REVIEW ARTICLE
Analysis of antibiotic resistance regions in Gram-negative bacteria
Sally R. Partridge
Centre for Infectious Diseases and Microbiology, The University of Sydney, Westmead Hospital, Sydney, NSW, Australia
Correspondence: Sally Partridge, CIDM,
Level 3, ICPMR Building, Westmead Hospital,
NSW 2145, Australia.
Tel.: 161 2 9845 5246;
fax: 161 2 9891 5317;
e-mail:
[email protected]
Received 31 August 2010; revised 10 March
2011; accepted 5 April 2011.
Final version published online 16 June 2011.
DOI:10.1111/j.1574-6976.2011.00277.x
Editor: Teresa Coque
MICROBIOLOGY REVIEWS
Keywords
insertion sequence; transposon; integron; gene
cassette; homologous recombination;
annotation.
Abstract
Antibiotic resistance in Gram-negative bacteria is often due to the acquisition of
resistance genes from a shared pool. In multiresistant isolates these genes, together
with associated mobile elements, may be found in complex conglomerations on
plasmids or on the chromosome. Analysis of available sequences reveals that these
multiresistance regions (MRR) are modular, mosaic structures composed of
different combinations of components from a limited set arranged in a limited
number of ways. Components common to different MRR provide targets for
homologous recombination, allowing these regions to evolve by combinatorial
evolution, but our understanding of this process is far from complete. Advances in
technology are leading to increasing amounts of sequence data, but currently
available automated annotation methods usually focus on identifying ORFs and
predicting protein function by homology. In MRR, where the genes are often well
characterized, the challenge is to identify precisely which genes are present and to
define the boundaries of complete and fragmented mobile elements. This review
aims to summarize the types of mobile elements involved in multiresistance in
Gram-negative bacteria and their associations with particular resistance genes, to
describe common components of MRR and to illustrate methods for detailed
analysis of these regions.
Introduction
Antibiotic resistance, especially simultaneous resistance to
multiple classes of antibiotics (multiresistance), is an increasing global problem. Gram-negative bacteria, in particular the Enterobacteriaceae, are adapted to exchanging
genetic information and antibiotic resistance in these organisms is often due to the acquisition of genes from a shared
pool (Iredell & Partridge, 2010). Genes in this pool are not
intrinsically mobile and appear to have been captured from
the chromosomes of various species, where they may have
originally had other functions (Martinez et al., 2009). Such
capture involves two different types of mobile genetic
elements: those able to transfer genes between DNA molecules, referred to here as mobile elements, for example
insertion sequences (IS) (Chandler & Mahillon, 2002), gene
cassettes (Partridge et al., 2009), integrons (Cambray et al.,
2010) and transposons (Grinsted et al., 1990; Grindley,
2002), and those able to transfer between cells, for example,
conjugative and mobilizable plasmids (Carattoli, 2009;
Smillie et al., 2010) and integrative conjugative elements
(ICE; Waldor, 2010; Wozniak & Waldor, 2010).
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
The reservoir of potential antibiotic resistance genes
detected in different environments, for example by metagenomic analysis (D’Costa et al., 2006; Sommer et al., 2009),
appears to be extremely large (Martinez et al., 2009).
However, it is not possible to predict which of these genes
will emerge into the pool accessible to potentially pathogenic Gram-negative species (Courvalin, 2005, 2008), which
contains only a limited variety of mobilized resistance genes
(Martı́nez et al., 2007; Martinez et al., 2009). Successful
mobilization of a resistance gene into this pool presumably
requires a combination of events. The relevant mobile
element must have access to the organism that carries the
resistance gene in question, the mobile element must
happen to interact with the gene to allow ‘capture’ (Baquero,
2004) and must be able to transfer the gene to a plasmid or a
similar genetic vehicle that is able to enter the relevant pool.
It seems likely that such successful capture/mobilization
events would be rare and the subsequent acquisition of a
gene from this pool by many different bacteria would be
more efficient than relying on additional capture events.
Mobilized resistance genes identified in Gram-negative
bacteria also vary in their distribution, suggesting that entry
FEMS Microbiol Rev 35 (2011) 820–855
821
Analysis of the antibiotic resistance regions
into the appropriate pool is not always sufficient for a new
gene to become widely established (Shaw et al., 1993; Walsh,
2006; Partridge et al., 2009). Under strong selection, such as
the use of an antibiotic, the first element to enter the pool
that confers an advantage would have the highest chance of
spreading and becoming predominant, but as new genes
enter the pool and selective pressures change, new elements
may take over (Martinez et al., 2009).
Available evidence indicates that in Gram-negative bacteria, particularly the Enterobacteriaceae, the resistance genes
and associated mobile elements carried on plasmids are
often found clustered together in large multiresistance
regions (MRR). Similar conglomerations are also found in
ICE (Wozniak et al., 2009) and various chromosomal
‘resistance islands’, for example SGI1 in Salmonella spp.
(Hall, 2010) and AbaR in Acinetobacter baumannii (Post &
Hall, 2009; Adams et al., 2010). Insertions into a particular
region of a plasmid or a chromosome may disrupt vital
functions, preventing replication or conjugation, for example, or disrupting cell growth or division, and insertions into
the chromosome usually occur at specific sites. Certain hotspots for the integration of different genetic information
have been identified in the Escherichia coli genome (Touchon et al., 2009), SXT elements insert into the prfC gene of
Vibrio cholerae (Hochhut & Waldor, 1999) and SGI variants
insert at the same position between the thdF and yidY genes
in Salmonella (Doublet et al., 2005), Proteus mirabilis (Boyd
et al., 2008) and potentially other bacteria (Doublet et al.,
2007). There is also evidence for the targeted insertion of
transposons into plasmids (Sota et al., 2007).
If a mobile element is inserted into a location where it has
no deleterious effects, either due to such targeting or by
chance, it may then act as a ‘founder element’ (Parks &
Peters, 2007) that provides a target for further insertions
that also do not disrupt vital functions. Such events may be
exceptionally rare ‘one-offs,’ but structures derived from
them may spread widely if they provide a strong selective
advantage. As we only see the ‘tip of the iceberg’ of
structures that are successful in terms of the biased sets of
samples that have been studied, rather than the results
of all possible insertion events, the observed accretion of
mobile elements and associated resistance genes into MRR
makes sense.
Examination of the available sequences of MRR on
plasmids and resistance islands suggests that they are
modular, mosaic structures, consisting of different combinations of highly conserved components from a limited set
(Baquero, 2004). The number of different configurations of
these components is also smaller than would be expected if
they were assembled by random interactions (Baquero,
2004). While some combinations can be explained by the
targeted insertion mentioned above, some elements, including many IS, do not appear to target specific sites. Instead,
FEMS Microbiol Rev 35 (2011) 820–855
common components present in different MRR provide
homologous regions that allow ‘combinatorial evolution’
based on new interactions between existing pieces (O’Brien,
2002; Baquero, 2004; Walsh, 2006). The composition of a
particular MRR will depend on the availability of different
components and some interactions may be more favourable
than others. Combined with selection pressure, this may
result in ‘winner’ combinations that are very common
(Baquero, 2004).
Accretion of resistance genes into MRR means that a
bacterium may be able to rapidly acquire a combination of
resistance genes en bloc and that the biological success of a
resistance gene is dependent on its wider genetic context
(Walsh, 2006). The association of a particular resistance
gene with others may allow co-selection for its maintenance
by several different antibiotics. The insertion of a resistance
gene into an MRR may also enable incorporation into new
mobile entities that may not have some of the limitations of
the original capturing element (O’Brien, 2002). Thus,
although the mechanisms of action of the products of many
resistance genes are well characterized and many of the
associated mobile elements have been studied, our understanding of the complexities of multiresistance is still very
limited (Walsh, 2006). There are clearly rules that govern
how MRR arise, evolve and spread (Baquero, 2004), and
potentially their associations with different types of plasmids, but understanding these rules requires comparison of
many examples.
Until recently, relatively few complete MRR or plasmids
had been sequenced (Frost et al., 2005), but advances in
technology are leading to the availability of increasing
amounts of sequence data. Unfortunately, meaningful comparison of MRR is often hampered by inconsistent annotation and incomplete analysis (Iredell & Partridge, 2010), as
most automated sequence annotation programs focus on
identifying genes and the potential function of their products (or individual domains) by homology to known
examples. This is of limited use in DNA segments relating
to antibiotic resistance in Gram-negative bacteria, where
very similar or even identical genes with known functions
have often already been identified many times. In these
sequences, identifying precisely which genes are present and
their genetic context, i.e. the associated mobile elements and
the boundaries between these elements, is more important.
This type of detailed analysis of all of the components of a
sequenced MRR still usually requires manual input (Frost
et al., 2005) in addition to automated annotations. This
review aims to summarize the characteristics of the most
common components of available MRR and the principles
needed to fully analyse sequences relating to antibiotic
resistance from Gram-negative bacteria and their plasmids,
using examples to illustrate these principles and to demonstrate ways of analysing these complex sequences.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
822
S.R. Partridge
Mobile elements and capture of
resistance genes
length, usually 2–14 bp (Chandler & Mahillon, 2002).
Although classical IS as originally defined do not carry
resistance genes within them, two copies of the same IS (or
two closely related IS) that happen to insert either side of a
gene can capture it as part of a composite transposon that
can move as a unit. IS may also provide complete or partial
promoters that can drive the expression of captured (or
adjacent) genes.
IS related to known families but carrying ‘passenger’
genes are now being identified, blurring the distinction with
transposons, and have been designated tIS (Siguier et al.,
2009). Two other types of IS, ISEcp1-like elements and ISCR,
are unusual in that a single copy of the element is able to
capture and move resistance genes.
The main types of mobile elements currently known to be
involved in the capture and mobilization of antibiotic
resistance genes found in Gram-negative bacteria are certain
IS (Chandler & Mahillon, 2002), gene cassettes/integrons
(Partridge et al., 2009) and transposons of the Tn3 (Grindley, 2002) and Tn5053 families (Rådström et al., 1994;
Kholodii et al., 1995) (Fig. 1). These elements have some
features in common, but capture and/or move genes by
different mechanisms.
‘Classic’ IS and composite transposons
Classic IS are compact mobile elements usually bounded by
short, identical or imperfect inverted repeats (IR). One or
two genes encoding transposase proteins generally cover
almost the entire region between these IR, which are defined
as IRL, at the left end relative to the direction of transcription of the transposition gene(s), and IRR, at the right end.
Recognition of the IR by the transposase protein enables the
movement of the IS to a new location by a ‘cut and paste’
and/or a ‘copy and paste’ process, depending on the
particular IS (Chandler & Mahillon, 2002). Transposition
of most IS generates direct repeats (DR) of a characteristic
Insertion
sequence
IRL
(DR)
ISEcp1 and related elements
ISEcp1 is flanked by 14-bp IR, but appears to move adjacent
regions by failing to recognize IRR and instead using a
weakly related downstream sequence (designated IRalt here)
in combination with IRL (Poirel et al., 2003, 2005a; Lartigue
et al., 2006). DR (5 bp) flanking the entire ‘transposition
unit’, i.e. IRL to IRalt, are created on insertion. Several other
elements (ISEnca1, ISSm2, IS1247) appear to mobilize
adjacent regions, including antibiotic resistance genes, in
the same way as ISEcp1 (van der Ploeg et al., 1995).
IRR
(DR)
tnp
(DR)
tnp
tnp
(DR)
Composite transposon
ISEcp1
IRL
DR
tnp
(5)
IRR
IRalt
DR
(5)
Terminal inverted repeat (IR)
Antibiotic resistance gene
Transposition unit
terIS
ISCR
oriIS
rcr
Gene
cassettes
attC
attC
attI
Integron
Cassette array
intI
Tn3-subgroup
transposon
IRtnp
DR
(5)
Tn21-subgroup
transposon
IRtnp
DR
(5)
Tn5053-family
transposon
IR
DR
(5)
tnpA
tnpR
IR
DR
(5)
res
tnpA
tniR
intI1/attI1
or mer
tnpR
mer or
res
tniQ
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
IR
DR
(5)
res
tniB
tniA
IRt
DR
(5)
Fig. 1. Summary of the characteristics of mobile
elements involved in the capture and mobilization
of antibiotic resistance genes in Gram-negative
bacteria. tnp, tni, transposition functions; IRL and
IRR, left and right inverted repeats; IRalt, alternative IR; rcr, rolling circle replicase; oriIS, origin of
ISCR elements; terIS, terminus of ISCR elements;
res, res site. Elements that create DR are indicated
and the DR length given, except for IS, where
the DR length varies for different elements.
Tn21-subfamily transposons may carry resistance
genes as part of class 1 integrons inserted in or
near the res site.
FEMS Microbiol Rev 35 (2011) 820–855
823
Analysis of the antibiotic resistance regions
ISCR elements
ISCR elements are similar to a distinctive family of IS that
includes IS91, IS801 and IS1294, which move by rolling circle
replication (Garcillán-Barcia et al., 2002). ISCR appear to
move in the same way (Toleman et al., 2006a, b) and the name
rcr (for rolling circle replicase) has been suggested for their
‘transposases’ (Levings et al., 2008). ISCR elements are
bounded by an origin (oriIS) downstream of this gene and a
terminus (terIS) upstream, rather than IR, and do not create
DR. Like IS91 (Garcillán-Barcia et al., 2002) and IS1294
(Tavakoli et al., 2000), ISCR elements appear to mobilize
genes by failing to recognize terIS and continuing replication
into the adjacent sequence (Toleman et al., 2006a, b).
Gene cassettes and integrons
Gene cassettes are the smallest mobile elements associated
with antibiotic resistance and each consists of a gene, often
preceded by a ribosome-binding site, but usually not a
promoter, and an attC recombination site (or 59-base
element). The attC sites of different cassettes vary in length
and sequence, but include conserved regions at their ends.
Gene cassettes can transiently exist as circular molecules
(Collis & Hall, 1992), but do not encode the mechanism for
their own movement and are usually found inserted into
integrons (In; Stokes & Hall, 1989) or, rarely, at secondary
sites (Francia et al., 1993; Recchia et al., 1994).
The minimum components of an integron are an intI
gene and an attI recombination site, plus a Pc promoter. The
intI gene encodes an IntI integrase that catalyses site-specific
recombination between the attI1 site and the attC site of the
gene cassette (or between two attC sites) to insert or release
cassettes (Collis et al., 1993). Several cassettes may be
inserted in tandem into the same integron to create a
cassette array, with the expression of cassette-borne genes
driven by Pc. Integrons have been divided into classes on the
basis of their IntI sequences and chromosomal integrons
with arrays of tens to hundreds of cassettes, usually with
related attC sites, are found in some species. Chromosomal
integrons collectively provide a reservoir of cassettes that can
be acquired by mobile or potentially mobile integrons associated with antibiotic resistance (Rowe-Magnus et al., 2001).
The latter contain fewer cassettes, often with quite different
attC sites, with class 1 integrons being the most common in
available MRR. The mechanism by which genes acquire attC
sites remains unknown, although generation from mRNA
(Recchia & Hall, 1997) and the involvement of group IIC-attC
introns (Léon & Roy, 2009) have been suggested.
Unit transposons -- the Tn3 family
Unit or complex transposons (Tn) as originally defined are
larger than IS and carry antibiotic resistance and/or other
FEMS Microbiol Rev 35 (2011) 820–855
genes in addition to genes encoding transposition functions.
The Tn3 transposon family (Grindley, 2002) includes two
subgroups: Tn3-like and Tn21-like transposons. Both types
are bounded by 38-bp IR and include a transposase gene
(tnpA), a resolvase gene (tnpR) and a resolution site (res).
These transposons move by a replicative process that
involves the recognition of the IR by TnpA and the generation of a cointegrate intermediate consisting of the donor
and the recipient molecules separated by two copies of the
transposon. The cointegrate is resolved by TnpR-mediated
site-specific recombination between directly oriented res
sites and transposition creates 5-bp DR (Grindley, 2002).
The two subgroups are distinguished by differences in
both sequence and organization. In members of the Tn3-like
subgroup, res lies between tnpA and tnpR, which face in
opposite directions (Grindley, 2002). In transposons of the
Tn21-like subgroup (Grinsted et al., 1990) tnpA and tnpR
are in the same orientation, with res near the start of tnpR. In
Tn3-like and some Tn21-like transposons resistance gene(s)
lie beyond tnpR, but the means by which they were captured
is not known. Many Tn21-like transposons include a
mercury resistance (mer) operon beyond the res site and
the resistance gene(s) are carried as part class 1 integrons
inserted in or near the res site. Related structures including
only tnpR and tnpA genes (e.g. Tn5403) are still defined as
transposons (Grindley, 2002).
Unit transposons -- the Tn5053 family
Some members of the Tn5053 family of transposons are
important in the spread of antibiotic resistance. Transposons of this family have three transposase genes, called
tniA, tniB and tniQ (or tniD) separated from a resolvase
gene tniR (or tniC) by a res site, and are flanked by 25-bp IR
(Rådström et al., 1994; Kholodii et al., 1995). These transposons move in a manner similar to members of the Tn3family, with TniA, TniB and TniQ mediating the formation
of a cointegrate, which is resolved by recombination at the
res site catalysed by TniR, and they also generate 5-bp DR on
transposition (Kholodii et al., 1995; Kamali-Moghaddam &
Sundström, 2000). Tn5053-family transposons target the res
sites of Tn21-subgroup transposons and related partitioning
(par) regions in plasmids (Minakhina et al., 1999; KamaliMoghaddam & Sundström, 2000; Petrovski & Stanisich,
2010) and they may carry class 1 integrons or mercury
resistance operons (Kholodii et al., 1995).
Associations between particular resistance
genes and particular mobile elements
Many different genes conferring resistance to a particular
antibiotic or class/group of antibiotics have been (and
continue to be) identified in Gram-negative bacteria. However, examination of the available sequences that include
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
824
context information as well as the resistance gene suggests
that, as might be expected from the considerations outlined
in the Introduction, each particular resistance gene is
generally immediately associated with the same mobile
element (Table 1). In some cases, the source of a captured
resistance gene can be identified, when the same (or a very
closely related) DNA segment is found both associated with
a mobile element on a plasmid and without the mobile
element on the chromosome of certain species (Table 2). For
example, plasmid-borne ampC genes are derived from the
chromosomal ampC genes of various Enterobacteriaceae and
ancestors of most of the blaCTX-M groups of b-lactamases
have been identified on the chromosomes of different
Kluyvera species (Table 2). Capture of the blaCTX-M-2 gene
from the Kluyvera ascorbata chromosome by ISEcp1 and
transfer to a plasmid has also been demonstrated (Lartigue
et al., 2006). In other cases, the source of the gene remains
unknown, even if an associated mobile element has been
identified, for example blaTEM genes associated with Tn3like transposons.
The same mobile element (or type of mobile element)
may be associated with genes conferring resistance to
different classes of antibiotics and genes conferring similar
resistance phenotypes may be associated with quite different
mobile elements (Table 1), but all types of mobile elements
are not associated with all types of resistance genes. For
example, no plasmid-mediated ampC genes (Class C in
Table 1), which originate from Enterobacteriaceae, have been
found in gene cassettes, which may be generated in ‘environmental’ species. Conversely, in Gram-negative bacteria,
most of the genes encoding aminoglycoside-modifying enzymes, the exact sources of which are unknown, are found in
gene cassettes. This may reflect the limited possibilities for
interaction between mobile elements and genes originating
from species that are not normally found together.
At least one gene, blaCTX-M-14a, does appear to have been
captured in two separate events: either by ISEcp1 or by
ISCR1 (Valverde et al., 2009). In other cases, different
extents of the source chromosome have apparently been
captured by the same mobile element. For example, blaSHV
genes are found in two different composite transposons,
both flanked by IS26, apparently due to separate mobilizations of chromosomal regions of Klebsiella pneumoniae of
different lengths giving rise to two different lineages of genes
(Ford & Avison, 2004). Available sequences also include
examples of minor gene variants associated with different
mobile elements. For example, genes designated catA2
(formerly catII) are apparently found associated with ISCR1
or as part of an IS26-mediated composite transposon.
Closer examination indicates that these genes and flanking
regions are only 96% identical and could have been captured
from slightly different sources. These genes are designated
catA2a (ISCR1-associated) and catA2b (IS26-associated)
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S.R. Partridge
here. Similarly, the catA1 genes and flanking regions associated with IS1 (catA1a here) and with IS26 (catA1b, also
known as pp-cat) are about 98% identical.
In other cases where the same resistance gene is apparently closely associated with different mobile elements,
detailed examination reveals a more complex picture. In
one sequence where blaCTX-M-14a is apparently associated
with ISCR1 (EU056266) (Bae et al., 2008), the IRR end of
ISEcp1 is present between ISCR1 and blaCTX-M-14a, suggesting initial capture by ISEcp1. Another example is provided
by the blaVEB-1 gene, first identified as part of a gene cassette
in an array in a class 1 integron (Poirel et al., 1999). blaVEB-1
and minor variants have since been found in contexts other
than cassette arrays, associated with ISCR1 (Naas et al.,
2006), ISCR2 (Poirel et al., 2009) or a 135-bp repeated
element (Re; see Zong et al., 2009 and references therein).
Examination of the sequences surrounding blaVEB indicates
that it is still part of the same gene cassette, i.e. associated
with the expected attC site, although the cassette is missing
the first 7 bp in some contexts.
If a resistance gene was first captured some time ago, it
may no longer be possible to identify exactly which element
was responsible. For example, minor variants of the aphA1
gene have been found in at least two different composite
transposons flanked by IS26, Tn4352 (Wrighton & Strike,
1987) and Tn6020 (Post & Hall, 2009), Tn903 flanked by
IS903 (Oka et al., 1981) and Tn2680, flanked by IS26, but
also carrying IS903 (Mollet et al., 1985a). The region
common to these structures extends beyond the aphA1 gene
itself but, as the chromosomal source is not known, it is
more difficult to identify the region that was initially
captured and the element responsible.
Recombination is important in the
assembly and evolution of resistance
regions
Individual mobile elements and specific gene capture processes may be crucial in the entry of genes into the mobile
pool, but repeated identification of the same assemblies of a
few components, with the same boundaries between them,
in different contexts suggests that recombination between
common components also plays a large role in the assembly
and evolution of MRR. In addition to homologous recombination, which can occur between essentially any closely
related sequences, some MRR also show evidence of resolvase-mediated site-specific recombination in the res sites of
Tn3-family and Tn5053-family transposons.
Homologous recombination
Homologous recombination requires breaking and joining
of DNA strands and its likelihood is dependent on the length
FEMS Microbiol Rev 35 (2011) 820–855
FEMS Microbiol Rev 35 (2011) 820–855
c
tetA(B)
tetA(C)
tetA(D)
catA1a
catA2b
blaOXA-23
blaOXA-48
blaCMY-13
blaSHV
aphA1a,b
aphA1
npmA
R gene
1247
Ecp1
Ecp1
Ecp1
Ecp1
Ecp1
Ecp1
Enca1
1247
Sm2
IS
z
arr6z
qnrB19
blaACC-1
blaCMY-2
blaCTX-M-14‰
blaCTX-M-15
rmtC
aph(200 )-e
aac(3)-IIf
aac(3)-IIb
R gene
ISEcp1-like
3
14
3
1
3
2
1
14
1
1
20
4
15
1
1
8
5
19
1
1
3
2
1
2
6
16
IS
ere(B)
erm(B)
floR
catA2a
tetA(G)
tetA(31)
armA
rmtD
blaCTX-M-2
blaCTX-M-9, 14‰
blaTLA-1
blaSPM-1
blaAIM-1
blaCMY-1
blaDHA-1
blaMIR-1
blaOXA-45
blaOXA-18
qnrA
qnrB2, 4
qepA
sul2
dfrA10,19,23
dfrA9,18,20
ant(4 0 )-IIb
aac(3)-VIa
R gene
ISCR elements
cmlA1,2,8
arr2,4,5
lnu(F)1,2z
ere(A)1,2
catB2,3,5
dfrB1-8
dfrA1,12,17
qnrVC1
aacA4cr
blaOXA-2, 10, 30
blaPSE-1
blaVEB
blaGES
blaIMP
blaVIM
aacA1,4,7
aacC1
aadA1,2,5
aadB
aphA15
Gene cassettesw
z
More extensive lists can be found in Partridge et al. (2009) and at http://www2.chi.unsw.edu.au/rac
The names aac(3)-IIf and arr6 have been proposed here, while lnu(F)1 and lnu(F)2 correspond to genes originally called linF and linG, respectively.
‰
Both the blaCTX-M-14a and blaCTX-M-14b variants have now been found to be associated with either ISEcp1 or ISCR1 (Valverde et al., 2009).
w
Details and more examples can be found in Toleman et al. (2006b) and at http://medicine.cf.ac.uk/en/research/research-groups/i3/research/antibacterial-agents/iscr-elements/
Efflux
ADP-ribosyl transferase
Nucleotidyltransferase
Erythromycin esterase
23S rRNA methylase
Acetyltransferase
Chloramphenicol
Rifampicin
Macrolides, lincosamides and streptogramins
DHFR type B
Efflux
10
26
26
1
26
Aba1
1999
Class D
Pentapeptide protein
Acetyltransferase
Efflux
Dihydropteroate synthase
DHFR type A
26
26
26
903
26
IS
Class C
Class B
Class A
16S rRNA methylase
Phosphotransferase
Tetracycline
Sulphonamides
Trimethoprim
Quinolones (low level)
b-lactams
Acetyltransferase
Aminoglycosides
Adenylyltransferase
Mechanism
Resistance to
Composite Tn
Table 1. Examples of observed associations between antibiotic resistance genes and mobile elements
1721
1,2,3
4401
5393
Tn
tetA(A)
blaTEM
blaKPC
strAB
R gene(s)
Tn3-like Tn
Analysis of the antibiotic resistance regions
825
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
826
S.R. Partridge
Table 2. Examples of sources of antibiotic resistance genes
Gene
Source
Reference
blaSHV
blaOXA-48
blaDHA-1
blaCMY-2-like
blaACC-1
blaACT-1
blaFOX
blaCTX-M-3
blaCTX-M-5
blaCTX-M-8 group
blaCTX-M-14
blaCTX-M-25 group
qnrA
qnrS
Klebsiella pneumoniae
Shewanella spp.
Morganella morganii
Citrobacter freundii
Hafnia alvei
Enterobacter asburiae
Aeromonas caviae
Kluyvera ascorbata
Kluyvera ascorbata
Kluyvera georgiana
Kluyvera georgiana
Kluyvera georgiana
Shewanella algae
Vibrio splendidus
Ford & Avison (2004)
Aubert et al. (2006)
Verdet et al. (2000)
Barlow & Hall (2002)
Nadjar et al. (2000)
Rottman et al. (2002)
Fosse et al. (2003)
Rodrı́guez et al. (2004)
Humeniuk et al. (2002)
Poirel et al. (2002)
Olson et al. (2005)
Rodrı́guez et al. (2010)
Poirel et al. (2005b)
Cattoir et al. (2007)
of the homologous region as well as the degree of relatedness. The complexities of recombination mechanisms will
not be discussed here (reviewed by Clark & Sandler, 1994);
rather, some of the potential consequences of this process
will be described, as an aid to analysing MRR.
Recombination can occur between regions in the same
DNA molecule or on different DNA molecules in the same
cell. Recombination between two inversely oriented copies
of the same element on the same DNA molecule will result
in inversion of the segment between them (Fig. 2a). If the
repeated element is an IS or transposon that creates DR,
then examination of adjacent sequences may provide evidence of inversion (Fig. 2a). Recombination between two
directly oriented copies of a duplicated element in the same
DNA molecule will release a circular molecule, which carries
one copy of the element and the region that lay between the
elements, and leave a single copy of the element (Fig. 2b).
Such circles may potentially reinsert at a different location
by recombination with another copy of the same element, or
with a sequence that matches any part of the circle.
Recombination between copies of the same element on
different DNA molecules (e.g. two plasmids) may result in
the fusion of these molecules (Fig. 2c). ‘Double crossover’
between each of two pairs of repeated elements flanking
different DNA segments can result in exchange of these
segments between the two locations (Fig. 2d). Recombination can also occur between elements that are closely related
rather than identical, forming hybrids that may be apparent
from an unequal distribution of nucleotide differences in
sequence alignments.
Site-specific recombination in res sites of
Tn3 -like and Tn5053 -like transposons
In Tn3 family and Tn5053 family transposons, resolvasemediated site-specific recombination between res sites is
required to resolve the cointegrate intermediates of transpo2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
(a)
(b)
+
(c)
(d)
Fig. 2. Common outcomes of homologous recombination. Identical (or
closely related) DNA segments are represented by the same shape
coloured blue or red. Horizontal arrows represent genes and recombination is indicated by a cross. (a) A single recombination between homologous regions in opposite orientations in the same DNA molecule will
invert the intervening structure. The filled circles flanking the blue
element represent DR. Recombination reverses the direction of the right
end of this element, so that the adjacent sequence (shown as an open
circle) is the reverse complement of the original DR sequence. (b) A single
recombination between homologous regions in the same orientation in
the same DNA molecule will excise a circle, consisting of one copy of the
repeated element and the region originally found between the repeats,
and leave a single copy of the repeated element in the original location.
The reverse process may occur to reinsert the circular molecule at a new
location with homology to any part of the circle. (c) A single crossover
between the same element on each of two circular molecules will result
in a fused molecule. (d) Two recombination events (double crossover)
between pairs of homologous regions flanking different DNA segments
will result in the exchange of these segments.
sition (Grindley, 2002). The res sites of Tn3-like transposons
contain three subsites (resI, resII and resIII) (Rogowsky &
Schmitt, 1984), with recombination occurring at a specific
AT dinucleotide in resI in res sites that are aligned in the
same orientation (Grindley, 2002). The res sites of Tn5053family transposons include six IRs (r1-r6), with recombination taking place between r1 and r2 (Kholodii et al., 1995).
Recombination between the res sites of related, but
different, Tn3 family (e.g. Partridge & Hall, 2004, 2005) or
Tn5053 family (e.g. Mindlin et al., 2001; Labbate et al., 2008;
Petrovski & Stanisich, 2010) transposons can also contribute
to the evolution of MRR and exchange of components. If
adjacent parts of a sequenced region are found to match two
different transposons, then determining whether the boundary between the two matching regions is close to resI could
indicate whether res-mediated recombination has taken
place. Simple diagrams showing the sequences of the res
sites of various Tn3-like and Tn5053-family transposons can
FEMS Microbiol Rev 35 (2011) 820–855
827
Analysis of the antibiotic resistance regions
be found in a number of references (e.g. Partridge & Hall,
2004, 2005; Labbate et al., 2008) and related sites in other
similar transposons can be identified from these.
alone or as part of a derivative of Tn9, which consists of two
directly oriented copies of IS1 flanking a region that includes
the catA1a gene (Fig. 3d), in MRR.
Characteristics of common MRR
components and modules
IS10 and Tn10
The following sections provide details about some of the
most common components and combinations of these
components in currently available MRR, mainly focusing
on the Enterobacteriaceae. It is not possible to describe all
known components and some not listed here may be more
frequently identified in the future, but similar principles
would be expected to apply to identifying these elements
and analysing sequences that contain them.
IS10 is 1329 bp in length, has 22-bp IR (Table 3), transposes
by a ‘cut and paste’ mechanism that creates 9-bp DR and
shows some target site specificity (Chandler & Mahillon,
2002). IS10 is commonly found as part of the composite
transposon Tn10 (Lawley et al., 2000) that carries tetA(B)
encoding a tetracycline efflux protein, tetR(B) encoding a
tetracycline repressor protein, the tetC transcriptional regulator gene, tetD and several other genes (Fig. 3b).
ISAba1
IS26
IS26 is very common in MRR, with 4 10 copies present in
some plasmids. This 820-bp element has a single reading
frame encoding the transposase, perfect 14-bp IR (Table 3)
and generates 8-bp DR. IS26 creates replicon fusions (cointegrates), suggesting that transposition is accompanied by
replication and that homologous recombination is necessary
to resolve the cointegrates (Chandler & Mahillon, 2002). A
number of IS later found to be identical or closely related to
IS26 were originally given different names (e.g. IS6, IS15D,
IS46, IS140, IS160, IS176). IS15 corresponds to one copy of
IS26 inserted inside another (Labigne-Roussel & Courvalin,
1983) and a remnant of this structure, consisting of adjacent
complete and partial copies of IS26, is found in Tn6020 in an
AbaR (Post & Hall, 2009). Examples of different fragments
of IS26 adjacent to a complete copy are also found in
available sequences.
IS26 is the flanking element in a number of different
composite transposons that each carry a single antibiotic
resistance gene (Table 1; Fig. 3). These are found inserted
directly into some plasmid backbones and also as part of
larger MRR, but IS26 can cause adjacent deletions (Mollet
et al., 1985b), removing the evidence of insertion provided
by DR.
IS1 and Tn9
IS1 was one of the first IS to be identified in bacteria and is
one of the smallest at 768 bp. IS1 has 23-bp IR (Table 3) and
usually creates DR of 9 bp, but 8, 10 and 14-bp DR have also
been observed (Chandler & Mahillon, 2002). IS1 includes
two overlapping ORFs, known as insA and insB, which are
fused by translational frameshifting to produce the functional transposase. IS1 generates both simple insertions and
cointegrates and, like IS26, can cause adjacent deletions
(Turlan & Chandler, 1995). In plasmids and other sequences
relating to antibiotic resistance, IS1 is most often found
FEMS Microbiol Rev 35 (2011) 820–855
ISAba1 was first identified in A. baumannii (Corvec et al.,
2003) and initially appeared to be restricted to this species
(Segal et al., 2005). This IS is 1180 bp in length, has 16-bp IR
(Table 3) and creates 9-bp DR. In addition to forming a
composite transposon (Tn2006) carrying the blaOXA-23 gene
(Corvec et al., 2007), the insertion of ISAba1 upstream of A.
baumannii chromosomal ampC genes (blaADC), blaOXA-51like genes and blaOXA-58-like genes provides a promoter that
enhances their expression (Corvec et al., 2003; Poirel &
Nordmann, 2006; Turton et al., 2006).
ISEcp1 and related elements
ISEcp1 (also called ISEc9), first identified in E. coli in about
1999 (AJ242809), is a member of the IS1380 family. ISEcp1 is
1656 bp in length and is flanked by 14-bp IR (Table 3). As
stated above, ISEcp1 uses IRL in combination with IRalt
sequences to move adjacent genes, inserting a ‘transposition
unit’ at new locations, flanked by 5-bp DR. The availability
of matching chromosomal regions including some captured
genes (e.g. Fig. 4a) indicates that different-sized transposition units may be moved following the insertion of ISEcp1
adjacent to a gene (Fig. 4b). In other cases, additional
segments adjacent to insertion of the first transposition unit
may be picked up in subsequent transposition events (Fig.
4c). This process is also evident from transposition experiments using cloned ISEcp1-resistance gene combinations,
where adjacent vector sequence may also be captured and
moved (Poirel et al., 2005a; Wachino et al., 2006). ISEcp1
therefore has the potential to mobilize regions that include
more than one resistance gene.
As IRalt do not fit an easily defined consensus (Lartigue
et al., 2006), different methods may be needed to identify the
end of the transposition unit distal to IRL. If the ancestral
resistance gene has been identified in a chromosomal
sequence, it may be possible to identify (or confirm) the
end of the transposition unit from the boundary of
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
828
S.R. Partridge
Table 3. Sequences defining the ends of common mobile elements
IR or ends
Mobile element
Length (bp)
IS1
23
IS10
22
IS26
IS1326
14
26
IS1353
24
IS6100
IS903
ISAba1
14
18
16
ISEcp1
14
IS4321
IS5075
ISCR1
11
ISCR2
–
–
ISCR3
IRi
IRt
IRchrA
Tn21
Tn5060
Tn1696
Tn5036
Tn1721
Tn1,2,3
Tn5393
25
38
38
38
38
k
38
81
Sequence (out ! in)
DR (bp)
GGTGATGCTGCCAACTTACTGAT
GGTAATGACTCCAACTTATTGAT
CTGATGAATCCCCTAATGATTT
CTGAGAGATCCCCTCATAATTT
GGCACTGTTGCAAAw
TGTTGAGTTGCATCTAAAATTGACCC
TGTTGATTTGCACCCAAATTTGACCC
TGGGG-TGCGGACAAAATCTTGGA
TGGGGGTGCGGACGATTTCTTGGA
GGCTCTGTTGCAAA
GGCTTTGTTGAATAAATC
CTCTGTACACGATAAA
CTCTGTACACGACAAA
CCTAGATTCTACGT
CCTAAATTCCACGT
taatgagATGGTCACTCCz
tctATGGTCACTCC
3 0 -CS-AATATCTCCTTTTGGGTTG‰
GGGTATAGGAAGTATAAAC (oriIS)
GGGAGTGACGGGCACTGGC (terIS)
ACGTATAGGAAGAATAAAC (oriIS)
groEL-GGTTGGCCCGGTCGTCAGG‰
GCGTATAGGAAGTTCAAAC (oriIS)
TGTCGTTTTCAGAAGACGGCTGCAC
TGTCATTTTCAGAAGACGACTGCAC
GGGATCGCCTCAGAAAACGGAAAATAAAGCACGCTAAG
GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGctaAG
GGGGGCACCTCAGAAAACGGAAAATAAAGCACGCTAAG
GGGGTCGTCTCAGAAAACGGAAAATAAAGCACGctaAG
GGGGTCGTCTCAGAATTCGGAAAATAAAGCACGCTAAG
GGGGAGCCCGCAGAATTCGGAAAAAATCGTCAGctaAGz
GGGGGAACCGCAGAATTCGGAAAAAATCGTACGCTAAG
GGGGTCTGACGCTCAGTGGAACGAAAACTCACGttaAG
GGGGTCGTTTGCGGGAGGGGGCGGAATCCTACGctaAG
GGGGTCGTTTGCGGGAGAGGGCGAAATCCTACGCTAAG
9 (8, 10, 14)
9
8
–
2
8
9
9
5
–
–
–
–
5
–
5
5
5
5
If both IR are identical, the sequence is only shown once. For IS where the IR differ, IR is shown above IR . For transposons where the IR differ, IR is
L
R
tnp
shown above, with the stop codon of the tnpA gene in lowercase. For Tn21-like transposons the position of IS4321/IS5075 insertion is in bold.
The underlined A in IRL is G in a few examples of IS26.
z
The lowercase letters indicate the bases that lie outside the IR, but that are still part of the IS (Partridge & Hall, 2003b).
‰
As the terIS ends of ISCR1 and ISCR3 have not really been defined, the boundaries with conserved adjacent sequences (the 3 0 -CS or groEL are given).
z
Tn1721 includes two identical copies of IRtnp, represented by the top sequence.
k
Tn5393 has 81-bp IR (1 nt difference), but the outer 38 bp are related to IR of other Tn3 family transposons and only these are shown here.
The underlined A residues in IR can be Gs and the underlined G can be an A. RSF1010 includes an IR with all of these changes (Fig. 8)
str
w
homology with this sequence (see Fig. 4a). If the transposition unit is inserted within another mobile element or wellcharacterized region, the IRalt end should become apparent
when the remainder of the sequence is annotated (see Fig.
4b). Searching the sequence beyond the resistance gene for a
DR of the 5-bp sequence found immediately adjacent to IRL
may identify the boundary of a potential transposition unit.
The sequences flanking this region can then be joined (minus
one copy of the DR) and used to search for identical or closely
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
related sequences that represent an uninterrupted ancestor. If
none of these approaches yield results, it may be possible to
identify putative IRalt by the boundary of identity to another
known sequence (Partridge, 2007; Zong et al., 2010).
In some cases, an ‘inside-out’ ISEcp1 structure has been
identified, for example ISEcp1 associated with blaCTX-M-3b in
pK29 (EF382672) and with blaCTX-M-62 (1 nt difference) in
pJIE137 (EF219134). The arrangement in pJIE137 suggests the
insertion of a transposition unit into another copy of ISEcp1,
FEMS Microbiol Rev 35 (2011) 820–855
829
Analysis of the antibiotic resistance regions
Fig. 3. Composite transposons. The extents and
directions of various antibiotic resistance (wide arrows) and other (thin arrows) genes are indicated. IS
are shown as pointed boxes labelled with the IS
number. Sequences of DR length are used to indicate
the boundaries between the IS and the captured
region. (a) IS26-flanked composite transposons carrying different length regions from the Klebsiella
pneumoniae chromosome that include blaSHV. (b)
Composite transposons carrying different tetA and
tetR genes, the sources of which are currently
unknown. (c) IS26-flanked composite transposons
carrying aphA1 gene variants. (d) Composite transposons carrying catA genes. The sequences used to
draw the diagrams were from the following GenBank accession numbers: larger blaSHV and tet(D)
composite transposons, CP000603; smaller blaSHV
and catA2b composite transposons, EU855787;
Tn10 and Tn9, AP000342; Tn4352, AJ851089;
Tn6020, FJ172370.
(a)
GTGGAAGC
26
lacY
bla
deoR
ygbJ
AACGCCGG
26
6
(b)
Tn10
TGCTCAGCA
10
ydhA
ygbK
GGGGCTCG
26
6
ydjAB yeaA tetR(A) tetA(A)
GGCAATGCA
10
tetC tetD
GTAAGCTG
26
(c)
CTCTGATG
26
Tn4352
Tn6020
Gene cassettes and cassette arrays
Over 130 different (o 98% identical) gene cassettes carrying
antibiotic resistance genes and found in mobile resistance
integrons are listed in a recent review, with suggested
nomenclature, references to exemplar sequences and instructions for identifying cassette boundaries and attC sites
(Partridge et al., 2009). Several modifications to cassettes
26
CATAAATT
aphA1a
GATAAAAA
followed by recombination between duplicated regions (Zong
et al., 2010). Similarly, in some IncA/C plasmids and partially
sequenced regions, blaCMY-2 is duplicated and associated with
complete and partial copies of ISEcp1 (Welch et al., 2007;
Verdet et al., 2009; Call et al., 2010). The insertion of one
ISEcp1-blaCMY-2 transposition unit into a related unit, followed by different recombination events could explain these
different structures (Fig. 4d). A Tn10-mediated composite
transposon inserted into an SXT/R391-related ICE (Harada
et al., 2010) and a similar structure in a partial plasmid
sequence (Verdet et al., 2009) could also be derived from one
of these structures (Fig. 4d).
A few related elements that appear to operate by the same
mechanism as ISEcp1 have been identified adjacent to
antibiotic resistance and other genes. ISEnca1, found upstream of aph(200 )-Ie (AY939911) (Chen et al., 2006), is 91%
identical to ISEcp1. IS1247 is found in several sequences
(e.g. AJ971344) as part of a transposition unit carrying an
aac(3)-II gene [suggested name aac(3)-IIf; see section on
aac(3)-II genes and regions] and a putative rifampin ADPribosyl transferase (suggested name arr6) inserted into the
ere(A)2 cassette and flanked by 4-bp DR (van der Ploeg
et al., 1995). A partial ISSm2 (88% nucleotide identity to
IS1247) is found adjacent to the aac(3)-IIb gene (van der
Ploeg et al., 1995).
FEMS Microbiol Rev 35 (2011) 820–855
repF
GGGCGAAA
26
ygbL ygbM
26
(d)
Tn9
CGACGCACT CGTCCGGGG
1
1
catA1a
CTGTTTAG TTTCAGAA
26
26
catA2b
CTAAATTC
aphA1b
tetR(D)tetA(D)
26
GAAAAACG
26
1 kb
have been observed, including insertions of group IIC-attC
introns and IS1111-attC elements into the attC site, specific
deletions in the attC site and the creation of hybrid cassettes
(see Partridge et al., 2009 and references therein). Certain
cassettes appear to be much more common than others in
available sequences and surveys and some cassette arrays
(e.g. |dfrA17|aadA5| and |dfrA12|gcuF|aadA2|) also seem to
be particularly common (Partridge et al., 2009).
Class 1 integrons -- creation and definitions
The first integrons were discovered due to their association
with antibiotic resistance genes (Stokes et al., 2006). Subsequent identification of other ‘mobile resistance integrons’
and many different chromosomal integrons led to classification by IntI sequences and the original integrons became
known as class 1. The ancestor of the first type of class 1
integron structures to be identified was created by the
acquisition of intI1 and attI1 from a chromosomal integron
by a Tn5053-family transposon (Fig. 5a) (Stokes et al., 2006;
Gillings et al., 2008). This coupling of the gene-acquisition
and expression properties of the integron with the mobility
of the transposon was clearly an important ‘winner’ event
(Labbate et al., 2008). The best-known example of this type
of structure was named Tn5090 when it was first sequenced
(X72585; Rådström et al., 1994) but, as these authors had
suggested, it was later found to equate to Tn402, previously
identified as a transposable region on the same plasmid,
R751 (Shapiro & Sporn, 1977). Names such as Tn5090/
Tn402 or Tn402(Tn5090) have been used, but are cumbersome and this transposon is referred to as Tn402 in the
remainder of this review. Tn402 is bounded by the 25-bp IR
of the ancestral transposon, named IRi, at the intI1 end, and
IRt, at the tni end (Fig. 3b; Table 3).
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
830
S.R. Partridge
(a)
C. freundii
ampR
(b)
blaCMY-2
blc
sugE
TGGGT
ecnRBA
TGGGT
pCVM29188_101 (IncI)
(2.254 kb)
ISEcp1
blaCMY-2
GATTA
GATTA
pH205 (ColE1-like)
(2.369 kb)
ISEcp1
blaCMY-36
GATAA
GATAA
ISEcp1
blaCMY-2
ATTTC
ATTTC
pAR060302 (IncA/C)
(2.823 kb)
ISEcp1
blaCMY-2
(c)
ATTTG
ATTTG
ISEcp1
blaCMY-2
(d)
pSC138 (IncI)
(2.431 kb)
E. coli
500 bp
TN44889
(1.422 kb C. freundii
plus 0.503 kb E. coli)
ATTTC
ATTTC
ISEcp 1
pAR060302
blaCMY-2
ISEcp1
blaCMY-2
TATGA
ATTTC
ATTTC
TATGA
pAM04258
ISEcp1
blaCMY-2
blaCMY-2
1
2
1
2
ATTTC
peH4H
ATTTC
ISEcp1
blaCMY-2
blaCMY-2
ATTTC
ATTTC
pSN254
ISEcp1
blaCMY-2
CGCCTAGCT
ICEPmiJpn1
blaCMY-2
CGCCTAGCT
IS10
IS10
blaCMY-2
Fig. 4. ISEcp1 transposition units. (a) The chromosomal region of Citrobacter freundii (dotted line) that includes the blaCMY-2 gene. The extents and
directions of various genes are shown by labelled arrows. (b) Examples of ISEcp1 transposition units carrying blaCMY-2 and variants. ISEcp1 is shown as a
pointed box, IRL and IRR by solid vertical bars, IRalt as broken vertical bars and DR sequences are given. The type of plasmid and the size of the C. freundii
chromosomal region captured are indicated. (c) The transposition unit in TN44889 includes a segment 100% identical to various Escherichia coli
chromosomes adjacent to blaCMY-2 and IRalt could be identified because the flanking sequence corresponds to an IS200-like element. (d) A possible
explanation for complex ISEcp1-blaCMY-2 arrangements in IncA/C plasmids with two copies of blaCMY-2. The IncA/C backbone is represented by a shaded
box (not shown to scale). Insertion of a transposition unit derived from pAR060302 that includes 7.148 kb of IncA/C backbone (shown in blue) back into
the pAR060302 structure, in the inverse orientation, would create the structure seen in pAM04258. Recombination between the 5 0 -ends of ISEcp1
duplicated in opposite orientations (marked 1) would create the structure seen in peH4H. Recombination between the duplicated, inversely oriented
regions that include blaCMY-2 (marked 2; recombination shown as occurring at the end of the blaCMY-2 gene for simplicity) would create the structure
seen in pSN254. The structure in ICEPmiJpn1 could have been created by the insertion of two copies of IS10 into the pAM04258 or pSN254 structure,
followed by transposition to a new location. The sequences used to draw the diagrams were from the following GenBank accession numbers: C.
freundii chromosome, U21727 and AY125469; pCVM2988_101, CP001121; pH205, EU331426; pSC138, AY509004; pAR0060302, FJ621588;
TN44889, FM246884; pAM04258, FJ621587; peH4H, FJ621586; pSN254, CP000604; ICEPmiJpn1, AB525688.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
FEMS Microbiol Rev 35 (2011) 820–855
831
Analysis of the antibiotic resistance regions
(a)
intI1
attI1
CA
+
IR
IR
tniR
tniQ
tniB
tniA
(b)
IRi
tni402
5′-CS
IRt
CA
qacE
(c)
IS
IRi
IRt
3′-CS
In0/In2-like
CA
1353
tniB1
IS
IRi
CA
qacE1 sul1
IRi
1326
IRt
3′-CS
In5-like
orf5 orf6
tniB2
IRt
IRt
3′-CS
CA
IRt
IRi
In4-like
6100
CA
6100
dfrA14
(d)
IRi
IR
3′-CS1
3′-CS2
CR1
CA
(e)
IRi
CA
qacI
(f)
IRi
IS440
tnp
3′-CS
mef(B)
sul3
IRt
IR
1 kb
6100
CA
chrA
orf98
IR
IR
chrA
orf98 tnpR
tnpA
Fig. 5. Creation and structures of class 1 In/Tn. The attI1 site is represented by an oval. Cassette arrays are represented by a box labelled CA, but
selected cassettes are shown as small open boxes, with a filled box at the 3 0 -end representing the attC site. Antibiotic resistance genes outside cassettes
are shown as wide arrows and various other genes by thin arrows. Different regions are represented by lines of different thickness with their names
given above and IS are shown as pointed boxes containing their name or number. (a) The top line represents an ancestral chromosomal class 1 integron
that was acquired by a Tn5053-family transposon (shown below) to yield a functional Tn402-like transposon with qacE as the final cassette in the array
(b), which may have required more than one step. Further steps, including capture of sul1 and various deletions and insertions, were required to
generate the structures in part (c), which contain different extents of the 3 0 -CS found in ‘clinical’ or ‘sul1-type’ integrons. The start of the 3 0 -CS
corresponds to the start of the qacE cassette and the truncated qacED1 gene overlaps with sul1. In2 and In5-like class 1 In/Tn have different extents of
the 3 0 -CS and tni402 (see Table 4) and IS1326 or IS1326 plus IS1353 (shown on the right) may be found at the positions indicated by the arrows labelled
‘IS’. In4-like class 1 In/Tn include only short remnants of the IRt end of tni402 duplicated in opposite orientations flanking IS6100 (arrowheads show the
relative directions of IR). IS6100-mediated deletions may result in the structure shown to the right, where the sequence beyond the dfrA14 cassette is
interrupted by IRt. (d) ‘Complex’ class 1 In/Tn include ISCR1 and resistance gene(s), typically flanked by partial duplications of the 3 0 -CS (see Fig. 6 for
more details). (e) A region that includes the IS440 transposase (the ends of IS440 have not been defined) and the sul3 and mef(B) resistance genes,
rather than the 3 0 -CS, may follow the cassette array. (f) The chrA region is often associated with class 1 In/Tn and the lower diagram shows a transposon
from which this region may be derived. IRchrA is often followed by IRt-IS6100 and the mph(A) region (see Fig. 10). Parts (b)–(f) were drawn using
sequences from the GenBank accession numbers listed in Table 4.
FEMS Microbiol Rev 35 (2011) 820–855
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
832
While a number of complete Tn402-like transposons
carrying intI1 and attI1 have now been identified, the most
commonly encountered structures in available sequences are
‘clinical’ or ‘sul1-type’ class 1 integrons. These were derived
from a Tn402-like transposon that included qacE as the final
cassette by the incorporation of the sul1 (formerly sulI)
sulphonamide resistance gene, truncation of qacE and
loss of part of tni402 (Stokes et al., 2006; Gillings et al.,
2008) (Fig. 5c). The original ‘structural’ definition of a class
1 integron included all of the Tn402-like transposon from
IRi to IRt, if the latter was present, while the current
‘functional’ definition of an integron includes only the
minimal integron components intI and attI, which are
sufficient to specify the class. The first definition is useful
when annotating MRR sequences, as it indicates the extent
of ‘mobile unit’ that can potentially be transposed and the
term ‘class 1 In/Tn’ will be used to refer to these structures in
the remainder of this review.
Linking of genes conferring resistance to antiseptics and
to an early class of antibiotics (sulphonamides) to different
cassette-encoded resistance mechanisms was clearly a ‘winner’ event, despite the fact that it resulted in defective
transposon derivatives that are no longer able to transpose
themselves. However, as predicted (Kholodii et al., 1995;
Brown et al., 1996; Partridge et al., 2002a), the movement of
such transposons with intact IRi and IRt catalysed by Tni
proteins provided in trans has now been demonstrated, with
RecA-mediated recombination resolving cointegrates
formed in the absence of the res site (Petrovski & Stanisich,
2010). Coupled with the res site-hunter characteristics of
Tn5053-family elements, this has allowed the spread of class
1 In/Tn and the resistance genes they carry as ‘passengers’ on
Tn21-like transposons (see section on Tn21-subgroup transposons carrying class 1 In/Tn).
Class 1 In/Tn structures
In ‘clinical’ class 1 In/Tn two conserved segments (CS) with
defined sequences flank the cassette array, also known as the
variable region. The 5 0 -CS starts at IRi and includes intI1
and a Pc promoter responsible for the expression of cassette
genes (see Jové et al., 2010 for a recent summary of
Pc variants). The 5 0 -CS ends with the sequence AAACAAAG
within the core site of attI1 (see Partridge et al., 2009) and
the adjacent T corresponds to the start of the first cassette
of the array (or position 1 of the 3 0 -CS if the integron is
‘empty’). The final cassette is followed by the 3 0 -CS,
with position 1 defined as the first T of the sequence
TTAGAT, corresponding to the start of the remnant qacE
cassette. The truncated qacED1 gene overlaps with sul1
and two ORFs of unknown function (orf5 and orf6) are
present in the longest examples of the 3 0 -CS. The 3 0 -CS may
be followed by certain IS or may directly abut various
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S.R. Partridge
Table 4. Different class 1 In/Tn structures
In
3 0 -CS
Tn402-like
In0
In2
pB8w
In70z
pSN254
In5
In31‰
In4
–
1-2025
1-2025
1-2021
1-2022
1-2384
1-2384
1-2384
1-2239
ISCR1z
sul3
chrA
1-1313
–
1-1593
tni402
1-4733
2056-4733
2056-4733
2056-4733
2060-4733
2056-4733
2495-4733
2495-4733
4733-4611
4582-4733
variable
not present
not present
IS
Example
–
IS1326
IS1326, IS1353
–
–
IS1326, IS1353
IS1326
–
IS6100
U67194
U49101
AF071413
AJ863570
AJ278515
CP000604
U38230
AJ223604
U12338
variable
IS440
IS6100
L06418
FJ196385
AB366440
Positions 1-4733 of tni
402 correspond to 34376-39108 of R751 in
U67194.4.
CA at the junction between the 3 0 -CS and tni402 belongs to neither
segment, but could be a remnant of IS1326.
z
AT at the junction between the 3 0 -CS and tni402 could belong to either
segment and position numbers include them in both.
‰
GC at the junction between the 3 0 -CS and tni402 could belong to either
segment and position numbers include them in both.
z
‘Complex’ class 1 In/Tn with ISCR1 and associated resistance genes
generally have a second partial copy of the 3 0 -CS that may be followed
by a region matching one of the typical class 1 In/Tn structures.
w
extents of the truncated tni402 region, which ends with IRt
(see Table 4 for examples).
The first few class 1 In/Tns to be characterized were given
integron numbers (Stokes & Hall, 1989) intended to specify
the entire structure from IRi to IRt (if the latter was
present), including defined extents of the 3 0 -CS and tni402
and different IS (Table 4). ‘Integron’ numbers are now
commonly used to refer only to cassette arrays (a list is
available from the Annotation page of INTEGRALL;
Table 5), but in most cases, simply stating the cassettes in
the array is more helpful. Some early integron numbers,
however, remain useful for referring to structures that
persist in currently available sequences (Table 4).
In0 and In2 contain the same extents of the 3 0 -CS and
tni402, while In5 has a longer version of 3 0 -CS and less of
tni402 (Fig. 5c), and either no IS, IS1326 alone or both IS1326
and IS1353 may be associated with both of these types of
class 1 In/Tn (Table 4). In4 includes a partially duplicated
IS6100 element flanked by inverted 123 and 152-bp fragments of the end of the tni402 region that both include IRt
(Partridge et al., 2001a) and a similar structure without the
IS6100 duplication is found in several class 1 In/Tn (Fig. 5c).
Variants lacking part or all of the 3 0 -CS (Fig. 5c; Table 4) are
also found, presumably resulting from IS6100-mediated
deletions into the 3 0 -CS or cassettes, for example the dfrA14
cassette is often followed by a sequence interrupted by
IS6100 (Partridge et al., 2001b). So-called ‘complex’ class 1
FEMS Microbiol Rev 35 (2011) 820–855
833
Analysis of the antibiotic resistance regions
In/Tn carry ISCR1 and resistance genes that are not part of
cassettes, usually between partial duplications of the 3 0 -CS
(see section on ISCR elements and ‘complex’ class 1 In/Tn).
Structures in which related cassette arrays are followed by
a region that includes a transposase gene (usually annotated
as IS440, although the boundaries of the IS have not been
identified), sul3 (formerly sulIII; sulphonamide resistance)
and the mef(B) macrolide efflux gene (Liu et al., 2009),
rather than the 3 0 -CS, are increasingly being reported (see
Partridge et al., 2009 for examples).
The conserved nature of the 5 0 -CS and 3 0 -CS flanking
cassette arrays means that entire cassette arrays can be
exchanged between class 1 In/Tn by recombination in both
of these regions (see Fig. 2d; Partridge et al., 2002a, b),
explaining the occurrence of common cassette arrays in class
1 In/Tn with different structures or in different locations.
Recombination may also occur between related cassettes
common to different arrays to create hybrid cassettes
(e.g. Gestal et al., 2005).
The chrA region
A region that includes a gene potentially encoding chromate
resistance (chrA) and an ORF (usually annotated as orf98 or
padR) has now been identified in several MRR, usually
adjacent to the 3 0 -CS of class 1 In/Tn (Fig. 5f). The
boundary between this chrA region and the 3 0 -CS is defined
by a Tn21-like 38-bp IR (designated IRchrA here; Table 4).
The entire region is 86% identical to part of a Tn21-like
transposon found in pCNB1 (EF079106), an IncP1-b plasmid from Comamonas (Ma et al., 2007), suggesting that a
related transposon may be the origin of this fragment and it
is interesting that IRt adjacent to IS6100 lies close to the
presumed res site (Fig. 5f). The chrA region is usually
followed by IRt-IS6100 and a region designated mph(A)
here (see section on Macrolide phosphotransferase regions).
ISCR elements and ‘complex’ class 1 In/Tn
Unusual class 1 integrons containing a ‘common region’
between duplications of the 3 0 -CS were identified in the
1990s (Stokes et al., 1993). The name was later shortened to
CR1 when two related regions, designated CR2 and CR3,
were identified (Partridge & Hall, 2003a). When it became
apparent that these regions are related to IS91-like elements,
they were renamed ISCR (Toleman et al., 2006b). Over 20
different ISCR elements have now been identified and
related elements can be grouped into families, with differences in the G1C content between families suggesting
different origins.
IS91 (Mendiola et al., 1994; Garcillán-Barcia et al., 2002)
and the related elements IS801 (Richter et al., 1998) and
IS1294 (Tavakoli et al., 2000) are unusual in that they
transpose by a rolling circle mechanism. The identification
FEMS Microbiol Rev 35 (2011) 820–855
of these elements in different locations and/or transposition
experiments enabled their ends to be defined and 4-bp target
sequences to be identified (Mendiola & de la Cruz, 1989;
Tavakoli et al., 2000; Garcillán-Barcia et al., 2002). terIS
upstream of the rolling circle replicase gene and oriIS
downstream are conserved between these elements and each
includes short inversely repeated sequences (Garcillán-Barcia et al., 2002). Replication proceeds from oriIS through
the IS, ending at terIS, and can generate insertions or
free circular intermediates (Garcillán-Barcia et al., 2002)
(Fig. 6a). IS91-like elements can capture genes when replication proceeds past terIS into the adjacent region (Fig. 6b),
which occurs in about 1–10% of transposition events
(Tavakoli et al., 2000; Garcillán-Barcia et al., 2002) and ISCR
elements presumably capture adjacent genes in the same way
(Toleman et al., 2006b).
Simple insertions of ISCR elements have not yet been seen
and regions containing these elements can be quite complex,
including multiple ISCR copies, some of which are truncated, duplications of other regions and multiple resistance
genes. The oriIS ends of ISCR1, ISCR2 and ISCR3 (Table 3)
and other ISCR have been identified from boundaries with
regions carrying different resistance genes found downstream of rcr and from similarity to each other and to oriIS
of IS91, IS801 and IS129 (Partridge & Hall, 2003a; Toleman
et al., 2006b). However, as successive aberrant transposition
events may allow ISCR to acquire multiple segments adjacent to terIS (Fig. 6d), it can be difficult to identify the
original ends of these elements and unravel the events that
created the structures containing them, unless the origin and
boundaries of each segment can be identified.
ISCR2 has been found associated with a limited number
of resistance genes (Table 1; Partridge & Hall, 2003a; Toleman et al., 2006b) and several different sequences have been
found upstream of the rcr gene of ISCR2, allowing a terIS to
be proposed (Table 3). Regions including ISCR2 have
mainly been identified on IncA/C plasmids and their
relatives, the SXT ICE (Wozniak et al., 2009). These regions
seem to be related and often consist of complete or partial
copies of ISCR2 separating regions containing different
resistance genes. The generation of these structures may rely
on direct insertion or homologous recombination between
copies of ISCR2. Fragments of IS91 with an oriIS end can
move if replicase is provided by an intact copy of the
element (Schlör et al., 2000; Garcillán-Barcia et al., 2002)
and similar events could potentially explain some structures
carrying ISCR2. Defined fragments of ISCR2 are also found
on small IncQ plasmids or in a common multicomponent
structure (see section on Tn5393 and modules containing
fragments of this transposon).
ISCR1 has only ever been found adjacent to position 1313
of the 3 0 -CS of class 1 In/Tn and this boundary has been
used to define the end of the element. This end does not
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
834
S.R. Partridge
(a)
terIS
oriIS
(b)
RCR
(c) ISCR2
ISCR2
sul2
(d)
(g)
+
(h)
(e)
(f) ISCR1
(i) ISCR3-like
3'-CS
CA
ISCR1
blaDHA-1 ampR
bl
CA
CA
ISCR1
sul1
CA
ISCR1
ISCR1
CA
cmlA9
14Δ
CA
qnrA1
floR
6Δ
ant(4')-IIb
dfrA3b
CA
CA
tetA(G)
6
catA2a
3
14
rmtD1 groELΔ
CA
14B
14
rmtD2
1 kb
Fig. 6. Possible outcomes for events involving ISCR elements. Most elements are represented as in earlier figures. (a) An IS91-like or an ISCR element
undergoes simple rolling circle replication (dotted line with arrow), creating a circular intermediate. (b) After insertion into a new location, a subsequent
round of rolling circle replication continues through terIS and into the adjacent region, capturing part of it. (c) Some ISCR2-sul2 structures could be the
result of an insertion of this type of structure, but the sul2 gene is found at the oriIS end. (d) Subsequent rounds of rolling circle replication capture
additional regions. (e) The circular intermediate is rescued by recombination with one of the captured regions, so that duplications of this region flank
ISCR and the other captured regions. (f) Examples of ISCR1 in class 1 In/Tn, where recombination in the 3 0 -CS (acquired in an early capture event) has
resulted in partial duplications of this region flanking the ISCR1-resistance gene region. The black box represents a region associated with different
resistance genes, which could have been captured separately in an early event or as part of a resistance gene region. (g) A circular intermediate with one
captured region is rescued by recombination with a related, but not identical, ISCR (shaded), forming hybrid elements. (h) A circular molecule created by
recombination between related ISCR is inserted by recombination with another related ISCR (different shading), creating mosaic structures. (i) Several
elements closely related to ISCR3 are hybrids or mosaics (ISCR3 is shown as the ancestor here). They share the same immediate boundary (red ovals) with
a groEL region related to those of Xanthomonas spp., but differences in these regions further from ISCR (different shading) could indicate additional
recombination between related groEL regions. cmlA9 is 89% identical to floR and rmtD2 is 98% identical to rmtD1 (represented by different shading).
Capture of segments of the 5 0 -CS presumably allowed insertion into class 1 In/Tn in a manner similar to ISCR1 in the 3 0 -CS. The sequences and
information used to draw the diagrams were from the following GenBank accession numbers: ISCR2-sul2, AB277723; ISCR1-catA2, L06822; ISCR1dfrA3b, AY162283; ISCR1-qnrA1/dfrA3b, AY878717; ISCR3-tetA(G)/floR (SGI1), AF261825; ISCR6-ant(4 0 )-IIb (Tn6061), GQ388247; ISCR14-rmtD1,
DQ914960; ISCR14-rmtD2, HQ401565.
include typical terIS features and it has been suggested that
ISCR1 may be a truncated version of an element that
inserted adjacent to the 3 0 -CS and then was fused to this
region by a deletion (Toleman et al., 2006b). However, the
2154-bp region from the boundary with the 3 0 -CS to the end
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
of oriIS is about 300–650 bp longer than related elements
(IS91, 1830 bp; IS801, 1512 bp; IS1294, 1688 bp; ISCR2 from
terIS in Table 3, 1847 bp). Thus, it is possible that the
element defined as ISCR1 had already acquired region(s)
before being inserted into the 3 0 -CS, with selection pressures
FEMS Microbiol Rev 35 (2011) 820–855
835
Analysis of the antibiotic resistance regions
and sampling bias potentially explaining why the same
structure has always been seen. In either case, the association
of ISCR1 with the 3 0 -CS created a ‘winner’ combination that
is able to capture different resistance genes (Table 1) and
insert them into any class 1 In/Tn with a 3 0 -CS and that can
potentially mobilize different parts of the class 1 In/Tn that
lies upstream (Toleman et al., 2006b).
In class 1 In/Tn with ISCR1, the acquired resistance genes
lie adjacent to the oriIS end of ISCR1. This is explained by a
model that requires a combination of rolling circle transposition and homologous recombination (Toleman et al.,
2006b). Replication from oriIS through ISCR1 and into the
3 0 -CS would create a circular molecule that contains part of
the 3 0 -CS (represented by Fig. 6b). This could insert adjacent
to a resistance gene and another round of rolling circle
replication with a different sequence acting as terIS would
create a circular molecule containing ISCR1, part of the 3 0 CS and an adjacent captured region (represented by Fig. 6d).
Additional rounds of the same process could add further
regions containing resistance genes. The rescue of circular
intermediates by homologous recombination with the 3 0 -CS
of a class 1 In/Tn would result in the observed structures, in
which partial duplications of the 3 0 -CS flank the ISCR1resistance gene(s) region (Fig. 6e). Several examples of class 1
In/Tn include ISCR1 associated with more than one resistance gene (e.g. Fig. 6f). Different extents of the class 1 In/Tn
adjacent to ISCR1 could also be captured, allowing recombination in the 5 0 -CS or cassette array, or recombination
with an ISCR1 element already in a class 1 In/Tn could yield
a variety of structures (see Toleman et al., 2006b for
examples). Once an ISCR1-resistance gene combination has
been placed in a class 1 In/Tn, it could also move to other
class 1 In/Tn as a circular molecule generated by homologous recombination between the flanking duplicated 3 0 CS (see Fig. 2b; Partridge & Hall, 2003a).
A number of elements 75–95% identical to ISCR3 have
been identified (Toleman & Walsh, 2008). ISCR3 itself has
been found associated with several different resistance genes,
while generally only one or two examples of other ISCR3like elements are currently available in GenBank, each
associated with a particular resistance gene (Table 1). A
region related to the groEL gene of Xanthomonas spp. is
found adjacent to the presumed terIS end of ISCR3 and
some related elements, suggesting that an ancestor inserted
adjacent to groEL and picked up part of this gene (Toleman
& Walsh, 2008). Examination of alignments of ISCR elements with the same boundary with groEL as ISCR3 itself
reveals an uneven distribution of nucleotide differences,
suggesting that some are hybrid or mosaic structures.
Complete and partial duplications of these elements are
associated with several resistance genes (Fig. 6i) and rescue
of circular transposition intermediates (represented in Fig.
6g) and other events (Fig. 6h) involving recombination
FEMS Microbiol Rev 35 (2011) 820–855
between related rather than identical elements could generate these structures. Additional recombination between
different, but related groES-groEL regions (Toleman &
Walsh, 2008) may explain differences in groEL sequences
further from the ISCR element (Fig. 6i).
Tn21-subgroup transposons carrying class 1 In/
Tn
Class 1 In/Tn have been found inserted into several different
Tn21-like transposons (summarized in Petrova et al., 2011).
Tn21 itself (Liebert et al., 1999) consists of a backbone
closely related to Tn5060 (Kholodii et al., 2003) that
includes a transposition region (tnp21) and a mercury
resistance region (mer21). A 782-bp region that includes the
urf2M gene separates the res site from the merD gene
(Liebert et al., 1999; Partridge et al., 2001a) and In2 is
inserted into this region, with DR (TCCAT) flanking IRi and
IRt (Fig. 7a).
Several class 1 In/Tn in Pseudomonas aeruginosa are
inserted into a transposon related to Tn5051, which has
only been partially sequenced, but appears to be a hybrid of
the mer region of Tn501 (Brown et al., 1985) and a different
tnp region (Mindlin et al., 2001) created by recombination
in the res site. Tn501 has orf2, equivalent to urf2M, between
the res site and merD and in six examples in GenBank a class
1 In/Tn carrying a blaIMP-13, blaVIM-1, blaVIM-2 or blaGES-1
gene cassette is inserted into the same position in this region
(Fig. 7a). Single examples of class 1 In/Tn inserted at two
other positions, both in the res site, have also been identified
(Fig. 7a).
Tn1696 (Partridge et al., 2001a), Tn6005 (Labbate et al.,
2008) and two other known transposons are based on a
backbone closely related to Tn5036 (Yurieva et al., 1997)
with class 1 In/Tn in different positions, indicating independent insertion events. Similarly, in Tn1403 (Stokes et al.,
2007), Tn5045 (Petrova et al., 2011), Tn6060 (Roy Chowdhury et al., 2009) and Tn6001 (Tseng et al., 2007), class 1 In/
Tn are inserted into different positions in a backbone related
to Tn1013 (Haines et al., 2007), which does not have a mer
operon. These transposons lack the urf2M/orf2 region found
in Tn21 and Tn501 and the class 1 In/Tn are inserted into
the res site, which would be expected to prevent resmediated resolution of cointegrates (Liebert et al., 1999;
Partridge et al., 2001a). This may help to explain why
transposons with both tnp1696 and mer1696 are not that
common in available sequences (Cain et al., 2010), with
these regions often forming hybrids, for example of Tn21
and Tn1696 (Partridge & Hall, 2004; Novais et al., 2010),
that presumably arose by homologous recombination between shared class 1 In/Tn components.
The insertion of the class 1 In/Tn outside the res site
of Tn21 seems to have created a ‘winner’ combination
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
836
S.R. Partridge
(a)
TCCAT
IRtnp
Tn5060
tnpA
IRmer
tnpR urf2 merD E
A
C P T R
GATTT
CTATT GAGTC
Tn5051
tnpA
tnpR
IRmer
orf2 merD E
A
from Tn501
P T R
Tn1696 Tn6005
CATGG TTTGC TCGTT
IRtnp
Tn5036
tnpA
IRmer
tnpR merD E
A
C P
T R
Tn1403
Tn6060 Tn5045 Tn6001
CAGTT GGCGC ATGTG
IRtnp
IRorf
Tn1013
tnpA
tnpR
orfA
B
C
D
(b)
IRtnp
Tn1721
In/Tn
TCAAG
IRtnp
tnpA
pecM
tetA(A) tetR(A)
tnpR
tnpA
mcp
TGAAT
TU
Tn1722
(c)
IRtnp
IRmcp
IRTEM
Tn2
tnpA
tnpR
blaTEM-1b
IRtnp
IRTEM
1 kb
Tn1331
tnpA
(d)
Tn4401a
tnpR aacA4 aadA1
oxa9
blaTEM-1a
IRtnp
IRKPC
IS Kpn7
IS Kpn6
blaKPC
IRΔ
tnpA
tnpR
Fig. 7. Tn3-family transposons commonly found in MRR. Genes are shown as in earlier figures. res sites are indicated by small black boxes and IR are
represented by vertical bars, with the end corresponding to the transposase gene labelled IRtnp and the other IR given a name specific to the transposon.
(a) Tn21-subfamily transposons with class 1 In/Tn. The names of the backbone transposons are given on the left. Tn21 consists of a backbone related to
Tn5060 (4 nt differences) with In2 inserted at the position indicated by the vertical arrow, flanked by the DR shown. For other backbones, different
insertion sites of class 1 In/Tn are shown by vertical arrows and the sequences of the DR created and the names of the resultant transposons, if assigned,
are given. (b) Tn1721. The region corresponding to Tn1722 is marked. Vertical arrows indicate the insertion positions of the ISEcp1-blaCTX-M-9-group
transposition unit (TU) or a class 1 In/Tn in the res site, with the DR sequences shown. (c) Tn3-subfamily transposons. Gene cassettes in Tn1331 are
shown as in Fig. 5 and a partial attC site is only present between the aadA1 and oxa9 cassettes. (d) Tn4401. The triangle below Tn4401 indicates the
position at which 100 extra bases are inserted into Tn4401b compared with Tn4401a. The narrow vertical bar labelled IRD represents the IR of the
original transposon truncated by ISKpn7. Filled circles of the same colour indicate DR flanking the two different IS. The sequences and information used
to draw the diagrams were from the following GenBank accession numbers: Tn5060, AJ551280; Tn21, AF071413; Tn5051, Y17719 plus Tn501 from
Z00027 (the region shown by dashed lines has not been sequenced); DR = GATTT, AJ969233; DR = CTATT, AJ634050; DR = GAGTC, AJ515707; Tn5036,
Y09025; Tn1696, U12338; Tn6005, EU591509; DR = TCGTT, AJ746361; Tn1013, AM261760; Tn1403, AF313472; Tn6060, GQ161847; Tn5045,
FN821089; Tn6001, EF138817; Tn1721, X61367; class 1 In/Tn in Tn1721, GQ396666; ISEcp1-blaCTX-M-14 in Tn1721, AF458080; Tn2, AY123253;
Tn1331, AF479774; Tn4401, EU176011.
that could explain the number of variants of this transposon found in available sequences (Liebert et al., 1999).
Tn21 may also have an advantage in that it includes an
ORF (tnpM), consisting of part of urf2M, proposed to
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
encode a protein that enhances transposition (Hyde & Tu,
1985), as shown recently for an equivalent protein (TniM)
from a Tn5036-family transposon (Petrovski et al., 2011).
Tn1696 and other transposons that lack an equivalent of the
FEMS Microbiol Rev 35 (2011) 820–855
837
Analysis of the antibiotic resistance regions
urf2M region would not be expected to produce such a
protein.
The closely related IS4321 and IS5075 and their minor
variants, which belong to the same family as IS1111-attC
elements, target the 38-bp IR of Tn21-subfamily transposons, but have not yet been found in the Tn3-subfamily.
These IS do not create DR and are unusual in that their ends
do not correspond to their IR and require careful annotation
(Table 3; Partridge & Hall, 2003b). IS4321-like elements
have always been found inserted into the same position
(Table 3) with the IRL end towards the middle of the
transposon and presumably prevents further TnpAmediated transposition.
Tn1721
Tn1721 (Allmeier et al., 1992) is a Tn21-like transposon with
an unusual structure that includes three 38-bp IR and a
partial duplication of the tnpA gene (Fig. 7b). One end
consists of tnpA, tnpR, a res site and an ORF encoding a
protein related to methyl-accepting chemotaxis proteins
(mcp in Fig. 7b and originally called orfI) flanked by 38-bp
IR (Table 3). This structure is also known as Tn1722 and can
move independently (Grinsted et al., 1990). The other end
of Tn1721 includes the tetA(A) tetracycline resistance gene
and a regulatory gene tetR(A) gene. Tn1721 may have
evolved by internal deletion of a composite transposon
consisting of two copies of Tn1722 flanking the tet(A) region
(Allmeier et al., 1992; Grindley, 2002).
Complete copies of Tn1721 are rare in sequences currently available in GenBank, but different fragments of this
transposon are often found, including adjacent to the rep
region of several IncPa plasmids. There is one example of a
class 1 In/Tn inserted into the res site of Tn1721 (Fig. 7b)
and several res-type hybrids of tnp1721/tnp21 with a class 1 In/
Tn inserted at the usual Tn21 location, for example in
pAPEC-O2-R (AY214164). A 4.8-kb ISEcp1 transposition
unit containing different blaCTX-M-9-like variants and IS903
(e.g. AF458080; Poirel et al., 2003) or a truncated version (e.g.
HM440049; Zong et al., 2011) is found inserted into the same
position in Tn1721/Tn1722 in several plasmids (Fig. 7b).
Tn1, Tn2 , Tn3 and relatives carrying blaTEM genes
Nearly 200 TEM b-lactamases, including extended-spectrum (ESBL), inhibitor resistant (IRT) and combination
(CMT) types, have been identified (http://www.lahey.org/
Studies/). The first examples, TEM-1 and TEM-2, differ by a
Gln to Lys substitution at amino acid 39 (Ambler numbering; Ambler et al., 1991) due to a single base change. These
and all other TEM b-lactamases are encoded by minor
variants of the same gene, with a single amino acid
difference sufficient for assignment of a new number.
blaTEM-1 variants with different combinations of silent
FEMS Microbiol Rev 35 (2011) 820–855
mutations at characteristic positions have also been identified (‘frameworks’, distinguished by letters e.g. blaTEM-1a,
blaTEM-1b; see Supporting Information, Fig. S1). The positions are numbered using a scheme that includes 208 nt
upstream of the start codon (Sutcliffe, 1978), as changes in
this region yield promoters of different strengths (P3, Pa/Pb,
P4, P5; Lartigue et al., 2002). Leflon-Guibout et al. (2000)
proposed that the framework and the promoter variant
present should also be specified for all blaTEM genes identified, for example blaTEM-33f (P4).
The closely related transposons identified as the carriers
of blaTEM genes were originally collectively designated TnA
(Hedges & Jacob, 1974), but were later distinguished as Tn1,
Tn2 Tn3, Tn801, etc. depending on the blaTEM variant
present and the plasmid they were derived from. Detailed
analysis of the sequences of Tn1 (blaTEM-2), Tn2 (blaTEM-1b)
and Tn3 (blaTEM-1a) indicated that most of the differences
between them were confined to short regions flanking the res
site, suggesting that they were generated by a combination of
site-specific and homologous recombination between ancestral transposons (Partridge & Hall, 2005). Analysis of
complete or almost complete sequences of transposons
carrying blaTEM genes now available in GenBank (Bailey
et al., 2011) suggests that they still fall into the three groups
represented by Tn1, Tn2 and Tn3.
Tn1 and Tn801 were the names given to transposons
carrying blaTEM-2 from a group of closely related IncP1a
plasmids (RP1, RP4, R68 and RK2). Tn1 from the compiled
sequence representing this group of plasmids (L27758,
BN000925; Pansegrau et al., 1994) has 7 nt differences outside the blaTEM gene/promoter region from Tn1 derived
from various other plasmids and from Tn801 transposed
from a derivative of RP1 (Burland et al., 1998; Brinkley et al.,
2006). These transposons all carry genes based on the 1f
framework, although the gene from Tn1R7K was named
blaTEM-1c (Revilla et al., 2008), but some encode TEM-2 or
other variants (Bailey et al., 2011). An association between
Tn1-like transposons carrying various blaTEM-2 derivatives
and tnp1696 has been noted (Novais et al., 2010).
Tn2, the transposon from RSF1030 defined as carrying
blaTEM-1b, was originally only partially sequenced (X54607;
Chen & Clowes, 1987), but part of the complete sequence of
a transposon initially called Tn2 (AY123253.3; Partridge &
Hall, 2005) is identical to this region. Many examples of a
complete or a partial transposon carrying blaTEM-1b or
derivatives in GenBank are identical or very closely related
to this sequence, suggesting that it can now simply be
referred to as Tn2 (Bailey et al., 2011). The complete
sequences of transposons carrying blaTEM-1c (HM749967,
EU935740) have only six differences from Tn2 outside the
blaTEM gene/promoter region and the name Tn2a has been
suggested (Bailey et al., 2011). Complete and partial copies
of Tn2 and minor variants appear to be much more
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
838
S.R. Partridge
Tn4401 carrying blaKPC genes
common than Tn1 and Tn3 in available sequences, but are
often incorrectly annotated as Tn3 (Bailey et al., 2011). In
several sequences, Tn2 is found inserted into the same
position in mer21 or with a common boundary with one or
the other end of this region (Partridge & Hall, 2004; Novais
et al., 2010) and fragments of Tn2 interrupted by IS26 at
different positions, but with the blaTEM gene intact, are also
common (Bailey et al., 2011).
The first available sequence of Tn3, carrying blaTEM-1a,
transposed from R1 (V00613) (Heffron et al., 1979) includes
a 9-bp duplication not present in the sequence recently
obtained directly from R1 (HM749966) (Bailey et al., 2011).
Tn1331 is a derivative of Tn3 that carries a cassette array
between short duplications (Fig. 7c; Tolmasky & Crosa,
1993).
In addition to the normal transposition process, Tn3- and
Tn21-subfamily transposons that include only one IR can also
move by rare TnpA-dependent, TnpR- and recA-independent
one-ended transposition events (Avila et al., 1984, 1988;
Mötsch & Schmitt, 1984; Heritage & Bennett, 1985; Mötsch
et al., 1985; Revilla et al., 2008). These produce recombinants
containing a segment of DNA that starts precisely at the IR
and is variable at the other end and usually results in replicon
fusion. Insertion products may even contain the entire donor
plasmid plus a duplication of the IR.
Tn3-like transposons also exhibit transposition immunity
i.e. the presence of one copy of the element in a potential
target molecule significantly reduces the insertion of a
second copy (Grindley, 2002). Thus, if an MRR includes two copies or fragments of one of these mobile
elements, it is probably unlikely that both were inserted by
direct transposition.
The blaKPC gene, encoding a class A b-lactamase capable of
conferring resistance to carbapenems, has recently become a
problem in several parts of the world. This gene is found
flanked by ISKpn6 and ISKpn7 within variants of Tn4401
(Fig. 7d), a Tn3 family transposon with an unusual organization. The Tn4401 structure may have been generated in a
manner similar to capture of genes by ISEcp1 (Naas et al.,
2008). In this scheme, a transposon containing the tnpA and
tnpR genes of Tn4401 first inserted upstream of blaKPC.
ISKpn6 then inserted upstream of blaKPC and ISKpn7 downstream, disrupting one IR of the original transposon, and a
sequence located further downstream of blaKPC was then
used as the second IR in subsequent transposition events.
Tn4401 has been found to be associated with Tn1331 in
several plasmids, including pLRM24 (Rice et al., 2008), p12
and p15 (FJ223605-6; Gootz et al., 2009) and pKpQIL
(GU595196; Leavitt et al., 2010).
Tn5393 and modules containing fragments of
this transposon
Tn5393 is a Tn3-like transposon that carries the aminoglycoside phosphotransferase genes strA and strB and is flanked
by 81-bp IR, the outermost 38 bp of which are related to
those of other Tn3-family transposons (Table 3). IS1133 is
inserted in the first example of Tn5393 identified (Chiou &
Jones, 1993), but the ‘original’ transposon without IS1133,
called Tn5393c, has since been identified (Fig. 8a; L’AbéeLund & Sørum, 2000). Complete copies of Tn5393-like
transposons and some with insertions and/or deletions are
TAG
Tn5393
IRtnp
(a)
Tn5393c
tnpA
TAG
1133
tnpR strA
IRstr
strB
IRstr
(b)
RSF1010
repA
strA
ATATCAAG
(c)
Tn6029
repC
26
strB
CTTGATAT
26
blaTEM-1b
26
strA
1 kb
strB
Fig. 8. Characteristics of Tn5393 and its fragments found in MRR. Most elements are represented as in earlier figures. Dashed lines represent the
RSF1010 plasmid backbone and pale green shapes represent the fragments of ISCR2. (a) Tn5393c (AF262622). In the original Tn5393 (M95402), IS1133
is inserted flanked by 3-bp DR (TAG) that corresponds to the stop codon of tnpR. (b) The combination of sul2, the strAB end of Tn5393 and a fragment
of ISCR2 found in RSF1010 (M28829). (c) Tn6029 (GQ150541). The 8-bp sequences shown adjacent to IRR and IRL of different copies of IS26 are reverse
complements of one another, suggesting that recombination has taken place between these two IS26 elements. Inverting the region between them to
simulate homologous recombination (see Fig. 2a) would yield a configuration in which the internal copy of IS26 is flanked by DR. Removing this IS26 and
one copy of the DR would reunite the strB gene with IRstr of Tn5393.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
FEMS Microbiol Rev 35 (2011) 820–855
839
Analysis of the antibiotic resistance regions
found in genomes, plasmid backbones and other transposons.
Part of Tn5393 (including strA, strB and IRstr) is found
adjacent to sul2 and a fragment of ISCR2 in the small
(8.7 kb) IncQ plasmid RSF1010 (Fig. 8b; Scholz et al.,
1989). This structure may have been created by the transposition of Tn5393 into the ISCR2-sul2 structure, followed by a
deletion event (Yau et al., 2010). Related IncQ plasmids
carry similar regions, in some cases with additional resistance genes inserted (Meyer, 2009). A module apparently
derived from RSF1010 (Fig. 8c) is found in several large
MRR and has been designated Tn6029 (Cain et al., 2010). It
is flanked by directly oriented copies of IS26, with a third,
internal, copy of IS26 in the opposite orientation. The 8-bp
sequence adjacent to IRL of the internal IS26 is the reverse
complement of the 8 bp adjacent to IRR of one flanking IS26
(Fig. 8c), indicating that the segment between these elements has been inverted. Reversing this process and removing the internal IS26 would regenerate the RSF1010-like
structure.
aac(3)-II genes and regions
aac(3)-II genes were among the most common encoding
aminoglycoside-modifying enzymes identified in early studies and three types, aac(3)-IIa (X13543), aac(3)-IIb
(M97172) and aac(3)-IIc (X54723), were distinguished
(Shaw et al., 1993). A recent study of human and animal E.
coli isolates suggests that genes of this family are still
common, but identified two different types: aac(3)-IId
(97% identical to aac(3)-IIa; EU022314) and aac(3)-IIe
(96% identical to aac(3)-IIa; EU022315; Ho et al., 2010).
Little context information is available for any of these genes,
but several plasmid and other sequences in GenBank include
genes closely related to either aac(3)-IId or to aac(3)-IIe.
Genes within each group have similar flanking regions, but
are associated with different combinations of mobile elements (Fig. 9a and b). It would be useful to distinguish
between these groups in annotations and the names aac(3)IId and aac(3)-IIe seem appropriate. Another gene, designated aac(3)-IIf here, is found in several sequences in
GenBank, associated with the ISEcp1-like element IS1247
(e.g. AJ971344; Fig. 9c). It is interesting that the most closely
related gene, aac(3)-IIb (79% identical), is associated with
the related (88% identical) element ISSm2 (van der Ploeg
et al., 1995).
resistance (Noguchi et al., 1995) and a transcriptional
repressor (Noguchi et al., 2000b; Szczepanowski et al.,
2004, 2005), often annotated as mrx and mphR(A), respectively. The mph(A) region is bounded at one end by IS26 and
is often found adjacent to IRt-IS6100 marking the end of the
chrA region (Fig. 5f). Another region flanked by two
different IS encodes proteins about 35–40% identical to
those encoded by the mph(A) region, but the genes are
organized differently (Fig. 10b; Szczepanowski et al., 2007).
The mph gene in this region has been assigned the name
mph(F) by the MLS resistance gene website (Table 5), as its
original name, mph(E), was assigned to another gene.
The gene now designated mph(E), previously called mph
or mph2, plus msr(E), previously called mel or mef(E) and
encoding an ATP-binding cassette transporter, are found in
several MRR (Schlüter et al., 2007; Kadlec et al., 2011),
usually flanked by IS26 and a second IS (Fig. 10c). A region
that includes mph(B) and a gene encoding a putative
penicillin-binding protein is inserted into tni402 in several
plasmids (Fig. 10d), apparently flanked by 12-bp DR
(Noguchi et al., 2000a). Examination of the sequence
suggests that the ends of the mph(B) region, including these
DR, correspond to fragments of an ISCR element (about
68% identical to ISCR2).
Annotating, analysing and comparing
MRR
The actions of individual mobile elements in concert with
homologous recombination can lead to very complex conglomerations of complete and fragmented version of the
components described above with insertions, deletions and
rearrangements. Detailed analysis of these regions and
consistent annotation allows more meaningful comparisons
of different structures and a better understanding of how
they may have arisen and evolved. As MRR components are
highly conserved, it is also important to carefully check
segments of new sequences against existing examples of the
same components to reduce errors and give confidence in
minor, but real, changes that may help to identify epidemiological relationships. The following sections give suggestions
about how to analyse and annotate the sequences of MRR,
illustrated by pIP1206 (AM886293; Périchon et al., 2008),
a plasmid with a complex MRR with multiple inversions
(Fig. 11).
Annotating antibiotic resistance genes
Macrolide phosphotransferase regions
Several regions including mph genes encoding different
macrolide 2 0 -phosphotransferases (30–40% amino acid
identity) have been found in MRR in Gram-negative bacteria. The mph(A) region (Fig. 10a) includes mph(A) and genes
encoding a protein required for high-level erythromycin
FEMS Microbiol Rev 35 (2011) 820–855
Newly obtained sequence data are usually analysed using
automated annotation programs, which will find potential
ORF, but often only identify the general function of the gene
family (e.g. ‘b-lactamase’; Fig 11a). As resistance genes
found in newly sequenced regions are often identical or
closely related to well-characterized genes, identifying
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
840
S.R. Partridge
IRTEM
IRTEM
(a)
pCTX-M3, pU302L
26
Cfr1
aac(3)-IId
pSTMDT12_L
26
pKF3-140*
10
pK245
10
blaTEM-1b
26
Cfr1
26
26
All 1 nt different from
aac(3)-IId (EU022314)
Kpn12
5 nt differences from
aac(3)-IIe (EU022315)
Kpn12
3 nt differences from
aac(3)-IIe (EU022315)
100% to aacC2/aacC3
Kpn11
(b)
Kpn12
pHHV35
aac(3)-IIe
Tn2#
,p3521
K. pneumonaie 12836
Kpn11
blaTEM-1b
K. oxytoca C994
26
Kpn11
pC15-1a, pEK516
26
IS
pTN48
26
IS
TTAA
(c)
pPMDHA
3 nt differences from
aac(3)-IIe (EU022315)
26
26
TTAA
3'-CS
1247
aacA27
aac(3)-IIf arr6
ere(A)2
1 kb
sul1
Fig. 9. aac(3)-II regions. Various elements are represented as in earlier figures. (a) Contexts of aac(3)-IId-like genes. The asterisk against pKF3-140
indicates that the structure shown is a rearranged version of the sequence in GenBank, created by inverting the region between IS26 elements in
opposite orientations, which yields one IS26 flanked by DR at the position shown by the vertical arrow. (b) Contexts of aac(3)-IIe-like genes. The IS in
pC15-1a, pEK516 and pTN48 has not been named, but is 88% identical to ISKpn11. (c) Context of aac(3)-IIf in an IS1247-mediated transposition unit
flanked by 4-bp DR. The sequences used to draw the diagrams were from the following GenBank accession numbers: pCTX-M3, AF550415;
pSTMDT12_L, AP011958; pKF3-140, FJ876827; pK245, DQ449578; pHHV35, FJ012882; p3521, GU256641; Klebsiella pneumoniae 12836,
EU780013; Klebsiella oxytoca C994, GU189577. pC15-1a, AY458016; pTN48, FQ482074; pPMDHA, AJ971344.
IRt
26
6100
(a)
mph(A)
6100
Pa15
(b)
mph(F)
RSB111
IRt
CR?
(c)
mph(B)
(d)
PBP?
26
RSB105-1
mph(E)
msr(E)
exactly which resistance genes are present, as shown in Fig.
11b, is important.
Unfortunately, the available nomenclature for antibiotic
resistance genes can be extremely confusing. Different
nomenclature systems exist for some gene families, for
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
Fig. 10. Macrolide resistance regions. Various
elements are represented as in earlier figures.
The sequences used to draw the diagrams were
from the following GenBank accession numbers:
(a) mph(A), AJ698325; (b) mph(F), AM260957;
(c) mph(B), CP001232; (d) mph(E), DQ839391.
example those encoding aminoglycoside-modifying enzymes. In this case, two systems both distinguish genes
encoding N-acetyltransferases (aac), O-adenylyltransferases
(aad or ant) and O-phosphotransferases (aph), but indicate
the site of modification in different ways [e.g. aac(6 0 ) or
FEMS Microbiol Rev 35 (2011) 820–855
841
Analysis of the antibiotic resistance regions
(a)
(b)
(c)
(d)
(e)
(f)
Fig. 11. Annotation and analysis of the pIP1206 MRR (AM886293). Various elements are represented as in earlier figures. # indicates that a transposon
is incomplete. Pointed grey boxes represent IS26 and are distinguished by letters in parts (b)–(d). Structures shown in parts (d)–(f) are hypothetical, but
the rearrangements shown here regenerate complete versions of known components. (a) Selected ORFs as identified by a typical automated analysis
program (H, hypothetical protein). (b) Further analysis by searching for IR of common mobile elements (Table 3) and BLAST searches of separate segments.
Reference to various websites (Table 5) allows the precise annotation of resistance and transposase genes, mobile elements and their fragments. (c)
Marking the sequences of DR length flanking IS26 (8 bp) and IS1 (8 or 9 bp). Only DR of the same sequence (represented by a pair of filled circles of the
same colour) and flanking sequences that are the reverse complements of one another (represented by a filled circle and an open circle of the same
colour) are shown. Sequences are given on the right. These sequences suggest that IS1 has been directly inserted (the DR are 8 bp here) and that two
inversion events have taken place by recombination between IS26 elements in opposite orientations. (d) Inverting the regions between IS26-c and IS26d (shown by the short arrowed line) simulates recombination between these elements and yields two copies of IS26 flanked by DR. (e) Inverting the
regions between IS26-a and IS26-e (shown by the long arrowed line) simulates recombination between these elements and yields another copy of IS26
flanked by DR. The events shown in (d) and (e) could have occurred in either order. (f) Removing IS26 elements flanked by DR plus one copy of the 8-bp
repeated sequence reunites fragments of the plasmid backbone, of tnp21 and of the chrA region.
Table 5. Useful websites
bla genes
qnr genes
tet genes
MLS resistance genes
16s rRNA
methylases
ARDB
ARGO
Gene cassettes
ACID
INTEGRALL
XXR
ISfinder
ISbrowser
IScan
ISCR elements
Tn number registry
ACLAME
Artemis
ACT
Mauve
Website
Reference
http://www.lahey.org/Studies/
http://www.lahey.org/qnrStudies/
http://faculty.washington.edu/marilynr/
http://faculty.washington.edu/marilynr/
http://www.nih.go.jp/niid/16s_database/index.html
Bush & Jacoby (2010)
Jacoby et al. (2008)
Levy et al. (1999)
Roberts et al. (1999)
Doi et al. (2008)
http://ardb.cbcb.umd.edu/
http://www.argodb.org/
http://www2.chi.unsw.edu.au/rac
http://integron.biochem.dal.ca/ACID/phpbb3/
http://integrall.bio.ua.pt/
http://mobyle.pasteur.fr/cgi-bin/portal.py?form=xxr
http://www-is.biotoul.fr/is.html
http://www-genome.biotoul.fr/ISbrowser.php
http://www.ieu.uzh.ch/wagner/software/IScan/index.html
http://medicine.cf.ac.uk/en/research/research-groups/i3/research/antibacterial-agents/
iscr-elements/
http://www.ucl.ac.uk/eastman/tn/
http://aclame.ulb.ac.be/
http://www.sanger.ac.uk/resources/software/artemis/
http://www.sanger.ac.uk/resources/software/act/
http://gel.ahabs.wisc.edu/mauve
Liu & Pop (2009)
Scaria et al. (2005)
Partridge et al. (2009)
Joss et al. (2009)
Moura et al. (2009
Rowe-Magnus et al. (2003)
Siguier et al. (2006)
Kichenaradja et al. (2010)
Wagner et al. (2007)
Toleman et al. (2006b)
FEMS Microbiol Rev 35 (2011) 820–855
Roberts et al. (2008)
Leplae et al. (2010)
Rutherford et al. (2000)
Carver et al. (2005)
Darling et al. (2010)
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
842
aacA; aac(3) or aacC]. One system uses additional Roman
numerals to distinguish the different phenotypes conferred
(Shaw et al., 1993), while the other does not and is often
used for genes found in gene cassettes (Partridge et al.,
2009). In other cases, older names using Roman numerals
have been replaced by names with Arabic numerals (e.g. sulI,
sulII, sulIII vs. sul1, sul2, sul3 and dfrXVII vs. dfrA17), but
both types of names continue to be used. It is also not
uncommon to find different names/numbers used to indicate the same gene in different locations and, conversely,
the same name/number being used for different genes.
General databases of antibiotic resistance genes (ARDB,
ARGO; Table 5) also use varying nomenclature.
Several groups keep track of and assign names/numbers
to different families of antibiotic resistance genes (Table 5)
and consulting their websites and submitting sequences
before preparing GenBank entries and/or publication enables the correct name to be used or an appropriate name to
be assigned to a novel gene. Recently defined nomenclature
systems generally favour the use of letters for distinguishing
subgroups of genes that belong to the same overall family (e.g.
qnrA, qnrB) and numbers to distinguish more closely related
genes within each subgroup (e.g. qnrA1, qnrA2, qnrB1, qnrB2)
(Jacoby et al., 2008). Different tetracycline resistance operons
include a resistance gene, tetA, a regulatory gene, tetR, and
other associated genes and it important to indicate which type
is present by the use of a letter or a number following the
name, for example tetA(A) (Levy et al., 1999).
In some cases, it is the encoded proteins, rather than the
genes, that are numbered, the most obvious example being
those encoding the various b-lactamase families. Subscript
letters are sometimes used to distinguish slightly different genes
encoding a particular b-lactamase, for example the blaTEM
genes discussed above and different blaCTX-M variants.
Annotating mobile elements and their
fragments
Automated sequence analysis programs generally annotate
full-length transposase genes, but commonly just as a
‘transposase’, ‘integrase/recombinase’ or even just as hypothetical proteins (Fig. 11a; Kichenaradja et al., 2010) and
predicted orfs may cross boundaries between mobile elements. The IR and/or ends of mobile elements and partial
copies are often not annotated in sequences in GenBank or a
mobile element is given as the same coordinates as the
transposase gene it contains. Determining exactly which
mobile elements are present and their boundaries, as shown
in Fig. 11b, is important to extract the most useful information MRR sequences.
The boundaries of complete versions and some fragments
of common mobile elements can rapidly be identified using
sequence analysis software to search for their IR sequences
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S.R. Partridge
(Table 3). A number of websites can also assist in annotating
mobile elements (Table 5). ISfinder provides a BLAST search
function that can be used to identify known IS or their
relatives in a sequence, with links to pages that provide
information about each IS, such as IR lengths and sequences, DR lengths and other characteristics. Newly identified IS can also be submitted for the assignment of names/
numbers, while a separate website is dedicated to ISCR
elements. IScan can detect specified IS in genomes and
ISbrowser has been designed to visualize IS locations on
expertly annotated genomes, including plasmids.
Several websites provide information about gene cassettes
and integrons. XXR can be used to identify attC sites, ACID
provides annotations of integrons and tools to detect cassettes
and integrons in novel sequence data, while INTEGRALL is a
collection of data on integrons, including lists of known
cassette arrays. Instructions for identifying cassette boundaries
and attC sites can be found in a recent review, which also lists
all gene cassettes found in mobile resistance integrons, with
suggested nomenclature and references to exemplar sequences
(Partridge et al., 2009). The Repository of Antibiotic-resistance Cassettes (RAC) provides updated lists and sequences
can be submitted for the annotation of gene cassettes (G.
Tsafnat & S.R. Partridge, unpublished data). The transposon
number registry lists recently identified transposons and
assigns numbers to newly identified examples, while ACLAME
is a website dedicated to mobile genetic elements.
Finding evidence of insertions
Identifying sequences of the expected DR length adjacent to
each copy of IS and transposons that create such repeats
(Fig. 11c) can be very helpful in analysing MRR. Matching
sequences of the expected DR length flanking a mobile
element or composite transposon provide direct evidence
of insertion, as in Fig. 11c, where one copy of IS1 has
matching 8-bp flanking sequences. Potential DR that are not
immediately adjacent to the ends of the mobile element, that
overlap with the IR, that differ by a base or two or that are
not the expected length are unlikely to be real evidence of an
insertion. However, mobile elements may occasionally create DR of an atypical length for example Tn5393 in pEFER
(CU928144) and the ISEcp1-blaCTX-M-17 transposition unit
in pIP843 (Cao et al., 2002) both appear to be flanked by 6bp DR, rather than the expected 5 bp. In the first case, an
uninterrupted version of the flanking sequence is available
to confirm this. Identifying DR flanking terminal fragments
of a mobile element bounding an MRR can also provide
evidence of potential ‘founder’ elements.
Identifying rearrangements
Tools for visualizing sequence comparisons, such as Mauve
and Artemis/ACT (Table 5), may be useful in identifying
FEMS Microbiol Rev 35 (2011) 820–855
843
Analysis of the antibiotic resistance regions
rearrangements, particularly those involving large segments,
but more detailed analysis may be required to understand
how these may have taken place. The identification of a
sequence of the DR length adjacent to one end of a repeated
element and the reverse complement of this sequence
adjacent to the other end of another copy, as shown in Fig.
2a, suggests inversion by homologous recombination between these elements. In Fig. 11c, identifying such sequences
suggests two inversions by recombination in IS26, which
could have occurred in either order. Figures 11d and 11e
simulate the effects of reversing these events by inverting the
regions between the relevant copies of IS26. This recreates a
structure in which all three copies of IS26 are flanked by DR,
indicative of insertions. Removing these IS plus one copy of
the DR, as shown in Fig. 11f, yields uninterrupted versions
of other recognizable MRR components or the plasmid
backbone, generating the presumed ancestral structure.
Identifying common boundaries between
mobile elements
Papers describing MRR often indicate the extents of regions
that match part of one other known MRR sequence,
presumably the first listed in a BLASTN search result. This is
usually not very helpful if the region in question is a
common MRR component or a common module composed
of several components. Searches with short sequences that
overlap the boundaries between mobile elements or other
distinct regions can be used to determine how common
these combinations are in available sequences and suggest
relationships with other MRR.
Examples of MRR structures, evolution
and relationships
Many sequences of complete plasmids and genomic islands
carrying MRR from human clinical samples, animals and
various environments are now available in GenBank. Detailed analysis and comparison of these sequences reveals
examples of relationships between MRR in different contexts and variations that illustrate the principles outlined in
this review. Some examples from plasmids and chromosomes of different species of Enterobacteriaceae from different times and locations (see Table 6 for details) are shown in
Fig. 12 and discussed in the following sections. Other
structures, such as SGI variants (see references in Table 1 in
Levings et al., 2008), AbaR variants (see references in Table 1
in Post & Hall, 2009 plus Adams et al., 2010) and the SXTlike ICE (Garriss et al., 2009), also share components with
these MRR and display similar variations in structure, but
will not be discussed here.
Different levels of mobility
R100 (also called NR1; IncFII), one of the earliest ‘resistance
transfer factors’ identified (Nakaya et al., 1960), carries
Tn2670, also known as the resistance determinant (r-det).
This nested structure consists of a composite transposon
related to Tn9 into which Tn21 is inserted (Fig. 12a). This
Table 6. Details of the sources of MRR shown in Fig. 12
R100 (NR1)
042
pAKU_1
UMN026
T000240
2a (SRL)
pRSB107
pIP1206
pKF3-140
pRMH760
peH4H
pSN254
pAR060302
pAM04528
pCTX-M3
pEK499
pTN48
GenBank
Plasmid Inc.
Size (kb)
Species
Sourcew
Countryw
Yearw
References
AP000342
FN554766
AM412236
CU928163
AP011957
AF326777
AJ851089
AM886293
FJ876827
AY123253
FJ621586
CP000604
FJ621588
FJ621587
AF550415
EU935739
FQ482074
FII
Chromosome
HI1
Chromosome
Chromosome
Chromosome
FII FIA FIB
FII FIA FIB
FIIKz FIA FIB
A/C‰
A/C
A/C
A/C
A/C
L/M
FII FIA
FII FIB
94 281
NA
212 711
NA
NA
NA
120 592
168 113
147416
partial
148 105
176 473
166 530
158 213
89 468
117 536
165 657
S. flexneri
E. coli EAEC
S. Paratyphi
E. coli
S. Typhimurium
S. flexneri
uncultured
E. coli
K. pneumoniae
K. pneumoniae
E. coli
S. Newport
E. coli
S. Newport
C. freundii
E. coli
E. coli
–
Human
Human
–
Human
Primate
WWTPz
Human
Human
Human
Cow
–
Cow
Human
Human
Human
Human
Japan
Peru
Pakistan
–
Japan
Japan
Germany
Belgium
China
Australia
USA
–
USA
USA
Poland
UK
France
1950s
1983
2002
–
2000
–
–
–
2006
1997
2002
–
2002
1998
1996
2001?
2004
Nakaya et al. (1960)
Chaudhuri et al. (2010)
Holt et al. (2007)
–
Izumiya et al. (2011)
Luck et al. (2001)
Szczepanowski et al. (2005)
Périchon et al. (2008)
Zhao et al. (2010)
Partridge & Hall (2004)
Call et al. (2010)
Welch et al. (2007)
Call et al. (2010)
Call et al. (2010)
Gołe˛biewski et al. (2007)
Woodford et al. (2009)
Billard-Pomares et al. (2011)
NA, not applicable; partial indicates that the entire plasmid has not been sequenced.
w
Dashes indicate that the relevant information could not be found.
See Villa et al. (2010).
‰
Presumed to be an IncA/C plasmid from small stretches of available sequence flanking the MRR.
z
FEMS Microbiol Rev 35 (2011) 820–855
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
844
S.R. Partridge
(a)
(b)
(c)
(d)
(e)
Fig. 12. Illustrative MRR from different plasmids and chromosomes. Various elements are represented as in earlier figures, with additional information
given in keys. Boxes containing letters represent different cassette arrays, as indicated in the key. Various resistance genes names are indicated at their
first occurrence only. DR are shown as paired filled circles of the same colour. An unpaired circle indicates that the same boundary between regions is
also present in another of the structures shown. Asterisks against plasmid/strain names indicate that the structures shown have been rearranged to
emphasize relationships, usually by inverting regions flanked by IS26. Vertical arrows indicate the positions of IS26 elements flanked by DR that have
been removed for ease of comparison. (a) Different levels of mobility illustrated by Tn2670. Curved lines indicate the extent of the cassette array, In2 and
Tn21. (b) Examples of MRR related to Tn2670, illustrating the evolution and spread of an MRR. The region labelled Pa in Escherichia coli 042 represents
part of the IncPa plasmid backbone and the line labelled rep in pAKU_1 is part of the RSF1010 rep region (see Fig. 8b and c). (c) Regions carrying
Tn2670-like MRR and truncated copies of Tn10 (see Fig. 3b). The rearrangements to generate the pIP1206 structure are shown in detail in Fig. 11. (d)
The pRMH760 MRR and related regions found on IncA/C plasmids. ISCR1-dfrA10 is inserted into pRMH760 and ISCR16-aac(3)-VIa into peH4H, pSN254
and pAR060302, in both cases flanked by duplications of the 3 0 -CS (shown by horizontal lines). More detailed diagrams of these regions can be found in
Partridge & Hall (2004) and Hall (2007), respectively. (e) Examples of large complex MRR that include important resistance genes that have emerged
recently. The circular molecule shown below the pTN48 MRR could have been inserted by homologous recombination in IS26. The region in pink
matches regions found in various Gram-positive bacteria. The sequences used to draw the diagrams were from the GenBank accession numbers listed in
Table 6.
structure illustrates how resistance genes in MRR can have
several levels of mobility as the aadA1a gene cassette could
move independently (either mediated by IntI1 or by homo2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
logous recombination in the CS), as part of In2 (if the
necessary Tni proteins are provided), as part of Tn21
(transposition of the entire transposon or one-ended
FEMS Microbiol Rev 35 (2011) 820–855
845
Analysis of the antibiotic resistance regions
transposition, TnpR-mediated site specific recombination
or homologous recombination of segments). The whole of
Tn2670 can also move as a composite transposon (Iida et al.,
1981) or as a circle generated by homologous recombination
(Silver et al., 1980).
Evolution and spread of MRR
A number of available MRR sequences include the tnp21
and/or mer21 regions adjacent to parts of Tn9 with the same
boundaries as in Tn2670, but contain different cassette
arrays, insertions of different modules and/or various deletions (Fig. 12b). The three structures shown are from two
different species, from a plasmid and the chromosome and
from at least two locations (Table 6), and illustrate how large
complex MRR may persist, evolve and spread. All are
flanked by directly oriented copies of IS1 and DR and could
have been inserted as composite transposons or as circular
molecules.
Complex structures can indicate relationships
between MRR
The R100 backbone carries Tn10 (see Fig. 3b) in addition to
Tn2670 and in some MRR a Tn2670-related structure abuts
a truncated version of Tn10 (Fig. 12c). One end of this
region in several plasmids is defined by a multi-IS structure
containing IS1 flanked by DR in an IS10 element that abuts
149 bp of the IRR end of IS26, which is followed by a
remnant of an IS4321-like element interrupting a 38-bp IR
(Fig. 12c). This complex structure was presumably only
generated once and MRR containing the entire structure or
truncated versions are likely to be derived from one another.
MRR become more complex, but can also
degenerate
The MRR of pRMH760 could have been created by the
incorporation of a circular Tn2670-like element into a
Tn1696-like transposon by homologous recombination in
the 3 0 -CS and TnpR-mediated site-specific recombination
between the res sites of Tn21 and another transposon
(Partridge & Hall, 2004). This MRR includes two commonly
encountered structures: Tn2 inserted into mer21 (Novais
et al., 2010) and Tn4352 (Fig. 3c) inserted into tni402. Like
the examples in the previous section, pRMH760 illustrates
how MRR can become very large and complex.
The boundaries of the pRMH760 MRR match those
between the MRR and backbones of several IncA/C plasmids
(Fig. 12d) and the MRR in these plasmids appear to be
derivatives of the pRMH760 MRR structure that have
undergone deletions of progressively larger segments. These
could be explained by the insertion of directly oriented IS26
elements, followed by recombination between them. The IR
FEMS Microbiol Rev 35 (2011) 820–855
of all Tn21-like transposon fragments in these structures
have insertions of IS4321 or IS5075, but differences between
pRMH760 and the others suggest insertion at two different
times.
Complex MRR containing ‘old’ components plus
important ‘new’ resistance genes
Most of the MRR illustrated in Fig. 12a–d carry mainly ‘old’
resistance genes that apparently emerged some time ago.
The MRR illustrated in Fig. 12e include selections of these
same common MRR components, but also one or more
important resistance genes that have apparently emerged
more recently. The pCTX-M3 MRR, which carries the armA
16S rRNA methylase gene, is bounded by the ends of Tn2
flanked by 5-bp DR. This suggests that Tn2 was first inserted
into the plasmid backbone and underwent multiple insertions of additional components (Gołe˛biewski et al., 2007).
pCTX-M360, with a very similar backbone and a complete
copy of Tn2 inserted in the same place and flanked by the
same DR, has since been identified (Zhu et al., 2009).
pEK499 carries the blaCTX-M-15 gene, which has become
dominant worldwide, as part of an MRR that includes a
cassette array that is flanked by IS26 elements rather than the
5 0 -CS and 3 0 -CS of class 1 In/Tn. Although the outer ends of
the IS26 are not flanked by DR, it is possible that this cassette
array was originally captured from a class 1 In/Tn as a
composite transposon. The pEK499 MRR is related to the
MRR of pC15-1a, the first blaCTX-M-15 plasmid to be
sequenced (Boyd et al., 2004; see Fig. 13b), but some regions
are missing and pEK499 includes a class 1 In/Tn and other
regions not found on pC15-1a.
The pTN48 MRR includes another important gene,
blaCTX-M-14, as part of an ISEcp1 transposition unit flanked
by DR. An erm(B) gene is also present with ISCR14 in a
region flanked by directly oriented copies of IS26, with
matching 8-bp sequences adjacent to their inner ends. This
suggests that a circular molecule containing one copy of IS26
flanked by DR of this sequence (Fig. 12e), presumably
generated by ISCR14 rolling circle replication, was inserted
by recombination with an IS26 element in a pre-existing
MRR. The region containing erm(B), including the small
fragment beyond IRR of IS26 in the circular molecule, is
closely related to part of several plasmids and transposons
found in Gram-positive bacteria (Brisson-Noël et al., 1988).
Metagenomic sequencing data relating to
multiresistance
Data from several recent studies using metagenomic approaches to examine resistant isolates and/or plasmids seem
to confirm the dominance of a limited set of resistance
genes, MRR components and combinations of components.
In one study, pooled plasmid DNA from sets (about 100
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
846
S.R. Partridge
each) of clinical K. pneumoniae isolated at two different
times was sequenced using Illumina technology. Sequences
were then mapped to three plasmids from a single K.
pneumoniae isolate from the same hospital sequenced by
conventional methods (Zhao et al., 2010). Detailed analysis
of one plasmid (pKF3-140) allows the coverage in a specific
section of the MRR to be directly related to known components (Fig. 13a). The regions with the highest coverage in
both sets correspond to IS26 and high coverage of the 5 0 -CS
and 3 0 -CS suggests that ‘clinical’ class 1 In/Tn are also
common. Despite being one of the most frequently reported
cassette arrays (Fig. 12; Partridge et al., 2009) |dfrA17|aadA5|
has a relatively low coverage, but few examples of this array
in GenBank are from K. pneumoniae ( o 10) compared with
E. coli ( 4 75) and dfrA17 is apparently rare in K. pneumo-
Position
(a)
40 000
niae (Brolund et al., 2010). Coverage of the sul2/strAB region
is apparently higher in the earlier set, while coverage of chrA/
mph(A) is higher in the later set. The right-hand end of the
pKF3-140 MRR sequence shown corresponds to part of the
aac(3)-IId region, but has apparently undergone an IS26mediated rearrangement, and ISCfr1, which is not found in
all structures carrying this resistance gene (Fig. 9a), has
lower coverage. Similar results were obtained by mapping
454 pyrosequencing data from mixed resistance plasmid
populations obtained from uncultured organisms in a
wastewater treatment plant to known plasmid sequences
(Szczepanowski et al., 2008).
In another study, fragments conferring resistance to
various antibiotics cloned from two human gut microbiomes were sequenced (Sommer et al., 2009). Sequences
45 000
50 000
55 000
Coverage
800
600
400
200
5'
pKF3-140
1
3'
IRchrA IR t
26 Cfr1
26
|dfrA17| sul1
|aadA5|
(b)
IRstr
26
chrA
mph(A)
sul2 strAB
tetA(A)
26 10
tni 402
IR TEM
26
Ecp1
pC15-1a
bla TEM-1b
AX _iG1 _01
AX_iG1_04
AX_iG1_08
CA_iG1_09
CA_iG1_11
CF_iG1_01
PE_iG1_09
26
aac(3)-IIe
blaCTX-M-15
26
26
|aacA4cr|oxa30|
GE_ iG1_ 01
GE_iG1_04
GE_iG1_06
AM _iG1 _03
AM_iG1_07
AM_iG1_19
SI_iG1_02
SI_iG1_01
Fig. 13. Metagenomic analysis of antibiotic resistance genes and plasmids. (a) Mapping of sequencing reads to part of pKF3-140 (adapted from
Supporting information Fig. S1 of Zhao et al., 2010). Klebsiella pneumoniae isolates were divided into two categories: S1, n = 110 from 2002 to 2006
(blue); S2, n = 96 from 2007 to 2008 (pink). Short Illumina sequencing reads from pooled plasmid samples were mapped to pKF3-140. Details of the
components in the corresponding region of pKF3-140 (FJ876827) are shown below, with components represented as in earlier figures and various
regions and IR labelled. Dotted vertical lines identify the boundaries of defined segments. (b) Sequences from culturable isolates identified during
analysis of a human gut microbiome (Sommer et al., 2009) correspond to parts the MRR of pC15-1a (AY458016), shown at the top. Regions identified
in cloned fragments are shown below, from sequences in GenBank accession numbers listed in Table S6 of Sommer et al. (2009) and labelled with the
Gene ID, where two-letter codes indicate the antibiotic used for selection (AX, amoxicillin; CA, carbenicillin; CF, cefdinir; GE, gentamicin; MN,
minocycline; OX, oxytetracycline; PE, penicillin G; PI, piperacillin; SI, sisomicin; TE, tetracycline) and iG1 indicates inserts from cultured isolates from
microbiome 1.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
FEMS Microbiol Rev 35 (2011) 820–855
847
Analysis of the antibiotic resistance regions
identified as transposases corresponded to fragments of
IS26, Tn2, Tn2a, ISEcp1 and Tn1721 and fragments from
one individual included the blaTEM-1b, blaCTX-M-15, aac(6 0 )Ib-cr and aac(3)-IIe resistance genes. The presence of
distinctive boundaries between different genetic components previously found almost exclusively in related MRR
carrying blaCTX-M-15 (Fig. 13b) suggests that the sequences
are derived from related plasmids. Further mapping of this
type of short read data to common MRR components may
yield additional information.
Concluding remarks
The information provided in this review, particularly in
Figs 11 and 12, illustrates how transferable multiresistance
in Gram-negative bacteria appears to be generated by rare
gene capture events mediated by different mobile genetic
elements, clustering of resistance genes and associated
mobile elements and combinatorial evolution between a
limited number of shared components.
In addition to the actions of individual mobile elements,
homologous recombination is clearly extremely important
in both the movement of resistance genes (e.g. cassette
arrays, ISCR1-associated genes) and the creation and evolution of MRR. The accumulation of common components in
large regions (see Fig. 12) increases the targets for homologous recombination events. If the mobile element that
captures a resistance gene is one of these components, or
quickly transfers the gene to a region containing such
elements, the emerging gene may able to spread very rapidly
between existing structures. A number of plasmids carrying
the globally successful blaCTX-M-15 gene have now been
sequenced and in most cases this gene seems to be associated
with not only ISEcp1 but also Tn2, a very common MRR
component, in large related MRR, although clearly particular plasmids and bacterial strains are also very important in
the dissemination of this gene. blaKPC, initially associated
with a ‘new’ transposon, seemed to spread only locally at
first, but is now expanding its range, which may partly
reflect an increasing association with more typical MRR
components. If a captured gene is ‘unlucky’ and does not
become associated with common MRR components, its
spread may be very limited. Like blaCTX-M-15, rmtC is
associated with ISEcp1, but its wider context(s) are not
known and rmtC is rarely identified compared with the
armA and rmtB 16S rRNA gene methylases found in large
complex MRR (see Fig. 12). There are many other examples
of resistance genes that have only been identified very rarely
and that may have emerged only to disappear again.
One mobile element in particular, IS26, seems to be very
important in relation to multiresistance in Gram-negative
bacteria, being found in many different species on plasmids
and the chromosome. As well as being able to form a
FEMS Microbiol Rev 35 (2011) 820–855
number of composite transposons (Fig. 3), recombination
between inverted copies of IS26 also seems to be responsible
for the generation of many different rearrangements in
MRR. Some MRR also include segments corresponding to
the ‘payloads’ of different composite transposons separated
by a single IS26 element, for example the adjacent Tn4352
(Fig. 3c) and Tn6029 (Fig. 8c) regions in pAKU_1 and
pRSB107 (Fig. 12c) and the aac(3)-II and erm(B) regions in
pTN48 (Fig. 12e). Such structures presumably arise by
recombination between IS26 elements flanking different
composite transposons or by incorporation of circular
molecules by homologous recombination (see Fig. 2b) into
an IS26 element that is already part of a composite transposon. While IS26 can insert resistance genes, it can also cause
extensive rearrangements and resistance genes may also be
deleted, for example the aac(3)-IIe region is found in the
pC15-1a MRR (Fig. 13b), but not the related pEK499 MRR
(Fig 12e). Thus, not all of the actions of IS26 may be
beneficial, but the presence of this element in MRR potentially provides great flexibility to create different structures,
some of which are likely to be selected for.
The combination of all of the factors discussed above has
allowed Gram-negative bacteria to resist the actions of
antibiotics and there is no reason to suppose that this will
change as new antibiotics are developed. There are clearly
huge reservoirs of potential antibiotic resistance genes in
various environments and identifying and characterizing
them could identify new mechanisms of resistance that may
inform the development of new antimicrobial agents
(Cantón, 2009). However, relatively few resistance genes
appear to dominate in clinically important bacteria and it
is not possible to predict which genes may become mobilized and available to the pathogenic bacteria that cause
infections (Courvalin, 2005, 2008). Predicting which emerging genes are likely to become the most problematic
and which other resistance genes they are likely to become
associated with, which is crucial for the management of
multiantibiotic resistance, may be possible if we had the
right data.
Currently available plasmid and other sequences relating
to multiresistance can at best only provide hints to fully
understanding the processes involved, as we are missing
many informative structures. Sequenced examples of plasmids and other regions have generally been selected somewhat randomly, so the available set is likely to be biased, and
sequences are often poorly or incompletely analysed, so that
important information is lost. Large-scale sequencing of
plasmids and/or genomes is becoming more and more
feasible and cost-effective, but examples from different
geographic locations and times need to be carefully and
systematically selected to provide the most useful information (O’Brien, 2002). Dealing with nomenclature issues and
developing improved bioinformatic methods tailored to the
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
848
characteristics of the complex sequences involved in multiresistance in Gram-negative bacteria are also needed to
make best use of these data.
Acknowledgements
I would like to thank Jon Iredell, for interesting discussions,
for encouraging me to think about the bigger picture and for
comments on this manuscript. Working with Ruth Hall for
several years gave me an excellent introduction to this field
and supervising Zhiyong Zong and collaborating with Guy
Tsafnat also contributed to the ideas in this review. Thanks
are also due to the Editor and two reviewers for suggesting
improvements, Marilyn Roberts for help with MLS resistance gene nomenclature, Hatch Stokes for useful discussion
during revision and Andrew Ginn for help with checking the
manuscript. I was partly funded by grant no. 512396 from
the National Health and Medical Research Council of
Australia.
References
Adams MD, Chan ER, Molyneaux ND & Bonomo RA (2010)
Genomewide analysis of divergence of antibiotic resistance
determinants in closely related isolates of Acinetobacter
baumannii. Antimicrob Agents Ch 54: 3569–3577.
Allmeier H, Cresnar B, Greck M & Schmitt R (1992) Complete
nucleotide sequence of Tn1721: gene organization and a novel
gene product with features of a chemotaxis protein. Gene 111:
11–20.
Ambler RP, Coulson AF, Frère JM, Ghuysen JM, Joris B, Forsman
M, Levesque RC, Tiraby G & Waley SG (1991) A standard
numbering scheme for the class A b-lactamases. Biochem J 276:
269–270.
Aubert D, Naas T, Héritier C, Poirel L & Nordmann P (2006)
Functional characterization of IS1999, an IS4 family element
involved in mobilization and expression of b-lactam resistance
genes. J Bacteriol 188: 6506–6514.
Avila P, de la Cruz F, Ward E & Grinsted J (1984) Plasmids
containing one inverted repeat of Tn21 can fuse with other
plasmids in the presence of Tn21 transposase. Mol Gen Genet
195: 288–293.
Avila P, Grinsted J & de la Cruz F (1988) Analysis of the variable
endpoints generated by one-ended transposition of Tn21.
J Bacteriol 170: 1350–1353.
Bae IK, Lee YH, Jeong HJ, Hong SG, Lee SH & Jeong SH (2008) A
novel blaCTX-M-14 gene-harboring complex class 1 integron
with an In4-like backbone structure from a clinical isolate of
Escherichia coli. Diagn Micr Infec Dis 62: 340–342.
Bailey J, Pinyon J, Anantham S & Hall R (2011) Distribution of
the blaTEM gene and blaTEM-containing transposons in
commensal Escherichia coli. J Antimicrob Chemoth 66:
745–751.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S.R. Partridge
Baquero F (2004) From pieces to patterns: evolutionary
engineering in bacterial pathogens. Nat Rev Microbiol 2:
510–518.
Barlow M & Hall BG (2002) Origin and evolution of the AmpC
b-lactamases of Citrobacter freundii. Antimicrob Agents Ch 46:
1190–1198.
Billard-Pomares T, Tenaillon O, Le Nagard H, Rouy Z, Cruveiller
S, Médigue C, Arlet G, Denamur E & Branger C (2011)
Complete nucleotide sequence of plasmid pTN48, encoding
the CTX-M-14 extended-spectrum b-lactamase from an
Escherichia coli O102-ST405 strain. Antimicrob Agents Ch 55:
1270–1273.
Boyd DA, Tyler S, Christianson S et al. (2004) Complete
nucleotide sequence of a 92-kilobase plasmid harbouring the
CTX-M-15 extended-spectrum beta-lactamase involved in an
outbreak in long-term-care facilities in Toronto, Canada.
Antimicrob Agents Ch 48: 3758–3764.
Boyd DA, Shi X, Hu QH, Ng LK, Doublet B, Cloeckaert A &
Mulvey MR (2008) Salmonella genomic island 1 (SGI1),
variant SGI1-I, and new variant SGI1-O in Proteus mirabilis
clinical and food isolates from China. Antimicrob Agents Ch
52: 340–344.
Brinkley C, Burland V, Keller R, Rose DJ, Boutin AT, Klink SA,
Blattner FR & Kaper JB (2006) Nucleotide sequence analysis of
the enteropathogenic Escherichia coli adherence factor plasmid
pMAR7. Infect Immun 74: 5408–5413.
Brisson-Noël A, Arthur M & Courvalin P (1988) Evidence for
natural gene transfer from Gram-positive cocci to Escherichia
coli. J Bacteriol 170: 1739–1745.
Brolund A, Sundqvist M, Kahlmeter G & Grape M (2010)
Molecular characterisation of trimethoprim resistance in
Escherichia coli and Klebsiella pneumoniae during a two year
intervention on trimethoprim use. PLoS One 5: e9233.
Brown HJ, Stokes HW & Hall RM (1996) The integrons In0, In2,
and In5 are defective transposon derivatives. J Bacteriol 178:
4429–4437.
Brown NL, Winnie JN, Fritzinger D & Pridmore RD (1985) The
nucleotide sequence of the tnpA gene completes the sequence
of the Pseudomonas transposon Tn501. Nucleic Acids Res 13:
5657–5669.
Burland V, Shao Y, Perna NT, Plunkett G, Sofia HJ & Blattner FR
(1998) The complete DNA sequence and analysis of the large
virulence plasmid of Escherichia coli O157:H7. Nucleic Acids
Res 26: 4196–4204.
Bush K & Jacoby GA (2010) Updated functional classification of
b-lactamases. Antimicrob Agents Ch 54: 969–976.
Cain AK, Liu X, Djordjevic SP & Hall RM (2010) Transposons
related to Tn1696 in IncHI2 plasmids in multiply antibiotic
resistant Salmonella enterica serovar Typhimurium from
Australian animals. Microb Drug Resist 16: 197–202.
Call DR, Singer RS, Meng D, Broschat SL, Orfe LH, Anderson JM,
Herndon DR, Kappmeyer LS, Daniels JB & Besser TE (2010)
blaCMY-2-positive IncA/C plasmids from Escherichia coli and
Salmonella enterica are a distinct component of a larger lineage
of plasmids. Antimicrob Agents Ch 54: 590–596.
FEMS Microbiol Rev 35 (2011) 820–855
849
Analysis of the antibiotic resistance regions
Cambray G, Guerout AM & Mazel D (2010) Integrons. Annu Rev
Genet 44: 141–166.
Cantón R (2009) Antibiotic resistance genes from the
environment: a perspective through newly identified antibiotic
resistance mechanisms in the clinical setting. Clin Microbiol
Infect 15 (Suppl. 1): 20–25.
Cao V, Lambert T & Courvalin P (2002) ColE1-like plasmid
pIP843 of Klebsiella pneumoniae encoding extended-spectrum
b-lactamase CTX-M-17. Antimicrob Agents Ch 46: 1212–1217.
Carattoli A (2009) Resistance plasmid families in
Enterobacteriaceae. Antimicrob Agents Ch 53: 2227–2238.
Carver TJ, Rutherford KM, Berriman M, Rajandream MA, Barrell
BG & Parkhill J (2005) ACT: the Artemis comparison tool.
Bioinformatics 21: 3422–3423.
Cattoir V, Poirel L, Mazel D, Soussy CJ & Nordmann P (2007)
Vibrio splendidus as the source of plasmid-mediated QnrS-like
quinolone resistance determinants. Antimicrob Agents Ch 51:
2650–2651.
Chandler M & Mahillon J (2002) Insertion sequences revisited.
Mobile DNA II (Craig NL, Craigie R, Gellert M & Lambowitz
AM, eds), pp. 305–366. ASM Press, Washington, DC.
Chaudhuri RR, Sebaihia M, Hobman JL et al. (2010) Complete
genome sequence and comparative metabolic profiling of the
prototypical enteroaggregative Escherichia coli strain 042. PLoS
One 5: e8801.
Chen ST & Clowes RC (1987) Variations between the nucleotide
sequences of Tn1, Tn2, and Tn3 and expression of b-lactamase
in Pseudomonas aeruginosa and Escherichia coli. J Bacteriol 169:
913–916.
Chen YG, Qu TT, Yu YS, Zhou JY & Li LJ (2006) Insertion
sequence ISEcp1-like element connected with a novel aph(200 )
allele [aph(200 )-Ie] conferring high-level gentamicin resistance
and a novel streptomycin adenylyltransferase gene in
Enterococcus. J Med Microbiol 55: 1521–1525.
Chiou CS & Jones AL (1993) Nucleotide sequence analysis of a
transposon (Tn5393) carrying streptomycin resistance genes
in Erwinia amylovora and other Gram-negative bacteria.
J Bacteriol 175: 732–740.
Clark AJ & Sandler SJ (1994) Homologous genetic
recombination: the pieces begin to fall into place. Crit Rev
Microbiol 20: 125–142.
Collis CM & Hall RM (1992) Gene cassettes from the insert
region of integrons are excised as covalently closed circles. Mol
Microbiol 6: 2875–2885.
Collis CM, Grammaticopoulos G, Briton J, Stokes HW & Hall
RM (1993) Site-specific insertion of gene cassettes into
integrons. Mol Microbiol 9: 41–52.
Corvec S, Caroff N, Espaze E, Giraudeau C, Drugeon H &
Reynaud A (2003) AmpC cephalosporinase hyperproduction
in Acinetobacter baumannii clinical strains. J Antimicrob
Chemoth 52: 629–635.
Corvec S, Poirel L, Naas T, Drugeon H & Nordmann P (2007)
Genetics and expression of the carbapenem-hydrolyzing
oxacillinase gene blaOXA-23 in Acinetobacter baumannii.
Antimicrob Agents Ch 51: 1530–1533.
FEMS Microbiol Rev 35 (2011) 820–855
Courvalin P (2005) Antimicrobial drug resistance: ‘‘Prediction is
very difficult, especially about the future’’. Emerg Infect Dis 11:
1503–1506.
Courvalin P (2008) Predictable and unpredictable evolution of
antibiotic resistance. J Intern Med 264: 4–16.
Darling AE, Mau B & Perna NT (2010) progressiveMauve:
multiple genome alignment with gene gain, loss and
rearrangement. PLoS One 5: e11147.
D’Costa VM, McGrann KM, Hughes DW & Wright GD (2006)
Sampling the antibiotic resistome. Science 311: 374–377.
Doi Y, Wachino J & Arakawa Y (2008) Nomenclature of plasmidmediated 16S rRNA methylases responsible for
panaminoglycoside resistance. Antimicrob Agents Ch 52:
2287–2288.
Doublet B, Boyd D, Mulvey MR & Cloeckaert A (2005) The
Salmonella genomic island 1 is an integrative mobilizable
element. Mol Microbiol 55: 1911–1924.
Doublet B, Golding GR, Mulvey MR & Cloeckaert A (2007)
Potential integration sites of the Salmonella genomic island 1
in Proteus mirabilis and other bacteria. J Antimicrob Chemoth
59: 801–803.
Ford PJ & Avison MB (2004) Evolutionary mapping of the SHV
b-lactamase and evidence for two separate IS26-dependent
blaSHV mobilization events from the Klebsiella pneumoniae
chromosome. J Antimicrob Chemoth 54: 69–75.
Fosse T, Giraud-Morin C, Madinier I & Labia R (2003) Sequence
analysis and biochemical characterisation of chromosomal
CAV-1 (Aeromonas caviae), the parental cephalosporinase of
plasmid-mediated AmpC ‘FOX’ cluster. FEMS Microbiol Lett
222: 93–98.
Francia MV, de la Cruz F & Garcı́a Lobo JM (1993) Secondarysites for integration mediated by the Tn21 integrase. Mol
Microbiol 10: 823–828.
Frost LS, Leplae R, Summers AO & Toussaint A (2005) Mobile
genetic elements: the agents of open source evolution. Nat Rev
Microbiol 3: 722–732.
Garcillán-Barcia M, Bernales I, Mendiola M & De la Cruz F
(2002) IS91 rolling circle transposition. Mobile DNA II (Craig
NL, Craigie R, Gellert M & Lambowitz AM, eds), pp. 891–904.
ASM Press, Washington, DC.
Garriss G, Waldor MK & Burrus V (2009) Mobile antibiotic
resistance encoding elements promote their own diversity.
PLoS Genet 5: e1000775.
Gestal AM, Stokes HW, Partridge SR & Hall RM (2005)
Recombination between the dfrA12-orfF-aadA2 cassette array
and an aadA1 gene cassette creates a hybrid cassette, aadA8b.
Antimicrob Agents Ch 49: 4771–4774.
Gillings M, Boucher Y, Labbate M, Holmes A, Krishnan S, Holley
M & Stokes HW (2008) The evolution of class 1 integrons and
the rise of antibiotic resistance. J Bacteriol 190: 5095–5100.
Gołe˛biewski M, Kern-Zdanowicz I, Zienkiewicz M, Adamczyk M,
Żyliǹska J, Baraniak A, Gniadkowski M, Bardowski J &
Cegłowski P (2007) Complete nucleotide sequence of the pCTXM3 plasmid and its involvement in spread of the extended-
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
850
spectrum b-lactamase gene blaCTX-M-3. Antimicrob Agents Ch 51:
3789–3795.
Gootz TD, Lescoe MK, Dib-Hajj F, Dougherty BA, He W, DellaLatta P & Huard RC (2009) Genetic organization of
transposase regions surrounding blaKPC carbapenemase genes
on plasmids from Klebsiella strains isolated in a New York city
hospital. Antimicrob Agents Ch 53: 1998–2004.
Grindley NDF (2002) The movement of Tn3-like elements:
transposition and cointegrate resolution. Mobile DNA II
(Craig NL, Craigie R, Gellert M & Lambowitz AM, eds), pp.
272–302. ASM Press, Washington, DC.
Grinsted J, de la Cruz F & Schmitt R (1990) The Tn21 subgroup
of bacterial transposable elements. Plasmid 2: 163–189.
Haines AS, Jones K, Batt SM, Kosheleva IA & Thomas CM (2007)
Sequence of plasmid pBS228 and reconstruction of the IncP1a phylogeny. Plasmid 58: 76–83.
Hall RM (2007) Antibiotic resistance gene cluster of pAPEC-O1R. Antimicrob Agents Ch 51: 3461–3462.
Hall RM (2010) Salmonella genomic islands and antibiotic
resistance in Salmonella enterica. Future Microbiol 5:
1525–1538.
Harada S, Ishii Y, Saga T, Tateda K & Yamaguchi K (2010)
Chromosomally encoded blaCMY-1 located on a novel SXT/
R391-related integrating conjugative element in a Proteus
mirabilis clinical isolate. Antimicrob Agents Ch 54: 3545–3550.
Hedges RW & Jacob AE (1974) Transposition of ampicillin
resistance from RP4 to other replicons. Mol Gen Genet 132:
31–40.
Heffron F, McCarthy BJ, Ohtsubo H & Ohtsubo E (1979) DNA
sequence analysis of the transposon Tn3: three genes and three
sites involved in transposition of Tn3. Cell 18: 1153–1163.
Heritage J & Bennett PM (1985) Plasmid fusions mediated by one
end of TnA. J Gen Microbiol 131: 1130–1140.
Ho PL, Wong RC, Lo SW, Chow KH, Wong SS & Que TL (2010)
Genetic identity of aminoglycoside-resistance genes in
Escherichia coli isolates from human and animal sources. J Med
Microbiol 59: 702–707.
Hochhut B & Waldor MK (1999) Site-specific integration of the
conjugal Vibrio cholerae SXT element into prfC. Mol Microbiol
32: 99–110.
Holt KE, Thomson NR, Wain J et al. (2007) Multidrug-resistant
Salmonella enterica serovar Paratyphi A harbors IncHI1
plasmids similar to those found in serovar Typhi. J Bacteriol
189: 4257–4264.
Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R & Philippon
A (2002) b-lactamases of Kluyvera ascorbata, probable
progenitors of some plasmid-encoded CTX-M types.
Antimicrob Agents Ch 46: 3045–3049.
Hyde DR & Tu CP (1985) tnpM: a novel regulatory gene that
enhances Tn21 transposition and suppresses cointegrate
resolution. Cell 42: 629–638.
Iida S, Hänni C, Echarti C & Arber W (1981) Is the IS1-flanked rdeterminant of the R plasmid NR1 a transposon? J Gen
Microbiol 126: 413–425.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S.R. Partridge
Iredell JR & Partridge SR (2010) Understanding the shared gene
pool in Gram-negative bacteria. Infectious Disease Informatics
(Sintchenko V, ed), pp. 245–261. Springer, New York.
Izumiya H, Sekizuka T, Nakaya H et al. (2011) Whole-genome
analysis of Salmonella enterica serovar Typhimurium T000240
reveals the acquisition of a genomic island involved in
multidrug resistance via IS1 derivatives on the chromosome.
Antimicrob Agents Ch 55: 623–630.
Jacoby G, Cattoir V, Hooper D, Martı́nez-Martı́nez L, Nordmann
P, Pascual A, Poirel L & Wang M (2008) qnr gene
nomenclature. Antimicrob Agents Ch 52: 2297–2299.
Joss MJ, Koenig JE, Labbate M, Polz MF, Gillings MR, Stokes HW,
Doolittle WF & Boucher Y (2009) ACID: annotation of
cassette and integron data. BMC Bioinformatics 10: 118.
Jové T, Da Re S, Denis F, Mazel D & Ploy MC (2010) Inverse
correlation between promoter strength and excision activity in
class 1 integrons. PLoS Genet 6: e1000793.
Kadlec K, Michael GB, Sweeney MT, Brzuszkiewicz E, Liesegang
H, Daniel R, Watts JL & Schwarz S (2011) Molecular basis of
macrolide, triamilide and lincosamide resistance in Pasteurella
multocida from bovine respiratory disease. Antimicrob Agents
Ch 55: 2475–2477.
Kamali-Moghaddam M & Sundström L (2000) Transposon
targeting determined by resolvase. FEMS Microbiol Lett 186:
55–59.
Kholodii G, Mindlin S, Petrova M & Minakhina S (2003) Tn5060
from the Siberian permafrost is most closely related to the
ancestor of Tn21 prior to integron acquisition. FEMS
Microbiol Lett 226: 251–255.
Kholodii GY, Mindlin SZ, Bass IA, Yurieva OV, Minakhina SV &
Nikiforov VG (1995) Four genes, two ends, and a res region are
involved in transposition of Tn5053: a paradigm for a novel
family of transposons carrying either a mer operon or an
integron. Mol Microbiol 17: 1189–1200.
Kichenaradja P, Siguier P, Pérochon J & Chandler M (2010)
ISbrowser: an extension of ISfinder for visualizing insertion
sequences in prokaryotic genomes. Nucleic Acids Res 38:
D62–D68.
Labbate M, Roy Chowdhury P & Stokes HW (2008) A class 1
integron present in a human commensal has a hybrid
transposition module compared to Tn402: evidence of
interaction with mobile DNA from natural environments.
J Bacteriol 190: 5318–5327.
L’Abée-Lund TM & Sørum H (2000) Functional Tn5393-like
transposon in the R plasmid pRAS2 from the fish pathogen
Aeromonas salmonicida subspecies salmonicida isolated in
Norway. Appl Environ Microb 66: 5533–5535.
Labigne-Roussel A & Courvalin P (1983) IS15, a new insertion
sequence widely spread in R plasmids of Gram-negative
bacteria. Mol Gen Genet 189: 102–112.
Lartigue MF, Leflon-Guibout V, Poirel L, Nordmann P & NicolasChanoine MH (2002) Promoters P3, Pa/Pb, P4, and P5
upstream from blaTEM genes and their relationship to b-lactam
resistance. Antimicrob Agents Ch 46: 4035–4037.
FEMS Microbiol Rev 35 (2011) 820–855
851
Analysis of the antibiotic resistance regions
Lartigue MF, Poirel L, Aubert D & Nordmann P (2006) In vitro
analysis of ISEcp1B-mediated mobilization of naturally
occurring b-lactamase gene blaCTX-M of Kluyvera ascorbata.
Antimicrob Agents Ch 50: 1282–1286.
Lawley TD, Burland V & Taylor DE (2000) Analysis of the
complete nucleotide sequence of the tetracycline-resistance
transposon Tn10. Plasmid 43: 235–239.
Leavitt A, Chmelnitsky I, Carmeli Y & Navon-Venezia S (2010)
Complete nucleotide sequence of KPC-3-encoding plasmid
pKpQIL in the epidemic Klebsiella pneumoniae sequence type
258. Antimicrob Agents Ch 54: 4493–4496.
Leflon-Guibout V, Heym B & Nicolas-Chanoine M (2000)
Updated sequence information and proposed nomenclature
for blaTEM genes and their promoters. Antimicrob Agents Ch
44: 3232–3234.
Léon G & Roy PH (2009) Potential role of group IIC-attC introns
in integron cassette formation. J Bacteriol 191: 6040–6051.
Leplae R, Lima-Mendez G & Toussaint A (2010) ACLAME: a
CLAssification of Mobile genetic Elements, update 2010.
Nucleic Acids Res 38: D57–D61.
Levings RS, Djordjevic SP & Hall RM (2008) SGI2, a relative of
Salmonella genomic island SGI1 with an independent origin.
Antimicrob Agents Ch 52: 2529–2537.
Levy SB, McMurry LM, Barbosa TM, Burdett V, Courvalin P,
Hillen W, Roberts MC, Rood JI & Taylor DE (1999)
Nomenclature for new tetracycline resistance determinants.
Antimicrob Agents Ch 43: 1523–1524.
Liebert CA, Hall RM & Summers AO (1999) Transposon Tn21,
flagship of the floating genome. Microbiol Mol Biol R 63:
507–522.
Liu B & Pop M (2009) ARDB–Antibiotic Resistance Genes
Database. Nucleic Acids Res 37: D443–447.
Liu J, Keelan P, Bennett PM & Enne VI (2009) Characterization of
a novel macrolide efflux gene, mef(B), found linked to sul3 in
porcine Escherichia coli. J Antimicrob Chemoth 63: 423–426.
Luck SN, Turner SA, Rajakumar K, Sakellaris H & Adler B (2001)
Ferric dicitrate transport system (Fec) of Shigella flexneri 2a
YSH6000 is encoded on a novel pathogenicity island carrying
multiple antibiotic resistance genes. Infect Immun 69:
6012–6021.
Ma YF, Wu JF, Wang SY, Jiang CY, Zhang Y, Qi SW, Liu L, Zhao
GP & Liu SJ (2007) Nucleotide sequence of plasmid pCNB1
from Comamonas strain CNB-1 reveals novel genetic
organization and evolution for 4-chloronitrobenzene
degradation. Appl Environ Microb 73: 4477–4483.
Martı́nez JL, Baquero F & Andersson DI (2007) Predicting
antibiotic resistance. Nat Rev Microbiol 5: 958–965.
Martinez JL, Fajardo A, Garmendia L, Hernandez A, Linares JF,
Martı́nez-Solano L & Sánchez MB (2009) A global view of
antibiotic resistance. FEMS Microbiol Rev 33: 44–65.
Mendiola MV & de la Cruz F (1989) Specificity of insertion of
IS91, an insertion sequence present in a-haemolysin plasmids
of Escherichia coli. Mol Microbiol 3: 979–984.
FEMS Microbiol Rev 35 (2011) 820–855
Mendiola MV, Bernales I & de la Cruz F (1994) Differential roles
of the transposon termini in IS91 transposition. P Natl Acad
Sci USA 91: 1922–1926.
Meyer R (2009) Replication and conjugative mobilization of
broad host-range IncQ plasmids. Plasmid 62: 57–70.
Minakhina S, Kholodii G, Mindlin S, Yurieva O & Nikiforov V
(1999) Tn5053 family transposons are res site hunters sensing
plasmidal res sites occupied by cognate resolvases. Mol
Microbiol 33: 1059–1068.
Mindlin S, Kholodii G, Gorlenko Z, Minakhina S, Minakhin L,
Kalyaeva E, Kopteva A, Petrova M, Yurieva O & Nikiforov V
(2001) Mercury resistance transposons of Gram-negative
environmental bacteria and their classification. Res Microbiol
152: 811–822.
Mollet B, Clerget M, Meyer J & Iida S (1985a) Organization of the
Tn6-related kanamycin resistance transposon Tn2680 carrying
two copies of IS26 and an IS903 variant, IS903.B. J Bacteriol
163: 55–60.
Mollet B, Iida S & Arber W (1985b) Gene organization and target
specificity of the prokaryotic mobile genetic element IS26. Mol
Gen Genet 201: 198–203.
Mötsch S & Schmitt R (1984) Replicon fusion mediated by a
single-ended derivative of transposon Tn1721. Mol Gen Genet
195: 281–287.
Mötsch S, Schmitt R, Avila P, de la Cruz F, Ward E & Grinsted J
(1985) Junction sequences generated by ‘one-ended
transposition’. Nucleic Acids Res 13: 3335–3342.
Moura A, Soares M, Pereira C, Leitão N, Henriques I & Correia A
(2009) INTEGRALL: a database and search engine for
integrons, integrases and gene cassettes. Bioinformatics 25:
1096–1098.
Naas T, Aubert D, Lambert T & Nordmann P (2006) Complex
genetic structures with repeated elements, a sul-type class 1
integron, and the blaVEB extended-spectrum b-lactamase gene.
Antimicrob Agents Ch 50: 1745–1752.
Naas T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP &
Nordmann P (2008) Genetic structures at the origin of
acquisition of the b-lactamase blaKPC gene. Antimicrob Agents
Ch 52: 1257–1263.
Nadjar D, Rouveau M, Verdet C, Donay L, Herrmann J, Lagrange
PH, Philippon A & Arlet G (2000) Outbreak of Klebsiella
pneumoniae producing transferable AmpC-type b-lactamase
(ACC-1) originating from Hafnia alvei. FEMS Microbiol Lett
187: 35–40.
Nakaya R, Nakamura A & Murata Y (1960) Resistance transfer
agents in Shigella. Biochem Bioph Res Co 3: 654–659.
Noguchi N, Emura A, Matsuyama H, O’Hara K, Sasatsu M &
Kono M (1995) Nucleotide sequence and characterization of
erythromycin resistance determinant that encodes macrolide
2 0 -phosphotransferase I in Escherichia coli. Antimicrob Agents
Ch 39: 2359–2363.
Noguchi N, Katayama J & Sasatsu M (2000a) A transposon
carrying the gene mphB for macrolide 2 0 -phosphotransferase
II. FEMS Microbiol Lett 192: 175–178.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
852
Noguchi N, Takada K, Katayama J, Emura A & Sasatsu M (2000b)
Regulation of transcription of the mph(A) gene for macrolide
2 0 -phosphotransferase I in Escherichia coli: characterization of
the regulatory gene mphR(A). J Bacteriol 182: 5052–5058.
Novais A, Baquero F, Machado E, Cantón R, Peixe L & Coque TM
(2010) International spread and persistence of TEM-24 is
caused by the confluence of highly penetrating
Enterobacteriaceae clones and an IncA/C2 plasmid containing
Tn1696<Tn1 and IS5075-Tn21. Antimicrob Agents Ch 54:
825–834.
O’Brien TF (2002) Emergence, spread, and environmental effect
of antimicrobial resistance: how use of an antimicrobial
anywhere can increase resistance to any antimicrobial
anywhere else. Clin Infect Dis 34: S78–S84.
Oka A, Sugisaki H & Takanami M (1981) Nucleotide sequence of
the kanamycin resistance transposon Tn903. J Mol Biol 147:
217–226.
Olson AB, Silverman M, Boyd DA, McGeer A, Willey BM, PongPorter V, Daneman N & Mulvey MR (2005) Identification of a
progenitor of the CTX-M-9 group of extended-spectrum blactamases from Kluyvera georgiana isolated in Guyana.
Antimicrob Agents Ch 49: 2112–2115.
Pansegrau W, Lanka E, Barth PT, Figurski DH, Guiney DG, Haas
D, Helinski DR, Schwab H, Stanisich VA & Thomas CM (1994)
Complete nucleotide sequence of Birmingham IncPa
plasmids. Compilation and comparative analysis. J Mol Biol
239: 623–663.
Parks AR & Peters JE (2007) Transposon Tn7 is widespread in
diverse bacteria and forms genomic islands. J Bacteriol 189:
2170–2173.
Partridge SR (2007) Genetic environment of ISEcp1 and blaACC-1.
Antimicrob Agents Ch 51: 2658–2659.
Partridge SR & Hall RM (2003a) In34, a complex In5 family class
1 integron containing orf513 and dfrA10. Antimicrob Agents
Ch 47: 342–349.
Partridge SR & Hall RM (2003b) The IS1111 family members
IS4321 and IS5075 have subterminal inverted repeats and
target the terminal inverted repeats of Tn21 family
transposons. J Bacteriol 185: 6371–6384.
Partridge SR & Hall RM (2004) Complex multiple antibiotic and
mercury resistance region derived from the r-det of NR1
(R100). Antimicrob Agents Ch 48: 4250–4255.
Partridge SR & Hall RM (2005) Evolution of transposons
containing blaTEM genes. Antimicrob Agents Ch 49: 1267–1268.
Partridge SR, Brown HJ, Stokes HW & Hall RM (2001a)
Transposons Tn1696 and Tn21 and their integrons In4 and In2
have independent origins. Antimicrob Agents Ch 45:
1263–1270.
Partridge SR, Recchia GD, Stokes HW & Hall RM (2001b) Family
of class 1 integrons related to In4 from Tn1696. Antimicrob
Agents Ch 45: 3014–3020.
Partridge SR, Brown HJ & Hall RM (2002a) Characterization and
movement of the class 1 integron known as Tn2521 and
Tn1405. Antimicrob Agents Ch 46: 1288–1294.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S.R. Partridge
Partridge SR, Collis CM & Hall RM (2002b) Class 1 integron
containing a new gene cassette, aadA10, associated with
Tn1404 from R151. Antimicrob Agents Ch 46: 2400–2408.
Partridge SR, Tsafnat G, Coiera E & Iredell JR (2009) Gene
cassettes and cassette arrays in mobile resistance integrons.
FEMS Microbiol Rev 33: 757–784.
Périchon B, Bogaerts P, Lambert T, Frangeul L, Courvalin P &
Galimand M (2008) Sequence of conjugative plasmid pIP1206
mediating resistance to aminoglycosides by 16S rRNA
methylation and to hydrophilic fluoroquinolones by efflux.
Antimicrob Agents Ch 52: 2581–2592.
Petrova M, Gorlenko Z & Mindlin S (2011) Tn5045, a novel
integron-containing antibiotic and chromate resistance
transposon isolated from a permafrost bacterium. Res
Microbiol 162: 337–345.
Petrovski S & Stanisich VA (2010) Tn502 and Tn512 are res site
hunters that provide evidence of resolvase-independent
transposition to random sites. J Bacteriol 192: 1865–1874.
Petrovski S, Blackmore DW, Jackson KL & Stanisich VA (2011)
Mercury(II)-resistance transposons Tn502 and Tn512, from
Pseudomonas clinical strains, are structurally different
members of the Tn5053 family. Plasmid 65: 58–64.
Poirel L & Nordmann P (2006) Genetic structures at the origin of
acquisition and expression of the carbapenem-hydrolyzing
oxacillinase gene blaOXA-58 in Acinetobacter baumannii.
Antimicrob Agents Ch 50: 1442–1448.
Poirel L, Naas T, Guibert M, Chaibi EB, Labia R & Nordmann P
(1999) Molecular and biochemical characterization of VEB-1,
a novel class A extended-spectrum b-lactamase encoded by an
Escherichia coli integron gene. Antimicrob Agents Ch 43:
573–581.
Poirel L, Kämpfer P & Nordmann P (2002) Chromosomeencoded Ambler class A b-lactamase of Kluyvera georgiana, a
probable progenitor of a subgroup of CTX-M extendedspectrum b-lactamases. Antimicrob Agents Ch 46: 4038–4040.
Poirel L, Decousser JW & Nordmann P (2003) Insertion sequence
ISEcp1B is involved in expression and mobilization of a blaCTX-M
b-lactamase gene. Antimicrob Agents Ch 47: 2938–2945.
Poirel L, Lartigue MF, Decousser JW & Nordmann P (2005a)
ISEcp1B-mediated transposition of blaCTX-M in Escherichia
coli. Antimicrob Agents Ch 49: 447–450.
Poirel L, Rodriguez-Martinez JM, Mammeri H, Liard A &
Nordmann P (2005b) Origin of plasmid-mediated quinolone
resistance determinant QnrA. Antimicrob Agents Ch 49:
3523–3525.
Poirel L, Mugnier PD, Toleman MA, Walsh TR, Rapoport MJ,
Petroni A & Nordmann P (2009) ISCR2, another vehicle for
blaVEB gene acquisition. Antimicrob Agents Ch 53: 4940–4943.
Post V & Hall RM (2009) AbaR5, a large multiple-antibiotic
resistance region found in Acinetobacter baumannii.
Antimicrob Agents Ch 53: 2667–2671.
Rådström P, Sköld O, Swedberg G, Flensburg J, Roy PH &
Sundström L (1994) Transposon Tn5090 of plasmid R751,
which carries an integron, is related to Tn7, Mu, and the
retroelements. J Bacteriol 176: 3257–3268.
FEMS Microbiol Rev 35 (2011) 820–855
853
Analysis of the antibiotic resistance regions
Recchia GD & Hall RM (1997) Origins of the mobile gene
cassettes found in integrons. Trends Microbiol 5: 389–394.
Recchia GD, Stokes HW & Hall RM (1994) Characterisation of
specific and secondary recombination sites recognised by the
integron DNA integrase. Nucleic Acids Res 22: 2071–2078.
Revilla C, Garcillán-Barcia MP, Fernández-López R, Thomson
NR, Sanders M, Cheung M, Thomas CM & de la Cruz F (2008)
Different pathways to acquiring resistance genes illustrated by
the recent evolution of IncW plasmids. Antimicrob Agents Ch
52: 1472–1480.
Rice LB, Carias LL, Hutton RA, Rudin SD, Endimiani A &
Bonomo RA (2008) The KQ element, a complex genetic region
conferring transferable resistance to carbapenems,
aminoglycosides, and fluoroquinolones in Klebsiella
pneumoniae. Antimicrob Agents Ch 52: 3427–3429.
Richter GY, Björklöf K, Romantschuk M & Mills D (1998)
Insertion specificity and trans-activation of IS801. Mol Gen
Genet 260: 381–387.
Roberts AP, Chandler M, Courvalin P et al. (2008) Revised
nomenclature for transposable genetic elements. Plasmid 60:
167–173.
Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J & Seppala
H (1999) Nomenclature for macrolide and macrolidelincosamide-streptogramin B resistance determinants.
Antimicrob Agents Ch 43: 2823–2830.
Rodrı́guez MM, Power P, Radice M, Vay C, Famiglietti A, Galleni
M, Ayala JA & Gutkind G (2004) Chromosome-encoded
CTX-M-3 from Kluyvera ascorbata: a possible origin of
plasmid-borne CTX-M-1-derived cefotaximases. Antimicrob
Agents Ch 48: 4895–4897.
Rodrı́guez MM, Power P, Sader H, Galleni M & Gutkind G (2010)
Novel chromosome-encoded CTX-M-78 b-lactamase from a
Kluyvera georgiana clinical isolate as a putative origin of
CTX-M-25 subgroup. Antimicrob Agents Ch 54: 3070–3071.
Rogowsky P & Schmitt R (1984) Resolution of a hybrid
cointegrate between transposons Tn501 and Tn1721 defines
the recombination site. Mol Gen Genet 193: 162–166.
Rottman M, Benzerara Y, Hanau-Berçot B, Bizet C, Philippon A
& Arlet G (2002) Chromosomal ampC genes in Enterobacter
species other than Enterobacter cloacae, and ancestral
association of the ACT-1 plasmid-encoded cephalosporinase
to Enterobacter asburiae. FEMS Microbiol Lett 210: 87–92.
Rowe-Magnus DA, Guerout AM, Ploncard P, Dychinco B, Davies
J & Mazel D (2001) The evolutionary history of chromosomal
super-integrons provides an ancestry for multiresistant
integrons. P Natl Acad Sci USA 98: 652–657.
Rowe-Magnus DA, Guerout AM, Biskri L, Bouige P & Mazel D
(2003) Comparative analysis of superintegrons: engineering
extensive genetic diversity in the Vibrionaceae. Genome Res 13:
428–442.
Roy Chowdhury P, Merlino J, Labbate M, Cheong EY, Gottlieb T
& Stokes HW (2009) Tn6060, a transposon from a genomic
island in a Pseudomonas aeruginosa clinical isolate that
includes two class 1 integrons. Antimicrob Agents Ch 53:
5294–5296.
FEMS Microbiol Rev 35 (2011) 820–855
Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream
MA & Barrell B (2000) Artemis: sequence visualization and
annotation. Bioinformatics 16: 944–945.
Scaria J, Chandramouli U & Verma SK (2005) Antibiotic
Resistance Genes Online (ARGO): a database on vancomycin
and b-lactam resistance genes. Bioinformation 1: 5–7.
Schlör S, Riedl S, Blaß J & Reidl J (2000) Genetic rearrangements
of the regions adjacent to genes encoding heat-labile
enterotoxins (eltAB) of enterotoxigenic Escherichia coli strains.
Appl Environ Microb 66: 352–358.
Scholz P, Haring V, Wittmann-Liebold B, Ashman K, Bagdasarian
M & Scherzinger E (1989) Complete nucleotide sequence and
gene organization of the broad-host-range plasmid RSF1010.
Gene 75: 271–288.
Schlüter A, Szczepanowski R, Kurz N, Schneiker S, Krahn I &
Pühler A (2007) Erythromycin resistance-conferring plasmid
pRSB105, isolated from a sewage treatment plant, harbors a
new macrolide resistance determinant, an integron-containing
Tn402-like element, and a large region of unknown function.
Appl Environ Microb 73: 1952–1960.
Segal H, Garny S & Elisha BG (2005) Is ISABA-1 customized for
Acinetobacter? FEMS Microbiol Lett 243: 425–429.
Shapiro JA & Sporn P (1977) Tn402: a new transposable element
determining trimethoprim resistance that inserts in
bacteriophage lambda. J Bacteriol 129: 1632–1635.
Shaw KJ, Rather PN, Hare RS & Miller GH (1993) Molecular
genetics of aminoglycoside resistance genes and familial
relationships of the aminoglycoside-modifying enzymes.
Microbiol Rev 57: 138–163.
Siguier P, Perochon J, Lestrade L, Mahillon J & Chandler M
(2006) ISfinder: the reference centre for bacterial insertion
sequences. Nucleic Acids Res 34: D32–D36.
Siguier P, Gagnevin L & Chandler M (2009) The new IS1595
family, its relation to IS1 and the frontier between insertion
sequences and transposons. Res Microbiol 160: 232–241.
Silver L, Chandler M, Lane HE & Caro L (1980) Production of
extrachromosomal r-determinant circles from integrated
R100.1: involvement of the E. coli recombination system. Mol
Gen Genet 179: 565–571.
Smillie C, Garcillán-Barcia MP, Francia MV, Rocha EP & de la
Cruz F (2010) Mobility of plasmids. Microbiol Mol Biol R 74:
434–452.
Sommer MO, Dantas G & Church GM (2009) Functional
characterization of the antibiotic resistance reservoir in the
human microflora. Science 325: 1128–1131.
Sota M, Tsuda M, Yano H, Suzuki H, Forney LJ & Top EM (2007)
Region-specific insertion of transposons in combination with
selection for high plasmid transferability and stability accounts
for the structural similarity of IncP-1 plasmids. J Bacteriol 189:
3091–3098.
Stokes HW & Hall RM (1989) A novel family of potentially
mobile DNA elements encoding site-specific gene-integration
functions: integrons. Mol Microbiol 3: 1669–1683.
Stokes HW, Tomaras C, Parsons Y & Hall RM (1993) The partial
3 0 -conserved segment duplications in the integrons In6 from
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
854
pSa and In7 from pDGO100 have a common origin. Plasmid
30: 39–50.
Stokes HW, Nesbø CL, Holley M, Bahl MI, Gillings MR &
Boucher Y (2006) Class 1 integrons potentially predating the
association with Tn402-like transposition genes are present in
a sediment microbial community. J Bacteriol 188: 5722–5730.
Stokes HW, Elbourne LD & Hall RM (2007) Tn1403, a multipleantibiotic resistance transposon made up of three distinct
transposons. Antimicrob Agents Ch 51: 1827–1829.
Sutcliffe JG (1978) Nucleotide sequence of the ampicillin
resistance gene of Escherichia coli plasmid pBR322. P Natl Acad
Sci USA 75: 3737–3741.
Szczepanowski R, Krahn I, Linke B, Goesmann A, Pühler A &
Schlüter A (2004) Antibiotic multiresistance plasmid pRSB101
isolated from a wastewater treatment plant is related to
plasmids residing in phytopathogenic bacteria and carries
eight different resistance determinants including a multidrug
transport system. Microbiology 150: 3613–3630.
Szczepanowski R, Braun S, Riedel V, Schneiker S, Krahn I, Pühler
A & Schlüter A (2005) The 120 592 bp IncF plasmid pRSB107
isolated from a sewage-treatment plant encodes nine different
antibiotic-resistance determinants, two iron-acquisition
systems and other putative virulence-associated functions.
Microbiology 151: 1095–1111.
Szczepanowski R, Krahn I, Bohn N, Pühler A & Schlüter A (2007)
Novel macrolide resistance module carried by the IncP-1b
resistance plasmid pRSB111, isolated from a wastewater
treatment plant. Antimicrob Agents Ch 51: 673–678.
Szczepanowski R, Bekel T, Goesmann A, Krause L, Krömeke H,
Kaiser O, Eichler W, Pühler A & Schlüter A (2008) Insight into
the plasmid metagenome of wastewater treatment plant bacteria
showing reduced susceptibility to antimicrobial drugs analysed
by the 454-pyrosequencing technology. J Biotechnol 136: 54–64.
Tavakoli N, Comanducci A, Dodd HM, Lett MC, Albiger B &
Bennett P (2000) IS1294, a DNA element that transposes by
RC transposition. Plasmid 44: 66–84.
Toleman MA & Walsh TR (2008) Evolution of the ISCR3 group of
ISCR elements. Antimicrob Agents Ch 52: 3789–3791.
Toleman MA, Bennett PM & Walsh TR (2006a) Common regions
e.g. orf513 and antibiotic resistance: IS91-like elements
evolving complex class 1 integrons. J Antimicrob Chemoth
58: 1–6.
Toleman MA, Bennett PM & Walsh TR (2006b) ISCR elements:
novel gene-capturing systems of the 21st century? Microbiol
Mol Biol R 70: 296–316.
Tolmasky ME & Crosa JH (1993) Genetic organization of
antibiotic resistance genes (aac(6 0 )-Ib, aadA, and oxa9) in the
multiresistance transposon Tn1331. Plasmid 29: 31–40.
Touchon M, Hoede C, Tenaillon O et al. (2009) Organised
genome dynamics in the Escherichia coli species results in
highly diverse adaptive paths. PLoS Genet 5: e1000344.
Tseng SP, Hsueh PR, Tsai JC & Teng LJ (2007) Tn6001, a
transposon-like element containing the blaVIM-3-harboring
integron In450. Antimicrob Agents Ch 51: 4187–4190.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
S.R. Partridge
Turlan C & Chandler M (1995) IS1-mediated intramolecular
rearrangements: formation of excised transposon circles and
replicative deletions. EMBO J 14: 5410–5421.
Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R,
Livermore DM & Pitt TL (2006) The role of ISAba1 in
expression of OXA carbapenemase genes in Acinetobacter
baumannii. FEMS Microbiol Lett 258: 72–77.
Valverde A, Cantón R, Garcillán-Barcia MP, Novais A, Galán JC,
Alvarado A, de la Cruz F, Baquero F & Coque TM (2009)
Spread of blaCTX-M-14 is driven mainly by IncK plasmids
disseminated among Escherichia coli phylogroups A, B1, and D
in Spain. Antimicrob Agents Ch 53: 5204–5212.
van der Ploeg J, Willemsen M, van Hall G & Janssen DB (1995)
Adaptation of Xanthobacter autotrophicus GJ10 to
bromoacetate due to activation and mobilization of the
haloacetate dehalogenase gene by insertion element IS1247.
J Bacteriol 177: 1348–1356.
Verdet C, Arlet G, Barnaud G, Lagrange PH & Philippon A (2000)
A novel integron in Salmonella enterica serovar Enteritidis,
carrying the blaDHA-1 gene and its regulator gene ampR,
originated from Morganella morganii. Antimicrob Agents Ch
44: 222–225.
Verdet C, Gautier V, Chachaty E, Ronco E, Hidri N, Decré D &
Arlet G (2009) Genetic context of plasmid-carried blaCMY-2like genes in Enterobacteriaceae. Antimicrob Agents Ch 53:
4002–4006.
Villa L, Garcı́a-Fernández A, Fortini D & Carattoli A (2010)
Replicon sequence typing of IncF plasmids carrying virulence
and resistance determinants. J Antimicrob Chemoth 65:
2518–2529.
Wachino J, Yamane K, Kimura K, Shibata N, Suzuki S, Ike Y &
Arakawa Y (2006) Mode of transposition and expression of
16S rRNA methyltransferase gene rmtC accompanied by
ISEcp1. Antimicrob Agents Ch 50: 3212–3215.
Wagner A, Lewis C & Bichsel M (2007) A survey of bacterial
insertion sequences using IScan. Nucleic Acids Res 35: 5284–5293.
Waldor MK (2010) Mobilizable genomic islands: going mobile
with oriT mimicry. Mol Microbiol 78: 537–540.
Walsh TR (2006) Combinatorial genetic evolution of
multiresistance. Curr Opin Microbiol 9: 476–482.
Welch TJ, Fricke WF, McDermott PF et al. (2007) Multiple
antimicrobial resistance in plague: an emerging public health
risk. PLoS One 2: e309.
Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ
& Livermore DM (2009) Complete nucleotide sequences of
plasmids pEK204, pEK499, and pEK516, encoding CTX-M
enzymes in three major Escherichia coli lineages from the
United Kingdom, all belonging to the international O25:H4ST131 clone. Antimicrob Agents Ch 53: 4472–4482.
Wozniak RA & Waldor MK (2010) Integrative and conjugative
elements: mosaic mobile genetic elements enabling dynamic
lateral gene flow. Nat Rev Microbiol 8: 552–563.
Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli
D, Garriss G, Déry C, Burrus V & Waldor MK (2009)
FEMS Microbiol Rev 35 (2011) 820–855
855
Analysis of the antibiotic resistance regions
Comparative ICE genomics: insights into the evolution of the
SXT/R391 family of ICEs. PLoS Genet 5: e1000786.
Wrighton CJ & Strike P (1987) A pathway for the evolution of the
plasmid NTP16 involving the novel kanamycin resistance
transposon Tn4352. Plasmid 17: 37–45.
Yau S, Liu X, Djordjevic SP & Hall RM (2010) RSF1010-like
plasmids in Australian Salmonella enterica serovar
Typhimurium and origin of their sul2-strA-strB antibiotic
resistance gene cluster. Microb Drug Resist 16: 249–252.
Yurieva O, Kholodii G, Minakhin L, Gorlenko Z, Kalyaeva E,
Mindlin S & Nikiforov V (1997) Intercontinental spread of
promiscuous mercury-resistance transposons in
environmental bacteria. Mol Microbiol 24: 321–329.
Zhao F, Bai J, Wu J et al. (2010) Sequencing and genetic variation
of multidrug resistance plasmids in Klebsiella pneumoniae.
PLoS One 5: e10141.
Zhu WH, Luo L, Wang JY, Zhuang XH, Zhong L, Liao K, Zeng Y
& Lu YJ (2009) Complete nucleotide sequence of pCTX-M360,
an intermediate plasmid between pEL60 and pCTX-M3, from
a multidrug-resistant Klebsiella pneumoniae strain isolated in
China. Antimicrob Agents Ch 53: 5291–5293.
Zong Z, Partridge SR & Iredell JR (2009) A blaVEB-1 variant,
blaVEB-6, associated with repeated elements in a complex
genetic structure. Antimicrob Agents Ch 53: 1693–1697.
FEMS Microbiol Rev 35 (2011) 820–855
Zong Z, Partridge SR & Iredell JR (2010) ISEcp1-mediated
transposition and homologous recombination can explain the
context of blaCTX-M-62 linked to qnrB2. Antimicrob Agents Ch
54: 3039–3042.
Zong Z, Yu R, Wang X & Lü X (2011) blaCTX-M-65 is carried by a
Tn1722-like element on an IncN conjugative plasmid of ST131
Escherichia coli. J Med Microbiol 60: 435–441.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Fig. S1. blaTEM promoters and frameworks.
Please note: Wiley-Blackwell is not responsible for the
content or functionality of any supporting materials supplied by the authors. Any queries (other than missing
material) should be directed to the corresponding author
for the article.
2011 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c