Biochem. J. (2009) 421, 171–180 (Printed in Great Britain) 171 doi:10.1042/BJ20082020 A cotton kinesin GhKCH2 interacts with both microtubules and microfilaments Tao XU1 , Zhe QU1 , Xueyong YANG, Xinghua QIN, Jiyuan XIONG, Youqun WANG, Dongtao REN2 and Guoqin LIU2 State key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100193, China Many biological processes require the co-operative involvement of both microtubules and microfilaments; however, only a few proteins mediating the interaction between microtubules and microfilaments have been identified from plants. In the present study, a cotton kinesin GhKCH2, which contains a CH (calponin homology) domain at the N-terminus, was analysed in vitro and in vivo in order to understand its interaction with the two cytoskeletal elements. A specific antibody against GhKCH2 was prepared and used for immunolabelling experiments. Some GhKCH2 spots appeared along a few microtubules and microfilaments in developing cotton fibres. The His-tagged N-terminus of GhKCH2 (termed GhKCH2-N) could coprecipitate with microfilaments and strongly bind to actin filaments at a ratio of monomeric actin/GhKCH2-N of 1:0.6. The full-length GhKCH2 recombinant protein was shown to bind to and cross-link microtubules and microfilaments in vitro. A GFP-fusion protein GFP–GhKCH2 transiently overexpressed in Arabidopsis protoplasts decorated both microtubules and microfilaments, confirming the binding ability and specificities of GhKCH2 on microtubules and microfilaments in living plant cells. The results of the present study demonstrate that GhKCH2, a plant-specific microtubule-dependent motor protein, not only interacts with microtubules, but also strongly binds to microfilaments. The cytoskeletal dual-binding and cross-linking ability of GhKCH2 may be involved in the interaction between microtubules and microfilaments and the biological processes they co-ordinate together in cotton cells. INTRODUCTION cortical actin microfilaments in cotton fibres, and its N-terminal region with a CH (calponin homology) domain interacts with actin microfilaments [6]. In addition, the conserved CH domain is often found in many actin-binding proteins [13,14]. It is still unknown whether the plant-specific CH domain-containing kinesins can interact with actin microfilaments directly. Another question to be further addressed is whether the CH domain is responsible for their microfilament binding. More recently, GhKCH2, a novel CH domain-containing kinesin from the kinesin-14 family, that encodes a polypeptide sharing 57 % sequence identity with GhKCH1, was cloned from cotton and biochemically characterized as a plant-specific microtubule-dependent kinesin in our laboratory [15]. We later found that some GhKCH2 is distributed along microtubules, as well as microfilaments, in a punctate manner in developing cotton fibres. Cotton fibres are single, highly elongated cells differentiated from the epidermis of the ovule. It is well known that cytoskeletal elements play a critical role in the development of cotton fibres. Microtubules were found to be involved in the deposition and organization of cellulose microfibrils in cotton fibres via a drug treatment assay [16]. Actin microfilaments perform an essential role in cotton fibre growth [16–19]; however, the mechanism of how cytoskeleton networks are organized and involved in fibre development is still largely unknown. To date, besides GhKCH1 and GhKCH2, another two kinesins identified in cotton fibres are GhKinesin-13A and GhKCBP. GhKinesin13A was found in the cotton fibre Golgi apparatus [20]. GhKCBP decorates cortical microtubules and may stabilize microtubules in the interphase cell cortex [21]. In the present study, we report that In plant cells, microtubules and microfilaments are often distributed closely in the cortical layer, the cytoplasmic strands, the prophase band and the phragmoplast [1]. These two cytoskeletal elements participate in several biological processes together, such as transporting vesicles and organelles and formation of the prophase band, as well as the organization and formation of the phragmoplast and cell plate [2,3]. In animal and yeast cells, various proteins mediating the interaction between microtubules and microfilaments have been identified [2,4]; however, only a few of these proteins have been reported in plants, including a 190 kDa polypeptide from tobacco BY-2 cells [5], GhKCH1 from cotton fibre [6] and SB401 from potato pollen [7]. Kinesins are microtubule-based motor proteins that occur in various eukaryotic cells. Members of the kinesin superfamily are involved in diverse cellular functions, including transport of vesicle and membrane organelles, cell division, microtubule dynamics and signal transduction [8,9]. Interestingly, previous studies have demonstrated that some kinesins associate with actin microfilaments. In mammalian cells, a kinesin-like protein MKLP1/CHO1 interacts with F-actin through an actin-binding sequence in the tail domain [10], and plays a role in midbody formation and cytokinesis completion [11]. DdKin5, a kinesin from Dictyostelium cells, directly bundles actin filaments in vitro and associates with actin-based structures in cells [12]. In plants, a cotton kinesin GhKCH1 not only decorates cortical microtubules in a punctate manner, but also occasionally attaches to transverse- Key words: calponin homology domain, cotton fibre, cross-link, kinesin, microfilament, microtubule. Abbreviations used: CH, calponin homology; DPA, days post-anthesis; DTT, dithiothreitol; GFP, green fluorescent protein; GhKCH2-C, C-terminal domain of GhKCH2; GhKCH2-M, motor domain of GhKCH2; GhKCH2-N, N-terminal domain of GhKCH2; MPK4, MAPK (mitogen-activated protein kinase) 4; PI, propidium iodide; TRITC, tetramethylrhodamine β-isothiocyanate. 1 Both of these authors contributed equally to the present study. 2 Correspondence may be addressed to either of these authors (email [email protected] or [email protected]). c The Authors Journal compilation c 2009 Biochemical Society 172 Table 1 T. Xu and others Sequence-specific primers used in this study F, forward; R, reverse. The N240, N200, and N160 constructs share the forward primer with GhKCH2-N; the N160 construct shares the reverse primer with GhKCH2-N. Construct Primer sequence (5 to 3 ) Restriction site GhKCH2-N and N (1-306 aa) GhKCH2-C GhKCH2 F: GGATCCATGGCTGCAGAAGGAATGTT; R: GTCGACCATCACTTCGATGTTCTTTTCC F: CCATGGGTGCTGCTCGAGTG; R: GTCGACTTTTCTACTCCCAGTTCTGC For prokaryotic/eukaryotic expression, F: GCCCATGGCTGCAGAAGGAAT; R: GCAAGCTTTTTTCTACTCCCAGTTCTG For transient expression, F: GGATCCGGTACCATGGCTGCAGAAG; R: GAGCTCTTAGTCGACTTTTCTACTCCCAGTTC F: GGATCCATGAAGAAAGAAGATTGCTTCC; R: GTCGACTTTTCTACTCCCAGTTCTGC R: GTCGACATCTGTTAGAAGGGCAC R: GTCGACGGAGTTTGTGAAAGGCT R: GTCGACATAGGACTTAAGTGCTAGAAC F: GGATCCATGAACGAGTGGAGGCTCT F: GGATCCGTCGACATGAGTAAAGGAGAAGAAC; R: GAGCTCTTAGGTACCTTTGTATAGTTCATCCATG BamHI SalI NcoI SalI NcoI HindIII KpnI SacI N (307-1015 aa) N240 (1-240 aa) N200 (1-200 aa) N160 (1-160 aa) N160 (161-306 aa) GFP GhKCH2 can directly interact with both microtubules and microfilaments, suggesting that GhKCH2 may work as a candidate linker between the two cytoskeleton systems in cotton fibres. EXPERIMENTAL Plant materials To obtain cotton roots, cotton (Gossypium hirsutum Xuzhou 142) seeds were dipped in water overnight and placed on wet filter paper until the roots reached lengths of 2–3 cm. Cotton fibres were grown on ovules cultured in vitro from greenhouse-grown plants [22]. Ovules were dissected out of the ovaries on 2 DPA (days post-anthesis) and floated on the basal medium supplemented with 5 μmol/l indole-3-acetic acid and 0.5 μmol/l gibberellic acid. Cultures were incubated at 30 ◦C in the dark. Arabidopsis thaliana cell suspension cultures were maintained in liquid growth medium containing 4.4 g/l Murashige and Skoog basal medium (Sigma), 30 g/l sucrose and 1 mg/l 2, 4dichlorphenoxyacetic acid. The cell cultures were grown on a shaker at 23 ◦C in the dark, and subcultured every week with a 10-fold dilution into fresh medium. Plasmid construction The full-length cDNA sequence of GhKCH2 was obtained from GenBank® (accession number EF432568). Constructs were generated using sequence-specific primers (Table 1). For prokaryotic expression, the DNA fragments encoding GhKCH2N (the N-terminal region of GhKCH2, amino acids 1–306), GhKCH2-C (the C-terminal region of GhKCH2, amino acids 729–1015) and full-length GhKCH2 were cloned into the pET28a(+) vector. GhKCH2-M (the motor domain of GhKCH2, amino acids 396–734) was constructed as described previously [15]. For eukaryotic expression, GhKCH2 was introduced into pFastBacHTA vector to generate pFastBacHTA-GhKCH2. For transient expression in Arabidopsis protoplasts, several GFP (green fluorescent protein) fusion constructs were created. The GFP–GhKCH2 was generated by inserting the GhKCH2 coding region in-frame to the C-terminus of the GFP coding region. The truncated proteins (see Figure 4A) including N (amino acids 1–306), N (amino acids 307–1015), N240 (amino acids 1– 240), N200 (amino acids 1–200), N160 (amino acids 1–160) and N160 (amino acids 161–306) were fused to the N-terminus of GFP. All of the fusion proteins were under the control of the 35S cauliflower mosaic virus promoter. Additionally, AtFim1-ABD2– c The Authors Journal compilation c 2009 Biochemical Society BamHI SalI SalI SalI SalI BamHI BamHI or SalI KpnI or SacI GFP was kindly provided by Dr Elison B. Blancaflor (Noble Foundation, Ardmore, OK, U.S.A.), and GFP–AtMAP65-2 was obtained from Dr Ming Yuan (China Agricultural University, Beijing, China). Prokaryotic-expressed recombinant protein preparation and antibody production The recombinant 6 × His-tagged GhKCH2-N and GhKCH2C fusion proteins were expressed in Escherichia coli strain BL21 (DE3) induced with 0.2 mM IPTG (isopropyl β-Dthiogalactoside) for 8 h at 22 ◦C. Fusion proteins were purified by using Ni-NTA (Ni2+ -nitrilotriacetate) agarose resin (Amersham Pharmacia). Polyclonal anti-GhKCH2-N and anti-GhKCH2-C antibodies were raised in rabbits using purified GhKCH2-N and GhKCH2-C protein as antigens, and purified by using the AminoLink Plus kit (Pierce) according to the manufacturer’s protocol. Eukaryotic expression of GhKCH2 recombinant protein in insect Sf9 cells Insect Sf9 cells were maintained in TNM-FH medium (Sigma) containing 10 % (v/v) FBS (fetal bovine serum; Gibco). The cells were cultured in tissue culture flasks at 27 ◦C and subcultured every 3 days. DH10Bac E. coli competent cells were transformed with the plasmid pFastBacHTA-GhKCH2 to generate the recombinant bacmid. Sf9 cells were transfected with the bacmid and generated baculovirus which was subsequently used to infect Sf9 cells to express GhKCH2 protein. After 3 days, the cells were harvested for protein affinity purification as described by Sekine et al. [23]. Protein extraction and immunoblotting Proteins and crude subcellular fractions were extracted and separated from cotton roots with a mortar and pestle in extraction buffer [0.33 M sucrose, 10 mM KCl, 10 mM NaCl, 10 mM Mes/KOH (pH 6.0), 1 mM EDTA, 1 mM DTT (dithiothreitol) and 0.5 mM spermidine] plus protease inhibitors (1 mM PMSF, 10 μg/ml pepstatin A, 10 μg/ml aprotinin and 10 μg/ml leupeptin) according to methods previously described [24,25]. These protein samples were separated on SDS/PAGE (7.5 % gels) and then transferred on to nitrocellulose membrane for immunoblotting analysis. Total protein (GhKCH2, GhKCH2-N, GhKCH2-M or GhKCH2-C) from the induced bacteria was extracted by boiling A kinesin interacts with both microtubules and microfilaments in 1 × SDS sample buffer for 10 min. After centrifugation at 15 000 g for 3 min at 25 ◦C, the samples were loaded on to SDS/PAGE (10 % gels) and subjected to Western blot analysis with an anti-His tag monoclonal antibody (R&D Systems), an anti-GhKCH2-N polyclonal antibody and an antiGhKCH2-C polyclonal antibody as primary antibodies. HRP (horseradish peroxidase)-conjugated goat anti-mouse IgG and HRP-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories) were used as secondary antibodies. Immunolabelling Immunolocalization in cotton fibres Cotton fibres (12 DPA) were processed for immunolocalization as described by Preuss et al. [21]. The anti-GhKCH2-C antibody and FITC-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories; diluted 1:200) were used to detect GhKCH2 proteins. Anti-α-tubulin monoclonal antibody (Sigma; diluted 1:500) and TRITC (tetramethylrhodamine β-isothiocyanate)conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories; diluted 1:200) were applied to label microtubules. Microfilaments were stained with 50 nM rhodamine-phalloidin (Molecular Probes) for 1 h at room temperature (25 ◦C). DNA was stained with 0.5 μg/ml PI (propidium iodide; Sigma). Immunolabelling in Arabidopsis protoplasts To stain microtubules and microfilaments, Arabidopsis protoplasts were attached to coverslides coated with 1 mg/ml polyL-lysine (Mr > 300 000; Sigma) and fixed for 30 min at room temperature with 3 % (w/v) paraformaldehyde in PEM buffer [50 mM Pipes (pH 6.9), 5 mM EGTA and 1 mM MgSO4 ] supplemented with 1 % DMSO, 0.3 mM PMSF and 0.05 % Triton X-100. The fixed protoplast ghosts were then washed with PBS (pH 7.4) and blocked in 1 % (w/v) BSA (Sigma) for 10 min. Finally, microtubules and microfilaments were labelled as described above. After rinsing in PBS, slides were observed under a Zeiss LSM 510 META confocal microscope. Preparation and polymerization of actin and tubulin Rabbit muscle actin was purified according to the method described by Pardee and Spudich [26]. G-actin was centrifuged at 65000 rev./min for 1 h at 4 ◦C using a Beckman TLA 120.1 rotor before polymerization. Actin was polymerized in F-buffer [5 mM Tris/HCl (pH 7.5), 0.5 mM DTT, 0.2 mM ATP/Na2 , 50 mM KCl and 5 mM MgCl2 ] at 22 ◦C for 2 h. F-actin was stained by incubation with equimolecular Alexa Fluor® 488-phalloidin at 22 ◦C for 30 min. Porcine brain tubulins were purified according to previously published methods [27,28]. The NHS-rhodamine [5-(and 6-) carboxytetramethylrhodamine succinimidyl ester] (Molecular Probes)-labelled tubulin was prepared according to the method described by Hyman [29]. To prepare microtubules, purified tubulin was polymerized at 37 ◦C for 30 min in PEM buffer [100 mM Pipes (pH 6.9), 1 mM EGTA and 2 mM MgCl2 ] plus 1 mM GTP-Na2 and 10 μM taxol (Paclitaxel; Sigma), a drug which stabilizes microtubules. Fluorescence microscopy To test the interaction between GhKCH2 and the cytoskeleton in vitro, 0.1 μM F-actin stained with Alexa Fluor® 488phalloidin and/or 0.1 μM NHS-rhodamine-labelled microtubules were incubated with or without the eukaryotic-expressed GhKCH2 protein (0.1, 0.25 or 0.5 μM) for 40 min at 22 ◦C 173 in a reaction volume of 20 μl. BSA was used as a control. Then aliquots (4.5 μl) were placed on a slide pre-treated with poly-L-lysine and observed via an Olympus BX51 microscope equipped with a CoolSNAP HQ CCD (charge-coupled device) camera (Photometrics). Images were acquired using MetaMorph (Universal Imaging). To detect the effect of GhKCH2-N on F-actin, 0, 0.25 or 0.5 μM GhKCH2-N proteins were incubated with 0.5 μM F-actin, and the samples were observed as described above. An unrelated Histagged fusion protein MPK4 [MAPK (mitogen-activated protein kinase) 4] from our laboratory was used as a control. F-actin co-sedimentation assays For the F-actin and GhKCH2-N protein co-sedimentation assay, rabbit muscle actin and GhKCH2-N protein were centrifuged at 75 000 rev./min for 1 h at 4 ◦C using a Beckman TLA 120.1 rotor before use. Then, 3 μM F-actin and 0– 10 μM GhKCH2-N were incubated in a 100 μl volume of F-buffer for 40 min at 22 ◦C. Next, the samples were centrifuged at 75 000 rev./min for 1 h at 22 ◦C using a Beckman TLA 120.1 rotor. BSA was used as a negative control. The pellet was washed with F-buffer and resuspended in 1 × SDS sample buffer. Equal amounts of the resultant pellets and supernatants were separated by SDS/PAGE (12.5 % gels) and stained with Coomassie Brilliant Blue R250. After SDS/PAGE analysis, the concentration of GhKCH2-N in the supernatant and pellet was quantified by measuring protein band intensities with Quantity One (Bio-Rad). Data were analysed, and affinity constants were calculated using Microsoft Excel and GraphPad prism version 4.03 software. Transient expression in Arabidopsis protoplasts Plasmids used for transient expression were purified using a QIAprep Spin Miniprep Kit (Qiagen). The fusion constructs were introduced into Arabidopsis protoplasts prepared from 4-day suspension cells by PEG [poly(ethylene glycol)]-mediated transformation [30]. For drug treatment, the transformed protoplasts were incubated with 10 μM oryzalin (Sigma) for 1 h or 20 μM latrunculin B (Sigma) for 2 h. RESULTS A specific anti-GhKCH2 antibody was prepared To detect GhKCH2 in cotton cells, antibodies were raised against the N-terminus (GhKCH2-N; amino acids 1–306) and the C-terminus (GhKCH2-C; amino acids 729–1015) of GhKCH2. Affinity-purified anti-GhKCH2-N and anti-GhKCH2C antibodies could recognize their prokaryotic-expressed Histagged antigens (Figure 1Ab, lane 2 for GhKCH2-N and 1Ac, lane 4 for GhKCH2-C) and full-length GhKCH2 (Figures 1Ab and 1Ac, lane 1), but not the control protein GhKCH2-M (the motor domain of GhKCH2; amino acids 396–734; Figures 1Ab and 1Ac, lane 3). The bands below GhKCH2 (Figures 1Aa– 1Ac, lane 1) probably resulted from degradation of the full-length GhKCH2 protein. The anti-GhKCH2-C antibody also recognized an approx. 110 kDa band, close to the predicted size of GhKCH2 [15], in cotton root proteins (Figure 1B, lanes 1 and 1 ). When the anti-GhKCH2-C antibody was blocked with GhKCH2-C, the specific band disappeared (Figure 1B, lane 6 ), indicating that this antibody could recognize GhKCH2 specifically. However, the anti-GhKCH2-N failed to recognize GhKCH2 protein from cotton cells (results not shown), so only the anti-GhKCH2-C, which rendered a clean result with no additional bands, was c The Authors Journal compilation c 2009 Biochemical Society 174 Figure 1 T. Xu and others Specificity analysis of the self-prepared GhKCH2 antibodies (A) Total proteins loaded on to the gel were extracted from E. coli transformed with the corresponding recombinant plasmids (lane 1, full-length GhKCH2; lane 2, GhKCH2-N; lane 3, GhKCH2-M; and lane 4, GhKCH2-C). The Western blot was performed with an anti-His tag monoclonal antibody (a), anti-GhKCH2-N polyclonal antibody (b) and anti-GhKCH2-C polyclonal antibody (c). (B) SDS/PAGE and Western blot analysis of GhKCH2 in crude subcellular fractions of cotton roots. Only an approx. 110 kDa protein from the different cell fractions reacted with the anti-GHKCH2-C antibody. Lanes 1–5 show the Coomassie Blue-stained SDS/PAGE gel, and lanes 1 –5 show the Western blot with purified anti-GhKCH2-C antibody. Lanes 1 and 1 , total proteins of cotton roots; lanes 2 and 2 , crude cytoplasm proteins; lanes 3 and 3 , crude organelle proteins; lanes 4 and 4 , crude nuclear proteins; lanes 5 and 5 , antigen GhKCH2-C proteins used as a positive control. In lane 6 , the total protein from cotton roots was incubated with an anti-GhKCH2-C antibody that had been blocked with GhKCH2-C antigen. The positions of molecular mass markers (in kDa) are indicated on the left-hand side of the gels. used for further characterization of GhKCH2 in cotton cells. In order to reveal the subcellular localization, we extracted the crude cytoplasm protein fraction (Figure 1B, lanes 2 and 2 ), the organelle protein fraction (Figure 1B, lanes 3 and 3 ) and the nuclear protein fraction (Figure 1B, lanes 4 and 4 ) and analysed these subcellular fractions by Western blot analysis with the antiGhKCH2-C antibody. As shown in Figure 1(B), GhKCH2 was found in these three fractions, but was much lower in cytoplasm compared with organelle and nuclear fractions. Localization of GhKCH2 in cotton fibre cells To gain insight into the functions of GhKCH2, we detemined its intracellular localization pattern in cotton cells via immunofluorescence labelling. According to our previous studies, GhKCH2 is highly expressed in cotton fibres at the elongation stage [15]. Therefore cotton fibres at 12 DPA were chosen to detect GhKCH2 with the anti-GhKCH2-C antibody. The results showed that a few of the GhKCH2 proteins were localized in the nucleus in a punctate pattern and enriched in the nucleolus c The Authors Journal compilation c 2009 Biochemical Society (Figures 2a–2c). In the cytoplasm, a few punctate GhKCH2 signals were found to be co-localized with transverse microtubules (Figures 2d–2f). In addition, we observed some GhKCH2 proteins on axial microfilament cables (Figures 2g–2i). Thus GhKCH2 may be associated with the development of cotton fibres through an interaction with both microtubules and microfilaments. The N-terminal portion of GhKCH2 interacts with F-actin in vitro GhKCH2 polypeptide belongs to the kinesin-14 family and contains a single CH domain at the N-terminus, making it possible that GhKCH2 can bind to microfilaments through its N-terminal region in a similar manner to its homologous protein GhKCH1 [6]. To characterize the microfilament-binding ability of GhKCH2, His-tagged fusion protein GhKCH2-N (amino acids 1–306) including the CH domain (amino acids 42–160) was used in a high-speed in vitro co-sedimentation assay. The GhKCH2-N protein remained in the supernatant in the absence of F-actin (Figure 3A, lane 1). In the presence of F-actin, however, GhKCH2-N was found in the pellet (Figure 3A, A kinesin interacts with both microtubules and microfilaments Figure 2 Immunolocalization of GhKCH2 in cotton fibres (a)–(c) Double-labelling of GhKCH2 and nucleus. Fibres of 12 DPA were stained with the anti-GhKCH2-C antibody (a; green) and PI (b; red). Strong GhKCH2 signals appeared in particles in the nucleus, and were enriched in the nucleolus (c). (d)–(f) Double-labelling of GhKCH2 and microtubules. Transverse microtubules were shown by the anti-α-tubulin monoclonal antibody (e; red). GhKCH2 distributed in the cytoplasm in a punctate manner (d; green), and some of them were associated with cortical microtubules (f; arrows).(g)–(i) Double-labelling of GhKCH2 and microfilaments. Some GhKCH2 signals (g; green) were detected along rhodamine-phalloidin-labelled actin filaments (h; red) as shown in the merged image (i; arrowheads). Bar = 10 μm. lane 4), whereas the control protein, BSA, remained in the supernatant (Figure 3A, lane 7), indicating that GhKCH2-N co-sedimented with actin filaments. When the concentration of GhKCH2-N was increased from 0 to 10 μM in the presence of 3 μM F-actin, the pellets became enriched with GhKCH2-N (Figure 3B), and the binding ratio of monomeric actin/GhKCH2N was approximated as 1:0.6 at the saturation concentration. From three such independent experiments, a mean dissociation constant (K d + − S.D.) of 0.42 + − 0.02 μM was obtained by fitting the data with a hyperbolic function (Figure 3C). The effects of GhKCH2-N on microfilaments were directly visualized using fluorescence light microscopy, as shown in Figure 3(D). In the absence of GhKCH2-N (Figure 3Da) or the presence of another unrelated His-tagged fusion protein MPK4 (Figure 3Dd), 0.5 μM Alexa Fluor® -488-phalloidin-labelled F-actin exhibited a uniform meshwork of fine scattered single filaments. In contrast, addition of 0.25 μM GhKCH2-N resulted in the appearance of F-actin bundles (Figure 3Db). In the presence of 0.5 μM GhKCH2-N, additional F-actin bundles were formed, and almost all actin filaments were incorporated into large aggregated structures (Figure 3Dc). These data demonstrate that GhKCH2-N binds and bundles F-actin in vitro. The N-terminal portion of GhKCH2 binds to microfilaments in vivo Because the N-terminal of GhKCH2 was demonstrated to cosediment with actin microfilaments, we wanted to investigate 175 whether the N-terminal portion of GhKCH2 possesses the actinbinding ability in living cells. Residues 1–306 (N) and the other part of GhKCH2 (N; amino acids 307–1015) were transiently expressed as GFP-fusion proteins N–GFP and N– GFP (Figure 4A) in Arabidopsis protoplasts. N–GFP exhibited filamentous labelling in the transformed protoplasts (Figure 4Ba). To determine which cytoskeleton filaments were decorated by N–GFP, oryzalin, a depolymerizing reagent specific to microtubules, and latrunculin B, a depolymerizing reagent specific to microfilaments, were used to treat the protoplasts. After treatment with latrunculin B, the N–GFP-decorated filament structures were disrupted (Figure 4Bc), whereas oryzalin treatment had no effect on them (Figure 4Bb). This indicated that N–GFP binds to microfilaments in vivo. Since N–GFP proteins were dispersed at random in the protoplast (Figure 4Bd), the N-terminal portion (amino acids 1–306) of GhKCH2 appears to be critical for the interaction between GhKCH2 and actin microfilaments. Meanwhile, GFP–AtMAP65-2, a microtubule-binding GFPfusion protein, and AtFim1-ABD2–GFP, a truncated actinbinding GFP-fusion protein, were used as controls to ensure the specific depolymerizing effects of oryzalin and latrunculin B. As expected, oryzalin only depolymerized microtubules (Figure 4Bf), but not microfilaments (Figure 4Bi), and latrunculin B only seriously destroyed microfilaments (Figure 4Bj), but microtubules remained intact (Figure 4Bg). In addition, several N-terminal truncated GFP-fusion constructs (Figure 4A) were generated and transiently expressed in Arabidopsis protoplasts to tease out the region involved in the actin binding in more detail (Figure 4C). In the transformed protoplasts, N240–GFP (Figure 4Ca) and N200–GFP (Figure 4Cb) still interacted with the cytoskeleton filaments, although the level of binding decreased. The filaments were confirmed as microfilaments by depolymerizing drug treatment experiments (results not shown). Thus the N240–GFP and N200–GFP proteins had actin-binding abilities. No filamentous structures were observed in the protoplasts transformed with N160–GFP (Figure 4Cc) or N160–GFP (Figure 4Cd), showing that neither N160–GFP nor N160–GFP can bind to actin microfilaments. These results indicate that the CH domain-containing truncated polypeptide N160 is necessary, but insufficient, for the actin binding of GhKCH2, and N200 was the shortest polypeptide for binding to microfilaments in the present study. GhKCH2 is capable of not only bundling both microtubules and actin filaments, but also coupling them in vitro To determine whether the full-length GhKCH2 has microfilamentbinding ability, His-tagged GhKCH2 was successfully expressed in insect Sf9 cells using the Bac-to-Bac Baculovirus Expression System and affinity-purified (Figure 5A) for the in vitro microfilament-binding assay. A 0.1 μM concentration of Alexa Fluor® -488 phalloidin-labelled filamentous actin alone appeared as single filaments (Figure 5Ba). Surprisingly, after 0.1 μM GhKCH2 was added, actin bundles formed (Figure 5Bb). As the concentration of GhKCH2 went up to 0.25 μM and 0.5 μM, the bundles became more compact (Figures 5Bc and 5Bd). However, the presence of 0.5 μM BSA instead of GhKCH2 did not induce any change to F-actin (Figure 5Be), suggesting that GhKCH2 was able to bundle F-actin in a concentration-dependent manner. Similarly, GhKCH2 could bundle microtubules (0.1 μM) polymerized from rhodamine-conjugated tubulin (Figures 5Bf– 5Bj). However, we noticed that the same concentration of GhKCH2 made most of the actin filaments incorporate into large aggregated structures (Figures 5Bb–5Bd), but only a few c The Authors Journal compilation c 2009 Biochemical Society 176 Figure 3 T. Xu and others GhKCH2-N specifically binds to and bundles F-actin in vitro (A) Co-sedimentation assay. GhKCH2-N (10 μM) or control BSA (10 μM) was incubated with or without F-actin (5 μM). After centrifugation, the supernatants (S) and pellets (P) were analysed by SDS/PAGE. GhKCH2-N was present in the F-actin pellet (lane 4), whereas the control BSA did not co-sediment with F-actin (lane 8). The molecular mass in kDa is indicated on the left-hand side of the gel. (B) Various concentrations of GhKCH2-N proteins (0–10 μM) were incubated with 3 μM F-actin and then subjected to a co-sedimentation assay. The bound GhKCH2 was saturated at 3–3.5 μM. The supernatant (S) contained only the free GhKCH2-N. The pellet (P) contained the GhKCH2-N that co-sedimented with F-actin. (C) Protein quantification of the SDS/PAGE gel from (B). The concentration of bound GhKCH2-N was plotted against the concentration of free GhKCH2-N and fitted with a hyperbolic function. This graph represents one of three independent ® experiments. When the concentration of F-actin was 3 μM, the K d value was 0.42 + − 0.02 μM. (D) F-actin is bundled by GhKCH2-N. The effects of GhKCH2-N on F-actin stained with Alexa Fluor 488-phalloidin were directly visualized by fluorescence light microscopy: (a) control: F-actin in the absence of GhKCH2-N; (b) F-actin in the presence of GhKCH2-N (molecular molar ratio of F-actin/GhKCH2-N = 2:1); (c) F-actin in the presence of GhKCH2-N (molecular molar ratio of F-actin/GhKCH2-N = 1:1); and (d) F-actin in the presence of another unrelated His-tag-fused protein MPK4 as a negative control. Scale bar = 10 μm. microtubules formed bundles (Figures 5Bg–5Bi). It seemed that GhKCH2 had a stronger bundling ability to microfilaments than that to microtubules. When 0.1 μM F-actin and 0.1 μM microtubules were mixed, both remained as distinct single filaments that were scattered randomly throughout the suspension (Figure 5Bk). A similar pattern was observed following addition of BSA to the control mixture (Figure 5Bo). After 0.1 μM GhKCH2 was added, however, some of the microtubules and actin filaments began to bundle together (Figure 5Bl). A higher concentration of GhKCH2 (0.25 μM) made more microtubules and F-actin filaments aggregate (Figure 5Bm). When 0.5 μM GhKCH2 was added, most of the two kinds of cytoskeleton filaments co-localized and were incorporated into large aggregated structures (Figure 5Bn). Thus the full-length recombinant GhKCH2 was demonstrated not only to bundle both microfilaments and microtubules, but also to cross-link them efficiently in vitro. (Figure 6Aa). After incubation with oryzalin, the filaments were partly disrupted (Figure 6Ab), whereas in those treated with latrunculin B, the thick filaments of GFP–GhKCH2 (Figure 6Aa) became weaker and slimmer with more diffuse signals appearing in the cytoplasm (Figure 6Ac), suggesting that overexpressed GhKCH2 possesses a certain microtubule-binding ability that was independent of the integrity of actin microfilaments. When both oryzalin and latrunculin B were employed to treat the GFP– GhKCH2-expressed protoplasts for 1 h, the filamentous structures were totally diffuse (Figure 6Ad), suggesting that GhKCH2 bound to both microtubules and microfilaments. To get the direct observation of the co-localization of GhKCH2 with microtubules and microfilaments in transformed protoplasts, microtubules and microfilaments were fluorescently labelled (Figures 6Bb and 6Be respectively). The confocal images showed that some GhKCH2 proteins co-localized with microtubules (Figures 6Ba–6Bc), and some with microfilaments (Figures 6Bd– 6Bf). Thus we concluded that GhKCH2 interacted with both microtubules and microfilaments in living cells. GFP–GhKCH2 binds to both microtubules and microfilaments in Arabidopsis protoplasts Considering that cotton suspension cells are hard to culture and not stable, we used Arabidopsis cells as the overexpression reactor, in order to detect whether GhKCH2 has the ability to interact with microtubules and microfilaments in living plant cells. Confocal microscopy revealed that the GFP-fusion full-length protein GFP– GhKCH2 decorated filamentous structures in the protoplasts c The Authors Journal compilation c 2009 Biochemical Society DISCUSSION In plant cells, many biological processes rely on the co-ordination of microtubules and microfilaments, and the interaction between these two cytoskeleton systems plays an important role in various physiological activities [5]. The mechanism of this interaction, however, remains unclear. Only a few molecular A kinesin interacts with both microtubules and microfilaments Figure 4 177 The N-terminal portion of GhKCH2 contributes to actin binding in Arabidopsis protoplasts (A) GFP-fusion constructs of the truncated variants of GhKCH2. The regions of GhKCH2 used for making GFP fusions are indicated by their amino acid residues. (B) Confocal images showed that in transformed Arabidopsis protoplasts N–GFP exhibited filamentous structures (a), which were able to be disrupted by latrunculin B treatment (c), but not by oryzalin (b). Deletion of the N-terminal portion, N–GFP, resulted in random distribution (d). In the control protoplasts, GFP–AtMAP65–2-labelled microtubule networks (e) were depolymerized by oryzalin (f), but latrunculin B had no effect on them (g), whereas AtFim1-ABD2–GFP-labelled microfilaments (h) were only sensitive to latrunculin B (j), as oryzalin failed to destroy them (i). These controls diplayed the specific depolymerizing abilities of the drugs. (C) The shorter N-terminal portions of GhKCH2 (N240–GFP and N200–GFP) bound to the microfilaments at decreased levels (a and b). N160–GFP (c) and N160–GFP (d) failed to label the filaments. Scale bar = 5 μm. players interacting with both microtubules and microfilaments have been identified in plant cells [5–7]. In the present study, we report that GhKCH2, a cotton kinesin co-localized with both microtubules and microfilaments in cotton fibres, can interact with both of the two cytoskeletal elements, and its N-terminal portion, including a CH domain, plays the key role in its interaction with actin microfilaments. Until now, the actin-binding ability of full-length plant kinesin polypeptides has not been identified in vitro, partially because of the difficulties in obtaining active proteins. In the present study, we tried to express and purify recombinant GhKCH2 from E. coli, but failed to get soluble protein. Next, we employed a eukaryotic expression system, and His-tagged fusion proteins of full-length GhKCH2 were successfully obtained from insect Sf9 cells. c The Authors Journal compilation c 2009 Biochemical Society 178 Figure 5 T. Xu and others GhKCH2 bundles actin filaments as well as microtubules and cross-links them in vitro (A) SDS/PAGE (10 % gel) of GhKCH2 purified via affinity chromatography from transfected insect Sf9 cells (lane 1). Purified GhKCH2 was recognized by the anti-GhKCH2-C antibody in a Western blot (lane 2). The molecular mass in kDa is indicated on the left-hand side. (B) Fluorescence images of F-actin (MF; shown in green) and microtubule (MT; shown in red) in the absence or presence of eukaryotic-expressed GhKCH2. The yellow colour indicates the overlap of green and red signals. BSA was used as a control. Scale bar=5 μm. (a–e) The binding assay of GhKCH2 on microfilaments, showing that GhKCH2 bundled microfilaments. (f–j) The binding assay of GhKCH2 on microtubules, showing that GhKCH2 bundled microtubules. (k–o) The effect of GhKCH2 on the mixture of microfilaments and microtubules, showing that GhKCH2 cross-linked microfilaments and microtubules. In vitro, GhKCH2 protein induced the scattered microfilaments as well as microtubules to aggregate and bundle (Figures 5Bb, 5Bc, 5Bd, 5Bg, 5Bh and 5Bi). When GhKCH2 was incubated with the mixture of microtubules and microfilaments, it even made the two different kinds of filaments couple (Figures 5Bl– 5Bn), revealing that GhKCH2 interacts with both microtubules and microfilaments and possesses a cytoskeleton-cross-linking activity. In the transgenic Arabidopsis protoplasts, the filamentous structures labelled by GFP–GhKCH2 were sensitive to both oryzalin and latrunculin B (Figure 6A), which are specific reagents for depolymerizing microtubules and microfilaments respectively (Figures 4Be–4Bj). Thus the results above demonstrated the dual binding ability of GhKCH2 in living cells. The further direct observation via fluorescent labelling of microtubules and microfilaments in the fixed GFP–GhKCH2-expressed protoplasts gave more data supporting the above conclusion (Figure 6B). The CH domain was first identified at the N-terminus of calponin, an actin-binding protein that plays a major regulatory role in muscle contraction [31]. In many actin-binding proteins the CH domain was found to be involved in actin binding, although it alone was not always sufficient, as other tandem CH domains or other sequences were also required [13,14,32,33]. Kinesins with the CH domain were found only in plants and should play special roles in plant-specific biological processes. Among these CH domain-containing kinesins, only cotton GhKCH1 has been reported to co-localize with microfilaments in cotton fibres [6]. In the present study, using our self-prepared specific antibody, we immunolocalized another CH domain-containing kinesin, GhKCH2, which possesses a cytoskeleton-cross-linking ability in cotton fibres (Figure 2). c The Authors Journal compilation c 2009 Biochemical Society Cotton fibre development is a complicated process that requires participation of both microtubules and microfilaments [16], but how cytoskeletons are organized and work for fibre growth remains elusive. Current evidence reveals that cytoskeleton dynamics, regulated by cytoskeleton-associated proteins, plays a critical role in cotton fibre fast elongation [17–19]. GhKCH2 is highly expressed during cotton fibre elongation [15], and localized along microtubules (Figures 2d–2f) and microfilaments (Figures 2g–2i) in 12 DPA cotton fibres. Thus it is possible that GhKCH2, a kinesin possessing microtubule/microfilamentbinding abilities, plays a role in cotton fibre elongation through cross-linking or reorganizing microtubules and microfilaments. Besides, using an immunolabelling assay, we also found that GhKCH2 mainly localized at the midzone of the phragmoplast in dividing cotton root tip cells (Supplementary Figure S1 at http://www.BiochemJ.org/bj/421/bj4210171add.htm). The phragmoplast is a unique apparatus that forms during cytokinesis in plant cells and occurs with organized microtubules and microfilaments [1,34]. Previous studies have not revealed any motor proteins or integrating factors that interact with both microtubules and microfilaments in the phragmoplast. The cotton GhKCH2, with microtubule-stimulated ATPase activity [15] and a cross-linking ability to microtubules and microfilaments, is more suitable for the function or formation of the dynamic phragmoplast, such as assisting vesicles and cell wall materials to be correctly oriented and accumulated at the midzone of the phragmoplast. The detailed roles of GhKCH2 at the midzone of the phragmoplast of cotton root tip cells, as well as the colocalization with microtubules and microfilaments in cotton fibre cells or concentrated localization in interphase nucleus, need to be further investigated. A kinesin interacts with both microtubules and microfilaments Figure 6 179 GhKCH2 binds to both microtubules and microfilaments in transiently overexpressed Arabidopsis protoplasts (A) In living Arabidopsis protoplasts, GFP–GhKCH2 decorated filamentous structures (a). Specific drug treatment showed that the filaments of GFP–GhKCH2 were disrupted partly by oryzalin (b), and latrunculin B made the strong labelling of GFP–GhKCH2 (arrowhead in a) become weaker and thinner (arrow in c). When oryzalin and latrunculin B were applied concurrently, the filamentous structure was destroyed completely (d). (B) The co-localization of GFP–GhKCH2 and microtubules or microfilaments was revealed by fluorescence labelling of fixed protoplasts. Microtubules were immunofluorescently labelled with anti-α-tubulin antibody and TRITC-conjugated goat anti-mouse IgG (b; red), whereas microfilaments were fluorescently labelled with rhodamine-phalloidin (e; red). The presence of yellow signals in the merged images (c and f) indicates that a few of the GFP–GhKCH2 proteins co-localized with microtubules (c; arrow), whereas most of the GFP–GhKCH2 co-localized with microfilaments (f). Scale bar = 5 μm. AUTHOR CONTRIBUTION Tao Xu performed experiments for the results presented in Figures 1, 3, 5, 6 and Supplementary Figure S1. Zhe Qu performed experiments for the results presented in Figures 2, 4, 5 and 6. Xueyong Yang purified eukaryotic-expressed full-length GhKCH2 protein from Sf9 insect cells which is used in Figure 5. Xinghua Qin helped with the in vivo actin-binding ability analysis of N-terminal truncated proteins. Youqun Wang helped to immunolocalize GhKCH2 in cotton root tip cells. Jiyuan Xiong helped in probing actin and tubulin in cellular fractions of cotton roots. Guoqin Liu and Dongtao Ren supervised the study. ACKNOWLEDGEMENTS We thank Dr Elison B. Blancaflor (Noble Foundation, Ardmore, OK, U.S.A.) for the AtFim1ABD2–GFP plasmid and Dr Ming Yuan (China Agricultural University, Beijing, China) for the GFP–AtMAP65-2 construct. We thank Michael T. Guarnieri for critical reading of this manuscript prior to acceptance. FUNDING This work was supported by the National Natural Science Foundation of China [project numbers 30770128, 30671049, 30721062] and the Doctoral Fund of Ministry of Education of China [grant number 200800190022]. REFERENCES 1 Lloyd, C. W. (1987) The plant cytoskeleton: the impact of fluorescence microscopy. Annu. Rev. Plant Physiol. 38, 119–137 2 Goode, B. L., Drubin, D. G. and Barnes, G. (2000) Functional cooperation between the microtubule and actin cytoskeletons. Curr. Opin. Cell Biol. 12, 63–71 3 Jurgens, G. (2005) Cytokinesis in higher plants. Annu. Rev. Plant Biol. 56, 281–299 4 Gavin, R. H. (1997) Microtubule-microfilament synergy in the cytoskeleton. Int. Rev. Cytol. 173, 207–242 5 Igarashi, H., Orii, H., Mori, H., Shimmen, T. and Sonobe, S. (2000) Isolation of a novel 190 kDa protein from tobacco BY-2 cells: possible involvement in the interaction between actin filaments and microtubules. Plant Cell Physiol. 41, 920–931 6 Preuss, M. L., Kovar, D. R., Lee, Y. R., Staiger, C. J., Delmer, D. P. and Liu, B. (2004) A plant-specific kinesin binds to actin microfilaments and interacts with cortical microtubules in cotton fibers. Plant Physiol. 136, 3945–3955 7 Huang, S., Jin, L., Du, J., Li, H., Zhao, Q., Ou, G., Ao, G. and Yuan, M. (2007) SB401, a pollen-specific protein from Solanum berthaultii, binds to and bundles microtubules and F-actin. Plant J. 51, 406–418 8 Vale, R. D. and Fletterick, R. J. (1997) The design plan of kinesin motors. Annu. Rev. Cell Dev. Biol. 13, 745–777 9 Hirokawa, N. and Takemura, R. (2004) Kinesin superfamily proteins and their various functions and dynamics. Exp. Cell Res. 301, 50–59 10 Kuriyama, R., Gustus, C., Terada, Y., Uetake, Y. and Matuliene, J. (2002) CHO1, a mammalian kinesin-like protein, interacts with F-actin and is involved in the terminal phase of cytokinesis. J. Cell Biol. 156, 783–790 11 Pollard, T. D., Matuliene, J. and Kuriyama, R. (2002) Kinesin-like protein CHO1 is required for the formation of midbody matrix and the completion of cytokinesis in mammalian cells. Mol. Biol. Cell 13, 1832–1845 12 Iwai, S., Ishiji, A., Mabuchi, I. and Sutoh, K. (2004) A novel actin-bundling kinesin-related protein from Dictyostelium discoideum . J. Biol. Chem. 279, 4696–4704 13 Gimona, M., Djinovic-Carugo, K., Kranewitter, W. J. and Winder, S. J. (2002) Functional plasticity of CH domains. FEBS Lett. 513, 98–106 14 Korenbaum, E. and Rivero, F. (2002) Calponin homology domains at a glance. J. Cell Sci. 115, 3543–3545 c The Authors Journal compilation c 2009 Biochemical Society 180 T. Xu and others 15 Xu, T., Sun, X., Jiang, S., Ren, D. and Liu, G. (2007) Cotton GhKCH2, a plant-specific kinesin, is low-affinitive and nucleotide-independent as binding to microtubule. J. Biochem. Mol. Biol. 40, 723–730 16 Seagull, R. W. (1990) The effects of microtubule and microfilament disrupting agents on cytoskeletal arrays and wall deposition in developing cotton fibers. Protoplasma 159, 44–59 17 Wang, H., Yu, Y., Chen, Z. and Xia, G. (2005) Functional characterization of Gossypium hirsutum profilin 1 gene (GhPFN1) in tobacco suspension cells. Planta 222, 594–603 18 Li, X., Fan, X., Wang, X., Cai, L. and Yang, W. (2005) The cotton ACTIN1 gene is functionally expressed in fibers and participates in fiber elongation. Plant Cell 17, 859–887 19 Wang, H., Wang, J., Gao, P., Jiao, G., Zhao, P., Li, Y., Wang, G. and Xia, G. (2009) Down-regulation of GhADF1 gene expression affects cotton fibre properties. Plant Biotechnol. J. 7, 13–23 20 Lu, L., Lee, Y. R., Pan, R., Maloof, J. N. and Liu, B. (2005) An internal motor kinesin is associated with the Golgi apparatus and plays a role in trichome morphogenesis in Arabidopsis . Mol. Biol. Cell 16, 811–823 21 Preuss, M. L., Delmer, D. P. and Liu, B. (2003) The cotton kinesin-like calmodulinbinding protein associates with cortical microtubules in cotton fibers. Plant Physiol. 132, 154–160 22 Beasley, C. A. and Ting, I. P. (1973) The effects of plant growth substances on in vitro fiber development from fertilized cotton ovules. Am. J. Bot. 60, 130–139 23 Sekine, Y., Okada, Y., Noda, Y., Kondo, S., Aizawa, H., Takemura, R. and Hirokawa, N. (1994) A novel microtubule-based motor protein (KIF4) for organelle transports, whose expression is regulated developmentally. J. Biol. Chem. 127, 187–201 Received 7 October 2008/5 May 2009; accepted 6 May 2009 Published as BJ Immediate Publication 6 May 2009, doi:10.1042/BJ20082020 c The Authors Journal compilation c 2009 Biochemical Society 24 Brzeski, J., Podstolski, W., Olczak, K. and Jerzmanowski, A. (1999) Identification and analysis of the Arabidopsis thaliana BSH gene, a member of the SNF5 gene family. Nucleic Acids Res. 27, 2393–2399 25 Turck, F., Zhou, A. and Somssich, I. E. (2004) Stimulus-dependent, promoter-specific binding of transcription factor WRKY1 to its native promoter and the defense-related gene PcPR1-1 in parsley. Plant Cell 16, 2573–2585 26 Pardee, J. D. and Spudich, J. A. (1982) Purification of muscle actin. Methods Cell Biol. 24, 271–289 27 Williams, Jr, R. C. and Lee, J. C. (1982) Preparation of tubulin from brain. Methods Enzymol. 85, 376–385 28 Castoldi, M. and Popov, A. V. (2003) Purification of brain tubulin through two cycles of polymerization/depolymerization in a high-molarity buffer. Protein Exper. Purif. 32, 83–88 29 Hyman, A. A. (1991) Preparation of marked microtubules for the assay of the polarity of microtubule-based motors by fluorescence. J. Cell Sci. (Suppl.) 14, 125–127 30 Sheen, J. (2002) A transient expression assay using Arabidopsis mesophyll protoplasts, http://genetics.mgh.harvard.edu/sheenweb/ 31 Takahashi, K. and Nadal-Ginard, B. (1991) Molecular cloning and sequence analysis of smooth muscle calponin. J. Biol. Chem. 266, 13284–13288 32 Gimona, M. (1998) The single CH domain of calponin is neither sufficient nor necessary for F-actin binding. J. Cell Sci. 111, 1813–1821 33 Stradal, T., Kranewitter, W., Winder, S. J. and Gimona, M. (1998) CH domains revisited. FEBS Lett. 431, 134–137 34 Staehelin, L. A. and Hepler, P. K. (1996) Cytokinesis in higher plants. Cell 84, 821–824 Biochem. J. (2009) 421, 171–180 (Printed in Great Britain) doi:10.1042/BJ20082020 SUPPLEMENTARY ONLINE DATA A cotton kinesin GhKCH2 interacts with both microtubules and microfilaments Tao XU1 , Zhe QU1 , Xueyong YANG, Xinghua QIN, Jiyuan XIONG, Youqun WANG, Dongtao REN2 and Guoqin LIU2 State key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100193, China Immunolocalization in cotton root tip cells Excised cotton root tips were fixed in 4% paraformaldehyde in PEM buffer containing 0.1% Tween-80 for 1 h, rinsed three times with PEM buffer, and then treated with 1% cellulose “Onozuka” R-10 (Yakult Honsha) and 0.5% pectolyase Y-23 (Yakult Honsha) for 15 min. After being rinsed three times (10 min each), cells were released by squashing the root tips between two slides coated with 1 mg/ml poly-L-lysine and then chilled at − 20 ◦C for 30 min. After the uncovered coverslips air-dried, the cells were treated with 1% Triton X-100 for 30 min and then rinsed three times in PEM and PBS buffer. The purified anti-GhKCH2-C antibody and anti-α-tubulin monoclonal antibody were applied for 2 h at room temperature. FITC-conjugated goat anti-rabbit IgG and TRITC-conjugated goat anti-mouse IgG were used as secondary antibodies. In addition, 0.5 μg/ml 4 , 6-diamidino-2-phenylindole (DAPI; Sigma) was added to the Antifade (in PBS) to stain the DNA. Images were acquired with a Confocal Laser Scanning Microscope (Nikon Eclipse TE2000-E). 1 2 Both of these authors contributed equally to the present study. Correspondence may be addressed to either of these authors (email [email protected] or [email protected]). c The Authors Journal compilation c 2009 Biochemical Society T. Xu and others Figure S1 GhKCH2 distributes in a cell cycle-dependent manner in cotton root tip cells Microtubules (red), GhKCH2 (green), and DNA (stained with DAPI; blue) were shown at different cell division stages. During interphase, GhKCH2 mainly localized to the nucleolus, while a small percentage was distributed in the cytoplasm sporadically. When the preprophase band formed, increased punctate GhKCH2 occurred throughout the whole cytoplasm with a disappearance in the nucleus. During metaphase and anaphase, GhKCH2 moved to the central region of the dividing cells. Then from telophase to cytokinesis, it was concentrated at the midzone of the phragmoplast and focused on the cell plate when the cell plate started to form. Finally, as the nuclear material reassembled in daughter cells following cytokinesis, most of GhKCH2 was again localized in the nucleus. Received 7 October 2008/5 May 2009; accepted 6 May 2009 Published as BJ Immediate Publication 6 May 2009, doi:10.1042/BJ20082020 c The Authors Journal compilation c 2009 Biochemical Society
© Copyright 2025 Paperzz