International Immunology, Vbl. 8, No 7, pp. 1099-1111
© 1996 Oxford University Press
Primary porcine endothelial cells express
membrane-bound B7-2 (CD86) and a soluble
factor that co-stimulate cyclosporin
A-resistant and CD28-dependent human
T cell proliferation
Thomas A. Davis12, Nancy Craighead1, Amanda J. Williams1, Andrea Scadron1,
Carl H. June1-2 and Kelvin P. Lee1-2
1
lmmune Cell Biology Program, Naval Medical Research Institute, Bethesda, MD 20889-5067, USA
Uniformed Services University of the Health Sciences, Bethesda, MD 20814-4799, USA
Keywords: immunoprecipitation, mAb, mRNA, soluble activity, T cell activation
Abstract
Increasing evidence suggests that endothelial cells can directly activate syngeneic, allogenelc and
xenogeneic T cells. In this study we demonstrate that unstimulated, paraformaldehyde-flxed
primary porcine aortic endothelial cells (PAEC) and mlcrovascular endothelial cells (PMVEC) can
provide co-stimulation for human T cell IL-2 secretion and proliferation. EC-mediated costimulation has both cyclosporin A (CsA)-sensitive and CsA-reslstant components. The CsAresistant component is completely suppressed either by blocking with antl-CD28 F(ab) fragments
or CTLA-4-lg. Northern blot analysis of unstimulated PAEC and PMVEC with porcine-specific
probes reveals constitutive expression of B7-2 mRNA while B7-1 message was not detected.
hCTLA-4-lg and anti-B7-2 mAb Immunoprecipitates a single 79 kDa PMVEC surface protein.
Surprisingly, PMVEC conditioned media also has soluble co-stimulatory activity that Is blocked by
anti-CD28 F(ab) fragments or anti-B7-2 mAb. These findings demonstrate that primary unstimulated
porcine EC can co-stimulate CsA-resistant human T cell proliferation through binding of membrane
bound, constitutively expressed EC B7-2 (CD86) to human T cell CD28, providing one of the first
demonstrations of functional B7-2 on cells outside the immune system. In addition, PMVEC secrete
or shed a soluble factor that mediates CD28-dependent human T cell proliferation, demonstrating
the existence of soluble mediators of CD28 activation.
Introduction
Interactions between vascular endothelial cells (EC) and T
lymphocytes have been classically thought to subserve T
cell trafficking via specific adhesion cascades (1). However,
growing evidence indicates that EC play a direct role in
T cell activation. EC can mediate superantigen, allo- and
xenogeneic activation of both CD4 + and CD8 + subsets as
well as process and present antigen to HLA DR/DQ restricted
human T cell clones (2-31). Xenogeneic porcine endothelium
can directly activate resting human T cells through swine
MHC class I and II (11,14,15,31), and binding to human CD2
(11,15) and CD28 (15,31). Although the predominant focus
in xenotransplantation has been on hyperacute antibody/
complement-mediated graft rejection, recent studies suggest
an important and complex component of T cell activation and
cell-mediated anti-graft responses (11,13-15,22,32).
The mechanisms by which EC activate T cells are unclear.
EC expression of MHC class I and class II appears to
be required for T cell activation, presumably by delivering
signal 1 (6,8,9,11-15,17-21,24,25,28,29,31,33,34). This is
true even for xenogeneic (porcine EC-human T cell) activation (15,31). Co-stimulation via EC ligand-T cell counter
receptor binding has been reported for LFA-3/CD2
(5,8-11,15,17,28), ICAM-1/LFA-1 (9-11,28), E-selectm (9),
CD44 (28), B7/CD28 (9,15,31,35) and as yet undefined
Correspondence to K P Lee
Transmitting editor. A. Singer
Received 26 January 1996, accepted 28 March 1996
1100
T cell co-stimulation by endothelial B7-2 expression
molecules (5,27). EC expression of B7 and the importance of
CD28 co-stimulation remains largely uncharacterized
(6-10,15,17,20,24,27,31,35,36).
Recent studies have demonstrated a central role of CD28
co-stimulation in T cell-mediated immune responses (37,38).
The hallmark of CD28-mediated activation is the resistance
to immunosuppression by a number of agents, particularly
cyclosporin A (CsA) (39). The natural ligands for CD28 are
members of a gene family collectively referred to as B7 [B7-1
(CD80), B7-2 (CD86) and possibly a third member (37,38)].
B7-1 and -2 are found on activated immune cells, including
B cells, macrophages, dendritic cells, Langerhans cells and
T cells (37,38). Evidence for B7 expression on cells outside
the immune system (keratinocytes, EC) has also been reported
although specific molecules have not been identified (15,40).
In this study we further define the components of xenogeneic EC-mediated T cell co-stimulation. We demonstrate
that unstimulated, fixed primary porcine aortic endothelial
cells (PAEC) and microvascular endothelial cells (PMVEC) can
co-stimulate human T cell proliferation and IL-2 production, a
significant component of which is resistant to CsA. The
CsA-resistant co-stimulation is completely mediated through
binding of human CD28 on the T cell to a membraneassociated porcine B7 family member on the EC. Northern
blot analysis and immunoprecipitation demonstrates that
unstimulated PMVEC constitutively express B7-2 without
evidence for B7-1 expression. Finally, we demonstrate that
soluble CD28-dependent co-stimulatory activity could be
detected in serum-free PMVEC conditioned media (CM),
providing the first example of soluble mediators of CD28
activation.
Methods
Antibodies and reagents
Human CTLA-4-lg (lgG1) and a control fusion protein-lgG1
were prepared as previously described (41) and were kindly
provided by Repligen (Cambridge, MA). The anti-human
CD28 mAb 9.3 (lgG2a) (42) and CD3 mAb G19-4 (lgG1) (39)
were purified from hybridoma culture supernatants. G19-4
was bound to goat anti-mouse Ig-coated magnetic beads
(Dynal, Great Neck, NY) per manufacturer's instructions. 9.3
F(ab) fragments were made using the ImmunoPure Fab
kit (Pierce, Rockford, IL) according to the manufacturer's
instructions. The purity of the F(ab) fragments was verified
on a 12% SDS-PAGE gel under non-reducing conditions.
Anti-CD28 F(ab) preparations were also assessed for their
ability to block anti-CD3-induced proliferation of peripheral
blood mononuclear cells. The anti-human B7-2 mAb HF2.3D1
(lgG2a) was a gift of Dr Gary Gray (Repligen). Antibodies
against swine MHC class I (H58A, lgG2a) and class II (H42A,
lgG2a) were purchased from VMRD (Pullman, WA).
Cell lines and culture
PMVEC and PAEC were isolated, characterized and cultured
as previously described (43,44). These cultures have <2%
contaminating cells (44) and have been tested free of mycoplasma infection. Briefly, PMVEC (passages 22-25) and PAEC
(passages 21-24) cultures were maintained in EC culture
medium (ECCM) (M199 (Gibco, Grand Island, NY), 10%
FCS (Hyclone, Logan, UT), 100 ng/ml L-glutamine, 100 U/ml
penicillin/streptomycin, 50 (ig/ml preservative-free sodium
heparin (Sigma, St Louis, MO), 50 ng/ml EC growth factor
supplement (Sigma) and passaged weekly at 1x10 6 cells
per gelatin-coated 75 cm 2 flask
For the production of PMVEC CM, the cells were grown to
confluence in ECCM, washed twice with PBS and cultured in
Iscoves modified Dulbecco's medium (Gibco, Grand Island,
NY) without serum. After 7 days, CM was harvested, filtered
through a 0.2 ^m membrane and concentrated 70 times by
ultrafiltration using a YM-30 membrane (Amicon, Danavers,
MA) and stored at -20°C until use.
CHO cells stably transfected with the human B7-1 cDNA
(gift of G. Freeman, Dana-Farber) were maintained in DMEM
(Gibco, Grand Island, NY), G418 1 mg/ml (Gibco, Grand
Island, NY), 10% FCS, 100 jig/ml L-glutamine and 100 U/ml
penicillin/streptomycin. Expression of B7-1 was verified by
anti-B7-1 mAb staining and flow cytometnc analysis.
PMVEC CM fractionation by molecular sieve chromatography
Serum-free PMVEC CM was concentrated 70-fold by ultrafiltration using a 30 kDa mol. wt cut-off membrane as above.
Then, 30 ml of 70xPMVEC CM was loaded onto a 5x50 cm
Sephacryl S-200 column and equilibrated with 10 mM Tris0.5 M NaCI (pH 7.2) at a flow rate of 0.6 ml/min. Twenty-five
15 ml fractions were collected, concentrated 10 times using 30
kDa centrifugal concentrators and assayed for co-stimulatory
activity by T cell proliferation ([3H-methyl]thymidine incorporation) in the presence of 5 ng/ml concanavalin A (Con A).
CD28+ T cell purification and proliferation assays
Human peripheral blood leukocytes were obtained by leukapheresis from normal healthy adult donors. CD28 + T cells
were purified using a negative selection method as previously
described (39). PAEC or PMVEC were seeded into 96-well
flat-bottom microtiter plates at a density of 5X10 3 cells/well.
After 72 h of culture, confluent monolayers were washed twice
with PBS and treated with 200 nl/well of 1.6% paraformaldehyde (Electron Microscopy Sciences, Ft Washington, PA)
for 10 min at 22CC. Fixed EC monolayers were washed five
times with 200 ^l of complete culture medium. Purified T cells
were cultured at 5X10 5 cells/well in RPMI 1640 (Gibco)
supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine, 100 U/ml penicillin, 100 ng/ml streptomycin and 20 mM
HEPES, in the absence or presence of fixed EC in 96-well flat
bottom microtiter plates (Costar, Cambridge, MA). Con A
(5 ng/ ml; Calbiochem, La Jolla, CA), G19-4 mAb-coated
beads (3 beads/cell) (45), 9.3 mAb (1.0 ng/ml), HF2.3D1 (30
ng/ml) 9.3 F(ab) fragments (30 ng/ml), hCTLA-lg (30 ng/ml),
control fusion protein-lg (30 ng/ml), CsA (0.1-1.0 jig/ml,
Sandoz, East Hanover, NJ), ionomycin (0.4 ng/ml; Calbiochem) and phorbol myristate acetate (PMA, 1 ng/ml; Sigma)
were added as indicated.
Serum-free PMVEC CM was used at a final dilution of 1:10
In some studies, PMVEC and PAEC were harvested as a
single cell suspension from confluent monolayers with 3 mM
EDTA, fixed with 1.6% paraformaldehyde, washed and used
as stimulator cells.
Cultures were incubated for 5 days at 37CC in a humidified
T cell co-stimulation by endothelial B7-2 expression
5% CO2 in air atmosphere. T cell proliferation was assessed
after the addition of 0.5 nCi/well [3H-methyl]thymidine (New
England Nuclear, Boston, MA) for the final 18 h of culture.
Cells were harvested using a 96-well cell harvester and
[3H-methyl]thymidine incorporation was measured using a
Beta Plate scintillation counting system (Pharmacia/LKB,
Gaithersburg, MD) All determinations were performed in
quadruplicate and the data are expressed as the mean c.p.m.
± SD
1101
and plasmid purification by alkaline lysis (46), clones were
sequenced with T3 and T7 primers using the Sequenase
kit (USB, Cleveland, OH) per manufacturer's instructions.
Sequence was then compared to human B7-1 and B7-2 using
the DNASTAR analysis package (DNASTAR, Madison, Wl).
Northern blot analysis
Confluent monolayers of PMVEC and PAEC in 96-well flatbottom microtiter plates were washed twice with PBS and
then fixed with 200 nl/well of 1.6% paraformaldehyde for 10
min at 22°C. Fixed monolayers were washed five times with
complete culture medium. Purified CD28 + T cells (1X105)
were added to either gelatin-coated flat-bottom 96-well plates
or to fixed EC monolayers G19-4 mAb beads, Con A, 9.3
mAb and PMA were added as indicated. After 24 h of culture,
culture medium was collected from microtiter plates and
either assayed immediately or frozen at -20°C until assayed
for IL-2 production using the Quantikine IL-2 ELISA assay kit
(R&D Systems, Minneapolis, MN). Data are expressed as
pg IL-2/ml per 5X10 5 T cells from the appropriate culture
condition
Porcine lymphocytes were isolated from normal healthy pig
lymph nodes and stimulated in culture with PMA (1 ng/ml) +
ionomycin (0.4 ng/ml) or Con A (10 |ig/ml) for 72 h. RNA from
these cultures and unstimulated PAEC and PMVEC cultures
was extracted with RNAzol (Cinna Biotecs, Friendswood, TX)
as per the manufacturer's instructions. The RNA concentration
of each sample was determined by ethidium bromide visualization and was equalized by serial dilution within each sample
pair (lymph node, EC). Northern blot analysis was then
performed as previously described (46). Briefly, equal
amounts of each RNA sample were separated by electrophoresis through formaldehyde agarose gel and transferred
to a nylon membrane. The blot was then serially probed with
[32P]dCTP-labeled (random hexamer priming) porcine B7-1
and porcine B7-2 DNA fragments and the resulting signal
analyzed on a Phosphonmager 445 (Molecular Dynamics,
Sunnyvale, CA). The blot was then reprobed with a p-actin
cDNA fragment to confirm mRNA equalization and integrity.
Flow cytomethc analysis
Immunoprecipitation
Unstimulated CHO-B7-1, PAEC and PMVEC were harvested
with 3 mM EDTA, washed twice and resuspended in staining
medium (PBS + 5% FCS + 2% BSA + 0.1% sodium azide).
Cells (1X106) cells were stained with 10 |ig of anti-human
B7-1 mAb, H58a (anti-swine MHC class I) or H42a (anti-swine
MHC class II) as indicated. Stained cells were washed twice
and stained with goat anti-mouse IgG FITC (Becton Dickinson,
Immunocytometry Systems, San Jose, CA). Appropriate conjugated isotype-matched antibodies were used as controls,
and 10,000 cells were analyzed on a Coulter XL (Coulter,
Hialeah, FL) flow cytometer through a viable cell gate as
determined by forward and side scatter. The cytometer was
calibrated utilizing manufacturer supplied Autocomp beads
and software. Software used was Coulter XL software supplied
and installed by the manufacturer.
Unstimulated PMVEC were harvested with 3 mM EDTA,
labeled by lactoperoxidase-catalyzed iodination (Lofstrand
Labs, Rockville, MD) and immunoprecipitated as previously
described (47). Briefly, cells were lysed in ice-cold lysis buffer
(50 mM Tris, pH 7.6, 10 mM iodoacetamide, 0.7% Triton
X-100, 0.3M NaCI, 10 ng/ml aprotinin, 10 ng/ml leupeptin,
0.025 mM 4-nitrophenyl-4-guanidinobenzoate hydrochloride,
5 mM EDTA) for 1 h. Detergent-soluble lysates were precleared with Protein G-Sepharose beads (Pharmacia Biotech,
Uppsala, Sweden). Then, 1 x 106 c.p.m./sample was immuneprecipitated with 3 ng of 9.3 mAb (lgG2a), hCTLA-4-lg,
control Ig fusion protein or HF2.3D1 (lgG2a) for 4 h. Beads
were washed and bound protein was eluted by boiling in
sample buffer. Then, 1x10 6 cell equivalents (by c.p.m.) was
loaded into each lane of a 9% reducing SDS-PAGE gel and
the results analyzed on a Phosphoimager 445 as above.
Unknown mol. wt were determined from a relative mobility
versus Iog10[mol. wt] plot of standard mol. wt markers run on
the same gel
IL-2 assay
Porcine B7-1 and B7-2 PCR cloning
Genomic DNA from PMVEC was isolated as previously
described (46). Oligonucleotide primers (DNA International,
Lake Oswego, OR) corresponding to 5' (GGGGGATCCCCAAGGAAGTGAAAGTG) and 3' (CAACACACTCGTATGTGCCCGAATTGCGG) ends of human B7-1 exon 3 and 5'
(CAAGCTTATTTCAATGAG) and 3' (GGGGGATCCCAAGCACTGACAGTTCAGAA) ends of human B7-2 exon 4 were
synthesized (cloning sites are underlined). Porcine genomic
DNA (0.6 ng) was used as a template in a standard polymerase chain reaction with cycle parameters of 92°C for
1 min, 42°C for 1 min, 72°C for 2 min for 35 cycles followed
by a 10 min final extension step. PCR products were digested
with BanrtW (New England Biolabs, Beverly, MA) to cut the
primer cloning site, gel purified and ligated into the BamH\EcoRV sites of Bluescript SK (Stratagene, La Jolla, CA).
Following transformation into Escherichia coli strain JM109
Results
Paraformaldehyde-fixed primary PMVEC and PAEC can costimulate purified human T cells
The mitogenic effect of Con A on murine T lymphocytes is
absolutely dependent on the delivery of a separate costimulatory signal (48,49) that is delivered through CD28
(P. J. Perrin, manuscript submitted). We first examined whether
paraformaldehyde-fixed, unstimulated PAEC and PMVEC
could provide this co-stimulatory signal. Paraformaldehyde
fixation has been used as a means to study EC membraneassociated events and tends to exclude integrin-mediated
1102
A
T cell co-stimulation by endothelial B7-2 expression
6
B
media
conA
PMA+ionomycin
Primary stimulus
101
102
103
10*
10"
10"
5
Paraformakiehyde-fixed cells/10 T cells
Fig. 1. Activation of human T tymphocytes by exogenous mitogen and primary porcine EC. (A) Purified resting human T cells were stimulated
with no mitogen (media), Con A (5 (ig/ml) or PMA (1 ng/ml) + ionomycin (0 4 (ig/ml) (PMA + lonomycin) in the presence of medium alone
(open boxes), paraformaldehyde-fixed PMVEC (shaded boxes) or PAEC (filled boxes) monolayers. T cells were plated at 5X10 5 cells/well and
pulsed with pH-methyl]thymidine 102 h after the initiation of culture and harvested 18 h later All determinations were performed in quadruplicate
and expressed as mean c p m. ± SD. This data is representative of nine independent experiments. (B) Purified resting human T cells were
stimulated with Con A plus increasing numbers of paraformaldehyde-fixed human B7-1-transfected CHO cells (triangles), PMVEC (circles) or
PAEC (squares) Unstimulated CHO-B7-1, PMVEC and PAEC were harvested as a single cell suspension with 3 mM EDTA, washed, fixed with
1 6% paraformaldehyde and added to Con A-activated human T cells at the indicated ratios T cell proliferation was assayed as above. All
determinations were performed in quadruplicate and expressed as mean c p m ± SD
co-stimulation, which is generally paraformaldehyde sensitive
(5,10). As, shown in Fig. 1(A), purified T cells alone respond
minimally to Con A while both PAEC and PMVEC markedly
enhance the proliferate response to Con A. PAEC (but not
PMVEC) induce modest proliferation of purified resting human
T cells in the absence of exogenous mitogen. However,
when T cells are stimulated with optimal amounts of PMA +
lonomycin, the addition of EC does not increase proliferation.
EC augmentation of the Con A response is comparable to
hB7-1 -transfected CHO cells and is dose dependent (Fig. 1B).
The ability of PAEC, but not PMVEC to stimulate human
T cells without exogenous mitogen (Fig. 1 A) led us to examine
their MHC class I and II expression (Fig. 2) Both unstimulated
PAEC and PMVEC constitutively express class I and class II.
PAEC are brighter for both class I (5-fold) and class II
(2.4-fold) compared to PMVEC. This higher expression may
contribute to the differing abilities of PAEC and PMVEC to
deliver a primary mitogenic signal.
PMVEC provide T cell co-stimulation for a number of primary
T cell signals
We next examined the ability of fixed PMVEC to augment
human T cell proliferation in response to different stimuli (Fig.
3). PMVEC clearly enhance the T cell prohferative response
to immobilized anti-CD3 mAb, PMA and Con A, with little
effect on PMA + ionomycin-induced proliferation. Again,
PMVEC alone are unable to activate T cells. PMVEC + antiCD28 mAb 9.3 are also unable to induce T cell proliferation.
Given the expression of MHC class II on PMVEC, this was
unexpected and suggested that PMVEC may act primarily to
deliver a co-stimulatory signal(s).
A central feature of CD28 co-stimulation is the augmentation
of cytokine production, particularly IL-2 and tumor necrosis
factor-a. When purified T cells were stimulated with Con
A, anti-CD3 mAb or PMA there was no detectable IL-2
accumulation (Table 1). In contrast, the addition of fixed
PMVEC to T cells in conjunction with Con A, anti-CD3 mAb
or PMA resulted in high-level IL-2 secretion Consistent with
the above T cell proliferation results, addition of PMVEC alone
or with anti-CD28 mAb alone failed to induce detectable
IL-2 secretion.
Co-stimulation by PMVEC confers resistance to the CsAmediated suppression of both CD4 and CD8 subsets
Given the failure of PMVEC to co-stimulate T cells in conjunction with anti-CD28 mAb, we examined the effect of CsA on
PMVEC-mediated human T cell proliferation. As can be seen
in Fig. 4(A), anti-CD3 mAb or Con A-induced proliferation is
completely suppressed by CsA. Similarly, PMA + ionomycininduced T cell proliferation is completely suppressed by CsA
(not shown). In contrast, PMVEC-mediated co-stimulation
confers partial resistance to CsA. At 0.1 n 9 / m l CsA, 30% of
maximal anti-CD3 + PMVEC-induced and 33% of Con A +
PMVEC-induced proliferation persists. A CsA-resistant plateau was present with PMVEC-mediated co-stimulation even
at the highest CsA dose tested.
Examination of T cell subsets demonstrates that PMVECmediated co-stimulation augments proliferation in both CD4 +
T cell co-stimulation by endothelial B7-2 expression
1103
PMVEC
PAEC
MHCI
MHCII
L o g 1 0 fluoresencc (FTTC)
Fig. 2. Expression of swine MHC class I and II on PMVEC and PAEC. Unstimulated PMVEC and PAEC were harvested as a single cell
suspension with 3 mM EDTA Cells (1X106) were first stained with 10 ng murine lgG2a as a negative control (solid line), anti-SLA I mAb H58A
(dashed line) or anti-SLA II mAb H42A (dashed line) and then stained with FITC-conjugated goat anti-mouse IgG. 10,000 cells were analyzed
in hstmode on a Coulter XL flow cytometer.
and CD8 + populations and confers a similar degree of
resistance to CsA to both subsets (Fig. 4B). These findings
indicate that PMVEC deliver both CsA-sensitive and CsAresistant co-stimulatory signals to both CD4 + and CD8 +
human T cells.
types. Neither 9.3 F(ab) nor hCTLA-4-lg non-specifically
suppressed T cell proliferation when added to T cells already
activated by Con A + anti-CD28 mAb (data not shown).
These findings indicate that the CsA-resistant component of
porcine EC-mediated co-stimulation is CD28 dependent and
involves engagement to B7 molecules.
Blockade of CD28 activation completely abrogates CsAresistant T cell activation by porcine EC
PMVEC and PAEC express B7-2 (CD86)
Human T cell proliferation that is relatively resistant to CsA is
strongly suggestive of CD28-mediated co-stimulation (39).
However, human umbilical vein EC appear to mediate CsAresistant T cell activation through a non-CD28 pathway (27).
To address this possibility, we blocked the CD28 pathway on
both the T cell side with 9.3 F(ab) fragments and the endothelial (and T cell) side with hCTLA-4-lg, which binds both
CD28 ligands B7-1 and B7-2, and examined the effect on
EC-mediated CsA-resistant T cell proliferation (Fig. 5). Like
PMVEC, PAEC co-stimulate CsA-resistant proliferation. Both
9.3 F(ab) and hCTLA-4-lg could completely block the CsAresistant component of proliferation mediated by both EC
The preceding experiments point to the existence of a B7
family member on PAEC and PMVEC. Since no reagents are
currently available that identify specific members of the
porcine B7 family, we used low stringency PCR to clone
coding segments of the porcine B7-1 (equivalent to human
exon 3) and porcine B7-2 (human exon 4 equivalent) genes.
These exons encode the IgV-like domain of both genes (50,51)
and are not known to be alternatively spliced (52-54). The
nucleotide homology between porcine B7-1 and B7-2 and
the corresponding human gene segment is 80 and 82%
respectively (data not shown). These porcine gene segments
were used to probe a Northern blot of activated porcine
1104
T cell co-stimulation by endothelial B7-2 expression
40
media
anti-CD28
anti-CD3
PMA
conA
PMA+ionomycin
Primary stimulus
Fig. 3. The effect of PMVEC-mediated co-stimulation on human T cells activated by different primary stimuli Purified resting human T cells
were stimulated with no mitogen (media), anti-CD28 mAb 9 3 (1 ng/ml), anti-CD3 mAb G19-4-coated magnetic beads (3 beads/cell), PMA
(1 ng/ml), Con A (5 ng/ml) or PMA (1 ng/ml) + ionomycm (0.4 ng/ml) in the presence of medium alone (open boxes) or fixed PMVEC
monolayers (shaded boxes). T cell proliferation was assayed as previously described All determinations were performed in quadruplicate
and expressed as mean c p m ± SD This data is representative of nine independent experiments
Table 1. IL-2 production (pg/ml per 5X10 5 T cells) following
T cell stimulation in the presence or absence of fixed PMVEC
Condition
Media
Media
Anti-CD28 mAb
Con A
Anti-CD3 mAb
PMA
<50
<50
<50
<50
<50
PMVEC
<50
<50
788
811
411
Resting human T cells were treated with media alone (no stimulus),
anti-CD28 mAb 9.3 (1 iigjm\). Con A (5 ng/ml), anti-CD3 mAb G194 (solid phase attached to beads) and PMA (1 ng/ml) in the absence
(media) or presence of parafonmaldehyde-fixed PMVEC monolayers
(PMVEC) After 24 h of culture, supernatants were harvested and
IL-2 production was assayed by ELISA The data is expressed as pg
IL-2/ml per 5x 10s T cells
lymph node cells (as a control) and unstimulated PAEC and
PMVEC (Fig. 6). Both Con A and PMA + ionomycin-activated
lymph node cells express a single pB7-1 mRNA species (~3
kb) and no B7-2 message at 72 h, consistent with previous
reports of distinct temporal human B7-1 and 2 mRNA expression (55-57). In contrast, unstimulated PAEC and PMVEC do
not express pB7-1 message but constitutively express pB7-2
message (three species of ~7, 3 and 1.7 kb).
To confirm the mRNA expression, unstimulated PMVEC
were surface radioiodinated and cell lysates immunoprecipitated with hCTLA-4-lg, a panel of anti-human B7-1 and B7-2
mAb, control Ig (fusion protein control for hCTLA-4-lg) and
9.3 mAb (lgG2a isotype control for anti-B7-1 and -2 mAb).
As can be seen in Fig. 7, hCTLA-4-lg immunoprecipitates a
single broad 79 kDa band which is distinct from the 55 and
83 kDa bands in the control Ig lane. This is consistent with
the 70-80 kDa mol. wt of human B7-2 (58). No evidence for
a 60 kDa protein corresponding to human B7-1 is seen (59).
In addition, the anti-human B7-2 mAb HF2.3D1 immunoprecipitates a single prominent and identically sized 79 kDa
band. None of the other anti-B7-1 or -B7-2 mAb bound PMVEC
surface proteins (data not shown). These findings support
the Northern blot analysis that B7-2, but not B7-1, is expressed
by unstimulated porcine EC.
PMVEC CM contains a soluble factor that co-stimulates T cells
through the CD28 receptor
The above results indicated that PMVEC express B7-2 or a
B7-2-like molecule in the absence of B7-1. Given that we
were unable to demonstrate significant surface expression of
B7-2 by CTLA-4-lg staining of PMVEC (data not shown), we
asked whether the molecule might be predominantly shed or
secreted. We tested size fractionated serum-free PMVEC CM
for the ability to co-stimulate purified human T cells. Shown
in Fig. 8, fraction 29 (and fraction 35 to a lesser extent)
augments Con A-induced T cell proliferation. Fraction 29
corresponds to elution of >200 kDa and fraction 35 to 70-90
kDa proteins when mol. wt standards are run through the
same column. Fraction 29 alone has no mitogenic activity but
substantially augments Con A-induced T cell proliferation
(Table 2). This co-stimulatory activity can be almost entirely
blocked by the anti-human B7-2 mAb H2F.3D1 (91% reduc-
7" cell co-stimulation by endothelial B7-2 expression
0.0
0.1
0.2
0.3
0.4
0.5
06
0.7
0.8
0.9
1105
1.0
Cyclosporin A (ng/mL)
B
30
media
conA
0.1 ug/mL
0.3 ug/mL
0.6 ug/mL
1 ug/mL
cyclosporin A
Culture condition
Fig. 4. Effect of cyclosporin A on PMVEC-mediated co-stimulation of human T cells. (A) Purified resting human T cells were stimulated with
solid phase anti-CD3 mAb alone (circles), anti-CD3 mAb + fixed PMVEC monolayers (squares), Con A alone (triangles) or Con A + fixed
PMVEC monolayers (inverted triangles) in the presence of increasing concentrations of CsA. T cell proliferation was assayed as previously
described. All determinations were performed in quadruplicate and expressed as mean c.p m. ± SD. This data is representative of five
independent experiments. (B) Total T cell (open boxes), purified CD4 + (shaded boxes) and CD8 + (filled boxes) subsets were stimulated with
Con A + fixed PMVEC monolayers in the presence of increasing concentrations of CsA. T cell proliferation was assayed as previously
described. All determinations were performed in quadruplicate and expressed as mean c.p.m. ± SD. This data is representative of two
independent experiments.
1106
T cell co-stimulation by endothelial B7-2 expression
J
T
10 -
I
c
o
s
1
8 -
11
CO
I
g
4 -
Q.
1
2 -
0 -
±
11
6 -
r^n
media
_
, 1 [ 1 rr-
COMA
conA
conA+CTLA4lg
F
conA+9.3Fab
cyclosporin A 0.1 ug/mL
Culture condition
Fig. 5. Effect of anti-CD28 F(ab) and hCTLA-4-lg on PMVEC and PAEC-mediated CsA-resistant human T cell proliferation. Resting human T
cell (media) were stimulated with Con A (5 (ig/ml) in the absence of EC (open boxes), plus fixed PMVEC monolayers (shaded boxes) or plus
fixed PAEC monolayers (filled boxes) with the addition of CsA, hCTLA-4-lg (30 ng/ml) or anti-CD28 F(ab) [mAb 9.3 F(ab) 30 ng/ml] as
indicated. T cell proliferation was assayed as previously described. All determinations were performed in quadruplicate and expressed as
mean c.p.m. ± SD This data is representative of three independent experiments
tion) or by anti-CD28 F(ab) fragments (99%). The concentration of anti-CD28 F(ab) fragments is the same as that required
to block CHO-B7-2-mediated co-stimulation (data not shown).
These data suggest that porcine EC make a soluble CD28
ligand (or ligand complex) that is B7-2 or B7-2-like which can
mediate T cell co-stimulation.
Discussion
We have demonstrated that unstimulated, primary PAEC and
PMVEC can co-stimulate purified resting human T lymphocytes. A component of this co-stimulatory signal mediates
CsA-resistant proliferation in both CD4 + and CD8 + T cell
subsets. This component is entirely dependent on activation
of the T cell CD28 receptor and can be blocked with either
anti-CD28 F(ab) fragments or the B7-binding fusion protein
hCTLA-4-lg. Surprisingly, both mRNA and protein analysis
demonstrate that this porcine B7 family member is constitutively expressed CD86 (B7-2) with no evidence of porcine
CD80 (B7-1) expression. This represents one of the first
reports of functional B7-2 expression on a cell type not
classically thought of as part of the immune system. Moreover,
PMVEC were shown to secrete or shed a soluble factor
that mediates CD28-dependent human T cell proliferation.
Together, these findings delineate two specific CD28-B7-2mediated pathways (membrane-bound and soluble) by which
xenogeneic porcine endothelium may regulate human T cell
activation.
The mechanisms by which EC activate T cells are of great
interest, both from a biological standpoint and as potential
targets for immunosuppression in organ transplantation. Current studies indicate EC MHC expression is important for the
delivery of signal 1 to T cells. Mouse, porcine and human
endothelium express MHC class I constitutively (11,12,15,1821,24,25,28,29,31,33) and class II constitutively (31,60-66)
or inducible with IFN-y (4,6,9,12-22,24,25,28,29,32-34,67)
This expression is required for syn/allo/xenogeneic EC-mediated activation of CD8 + and C D 4 + T cells respectively in
most (6,8,9,11-15,17-21,24,25,28,29,31,33,34), but not all
(14,22,32,67), reports. Likewise, we find unstimulated PAEC
and PMVEC constitutively express both MHC class I and II.
The expression of both is higher on PAEC and may underlie
their ability to induce purified T cell proliferation with no
additional stimuli, in contrast to PMVEC.
Whereas EC delivery of signal 1 seems relatively well
defined, how EC co-stimulate T cells is less clear. Studies on
EC-mediated CD28 co-stimulation have been variable, with
several groups finding no involvement (6-8,10,17,20,27,36)
and others demonstrating a role (9,15,31,35). However, in all
but one of the latter studies specific B7 ligand(s) were not
identified. Seino et al. (35) demonstrated binding of anti-B72 antibodies (but not B7-1) to human umbilical vein and
microvascular endothelium, which is surprising given the
inability of other groups noted above to find CTLA-4-lg
binding proteins on the same cells. Differences of species
(human versus porcine) and vessel derivation (large versus
T cell co-stimulation by endothelial B7-2 expression
1107
I
CO
con
u
w
>
2
CO ^^
pB7-l
;.•
••
3
..?>"-.•••-.
1 1a 1
pB7-2
97kDa
83kDa.
79kDa
69kDa
actin
Fig. 6. Northern blot analysis of porcine B7-1 and B7-2 mRNA
expression. Coding gene segments of porcine B7-1 (pB7-1) and
B7-2 (pB7-2) were generated from porcine genomic DNA by low
stringency PCR using primers derived from the IgV domain of human
B7-1 and B7-2 The nucleotide homology between porcine B7-1 and
B7-2 and the corresponding human gene segment is 80 and 82%
respectively Total mRNA was isolated from porcine lymph node cells
activated with Con A (10 ng/ml) for 72 h (LN ConA), PMA (1 ng/ml)
+ ionomycm (0 4 (ig/ml) for 72 h (LN PMA + iono), unstimulated
PAEC and unstimulated PMVEC Ethidium bromide visualization and
serial dilution were used to equalize mRNA concentration between
lymph node samples and between EC samples. mRNA was separated
on a formaldehyde agarose gel, transferred to a nylon membrane
and serially probed with ^P-labeled pB7-1, pB7-2 and (J-actin (to
demonstrate mRNA integrity) gene fragments. The resulting signals
were analyzed on a Phosphoimager 445
microvascular) between endothelium have been implicated
in some (12,15,31) but not all (9) studies to account for this
variability.
We find that both unstimulated fixed PAEC and PMVEC
provide co-stimulation to human T cells stimulated with a
number of T cell mitogens, particularly Con A. It is unlikely
this is due to contaminating porcine accessory cells because
of the following, (i) The high cell purity (>98% EC by Factor
VIII immunohistochemistry) at passage 10. (ii) Terminally
differentiated antigen-presenting cells such as macrophages
or dendritic cells are unlikely to survive the substantial number
of serial passages these cells have subsequently undergone
f
Fig. 7. Immunoprecipitation of pB7-2 from surface labeled PMVEC.
Unstimulated PMVEC were harvested with 3 mM EDTA and labeled
by lactoperoxidase-catalyzed radioiodmatton. Surface proteins were
immunoprecipitated by lysing cells in ice-cold lysis buffer (50 mM
Tris, pH 7.6, 10 mM iodoacetamide, 0.7% Triton X-100, 0.3M NaCI,
10 ng/ml aprotinin, 10 tig/ml leupeptm, 0.025 mM 4-nitrophenyl-4guanidinobenzoate hydrochloride, 5 mM EDTA) for 1 h Detergentsoluble lysates were precleared with Protein G-Sepharose beads.
Then, 1X10 6 c.p.m./sample was immunoprecipitated with 3 ng of
9.3 mAb (lgG2a), control Ig fusion protein, hCTLA-4-lg or anti-hB72 mAb HF2.3D1 (lgG2a) for 4 h. Beads were washed and bound
protein was eluted by boiling in sample buffer. Then, 1X10 6 cell
equivalents (by c.p.m.) was loaded into each lane of a 9% reducing
SDS-PAGE gel and the results analyzed by phosphoimagery. Mol.
wt are indicated. Unknown mol. wt were determined from a relative
mobility versus log, 0 [mol wt] plot of standard mol. wt markers run
on the same gel
1108
T cell co-stimulation by endothelial B7-2 expression
(>11). It has been shown that three to four serial passages
significantly reduces the immunogenecity of primary human
EC cultures without affecting MHC class l/ll expression (68)
and reduces the number of contaminating CD45 + leukocytes
to <1/10,000 (20). (iii) The failure of PMVEC to induce T cell
proliferation in the absence of a primary mitogen, which would
not be the case if contaminating dendritic cells (for example)
were mediating T cell activation, (iv) Failure to detect B7-1
mRNA or protein, which is co-expressed with B7-2 on activated antigen-presenting cells, (v). The findings of other
groups, using EC from different species, vessel types and
passage, reporting EC-mediated T cell co-stimulation as a
general phenomenon (5,8-10,17,24,26-28) and CD28-mediated co-stimulation (9,15,31,35) as a specific pathway.
30
35
40
45
50
Fraction number
Fig. 8. Co-stimulation of Con A-mediated human T cell proliferation
by serum-free PMVEC CM. PMVEC CM was made by culturing cells
in serum-free Iscove's medium for 7 days. The media was then
harvested, filtered through a 0 2 urn membrane and proteins >30
kDa concentrated 70 times by ultrafiltration The 70xPMVEC CM was
then loaded onto a 5x50 cm Sephacryl S-200 column and equilibrated
with 10 mM Tris-0.5 M NaCI (pH 7 2) at a flow rate of 0 6 ml/mm
Then, 15 ml fractions were collected, concentrated 10 times using
30 kDa centrifugal concentrators and assayed for the ability to costimulate human T cells in the presence of 5 (ig/ml Con A PMVEC
CM fractions were used at a final dilution of 110 of 10 times
concentrate. T cell proliferation was assayed as previously described
The dotted line represents mean c p m of T cells activated with Con
A alone All determinations were performed in quadruplicate and
expressed as mean c p m. ± SD
Table 2. Human T cell proliferation
fractionated PMVEC CM
Primary
stimulus
co-stimulation
co-stimulated by
inhibitor
Tcell
proliferation
(±SD)
Media
Con A
Con A
Con A
Con A
Con A
_
CM fraction
anti-CD28
(mAb 9 3)
CM fraction
CM fraction
CM fraction
_
_
29
29
29
29
_
anti-B7-2 mAb
anti-CD28 F(ab)
128
318
456
52,814
±
±
±
±
37
172
91
6049
9066 ± 627
826 ± 393
59 ± 39
Serum-free media conditioned by PMVEC during 7 days of culture
was filtered (0 2 nM), concentrated 70-fold (proteins >30 kDa through
a YM-30 mol wt cut off membrane) and then fractionated by size
over a Sephacryl-S200 column. Fraction 29 was found to co-stimulate
human T cells activated by Con A (Fig. 8) T cells were then stimulated
with fraction 29 alone (10% final concentration) or in combination
with Con A (5 ng/ml) ± inhibitors of CD28-mediated co-stimulation
[anti-human B7-2 mAb (H2F3D1) (30 ng/ml) or anti-CD28 F(ab)
(30 (ig/ml)]. Responses to media alone and Con A alone were used
as negative controls and to Con A + antt-CD28 mAb as a positive
control. T cell proliferation was assayed as previously described. All
determinations were performed in quadruplicate and expressed as
mean c p.m ± SD These data are representative of two independent
experiments
Co-stimulation of primary T cell mitogens by unstimulated
fixed porcine EC indicates that EC co-stimulatory molecules
are membrane associated and constitutively expressed
PMVEC-mediated T cell co-stimulation has both CsA-resistant
and -sensitive components CsA resistance has also been
reported by Karmann et al. for human EC-mediated costimulation of T cell IL-2 production (27). Unlike these authors
we find the component resistant to CsA is completely dependent on CD28 activation and can be blocked by anti-CD28
F(ab) fragments or hCTLA-4-lg. Differences in CTLA-4-lg
binding to porcine EC versus human EC have been reported
(15) and may underlie differences in the mechanisms of CsAresistance between our findings and those of Karmann et al
For the CsA-sensitive components, the presence of multiple
redundant pathways makes it difficult to assess the actual
contribution of any specific pathway through blocking studies
However, it is very likely that the CsA-sensitive is mediated
by CD2/LFA-3 binding (5,8-11,15,17,28) and CsA-sensitive
components of CD28 activation (39), and potentially others
Previous studies have identified CTLA-4-lg-binding proteins on porcine EC (15,31). Our studies have identified this
molecule as the CD86 (B7-2) receptor. Cloning of the IgV
domains of both porcine B7-1 and -2 genes demonstrates
high nucleotide homology (80 and 82% respectively) to the
corresponding domains in the human genes, consistent with
the ability to bind human CD28 and CTU\-4. Analysis of
mRNA expression reveals that unstimulated PAEC and PMVEC
constitutively express pB7-2 message (7, 3 and 1.7 kb) but
not pB7-1 mRNA Functional expression of B7-2 is supported
by the finding that both hCTLA-4-lg and mAb HF2.3D1
(anti-human B7-2) immunoprecipitate a single membraneassociated protein of 79 kDa from PMVEC. This is similar but
not identical to the mol. wt reported for human B7-2 (70 kDa)
(58), leading to the speculation that alternative splicing or
glycosylation may account for the observed 9 kDa difference.
Our inability to identify CD80 (B7-1) EC expression indicates
that these cells are 'single-positive' CD80~CD86+, and are
thus similar to the phenotype of monocytes (58) and IFN(•y-stimulated mouse dendritic cells (69), and is consistent
with what has been reported for human EC (35). The functional
significance of different forms of co-stimulatory receptor
expression remains to be determined, but may have importance in determining the balance of Th1 and Th2 bias of the
subsequent immune response (reviewed in 70).
Surprisingly, in addition to a membrane-associated B7
activity we find a soluble, CD28-dependent co-stimulatory
T cell co-stimulation by endothelial B7-2 expression
activity present in cell-free, fractionated PMVEC CM. This
activity is predominantly in a high mol. wt fraction (fraction
29, >200 kDa) that was clearly separated from the void
volume and to a lesser extent in a lower mol. wt fraction
(fraction 35, 70-90 kDa). This activity may be acting indirectly
by inducing T cell expression of B7-2. More likely, this activity
may represent shed or soluble forms of B7-2 (fraction 35) or
B7-2 complexes (fraction 29 given the predicted mol/ wt).
Genetically engineered glycolipid-lmked B7-1 is shed and
enhances co-stimulation (71). Naturally soluble forms of B71 and B7-2 have not been described although alternatively
spliced mRNA isoforms of both (all containing the transmembrane domain) have been cloned (52-54). It is tempting
to speculate that this soluble activity either represents a
mechanism to co-stimulate in trans or conversely, a soluble
suppressor of CD28 activation through competition with membrane bound B7-2 and decreased receptor cross-linking.
Further characterization of these possibilities is underway.
The biological relevance of EC expression of co-stimulatory
ligands will likely soon be revealed with the renewed interest in
xenotransplantation. Although antibody-mediated hyperacute
rejection remains the major hurdle, a large number of studies
indicate that T cell-mediated responses may play a significant
role in graft failure (11,13-15,22,32). Our findings add to an
already substantial body of literature suggesting EC directly
mediate this response and may need to be considered in
any immunosuppression strategy Our results also suggest
that immunosuppression with CsA will be only partially
effective and that agents that specifically block CD28 activation may be necessary. Finally, our demonstration that soluble
forms of CD28-mediated co-stimulation exist has potentially
important implications in the regulation of the immune
response that await further characterization of the ligands.
Acknowledgements
This work was supported by the Naval Medical Research and
Development Command, Research Task no. KHX 1436 Views presented in this paper are those of the authors; no endorsement by the
Department of Navy has been given or should be inferred We would
like to thank Drs Peter Pernn and David Harlan for their review and
suggestions
Abbreviations
Con A
CsA
EC
PAEC
PMA
PMVEC
concanavalin A
cyclosporin A
endothelial cell
primary porcine aortic endothelial cells
phorbol myristate acetate
microvascular endothelial cells
References
1 Springer, T A 1993 Signals on endothelium for lymphocyte
recirculation and leukocyte emigration, the area code paradigm.
Harvey Led 8953
2 Hirschberg, H., Braathen, L. R. and Thorsby, E. 1982. Antigen
presentation by vascular endothelial cells and epidermal
Langerhans cells, the role of HLA-DR. Immunol. Rev. 6657.
3 Hughes, C C , Savage, C. O. and Pober, J S 1990. The
endothelial cell as a regulator of T-cell function. Immunol. Rev.
117.85.
1109
4 Baron, C , Palomera, S., Bierre, V., Vbgt, B , Chopin, D. and
Lang, P. 1995. Rat endothelial cells induce selective proliferation of
CD8-positive xenogeneic lymphocytes. Transplant. Proc. 27:2482.
5 Hughes, C. C. and Pober, J. S 1993. Co-stimulation of peripheral
blood T cell activation by human endothelial cells Enhanced IL2 transcription correlates with increased c-fos synthesis and
increased Fos content of AP-1 J. Immunol. 1503148
6 St. Louis, J. D., Lederer, J A and Lichtman, A H. 1993 Costimulator deficient antigen presentation by an endothelial cell
line induces a nonproliferative T cell activation response without
anergy J. Exp. Med 178:1597.
7 Fabry, Z , Sandor, M , Gajewski, T F, Herlem, J A., Waldschmidt,
M M , Lynch, R. G and Hart, M N. 1993. Differential activation
of Th1 and Th2 CD4 + cells by murine brain microvessel endothelial
cells and smooth muscle/pericytes J Immunol. 151.38
8 Epperson, D. E. and Pober, J S 1994. Antigen-presenting
function of human endothelial cells Direct activation of resting
CD8 T cells J. Immunol. 153 5402
9 Krakauer, T 1994. Co-stimulatory receptors for the superantigen
staphylococcal enterotoxin B on human vascular endothelial cells
and T cells J. Leukoc Biol 56:458.
10 Westphal, J R , Willems, H. W, Tax, W J., Koene, R. A., Ruiter,
D. J and de Waal, R. M. 1993 Endothelial cells promote antiCD3-induced T-cell proliferation via cell-cell contact mediated by
LFA-1 and CD2 Scand. J Immunol 38 435.
11 Rollins, S. A., Kennedy, S P, Chodera, A J , Elliott, E. A., Zavoico,
G B and Matis, L A 1994 Evidence that activation of human T
cells by porcine endothelium involves direct recognition of porcine
SLA and co-stimulation by porcine ligands for LFA-1 and CD2
Transplantation 57.1709
12 Lodge, P. A and Haisch, C. E. 1993 T cell subset responses to
allogeneic endothelium. Proliferation of CD8 + but not CD4 +
lymphocytes. Transplantation 56.656.
13 Kirk, A. D , Li, R A., Kinch, M S , Abernethy, K. A., Doyle, C and
Bollmger, R. R. 1993. The human antiporcine cellular repertoire.
In vitro studies of acquired and innate cellular responsiveness
Transplantation 55.924
14 Bravery, C. A , Rose, M L and Yacoub, M H. 1994. Proliferative
responses of highly purified human CD4 + T cells to porcine
endothelial cells. Transplant Proc 26.1157.
15 Murray, A. G., Khodadoust, M. M., Pober, J S and Bothwell, A. L
1994. Porcine aortic endothelial cells activate human T cells:
direct presentation of MHC antigens and co-stimulation by ligands
for human CD2 and CD28. Immunity. 1.57
16 Bosse, D., George, V, Candal, F. J., Lawley, T J and Ades, E W.
1993 Antigen presentation by a continuous human microvascular
endothelial cell line, HMEC-1, to human T cells Pathobiobgy
61.236.
17 Savage, C O., Brooks, C J , Harcourt, G. C , Picard, J. K.,
King, W., Sansom, D M and Willcox, N 1995. Human vascular
endothelial cells process and present autoantigen to human T
cell lines Int. Immunol 7:471
18 Adams, P. W, Lee, H. S., Ferguson, R. M. and Orosz, C G
1994 Alloantigenicity of human endothelial cells. II. Analysis of
interleukin 2 production and proliferation by T cells after contact
with allogeneic endothelia. Transplantation, 57:115.
19 Huang, E. H., Morgan, C. J., Sedmak, D. D., Ferguson, R. M. and
Orosz, C. G. 1994. Alloantigenicity of human endothelial cells.
IV Derivation, characterization, and utilization of gonadal vein
endothelia to control endothelial alloantigenicity during
lymphocyte-endothehal interactions. Transplantation 57:703.
20 Page, C. S , Holloway, N , Smith, H., Yacoub, M. and Rose, M. L.
1994. Alloproliferative responses of purified CD4 + and CD8 + T
cells to endothelial cells in the absence of contaminating
accessory cells. Transplantation 57 1628.
21 Adams, P. W, Lee, H S., Waldman, W. J., Sedmak, D. D. and
Orosz, C. G. 1994. Alloantigenicity of human endothelial cells III.
Quantitated indirect presentation of endothelial alloantigens to
human helper T lymphocytes. Transplantation 58476
22 Vallee, I., Wafer, H, Thibault, G., Salmon, H., Gruel, Y.,
Lebranchu, Y. and Bardos, P. 1995. Evidence of noninvolvement
of swine MHC class II in the in vitro proliferative response of human
lymphocytes to porcine endothelial cells. Transplantation 59:897.
1110
T cell co-stimulation by endothehal B7-2 expression
23 Briscoe, D. M , DesRoches, L. E , Kiely, J M., Lederer, J. A. and
Lichtman, A H 1995 Antigen-dependent activation of T helper
cell subsets by endothelium. Transplantation 59 1638.
24 Murray, A. G., Libby, P. and Pober, J S 1995 Human vascular
smooth muscle cells poorly co-stimulate and actively inhibit
allogeneic CD4 + T cell proliferation in vitro. J Immunol. 154:151
25 Brooks, C. J., Stackpoole, A. and Savage, C 0.1993 Synergistic
interactions of CD4 + and CD8 + T cell subsets with human vascular
endothehal cells in primary proliferative allogeneic responses. Int.
Immunol. 5.1041.
26 Westphal, J R , Tax, W J , Willems, H W, Koene, R. A , Ruiter,
D J. and de Waal, R M. 1992 Accessory function of endothelial
cells in anti-CD3-induced T-cell proliferation synergism with
monocytes Scand. J. Immunol 35449
27 Karmann, K, Pober, J S and Hughes, C C 1994 Endothehal
cell-induced resistance to cyclosporm A in human peripheral
blood T cells requires contact-dependent interactions involving
CD2 but not CD28 J Immunol. 1533929
28 Savage, C. O., Hughes, C C , Mclntyre, B. W., Picard, J. K. and
Pober, J. S. 1993. Human CD4 + T cells proliferate to HLADR + allogeneic vascular endothelium Identification of accessory
interactions Transplantation 56.128.
29 Theobald, V. A , Lauer, J. D , Kaplan, F A., Baker, K. B and
Rosenberg, M. 1993 Neutral allografts—lack of allogeneic
stimulation by cultured human cells expressing MHC class I and
class II antigens Transplantation 55-128
30 Savage, C. O., Hughes, C C , Pepinsky, R. B , Wallner, B. P.,
Freedman.A S and Pober, J.S 1991 Endothelial cell lymphocyte
function-associated antigen-3 and an unidentified ligand act in
concert to provide co-stimulation to human peripheral blood
CD4+ T cells. Cell Immunol. 137 150
31 Bravery, C A , Batten, P, Yacoub, M H and Rose, M L 1995
Direct recognition of SLA- and HLA-like class II antigens on
porcine endothelium by human T cells results in T cell activation
and release of interleukm-2. Transplantation 60.1024
32 vallee, I , Watier, H , Thibault, G , Lalmanach, A C , Lacord, M ,
Gruel, Y, Lebranchu, Y., Salmon, H. and Bardos, P. 1995 Human
TNF-alpha induces major histocompatibility complex class-ll
molecules on porcine endothelial cells without affecting the
proliferative response of human lymphocytes Transplant Proc
27:1678.
33 Adams, P W, Lee, H S , Waldman, W J , Sedmak, D D , Morgan,
C J , Ward, J. S. and Orosz, C. G. 1992. Alloantigenicity of human
endothelial cells 1 Frequency and phenotype of human T helper
lymphocytes that can react to allogeneic endothehal cells
J. Immunol. 148 3753.
34 Uchiyama, T, Araake, M , Yan, X J., Miyanaga, Y and Igarashi, H.
1992. Involvement of HLA class II molecules in acquisition of
staphylococcal enterotoxin A-binding activity and accessory cell
activity in activation of human T cells by related toxins in vascular
endothehal cells. Clin Exp. Immunol. 87:322.
35 Seino, K., Azuma, M , Bashuda, H., Fukao, K , Yagita, H and
Okumura, K 1995. CD86 (B70/B7-2) on endothelial cells costimulates allogeneic CD4 + T cells. Int Immunol 7 1331.
36 Page, C , Thompson, C , Yacoub, M and Rose, M 1994. Human
endothehal stimulation of allogeneic T cells via a CTLA-4
independent pathway. Transplant Immunol 2.342
37 June, C H., Bluestone, J. A., Nadler, L. M and Thompson, C B.
1994. The B7 and CD28 receptor families. Immunol 7bday15.321.
38 Guinan, E. C , Gribben, J. G., Boussiotis, V A, Freeman, G. J
and Nadler, L M. 1994 Pivotal role of the B7.CD28 pathway in
transplantation tolerance and tumor immunity. Blood 84:3261.
39 June, C H , Ledbetter, J. A , Gillespie, M M , Lmdsten, T. and
Thompson, C B. 1987 T-cell proliferation involving the CD28
pathway is associated with cyclosporine-resistant mterleukin 2
gene expression Mol. Cell Biol 7 4472.
40 Harlan, D M., Abe.fl., Lee, K. P. and June, C. H. 1995 Potential
roles of the B7 and CD28 receptor families in autoimmunity and
immune evasion. Clin Immunol. Immunopathol. 75 99.
41 Perrin, P. J , Scott, D., Quigley, L, Albert, P. S, Feder, O , Gray,
G. S , Abe, R., June, C. H and Racke, M. K. 1995 Role of
B7:CD28/CTLA-4 in the induction of chronic relapsing
experimental allergic encephalomyelitis J Immunol. 154:1481.
42 Martin, P J., Ledbetter, J A , Monshita, Y, June, C H., Beatty,
P G and Hansen, J A 1986 A 44 kilodalton cell surface
homodimer regulates mterleukin 2 production by activated human
T lymphocytes. J. Immunol 1363282
43 Davis, T A., Robinson, D. H , Lee, K P and Kessler, S. W 1995
Porcine brain microvascular endothelial cells support the in vitro
expansion of human primitive hematopoietic bone marrow
progenitor cells with a high replating potential requirement for cellto-cell interactions and colony-stimulating factors Blood 85-1751
44 Robinson, D. H., Kang, Y H , Deschner, S H and Nielsen, T B
1990 Morphologic plasticity and periodicity, porcine cerebral
microvascular cells in culture. In Vitro Cell Dev Biol 26'169
45 Levine, B L, Ueda, Y, Craighead, N., Huang, M L and June,
C H 1995 Anti-CD28 antibody and ligands CD80 and CD86
induce long term autocrine growth of CD4 + T cells and induce
similar patterns of cytokine secretion in vitro Int Immunol 7 891
46 Lee, K P, Taylor, C , Petrymak, B., Turka, L. A , June, C H and
Thompson, C B 1990 The genomic organization of the CD28
gene Implications for the regulation of CD28 mRNA expression
and heterogeneity. J. Immunol 145.344
47 Lmdsten, T, Lee, K P, Harris, E S , Petryniak, B., Craighead, N ,
Reynolds, P J , Lombard, D B., Freeman, G J , Nadler, L M ,
Gray, G. S. and June, C. H 1993. Characterization of CTLA-4
structure and expression on human T cells J Immunol 151 3489.
48 Ahmann, G. B., Sachs, D H and Hodes, R J 1978 Requirement
for an la-bearing accessory cell in Con A-induced T cell
proliferation J Immunol 121 1981
49 Weiss, A , Shields, R , Newton, M , Manger, B and Imboden, J.
1987. Ligand-receptor interactions required for commitment to
the activation of the mterleukin 2 gene J Immunol 138 2169
50 Selvakumar, A , Mohanraj, B K , Eddy, R L , Shows, T B ,
White, P C and Dupont, B. 1992. Genomic organization and
chromosomal location of the human gene encoding the Blymphocyte activation antigen B7. Immunogenetics 36 175
51 Jellis, C L , Wang, S S , Rennert, P, Bornello, F, Sharpe, A H.,
Green, N R. and Gray, G. S. 1995. Genomic organization of the
gene coding for the co-stimulatory human B-lymphocyte antigen
B7-2 (CD86). Immunogenetics 42 85
52 Bornelto, F, Freeman, G J., Edelhoff, S , Disteche, C. M., Nadler,
L. M. and Sharpe, A. H 1994 Characterization of the munne
B7-1 genomic locus reveals an additional exon encoding an
alternative cytoplasmic domain and a chromosomal location of
chromosome 16, band B5. J. Immunol. 153 5038.
53 Inobe, M., Linsley, P. S , Ledbetter, J A , Nagai, Y, Tamakoshi, M
and Uede. T. 1994. Identification of an alternatively spliced
form of the murine homologue of B7 Biochem Biophys Res.
Commun. 200.443
54 Bornello, F, Oliveros, J., Freeman, G J., Nadler, L. M and
Sharpe, A. H 1995 Differential expression of alternate mB7-2
transcripts J Immunol. 1555490.
55 Prabhu Das, M R, Zamvil, S S, Borriello, F, Weiner, H L,
Sharpe, A H. and Kuchroo, V K 1995 Reciprocal expression of
co-stimulatory molecules, B7-1 and B7-2, on murine T cells
following activation Eur. J. Immunol 25 207
56 Lenschow, D J., Su, G H , Zuckerman, L. A , Nabavi, N., Jellis,
C. L, Gray, G. S., Miller, J and Bluestone, J A 1993 Expression
and functional significance of an additional ligand for CTLA-4.
Proc Natl Acad. Sci USA 90 11054
57 Stack, R M , Lenschow, D. J., Gray, G. S , Bluestone, J A. and
Fitch, F W 1994. IL-4 treatment of small splenic B cells induces
co-stimulatory molecules B7-1 and B7-2. J Immunol 152.5723.
58 Azuma, M , Ito, D., Yagita, H., Okumura, K., Phillips, J H , Lanier,
L. L and Somoza, C 1993. B70 antigen is a second ligand for
CTLA-4 and CD28. Nature, 366:76.
59 Freeman, G J , Freedman, A S , Segil, J. M , Lee, G , Whitman,
J. F. and Nadler, L. M 1989. B7, a new member of the Ig
superfamily with unique expression on activated and neoplastic
B cells. J Immunol. 1432714.
60 Pescovitz, M. D , Sachs, D. H , Lunney, J K and Hsu, S M.
1984 Localization of class II MHC antigens on porcine renal
vascular endothelium. Transplantation 37:627
61 Pober, J. S, Collins, T., Gimbrone, M. A , Cotran, R S , G'rtlin,
J D., Rers, W., Clayberger, C , Krensky, A. M , Burakoff, S J
T cell co-stimulation by endothelial B7-2 expression
62
63
64
65
66
and Reiss, C S 1983. Lymphocytes recognize human vascular
endothelial and dermal fibroblast la antigens induced by
recombmant immune interferon Nature 305726
Koyama, K., Fukunishi, T, Barcos, M , Tanigaki, N. and
Pressman, D 1979 Human la-like antigens in non-lymphoid
organs Immunology38333.
Natali, P G , De Martino, C , Quaranta, V., Nicotra, M R., Frezza, F.,
Pellegnno, M A and Ferrone, S 1981 Expression of la-like
antigens in normal human nonlymphoid tissues Transplantation
3175
Rose, M L, Coles, M I., Griffin, R J , Pomerance, A and
Yacoub, M H. 1986 Expression of class I and class II major
histocompatibihty antigens in normal and transplanted human
heart Transplantation 41 776.
Fuggle, S. V., McWhinme, D L, Chapman, J. R , Taylor, H M.
and Morris, P J 1986 Sequential analysis of HLA-class II antigen
expression in human renal allografts Induction of tubular class II
antigens
and
correlation
with
clinical
parameters
Transplantation 42.144
Stemhoff, G , Womgeit, K and Pichlmayr, R 1988. Analysis of
67
68
69
70
71
1111
sequential changes in major histocompatibihty complex
expression in human liver grafts after transplantation
Transplantation 45.394.
Vbra, M , Yssel, H , de Vries, J. E. and Karasek, M A. 1994.
Antigen presentation by human dermal microvascular endothelial
cells Immunoregulatory effect of IFN-gamma and IL-10
J Immunol 152 5734.
Desai, J K , Thompson, M. M , Eady, S L , James, R. F. and Bell,
P R 1995 Immunomodulation of cultured vascular endothelial
cells by serial cell passage. Eur J Vase. Endovasc. Surg 10.101
Larsen, C. P., Ritchie, S C , Hendrix, R , Lmsley, P S., Hathcock,
K. S., Hodes, R. J., Lowry, R P. and Pearson, T C. 1994
Regulation of immuno-stimulatory function and co-stimulatory
molecule (B7-1 and B7-2) expression on murine dendritic cells
J Immunol. 152 5208
Thompson, C.B 1995. Distinct roles for the co-stimulatory ligands
B7-1 and B7-2 in T helper cell differentiation' Ce//81 979
McHugh, R. S , Ahmed, S. N , Wang, Y C , Sell, K. W. and
Selvaraj, P 1995 Construction, purification, and functional
incorporation on tumor cells of glycohpid-anchored human B7-1
(CD80). Proc NatlAcad Sci USA 928059