Biochem. J. (2009) 421, 171–180 (Printed in Great Britain)
171
doi:10.1042/BJ20082020
A cotton kinesin GhKCH2 interacts with both microtubules and
microfilaments
Tao XU1 , Zhe QU1 , Xueyong YANG, Xinghua QIN, Jiyuan XIONG, Youqun WANG, Dongtao REN2 and Guoqin LIU2
State key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100193, China
Many biological processes require the co-operative involvement
of both microtubules and microfilaments; however, only a few
proteins mediating the interaction between microtubules and
microfilaments have been identified from plants. In the present
study, a cotton kinesin GhKCH2, which contains a CH (calponin
homology) domain at the N-terminus, was analysed in vitro
and in vivo in order to understand its interaction with the two
cytoskeletal elements. A specific antibody against GhKCH2
was prepared and used for immunolabelling experiments.
Some GhKCH2 spots appeared along a few microtubules and
microfilaments in developing cotton fibres. The His-tagged
N-terminus of GhKCH2 (termed GhKCH2-N) could coprecipitate with microfilaments and strongly bind to actin
filaments at a ratio of monomeric actin/GhKCH2-N of 1:0.6.
The full-length GhKCH2 recombinant protein was shown to
bind to and cross-link microtubules and microfilaments in vitro.
A GFP-fusion protein GFP–GhKCH2 transiently overexpressed
in Arabidopsis protoplasts decorated both microtubules and
microfilaments, confirming the binding ability and specificities
of GhKCH2 on microtubules and microfilaments in living
plant cells. The results of the present study demonstrate that
GhKCH2, a plant-specific microtubule-dependent motor protein,
not only interacts with microtubules, but also strongly binds to
microfilaments. The cytoskeletal dual-binding and cross-linking
ability of GhKCH2 may be involved in the interaction between
microtubules and microfilaments and the biological processes
they co-ordinate together in cotton cells.
INTRODUCTION
cortical actin microfilaments in cotton fibres, and its N-terminal
region with a CH (calponin homology) domain interacts with actin
microfilaments [6]. In addition, the conserved CH domain is often
found in many actin-binding proteins [13,14]. It is still unknown
whether the plant-specific CH domain-containing kinesins can interact with actin microfilaments directly. Another question to be
further addressed is whether the CH domain is responsible for
their microfilament binding.
More recently, GhKCH2, a novel CH domain-containing
kinesin from the kinesin-14 family, that encodes a polypeptide
sharing 57 % sequence identity with GhKCH1, was cloned
from cotton and biochemically characterized as a plant-specific
microtubule-dependent kinesin in our laboratory [15]. We later
found that some GhKCH2 is distributed along microtubules,
as well as microfilaments, in a punctate manner in developing
cotton fibres. Cotton fibres are single, highly elongated cells
differentiated from the epidermis of the ovule. It is well known
that cytoskeletal elements play a critical role in the development
of cotton fibres. Microtubules were found to be involved in the
deposition and organization of cellulose microfibrils in cotton
fibres via a drug treatment assay [16]. Actin microfilaments
perform an essential role in cotton fibre growth [16–19]; however,
the mechanism of how cytoskeleton networks are organized and
involved in fibre development is still largely unknown. To date,
besides GhKCH1 and GhKCH2, another two kinesins identified
in cotton fibres are GhKinesin-13A and GhKCBP. GhKinesin13A was found in the cotton fibre Golgi apparatus [20]. GhKCBP
decorates cortical microtubules and may stabilize microtubules in
the interphase cell cortex [21]. In the present study, we report that
In plant cells, microtubules and microfilaments are often
distributed closely in the cortical layer, the cytoplasmic strands,
the prophase band and the phragmoplast [1]. These two
cytoskeletal elements participate in several biological processes
together, such as transporting vesicles and organelles and formation of the prophase band, as well as the organization and
formation of the phragmoplast and cell plate [2,3]. In animal
and yeast cells, various proteins mediating the interaction between
microtubules and microfilaments have been identified [2,4];
however, only a few of these proteins have been reported in
plants, including a 190 kDa polypeptide from tobacco BY-2 cells
[5], GhKCH1 from cotton fibre [6] and SB401 from potato
pollen [7].
Kinesins are microtubule-based motor proteins that occur in
various eukaryotic cells. Members of the kinesin superfamily
are involved in diverse cellular functions, including transport
of vesicle and membrane organelles, cell division, microtubule
dynamics and signal transduction [8,9]. Interestingly, previous
studies have demonstrated that some kinesins associate with
actin microfilaments. In mammalian cells, a kinesin-like protein
MKLP1/CHO1 interacts with F-actin through an actin-binding
sequence in the tail domain [10], and plays a role in midbody
formation and cytokinesis completion [11]. DdKin5, a kinesin
from Dictyostelium cells, directly bundles actin filaments in vitro
and associates with actin-based structures in cells [12]. In plants, a
cotton kinesin GhKCH1 not only decorates cortical microtubules
in a punctate manner, but also occasionally attaches to transverse-
Key words: calponin homology domain, cotton fibre, cross-link,
kinesin, microfilament, microtubule.
Abbreviations used: CH, calponin homology; DPA, days post-anthesis; DTT, dithiothreitol; GFP, green fluorescent protein; GhKCH2-C, C-terminal domain
of GhKCH2; GhKCH2-M, motor domain of GhKCH2; GhKCH2-N, N-terminal domain of GhKCH2; MPK4, MAPK (mitogen-activated protein kinase) 4; PI,
propidium iodide; TRITC, tetramethylrhodamine β-isothiocyanate.
1
Both of these authors contributed equally to the present study.
2
Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).
c The Authors Journal compilation c 2009 Biochemical Society
172
Table 1
T. Xu and others
Sequence-specific primers used in this study
F, forward; R, reverse. The N240, N200, and N160 constructs share the forward primer with GhKCH2-N; the N160 construct shares the reverse primer with GhKCH2-N.
Construct
Primer sequence (5 to 3 )
Restriction site
GhKCH2-N and N (1-306 aa)
GhKCH2-C
GhKCH2
F: GGATCCATGGCTGCAGAAGGAATGTT; R: GTCGACCATCACTTCGATGTTCTTTTCC
F: CCATGGGTGCTGCTCGAGTG; R: GTCGACTTTTCTACTCCCAGTTCTGC
For prokaryotic/eukaryotic expression, F: GCCCATGGCTGCAGAAGGAAT; R: GCAAGCTTTTTTCTACTCCCAGTTCTG
For transient expression, F: GGATCCGGTACCATGGCTGCAGAAG;
R: GAGCTCTTAGTCGACTTTTCTACTCCCAGTTC
F: GGATCCATGAAGAAAGAAGATTGCTTCC; R: GTCGACTTTTCTACTCCCAGTTCTGC
R: GTCGACATCTGTTAGAAGGGCAC
R: GTCGACGGAGTTTGTGAAAGGCT
R: GTCGACATAGGACTTAAGTGCTAGAAC
F: GGATCCATGAACGAGTGGAGGCTCT
F: GGATCCGTCGACATGAGTAAAGGAGAAGAAC; R: GAGCTCTTAGGTACCTTTGTATAGTTCATCCATG
BamHI SalI
NcoI SalI
NcoI HindIII KpnI SacI
N (307-1015 aa)
N240 (1-240 aa)
N200 (1-200 aa)
N160 (1-160 aa)
N160 (161-306 aa)
GFP
GhKCH2 can directly interact with both microtubules and microfilaments, suggesting that GhKCH2 may work as a candidate
linker between the two cytoskeleton systems in cotton fibres.
EXPERIMENTAL
Plant materials
To obtain cotton roots, cotton (Gossypium hirsutum Xuzhou 142)
seeds were dipped in water overnight and placed on wet filter
paper until the roots reached lengths of 2–3 cm.
Cotton fibres were grown on ovules cultured in vitro from
greenhouse-grown plants [22]. Ovules were dissected out of the
ovaries on 2 DPA (days post-anthesis) and floated on the basal
medium supplemented with 5 μmol/l indole-3-acetic acid and
0.5 μmol/l gibberellic acid. Cultures were incubated at 30 ◦C in
the dark.
Arabidopsis thaliana cell suspension cultures were maintained
in liquid growth medium containing 4.4 g/l Murashige and
Skoog basal medium (Sigma), 30 g/l sucrose and 1 mg/l 2, 4dichlorphenoxyacetic acid. The cell cultures were grown on a
shaker at 23 ◦C in the dark, and subcultured every week with
a 10-fold dilution into fresh medium.
Plasmid construction
The full-length cDNA sequence of GhKCH2 was obtained
from GenBank® (accession number EF432568). Constructs
were generated using sequence-specific primers (Table 1). For
prokaryotic expression, the DNA fragments encoding GhKCH2N (the N-terminal region of GhKCH2, amino acids 1–306),
GhKCH2-C (the C-terminal region of GhKCH2, amino acids
729–1015) and full-length GhKCH2 were cloned into the pET28a(+) vector. GhKCH2-M (the motor domain of GhKCH2,
amino acids 396–734) was constructed as described previously
[15]. For eukaryotic expression, GhKCH2 was introduced into
pFastBacHTA vector to generate pFastBacHTA-GhKCH2.
For transient expression in Arabidopsis protoplasts, several
GFP (green fluorescent protein) fusion constructs were created.
The GFP–GhKCH2 was generated by inserting the GhKCH2
coding region in-frame to the C-terminus of the GFP coding
region. The truncated proteins (see Figure 4A) including N (amino
acids 1–306), N (amino acids 307–1015), N240 (amino acids 1–
240), N200 (amino acids 1–200), N160 (amino acids 1–160) and
N160 (amino acids 161–306) were fused to the N-terminus of
GFP. All of the fusion proteins were under the control of the 35S
cauliflower mosaic virus promoter. Additionally, AtFim1-ABD2–
c The Authors Journal compilation c 2009 Biochemical Society
BamHI SalI
SalI
SalI
SalI
BamHI
BamHI or SalI KpnI or SacI
GFP was kindly provided by Dr Elison B. Blancaflor (Noble
Foundation, Ardmore, OK, U.S.A.), and GFP–AtMAP65-2 was
obtained from Dr Ming Yuan (China Agricultural University,
Beijing, China).
Prokaryotic-expressed recombinant protein preparation and
antibody production
The recombinant 6 × His-tagged GhKCH2-N and GhKCH2C fusion proteins were expressed in Escherichia coli strain
BL21 (DE3) induced with 0.2 mM IPTG (isopropyl β-Dthiogalactoside) for 8 h at 22 ◦C. Fusion proteins were purified by
using Ni-NTA (Ni2+ -nitrilotriacetate) agarose resin (Amersham
Pharmacia).
Polyclonal anti-GhKCH2-N and anti-GhKCH2-C antibodies
were raised in rabbits using purified GhKCH2-N and GhKCH2-C
protein as antigens, and purified by using the AminoLink Plus kit
(Pierce) according to the manufacturer’s protocol.
Eukaryotic expression of GhKCH2 recombinant protein
in insect Sf9 cells
Insect Sf9 cells were maintained in TNM-FH medium (Sigma)
containing 10 % (v/v) FBS (fetal bovine serum; Gibco). The
cells were cultured in tissue culture flasks at 27 ◦C and
subcultured every 3 days. DH10Bac E. coli competent cells
were transformed with the plasmid pFastBacHTA-GhKCH2 to
generate the recombinant bacmid. Sf9 cells were transfected with
the bacmid and generated baculovirus which was subsequently
used to infect Sf9 cells to express GhKCH2 protein. After
3 days, the cells were harvested for protein affinity purification as
described by Sekine et al. [23].
Protein extraction and immunoblotting
Proteins and crude subcellular fractions were extracted and
separated from cotton roots with a mortar and pestle in extraction
buffer [0.33 M sucrose, 10 mM KCl, 10 mM NaCl, 10 mM
Mes/KOH (pH 6.0), 1 mM EDTA, 1 mM DTT (dithiothreitol)
and 0.5 mM spermidine] plus protease inhibitors (1 mM
PMSF, 10 μg/ml pepstatin A, 10 μg/ml aprotinin and 10 μg/ml
leupeptin) according to methods previously described [24,25].
These protein samples were separated on SDS/PAGE (7.5 %
gels) and then transferred on to nitrocellulose membrane for
immunoblotting analysis.
Total protein (GhKCH2, GhKCH2-N, GhKCH2-M or
GhKCH2-C) from the induced bacteria was extracted by boiling
A kinesin interacts with both microtubules and microfilaments
in 1 × SDS sample buffer for 10 min. After centrifugation at
15 000 g for 3 min at 25 ◦C, the samples were loaded on
to SDS/PAGE (10 % gels) and subjected to Western blot
analysis with an anti-His tag monoclonal antibody (R&D
Systems), an anti-GhKCH2-N polyclonal antibody and an antiGhKCH2-C polyclonal antibody as primary antibodies. HRP
(horseradish peroxidase)-conjugated goat anti-mouse IgG and
HRP-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch
Laboratories) were used as secondary antibodies.
Immunolabelling
Immunolocalization in cotton fibres
Cotton fibres (12 DPA) were processed for immunolocalization as
described by Preuss et al. [21]. The anti-GhKCH2-C antibody and
FITC-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch
Laboratories; diluted 1:200) were used to detect GhKCH2
proteins. Anti-α-tubulin monoclonal antibody (Sigma; diluted
1:500) and TRITC (tetramethylrhodamine β-isothiocyanate)conjugated goat anti-mouse IgG (Jackson ImmunoResearch
Laboratories; diluted 1:200) were applied to label microtubules.
Microfilaments were stained with 50 nM rhodamine-phalloidin
(Molecular Probes) for 1 h at room temperature (25 ◦C). DNA
was stained with 0.5 μg/ml PI (propidium iodide; Sigma).
Immunolabelling in Arabidopsis protoplasts
To stain microtubules and microfilaments, Arabidopsis protoplasts were attached to coverslides coated with 1 mg/ml polyL-lysine (Mr > 300 000; Sigma) and fixed for 30 min at room
temperature with 3 % (w/v) paraformaldehyde in PEM buffer
[50 mM Pipes (pH 6.9), 5 mM EGTA and 1 mM MgSO4 ]
supplemented with 1 % DMSO, 0.3 mM PMSF and 0.05 %
Triton X-100. The fixed protoplast ghosts were then washed
with PBS (pH 7.4) and blocked in 1 % (w/v) BSA (Sigma) for
10 min. Finally, microtubules and microfilaments were labelled
as described above. After rinsing in PBS, slides were observed
under a Zeiss LSM 510 META confocal microscope.
Preparation and polymerization of actin and tubulin
Rabbit muscle actin was purified according to the method
described by Pardee and Spudich [26]. G-actin was centrifuged at
65000 rev./min for 1 h at 4 ◦C using a Beckman TLA 120.1 rotor
before polymerization. Actin was polymerized in F-buffer [5 mM
Tris/HCl (pH 7.5), 0.5 mM DTT, 0.2 mM ATP/Na2 , 50 mM KCl
and 5 mM MgCl2 ] at 22 ◦C for 2 h. F-actin was stained by
incubation with equimolecular Alexa Fluor® 488-phalloidin at
22 ◦C for 30 min.
Porcine brain tubulins were purified according to previously
published methods [27,28]. The NHS-rhodamine [5-(and 6-)
carboxytetramethylrhodamine succinimidyl ester] (Molecular
Probes)-labelled tubulin was prepared according to the method
described by Hyman [29]. To prepare microtubules, purified
tubulin was polymerized at 37 ◦C for 30 min in PEM buffer
[100 mM Pipes (pH 6.9), 1 mM EGTA and 2 mM MgCl2 ] plus
1 mM GTP-Na2 and 10 μM taxol (Paclitaxel; Sigma), a drug
which stabilizes microtubules.
Fluorescence microscopy
To test the interaction between GhKCH2 and the cytoskeleton
in vitro, 0.1 μM F-actin stained with Alexa Fluor® 488phalloidin and/or 0.1 μM NHS-rhodamine-labelled microtubules
were incubated with or without the eukaryotic-expressed
GhKCH2 protein (0.1, 0.25 or 0.5 μM) for 40 min at 22 ◦C
173
in a reaction volume of 20 μl. BSA was used as a control.
Then aliquots (4.5 μl) were placed on a slide pre-treated with
poly-L-lysine and observed via an Olympus BX51 microscope
equipped with a CoolSNAP HQ CCD (charge-coupled device)
camera (Photometrics). Images were acquired using MetaMorph
(Universal Imaging).
To detect the effect of GhKCH2-N on F-actin, 0, 0.25 or 0.5 μM
GhKCH2-N proteins were incubated with 0.5 μM F-actin, and
the samples were observed as described above. An unrelated Histagged fusion protein MPK4 [MAPK (mitogen-activated protein
kinase) 4] from our laboratory was used as a control.
F-actin co-sedimentation assays
For the F-actin and GhKCH2-N protein co-sedimentation
assay, rabbit muscle actin and GhKCH2-N protein were
centrifuged at 75 000 rev./min for 1 h at 4 ◦C using a Beckman
TLA 120.1 rotor before use. Then, 3 μM F-actin and 0–
10 μM GhKCH2-N were incubated in a 100 μl volume of
F-buffer for 40 min at 22 ◦C. Next, the samples were centrifuged
at 75 000 rev./min for 1 h at 22 ◦C using a Beckman TLA 120.1
rotor. BSA was used as a negative control. The pellet was washed
with F-buffer and resuspended in 1 × SDS sample buffer. Equal
amounts of the resultant pellets and supernatants were separated
by SDS/PAGE (12.5 % gels) and stained with Coomassie Brilliant
Blue R250. After SDS/PAGE analysis, the concentration of
GhKCH2-N in the supernatant and pellet was quantified by
measuring protein band intensities with Quantity One (Bio-Rad).
Data were analysed, and affinity constants were calculated using
Microsoft Excel and GraphPad prism version 4.03 software.
Transient expression in Arabidopsis protoplasts
Plasmids used for transient expression were purified using a
QIAprep Spin Miniprep Kit (Qiagen). The fusion constructs
were introduced into Arabidopsis protoplasts prepared from
4-day suspension cells by PEG [poly(ethylene glycol)]-mediated
transformation [30].
For drug treatment, the transformed protoplasts were incubated
with 10 μM oryzalin (Sigma) for 1 h or 20 μM latrunculin B
(Sigma) for 2 h.
RESULTS
A specific anti-GhKCH2 antibody was prepared
To detect GhKCH2 in cotton cells, antibodies were raised
against the N-terminus (GhKCH2-N; amino acids 1–306)
and the C-terminus (GhKCH2-C; amino acids 729–1015) of
GhKCH2. Affinity-purified anti-GhKCH2-N and anti-GhKCH2C antibodies could recognize their prokaryotic-expressed Histagged antigens (Figure 1Ab, lane 2 for GhKCH2-N and 1Ac,
lane 4 for GhKCH2-C) and full-length GhKCH2 (Figures 1Ab
and 1Ac, lane 1), but not the control protein GhKCH2-M (the
motor domain of GhKCH2; amino acids 396–734; Figures 1Ab
and 1Ac, lane 3). The bands below GhKCH2 (Figures 1Aa–
1Ac, lane 1) probably resulted from degradation of the full-length
GhKCH2 protein. The anti-GhKCH2-C antibody also recognized
an approx. 110 kDa band, close to the predicted size of GhKCH2
[15], in cotton root proteins (Figure 1B, lanes 1 and 1 ). When
the anti-GhKCH2-C antibody was blocked with GhKCH2-C, the
specific band disappeared (Figure 1B, lane 6 ), indicating that
this antibody could recognize GhKCH2 specifically. However,
the anti-GhKCH2-N failed to recognize GhKCH2 protein from
cotton cells (results not shown), so only the anti-GhKCH2-C,
which rendered a clean result with no additional bands, was
c The Authors Journal compilation c 2009 Biochemical Society
174
Figure 1
T. Xu and others
Specificity analysis of the self-prepared GhKCH2 antibodies
(A) Total proteins loaded on to the gel were extracted from E. coli transformed with the corresponding recombinant plasmids (lane 1, full-length GhKCH2; lane 2, GhKCH2-N; lane 3, GhKCH2-M;
and lane 4, GhKCH2-C). The Western blot was performed with an anti-His tag monoclonal antibody (a), anti-GhKCH2-N polyclonal antibody (b) and anti-GhKCH2-C polyclonal antibody (c).
(B) SDS/PAGE and Western blot analysis of GhKCH2 in crude subcellular fractions of cotton roots. Only an approx. 110 kDa protein from the different cell fractions reacted with the anti-GHKCH2-C
antibody. Lanes 1–5 show the Coomassie Blue-stained SDS/PAGE gel, and lanes 1 –5 show the Western blot with purified anti-GhKCH2-C antibody. Lanes 1 and 1 , total proteins of cotton roots;
lanes 2 and 2 , crude cytoplasm proteins; lanes 3 and 3 , crude organelle proteins; lanes 4 and 4 , crude nuclear proteins; lanes 5 and 5 , antigen GhKCH2-C proteins used as a positive control. In
lane 6 , the total protein from cotton roots was incubated with an anti-GhKCH2-C antibody that had been blocked with GhKCH2-C antigen. The positions of molecular mass markers (in kDa) are
indicated on the left-hand side of the gels.
used for further characterization of GhKCH2 in cotton cells.
In order to reveal the subcellular localization, we extracted the
crude cytoplasm protein fraction (Figure 1B, lanes 2 and 2 ),
the organelle protein fraction (Figure 1B, lanes 3 and 3 ) and the
nuclear protein fraction (Figure 1B, lanes 4 and 4 ) and analysed
these subcellular fractions by Western blot analysis with the antiGhKCH2-C antibody. As shown in Figure 1(B), GhKCH2 was
found in these three fractions, but was much lower in cytoplasm
compared with organelle and nuclear fractions.
Localization of GhKCH2 in cotton fibre cells
To gain insight into the functions of GhKCH2, we detemined
its intracellular localization pattern in cotton cells via
immunofluorescence labelling. According to our previous studies,
GhKCH2 is highly expressed in cotton fibres at the elongation
stage [15]. Therefore cotton fibres at 12 DPA were chosen to
detect GhKCH2 with the anti-GhKCH2-C antibody. The results
showed that a few of the GhKCH2 proteins were localized in
the nucleus in a punctate pattern and enriched in the nucleolus
c The Authors Journal compilation c 2009 Biochemical Society
(Figures 2a–2c). In the cytoplasm, a few punctate GhKCH2
signals were found to be co-localized with transverse microtubules
(Figures 2d–2f). In addition, we observed some GhKCH2 proteins
on axial microfilament cables (Figures 2g–2i). Thus GhKCH2
may be associated with the development of cotton fibres through
an interaction with both microtubules and microfilaments.
The N-terminal portion of GhKCH2 interacts with F-actin in vitro
GhKCH2 polypeptide belongs to the kinesin-14 family and
contains a single CH domain at the N-terminus, making it
possible that GhKCH2 can bind to microfilaments through its
N-terminal region in a similar manner to its homologous protein
GhKCH1 [6]. To characterize the microfilament-binding ability
of GhKCH2, His-tagged fusion protein GhKCH2-N (amino
acids 1–306) including the CH domain (amino acids 42–160)
was used in a high-speed in vitro co-sedimentation assay. The
GhKCH2-N protein remained in the supernatant in the absence
of F-actin (Figure 3A, lane 1). In the presence of F-actin,
however, GhKCH2-N was found in the pellet (Figure 3A,
A kinesin interacts with both microtubules and microfilaments
Figure 2
Immunolocalization of GhKCH2 in cotton fibres
(a)–(c) Double-labelling of GhKCH2 and nucleus. Fibres of 12 DPA were stained with the
anti-GhKCH2-C antibody (a; green) and PI (b; red). Strong GhKCH2 signals appeared in
particles in the nucleus, and were enriched in the nucleolus (c). (d)–(f) Double-labelling
of GhKCH2 and microtubules. Transverse microtubules were shown by the anti-α-tubulin
monoclonal antibody (e; red). GhKCH2 distributed in the cytoplasm in a punctate manner
(d; green), and some of them were associated with cortical microtubules (f; arrows).(g)–(i)
Double-labelling of GhKCH2 and microfilaments. Some GhKCH2 signals (g; green) were
detected along rhodamine-phalloidin-labelled actin filaments (h; red) as shown in the merged
image (i; arrowheads). Bar = 10 μm.
lane 4), whereas the control protein, BSA, remained in the
supernatant (Figure 3A, lane 7), indicating that GhKCH2-N
co-sedimented with actin filaments. When the concentration of
GhKCH2-N was increased from 0 to 10 μM in the presence
of 3 μM F-actin, the pellets became enriched with GhKCH2-N
(Figure 3B), and the binding ratio of monomeric actin/GhKCH2N was approximated as 1:0.6 at the saturation concentration. From
three such independent experiments, a mean dissociation constant
(K d +
− S.D.) of 0.42 +
− 0.02 μM was obtained by fitting the data
with a hyperbolic function (Figure 3C).
The effects of GhKCH2-N on microfilaments were directly
visualized using fluorescence light microscopy, as shown in
Figure 3(D). In the absence of GhKCH2-N (Figure 3Da) or the
presence of another unrelated His-tagged fusion protein MPK4
(Figure 3Dd), 0.5 μM Alexa Fluor® -488-phalloidin-labelled
F-actin exhibited a uniform meshwork of fine scattered single
filaments. In contrast, addition of 0.25 μM GhKCH2-N resulted in
the appearance of F-actin bundles (Figure 3Db). In the presence of
0.5 μM GhKCH2-N, additional F-actin bundles were formed, and
almost all actin filaments were incorporated into large aggregated
structures (Figure 3Dc). These data demonstrate that GhKCH2-N
binds and bundles F-actin in vitro.
The N-terminal portion of GhKCH2 binds to microfilaments in vivo
Because the N-terminal of GhKCH2 was demonstrated to cosediment with actin microfilaments, we wanted to investigate
175
whether the N-terminal portion of GhKCH2 possesses the actinbinding ability in living cells. Residues 1–306 (N) and the
other part of GhKCH2 (N; amino acids 307–1015) were
transiently expressed as GFP-fusion proteins N–GFP and N–
GFP (Figure 4A) in Arabidopsis protoplasts. N–GFP exhibited
filamentous labelling in the transformed protoplasts (Figure 4Ba).
To determine which cytoskeleton filaments were decorated
by N–GFP, oryzalin, a depolymerizing reagent specific to
microtubules, and latrunculin B, a depolymerizing reagent
specific to microfilaments, were used to treat the protoplasts.
After treatment with latrunculin B, the N–GFP-decorated
filament structures were disrupted (Figure 4Bc), whereas oryzalin
treatment had no effect on them (Figure 4Bb). This indicated that
N–GFP binds to microfilaments in vivo. Since N–GFP proteins
were dispersed at random in the protoplast (Figure 4Bd), the
N-terminal portion (amino acids 1–306) of GhKCH2 appears
to be critical for the interaction between GhKCH2 and actin
microfilaments.
Meanwhile, GFP–AtMAP65-2, a microtubule-binding GFPfusion protein, and AtFim1-ABD2–GFP, a truncated actinbinding GFP-fusion protein, were used as controls to ensure the
specific depolymerizing effects of oryzalin and latrunculin B.
As expected, oryzalin only depolymerized microtubules (Figure 4Bf), but not microfilaments (Figure 4Bi), and latrunculin B
only seriously destroyed microfilaments (Figure 4Bj), but microtubules remained intact (Figure 4Bg).
In addition, several N-terminal truncated GFP-fusion constructs
(Figure 4A) were generated and transiently expressed in
Arabidopsis protoplasts to tease out the region involved in the actin
binding in more detail (Figure 4C). In the transformed protoplasts,
N240–GFP (Figure 4Ca) and N200–GFP (Figure 4Cb) still
interacted with the cytoskeleton filaments, although the level
of binding decreased. The filaments were confirmed as
microfilaments by depolymerizing drug treatment experiments
(results not shown). Thus the N240–GFP and N200–GFP
proteins had actin-binding abilities. No filamentous structures
were observed in the protoplasts transformed with N160–GFP
(Figure 4Cc) or N160–GFP (Figure 4Cd), showing that neither
N160–GFP nor N160–GFP can bind to actin microfilaments.
These results indicate that the CH domain-containing truncated
polypeptide N160 is necessary, but insufficient, for the actin
binding of GhKCH2, and N200 was the shortest polypeptide
for binding to microfilaments in the present study.
GhKCH2 is capable of not only bundling both microtubules and
actin filaments, but also coupling them in vitro
To determine whether the full-length GhKCH2 has microfilamentbinding ability, His-tagged GhKCH2 was successfully expressed
in insect Sf9 cells using the Bac-to-Bac Baculovirus Expression
System and affinity-purified (Figure 5A) for the in vitro
microfilament-binding assay. A 0.1 μM concentration of Alexa
Fluor® -488 phalloidin-labelled filamentous actin alone appeared
as single filaments (Figure 5Ba). Surprisingly, after 0.1 μM
GhKCH2 was added, actin bundles formed (Figure 5Bb). As the
concentration of GhKCH2 went up to 0.25 μM and 0.5 μM,
the bundles became more compact (Figures 5Bc and 5Bd).
However, the presence of 0.5 μM BSA instead of GhKCH2 did
not induce any change to F-actin (Figure 5Be), suggesting that
GhKCH2 was able to bundle F-actin in a concentration-dependent
manner. Similarly, GhKCH2 could bundle microtubules (0.1 μM)
polymerized from rhodamine-conjugated tubulin (Figures 5Bf–
5Bj). However, we noticed that the same concentration of
GhKCH2 made most of the actin filaments incorporate into
large aggregated structures (Figures 5Bb–5Bd), but only a few
c The Authors Journal compilation c 2009 Biochemical Society
176
Figure 3
T. Xu and others
GhKCH2-N specifically binds to and bundles F-actin in vitro
(A) Co-sedimentation assay. GhKCH2-N (10 μM) or control BSA (10 μM) was incubated with or without F-actin (5 μM). After centrifugation, the supernatants (S) and pellets (P) were analysed
by SDS/PAGE. GhKCH2-N was present in the F-actin pellet (lane 4), whereas the control BSA did not co-sediment with F-actin (lane 8). The molecular mass in kDa is indicated on the left-hand
side of the gel. (B) Various concentrations of GhKCH2-N proteins (0–10 μM) were incubated with 3 μM F-actin and then subjected to a co-sedimentation assay. The bound GhKCH2 was saturated
at 3–3.5 μM. The supernatant (S) contained only the free GhKCH2-N. The pellet (P) contained the GhKCH2-N that co-sedimented with F-actin. (C) Protein quantification of the SDS/PAGE gel
from (B). The concentration of bound GhKCH2-N was plotted against the concentration of free GhKCH2-N and fitted with a hyperbolic function. This graph represents one of three independent
®
experiments. When the concentration of F-actin was 3 μM, the K d value was 0.42 +
− 0.02 μM. (D) F-actin is bundled by GhKCH2-N. The effects of GhKCH2-N on F-actin stained with Alexa Fluor
488-phalloidin were directly visualized by fluorescence light microscopy: (a) control: F-actin in the absence of GhKCH2-N; (b) F-actin in the presence of GhKCH2-N (molecular molar ratio of
F-actin/GhKCH2-N = 2:1); (c) F-actin in the presence of GhKCH2-N (molecular molar ratio of F-actin/GhKCH2-N = 1:1); and (d) F-actin in the presence of another unrelated His-tag-fused protein
MPK4 as a negative control. Scale bar = 10 μm.
microtubules formed bundles (Figures 5Bg–5Bi). It seemed that
GhKCH2 had a stronger bundling ability to microfilaments than
that to microtubules.
When 0.1 μM F-actin and 0.1 μM microtubules were mixed,
both remained as distinct single filaments that were scattered
randomly throughout the suspension (Figure 5Bk). A similar
pattern was observed following addition of BSA to the control
mixture (Figure 5Bo). After 0.1 μM GhKCH2 was added,
however, some of the microtubules and actin filaments began to
bundle together (Figure 5Bl). A higher concentration of GhKCH2
(0.25 μM) made more microtubules and F-actin filaments
aggregate (Figure 5Bm). When 0.5 μM GhKCH2 was added,
most of the two kinds of cytoskeleton filaments co-localized and
were incorporated into large aggregated structures (Figure 5Bn).
Thus the full-length recombinant GhKCH2 was demonstrated not
only to bundle both microfilaments and microtubules, but also to
cross-link them efficiently in vitro.
(Figure 6Aa). After incubation with oryzalin, the filaments were
partly disrupted (Figure 6Ab), whereas in those treated with
latrunculin B, the thick filaments of GFP–GhKCH2 (Figure 6Aa)
became weaker and slimmer with more diffuse signals appearing
in the cytoplasm (Figure 6Ac), suggesting that overexpressed
GhKCH2 possesses a certain microtubule-binding ability that
was independent of the integrity of actin microfilaments. When
both oryzalin and latrunculin B were employed to treat the GFP–
GhKCH2-expressed protoplasts for 1 h, the filamentous structures
were totally diffuse (Figure 6Ad), suggesting that GhKCH2 bound
to both microtubules and microfilaments.
To get the direct observation of the co-localization of GhKCH2
with microtubules and microfilaments in transformed protoplasts,
microtubules and microfilaments were fluorescently labelled
(Figures 6Bb and 6Be respectively). The confocal images showed
that some GhKCH2 proteins co-localized with microtubules
(Figures 6Ba–6Bc), and some with microfilaments (Figures 6Bd–
6Bf). Thus we concluded that GhKCH2 interacted with both
microtubules and microfilaments in living cells.
GFP–GhKCH2 binds to both microtubules and microfilaments
in Arabidopsis protoplasts
Considering that cotton suspension cells are hard to culture and not
stable, we used Arabidopsis cells as the overexpression reactor, in
order to detect whether GhKCH2 has the ability to interact with
microtubules and microfilaments in living plant cells. Confocal
microscopy revealed that the GFP-fusion full-length protein GFP–
GhKCH2 decorated filamentous structures in the protoplasts
c The Authors Journal compilation c 2009 Biochemical Society
DISCUSSION
In plant cells, many biological processes rely on the co-ordination
of microtubules and microfilaments, and the interaction between
these two cytoskeleton systems plays an important role in
various physiological activities [5]. The mechanism of this
interaction, however, remains unclear. Only a few molecular
A kinesin interacts with both microtubules and microfilaments
Figure 4
177
The N-terminal portion of GhKCH2 contributes to actin binding in Arabidopsis protoplasts
(A) GFP-fusion constructs of the truncated variants of GhKCH2. The regions of GhKCH2 used for making GFP fusions are indicated by their amino acid residues. (B) Confocal images showed that
in transformed Arabidopsis protoplasts N–GFP exhibited filamentous structures (a), which were able to be disrupted by latrunculin B treatment (c), but not by oryzalin (b). Deletion of the N-terminal
portion, N–GFP, resulted in random distribution (d). In the control protoplasts, GFP–AtMAP65–2-labelled microtubule networks (e) were depolymerized by oryzalin (f), but latrunculin B had
no effect on them (g), whereas AtFim1-ABD2–GFP-labelled microfilaments (h) were only sensitive to latrunculin B (j), as oryzalin failed to destroy them (i). These controls diplayed the specific
depolymerizing abilities of the drugs. (C) The shorter N-terminal portions of GhKCH2 (N240–GFP and N200–GFP) bound to the microfilaments at decreased levels (a and b). N160–GFP (c) and
N160–GFP (d) failed to label the filaments. Scale bar = 5 μm.
players interacting with both microtubules and microfilaments
have been identified in plant cells [5–7]. In the present study,
we report that GhKCH2, a cotton kinesin co-localized with both
microtubules and microfilaments in cotton fibres, can interact with
both of the two cytoskeletal elements, and its N-terminal portion,
including a CH domain, plays the key role in its interaction with
actin microfilaments.
Until now, the actin-binding ability of full-length plant kinesin
polypeptides has not been identified in vitro, partially because of
the difficulties in obtaining active proteins. In the present study,
we tried to express and purify recombinant GhKCH2 from E. coli,
but failed to get soluble protein. Next, we employed a eukaryotic
expression system, and His-tagged fusion proteins of full-length
GhKCH2 were successfully obtained from insect Sf9 cells.
c The Authors Journal compilation c 2009 Biochemical Society
178
Figure 5
T. Xu and others
GhKCH2 bundles actin filaments as well as microtubules and cross-links them in vitro
(A) SDS/PAGE (10 % gel) of GhKCH2 purified via affinity chromatography from transfected insect Sf9 cells (lane 1). Purified GhKCH2 was recognized by the anti-GhKCH2-C antibody in a Western
blot (lane 2). The molecular mass in kDa is indicated on the left-hand side. (B) Fluorescence images of F-actin (MF; shown in green) and microtubule (MT; shown in red) in the absence or presence of
eukaryotic-expressed GhKCH2. The yellow colour indicates the overlap of green and red signals. BSA was used as a control. Scale bar=5 μm. (a–e) The binding assay of GhKCH2 on microfilaments,
showing that GhKCH2 bundled microfilaments. (f–j) The binding assay of GhKCH2 on microtubules, showing that GhKCH2 bundled microtubules. (k–o) The effect of GhKCH2 on the mixture of
microfilaments and microtubules, showing that GhKCH2 cross-linked microfilaments and microtubules.
In vitro, GhKCH2 protein induced the scattered microfilaments
as well as microtubules to aggregate and bundle (Figures 5Bb,
5Bc, 5Bd, 5Bg, 5Bh and 5Bi). When GhKCH2 was incubated
with the mixture of microtubules and microfilaments, it even
made the two different kinds of filaments couple (Figures 5Bl–
5Bn), revealing that GhKCH2 interacts with both microtubules
and microfilaments and possesses a cytoskeleton-cross-linking
activity. In the transgenic Arabidopsis protoplasts, the filamentous
structures labelled by GFP–GhKCH2 were sensitive to both
oryzalin and latrunculin B (Figure 6A), which are specific reagents
for depolymerizing microtubules and microfilaments respectively
(Figures 4Be–4Bj). Thus the results above demonstrated the
dual binding ability of GhKCH2 in living cells. The further
direct observation via fluorescent labelling of microtubules
and microfilaments in the fixed GFP–GhKCH2-expressed
protoplasts gave more data supporting the above conclusion
(Figure 6B).
The CH domain was first identified at the N-terminus of
calponin, an actin-binding protein that plays a major regulatory
role in muscle contraction [31]. In many actin-binding proteins the
CH domain was found to be involved in actin binding, although
it alone was not always sufficient, as other tandem CH domains
or other sequences were also required [13,14,32,33]. Kinesins
with the CH domain were found only in plants and should play
special roles in plant-specific biological processes. Among these
CH domain-containing kinesins, only cotton GhKCH1 has been
reported to co-localize with microfilaments in cotton fibres [6].
In the present study, using our self-prepared specific antibody,
we immunolocalized another CH domain-containing kinesin,
GhKCH2, which possesses a cytoskeleton-cross-linking ability
in cotton fibres (Figure 2).
c The Authors Journal compilation c 2009 Biochemical Society
Cotton fibre development is a complicated process that requires
participation of both microtubules and microfilaments [16], but
how cytoskeletons are organized and work for fibre growth
remains elusive. Current evidence reveals that cytoskeleton
dynamics, regulated by cytoskeleton-associated proteins, plays
a critical role in cotton fibre fast elongation [17–19]. GhKCH2
is highly expressed during cotton fibre elongation [15], and
localized along microtubules (Figures 2d–2f) and microfilaments
(Figures 2g–2i) in 12 DPA cotton fibres. Thus it is possible
that GhKCH2, a kinesin possessing microtubule/microfilamentbinding abilities, plays a role in cotton fibre elongation through
cross-linking or reorganizing microtubules and microfilaments.
Besides, using an immunolabelling assay, we also found that
GhKCH2 mainly localized at the midzone of the phragmoplast
in dividing cotton root tip cells (Supplementary Figure S1
at http://www.BiochemJ.org/bj/421/bj4210171add.htm). The
phragmoplast is a unique apparatus that forms during cytokinesis
in plant cells and occurs with organized microtubules and
microfilaments [1,34]. Previous studies have not revealed any
motor proteins or integrating factors that interact with both
microtubules and microfilaments in the phragmoplast. The cotton
GhKCH2, with microtubule-stimulated ATPase activity [15] and
a cross-linking ability to microtubules and microfilaments, is
more suitable for the function or formation of the dynamic
phragmoplast, such as assisting vesicles and cell wall materials
to be correctly oriented and accumulated at the midzone of the
phragmoplast. The detailed roles of GhKCH2 at the midzone
of the phragmoplast of cotton root tip cells, as well as the colocalization with microtubules and microfilaments in cotton fibre
cells or concentrated localization in interphase nucleus, need to
be further investigated.
A kinesin interacts with both microtubules and microfilaments
Figure 6
179
GhKCH2 binds to both microtubules and microfilaments in transiently overexpressed Arabidopsis protoplasts
(A) In living Arabidopsis protoplasts, GFP–GhKCH2 decorated filamentous structures (a). Specific drug treatment showed that the filaments of GFP–GhKCH2 were disrupted partly by oryzalin (b),
and latrunculin B made the strong labelling of GFP–GhKCH2 (arrowhead in a) become weaker and thinner (arrow in c). When oryzalin and latrunculin B were applied concurrently, the filamentous
structure was destroyed completely (d). (B) The co-localization of GFP–GhKCH2 and microtubules or microfilaments was revealed by fluorescence labelling of fixed protoplasts. Microtubules
were immunofluorescently labelled with anti-α-tubulin antibody and TRITC-conjugated goat anti-mouse IgG (b; red), whereas microfilaments were fluorescently labelled with rhodamine-phalloidin
(e; red). The presence of yellow signals in the merged images (c and f) indicates that a few of the GFP–GhKCH2 proteins co-localized with microtubules (c; arrow), whereas most of the GFP–GhKCH2
co-localized with microfilaments (f). Scale bar = 5 μm.
AUTHOR CONTRIBUTION
Tao Xu performed experiments for the results presented in Figures 1, 3, 5, 6 and
Supplementary Figure S1. Zhe Qu performed experiments for the results presented in
Figures 2, 4, 5 and 6. Xueyong Yang purified eukaryotic-expressed full-length GhKCH2
protein from Sf9 insect cells which is used in Figure 5. Xinghua Qin helped with the in vivo
actin-binding ability analysis of N-terminal truncated proteins. Youqun Wang helped to
immunolocalize GhKCH2 in cotton root tip cells. Jiyuan Xiong helped in probing actin
and tubulin in cellular fractions of cotton roots. Guoqin Liu and Dongtao Ren supervised
the study.
ACKNOWLEDGEMENTS
We thank Dr Elison B. Blancaflor (Noble Foundation, Ardmore, OK, U.S.A.) for the AtFim1ABD2–GFP plasmid and Dr Ming Yuan (China Agricultural University, Beijing, China) for
the GFP–AtMAP65-2 construct. We thank Michael T. Guarnieri for critical reading of this
manuscript prior to acceptance.
FUNDING
This work was supported by the National Natural Science Foundation of China [project
numbers 30770128, 30671049, 30721062] and the Doctoral Fund of Ministry of Education
of China [grant number 200800190022].
REFERENCES
1 Lloyd, C. W. (1987) The plant cytoskeleton: the impact of fluorescence microscopy. Annu.
Rev. Plant Physiol. 38, 119–137
2 Goode, B. L., Drubin, D. G. and Barnes, G. (2000) Functional cooperation between the
microtubule and actin cytoskeletons. Curr. Opin. Cell Biol. 12, 63–71
3 Jurgens, G. (2005) Cytokinesis in higher plants. Annu. Rev. Plant Biol. 56, 281–299
4 Gavin, R. H. (1997) Microtubule-microfilament synergy in the cytoskeleton. Int. Rev.
Cytol. 173, 207–242
5 Igarashi, H., Orii, H., Mori, H., Shimmen, T. and Sonobe, S. (2000) Isolation of a novel
190 kDa protein from tobacco BY-2 cells: possible involvement in the interaction between
actin filaments and microtubules. Plant Cell Physiol. 41, 920–931
6 Preuss, M. L., Kovar, D. R., Lee, Y. R., Staiger, C. J., Delmer, D. P. and Liu, B. (2004) A
plant-specific kinesin binds to actin microfilaments and interacts with cortical
microtubules in cotton fibers. Plant Physiol. 136, 3945–3955
7 Huang, S., Jin, L., Du, J., Li, H., Zhao, Q., Ou, G., Ao, G. and Yuan, M. (2007) SB401, a
pollen-specific protein from Solanum berthaultii, binds to and bundles microtubules and
F-actin. Plant J. 51, 406–418
8 Vale, R. D. and Fletterick, R. J. (1997) The design plan of kinesin motors. Annu. Rev. Cell
Dev. Biol. 13, 745–777
9 Hirokawa, N. and Takemura, R. (2004) Kinesin superfamily proteins and their various
functions and dynamics. Exp. Cell Res. 301, 50–59
10 Kuriyama, R., Gustus, C., Terada, Y., Uetake, Y. and Matuliene, J. (2002) CHO1, a
mammalian kinesin-like protein, interacts with F-actin and is involved in the terminal
phase of cytokinesis. J. Cell Biol. 156, 783–790
11 Pollard, T. D., Matuliene, J. and Kuriyama, R. (2002) Kinesin-like protein CHO1 is
required for the formation of midbody matrix and the completion of cytokinesis in
mammalian cells. Mol. Biol. Cell 13, 1832–1845
12 Iwai, S., Ishiji, A., Mabuchi, I. and Sutoh, K. (2004) A novel actin-bundling
kinesin-related protein from Dictyostelium discoideum . J. Biol. Chem. 279, 4696–4704
13 Gimona, M., Djinovic-Carugo, K., Kranewitter, W. J. and Winder, S. J. (2002) Functional
plasticity of CH domains. FEBS Lett. 513, 98–106
14 Korenbaum, E. and Rivero, F. (2002) Calponin homology domains at a glance. J. Cell Sci.
115, 3543–3545
c The Authors Journal compilation c 2009 Biochemical Society
180
T. Xu and others
15 Xu, T., Sun, X., Jiang, S., Ren, D. and Liu, G. (2007) Cotton GhKCH2, a plant-specific
kinesin, is low-affinitive and nucleotide-independent as binding to microtubule. J.
Biochem. Mol. Biol. 40, 723–730
16 Seagull, R. W. (1990) The effects of microtubule and microfilament disrupting agents on
cytoskeletal arrays and wall deposition in developing cotton fibers. Protoplasma 159,
44–59
17 Wang, H., Yu, Y., Chen, Z. and Xia, G. (2005) Functional characterization of Gossypium
hirsutum profilin 1 gene (GhPFN1) in tobacco suspension cells. Planta 222, 594–603
18 Li, X., Fan, X., Wang, X., Cai, L. and Yang, W. (2005) The cotton ACTIN1 gene is
functionally expressed in fibers and participates in fiber elongation. Plant Cell 17,
859–887
19 Wang, H., Wang, J., Gao, P., Jiao, G., Zhao, P., Li, Y., Wang, G. and Xia, G. (2009)
Down-regulation of GhADF1 gene expression affects cotton fibre properties. Plant
Biotechnol. J. 7, 13–23
20 Lu, L., Lee, Y. R., Pan, R., Maloof, J. N. and Liu, B. (2005) An internal motor kinesin is
associated with the Golgi apparatus and plays a role in trichome morphogenesis in
Arabidopsis . Mol. Biol. Cell 16, 811–823
21 Preuss, M. L., Delmer, D. P. and Liu, B. (2003) The cotton kinesin-like calmodulinbinding
protein associates with cortical microtubules in cotton fibers. Plant Physiol. 132,
154–160
22 Beasley, C. A. and Ting, I. P. (1973) The effects of plant growth substances on in vitro
fiber development from fertilized cotton ovules. Am. J. Bot. 60, 130–139
23 Sekine, Y., Okada, Y., Noda, Y., Kondo, S., Aizawa, H., Takemura, R. and Hirokawa, N.
(1994) A novel microtubule-based motor protein (KIF4) for organelle transports, whose
expression is regulated developmentally. J. Biol. Chem. 127, 187–201
Received 7 October 2008/5 May 2009; accepted 6 May 2009
Published as BJ Immediate Publication 6 May 2009, doi:10.1042/BJ20082020
c The Authors Journal compilation c 2009 Biochemical Society
24 Brzeski, J., Podstolski, W., Olczak, K. and Jerzmanowski, A. (1999) Identification and
analysis of the Arabidopsis thaliana BSH gene, a member of the SNF5 gene family.
Nucleic Acids Res. 27, 2393–2399
25 Turck, F., Zhou, A. and Somssich, I. E. (2004) Stimulus-dependent, promoter-specific
binding of transcription factor WRKY1 to its native promoter and the defense-related gene
PcPR1-1 in parsley. Plant Cell 16, 2573–2585
26 Pardee, J. D. and Spudich, J. A. (1982) Purification of muscle actin. Methods Cell Biol.
24, 271–289
27 Williams, Jr, R. C. and Lee, J. C. (1982) Preparation of tubulin from brain. Methods
Enzymol. 85, 376–385
28 Castoldi, M. and Popov, A. V. (2003) Purification of brain tubulin through two cycles of
polymerization/depolymerization in a high-molarity buffer. Protein Exper. Purif. 32,
83–88
29 Hyman, A. A. (1991) Preparation of marked microtubules for the assay of the polarity of
microtubule-based motors by fluorescence. J. Cell Sci. (Suppl.) 14, 125–127
30 Sheen, J. (2002) A transient expression assay using Arabidopsis mesophyll protoplasts,
http://genetics.mgh.harvard.edu/sheenweb/
31 Takahashi, K. and Nadal-Ginard, B. (1991) Molecular cloning and sequence analysis of
smooth muscle calponin. J. Biol. Chem. 266, 13284–13288
32 Gimona, M. (1998) The single CH domain of calponin is neither sufficient nor necessary
for F-actin binding. J. Cell Sci. 111, 1813–1821
33 Stradal, T., Kranewitter, W., Winder, S. J. and Gimona, M. (1998) CH domains revisited.
FEBS Lett. 431, 134–137
34 Staehelin, L. A. and Hepler, P. K. (1996) Cytokinesis in higher plants. Cell 84,
821–824
Biochem. J. (2009) 421, 171–180 (Printed in Great Britain)
doi:10.1042/BJ20082020
SUPPLEMENTARY ONLINE DATA
A cotton kinesin GhKCH2 interacts with both microtubules and
microfilaments
Tao XU1 , Zhe QU1 , Xueyong YANG, Xinghua QIN, Jiyuan XIONG, Youqun WANG, Dongtao REN2 and Guoqin LIU2
State key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100193, China
Immunolocalization in cotton root tip cells
Excised cotton root tips were fixed in 4% paraformaldehyde in
PEM buffer containing 0.1% Tween-80 for 1 h, rinsed three times
with PEM buffer, and then treated with 1% cellulose “Onozuka”
R-10 (Yakult Honsha) and 0.5% pectolyase Y-23 (Yakult Honsha)
for 15 min. After being rinsed three times (10 min each), cells
were released by squashing the root tips between two slides coated
with 1 mg/ml poly-L-lysine and then chilled at − 20 ◦C for 30 min.
After the uncovered coverslips air-dried, the cells were treated
with 1% Triton X-100 for 30 min and then rinsed three times
in PEM and PBS buffer. The purified anti-GhKCH2-C antibody
and anti-α-tubulin monoclonal antibody were applied for 2 h
at room temperature. FITC-conjugated goat anti-rabbit IgG and
TRITC-conjugated goat anti-mouse IgG were used as secondary
antibodies. In addition, 0.5 μg/ml 4 , 6-diamidino-2-phenylindole
(DAPI; Sigma) was added to the Antifade (in PBS) to stain the
DNA. Images were acquired with a Confocal Laser Scanning
Microscope (Nikon Eclipse TE2000-E).
1
2
Both of these authors contributed equally to the present study.
Correspondence may be addressed to either of these authors (email [email protected] or [email protected]).
c The Authors Journal compilation c 2009 Biochemical Society
T. Xu and others
Figure S1
GhKCH2 distributes in a cell cycle-dependent manner in cotton root tip cells
Microtubules (red), GhKCH2 (green), and DNA (stained with DAPI; blue) were shown at different cell division stages. During interphase, GhKCH2 mainly localized to the nucleolus, while a small
percentage was distributed in the cytoplasm sporadically. When the preprophase band formed, increased punctate GhKCH2 occurred throughout the whole cytoplasm with a disappearance in the
nucleus. During metaphase and anaphase, GhKCH2 moved to the central region of the dividing cells. Then from telophase to cytokinesis, it was concentrated at the midzone of the phragmoplast and
focused on the cell plate when the cell plate started to form. Finally, as the nuclear material reassembled in daughter cells following cytokinesis, most of GhKCH2 was again localized in the nucleus.
Received 7 October 2008/5 May 2009; accepted 6 May 2009
Published as BJ Immediate Publication 6 May 2009, doi:10.1042/BJ20082020
c The Authors Journal compilation c 2009 Biochemical Society