
amplicon DNA
Thirty μL of the amplified product were treated
with 1.5 μL of 10 U/mL of MS II restriction
enzyme
solution
(Boehringer,
Mannheim,
Germany), and digested at 37ºC for 1 hour in
SURE/cut buffer A in a total volume of 35 µL.
Subsequently, the digestion products were
separated according to size on a 2% agarose gel
(Pharmacia, Sweden), by application of a 70-volt
current for 45 minutes and visualized by ethidium
bromide staining under ultraviolet light.
The MS II enzyme has a recognition site at
codon 6 in the normal beta-globin gene, and
cleaved the normal amplified beta-globin DNA
into two fragments, while the fragment amplified
from DNA of sickle cell mutation remained
uncleaved. The agarose gel electrophoresis of the
amplified DNA along with the MS II digested
products, detected the homozygous and
heterozygous patients and normal controls.
Results
A 110 bp fragment of the beta-globin gene
containing codon 6, among normal people and
patients was amplified. Figure 1 shows the agarose
gel electrophoresis of the amplified DNA along
with the digested products with MS II enzyme for
two patients and two normal subjects. MS II
enzyme has a recognition site at codon 6 in the
normal beta-globin gene, and cleaved the normal
amplified beta-globin DNA into two fragments of
54 bp and 56 bp which was as an overlap band in
agarose gel electrophoresis, while the 110 bp
fragment amplified from DNA of sickle cell
mutation remained uncleaved owing to a single
base substitution (A----T) at codon 6 in the
mutation. Line 3 in Figure 1 shows the digested
products of the MS II enzyme in homozygous
patient, and Line 7 represents the presence of the
MS II site in normal individual.
While this site was present in all 90
chromosomes of the normal individuals, it was not
found in homozygous state of sickle cell patients.
The single band with a molecular weight (MW) of
about 50 bp observed in the Line 7, is actually
86
Archives of Iranian Medicine, Volume 7, Number 2, April 2004
composed of a mixture of two equal size products,
due to the fact that the MS II site lies almost
exactly in the middle of the amplified DNA. Figure
2 shows the agarose gel electrophoresis of the
amplified DNA along with the MS II digested
products for three patients in the homozygous state
(p) and two heterozygous patients (h). Lines 7 and
11 in Figure 2 represent the heterozygous state
with two different bands. One band with a MW of
about 110 bp corresponding to the amplified DNA
of sickle cell mutation remained uncleaved with
MS II digestion, and another band which is a
mixture of two equally sized products
corresponding to the normal amplified beta-globin
gene. This methodology for SCD permitted us to
identify 13 patients (14.4 %) with sickle cell
anemia (having Hb SS) and 32 patients (35.5%) in
the homozygous state (Hb AS) (Table 1). We
confirm that the normal controls have the Hb AA
genotype.
Discussion
Sickle cell hemoglobin is a mutant hemoglobin
in which valine has been substituted for the
glutamic acid normally at the sixth amino acid of
the β-globin chain. This hemoglobin polymerizes
and becomes poorly soluble when oxygen tension
is lowered, and red cells that contain this
hemoglobin become distorted and rigid. 11 The
diagnosis of sickle cell anemia rests on the
1/m 2/p 3/p 4/p 5/p 6/h 7/h 8/p 9/p 10/h 11/h
500bp
250bp
100bp
50 bp
Figure 2. Line 1 is the molecular marker (0.07 –
12.2 kbp), Lines 2, 4, 6, 8, and 10 show the PCR
products of the amplified DNA from 3 patients in the
homozygous state (p) and 2 patients in the
heterozygous state (h). Lines 3, 5, 7, 9, and 11 are
the enzyme digested products corresponding to the
amplified DNA on its left line.
M. Ayatollahi, M. Haghshenas
electrophoretic pattern or chromatographic of
hemoglobins in hemolysates prepared from the
peripheral blood. However, several relatively
hemoglobin variants have an electrophoretic
mobility identical to that of Hb S on cellulose
acetate.2 Although the diagnosis of SCD is
straightforward, that of Hb Sß-thalassemia may
sometimes be problematic. In Hb Sß+ thalassemia,
there is a preponderance of Hb S with Hb A
comprising 5 – 30% of the total. Hb Sß0
thalassemia produces an electrophoretic pattern
that is visually indistinguishable from that of sickle
cell anemia, but a diagnosis can often be made by
the presence of elevated Hb A2 level and a
decreased MCV. However detailed family history
and DNA-based studies may be necessary to make
this distinction.2
In the last 2 decades, the molecular pathology
of the β-thalassemia and the mutation phenotype
relationships of these disorders have been largely
elucidated. This knowledge has been applied to
molecular diagnosis, carrier identification, and
prenatal diagnosis, and has resulted in dramatic
reduction of the incidence of the homozygous state
in several at-risk populations. 10 Detection of sickle
cell gene by analysis of amplified DNA sequences
was done in China9 and Venezuela17 by using the
endonuclease MS II. Hatcher et al18 designed an
enzymatic
amplification
and
restriction
endonuclease digestion method for detection of
Hb S.
In the previous study,3 we reported the
frequency of the sickle cell gene in South Iran. In
Fars Province, in southern Iran, with a gene
frequency of around 0.01, which is one-tenth of βthalassemia gene frequency, the sickle cell gene is
not too prevalent.3 However, infection must have
been the most likely selective force operating in
the dissemination of the sickle cell gene. 19 So,
screening for sickle cell carriers would be of great
benefit.17 In the present study, we have established
the technical condition for detection of sickle cell
mutation using a PCR assay that eliminates the
need for other hematologic analysis. This
methodology permitted us to identify the normal
controls, the homozygote and heterozygote sickle
cell patients. This amplification method is specific
and sensitive, thus permitting rapid economical
diagnosis of SCD. Also, as the detection of the
single base pair mutations at codon six of the betaglobin gene is important for the prenatal diagnosis
of sickle cell gene,18 this technique has research
potential that is important for the prenatal
diagnosis of sickle cell disease.
Acknowledgment
The authors would like to thank N. Rezaei and
V. Moayed for their technical assistance.
References
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
Luzzatto L. Hemoglobinopathies including thalassemia.
Part 3. Sickle cell anemia in tropical Africa. Clin
Haematol. 1981; 10: 757 – 84.
Winfred CW, John NL. Sickle cell anemia and other
sickling syndromes. In: Lee GR, Foerster J, Lukens J, eds.
Wintrobe's Clinical Hematology. 10th ed. Baltimore:
Williams and Wilkins; 1999: 1346 – 97.
Habibzadeh F, Yadollahie M, Ayatollahie M, Haghshenas
M. The sickle cell gene frequency in southern Iran. J Trop
Pediatr. 2000; 46: 181.
Serjeant GR. The geography of sickle cell disease:
opportunities for understanding its diversity. Ann Saudi
Med. 1994; 14: 237 – 46.
Craig JE, Rochette J, Fisher CA, Weatherall DJ, Marc S,
Lathrop GM, et al. Dissecting the loci controlling fetal
hemoglobin production on chromosome 11p and 6q by the
regressive approach. Nat Genet. 1996; 12: 58 – 64.
Falusi AG, Kulozik AE.
Relationship of foetal
hemoglobin levels and beta s haplotypes in homozygous
sickle cell disease. Eur J Haematol. 1990; 45: 1 – 4.
El-Hazmi H, Bahakim HM, Warsy AS. DNA
polymorphism in the beta-globin gene cluster in Saudi
Arabs: relation to severity of sickle cell anemia. Acta
Haematol. 1992; 88: 61 – 6.
Haghshenas M, Ismail-Beigi F, Clegg JB. Mild sickle cell
anemia in Iran associated with high levels of fetal
hemoglobin. J Med Genet. 1977; 3: 168 – 71.
Huang SZ, Sheng M, Zhao JQ, Giu XK, Zeng YT, Wang
AS, et al. Detection of sickle cell gene by analysis of
amplified DNA sequences [in Chinese]. Yi Chuan Xue
Bao. 1989; 16: 475 – 82.
Cao A, Galanello R, Saba L. Beta-thalassemias: molecular
diagnosis, carrier screening, and preventation. A review
for clinicians. J Am Med Assoc. 1997; 278: 1273 – 7.
Beutler E. The sickle cell diseases and related disorders.
In: Beutler E, Williams WJ, eds. Williams Hematology.
6th ed. New York: Mc Graw-Hill; 2002; 47: 581 – 605.
Daland GA, Castle WB. A simple and rapid method for
demonstrating sickling of the red blood cells: the use of
reducing agents. J Lab Clin Chem. 1948; 43: 2137.
Mario N, Baudin B, Aaussel C, Giboudeu J. Capillary
isoelectric focusing and high-performance cationexchange chromatography compared for qualitative and
quantitative analysis of hemoglobin variants. Clin Chem.
1997; 43: 2137 – 42.
Habibzadeh F, Yadollahie M, Ayatollahie M, Haghshenas
M. The prevalence of sickle cell syndrome in South of
Iran. Iran J Med Sci. 1999; 24: 32 – 4.
Betke K, Marti HR, Schlicht I. Estimation of small
percentages of fetal Hb. Nature. 1959; 184: 1877 – 8.
Graham M, Billington D. The introduction to
biotechniques. In: Newton CR, Graham A, eds. Bios
Scientific Publishers Limited. UK: Oxford; 1994: 10 – 25.
Martines J, Blanco Z, Hakshaw P, Mereno N. Application
of the polymerase chain reaction to the diagnosis of sickle
Archives of Iranian Medicine, Volume 7, Number 2, April 2004
87
Application of the PCR to the diagnosis of SCD
cell anemia in Venezuela. Sangre (Barc). 1998; 43:
63 – 6.
18 Hatcher SL, Trang QT, Robb KM, Templitz RL, Cavlson
JR. Prenatal diagnosis by enzymatic amplification and
restriction endonuclease digestion for detection of
hemoglobins A, S, and C. Mol Cell Probes. 1992; 6:
88
Archives of Iranian Medicine, Volume 7, Number 2, April 2004
343 – 8.
19 Lukens JN. The abnormal hemoglobins general principles.
In: Lee GR, Foerster J, Lukens J, Wintrobe MM, eds.
Wintrobe's Clinical Hematology. 10th ed. Baltimore:
Williams and Wilkins.1999: 1329 – 45.