AsPac J. Mol.
2013
Mol. Biol.
Biol.Biotechnol.
Biotechnol.
Vol. 21 (1), 2013
Vol. 21 (1) : 3-17
Methanogens and Methanotrophs in Rice Fields
1
Characteristics of Methanogens and Methanotrophs in Rice Fields: A Review
Pardis Fazli1*, Hasfalina Che Man1, Umi Kalsom Md Shah2 and Azni Idris3
Department of Biological and Agricultural Engineering, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
2
Department of Bioprocess Technology, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
3
Department of Chemical and Environmental Engineering, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
1
Received 8 January 2013 / Accepted 22 March 2013
Abstract. Methane is the second most important greenhouse gas after carbon dioxide (CO2) with a global warming
potential 25 times more than CO2. Rice fields are one of the main anthropogenic sources for methane and responsible for
approximately 15–20% of the annual global methane efflux. Methanogens and methanotrophs are two microbial communities which
contribute to the biogeochemical methane cycle in soil by producing and oxidizing methane, respectively. In fact, the total methane
emission from rice soil is the balance between methanogen and methanotroph activities. Methanogenic archaea are more active
in highly reduced conditions and anoxic soils. However, methanotrophs are more active in oxic soils. These microorganisms have
been studied frequently in different soils from natural wetlands to rice fields. This article has mainly focused on the characteristics
of methanogens and methanotrophs in a rice soil ecosystem with the objective of deriving solutions the high level of methane
emissions from paddy fields.
Keywords: Methane emission, Microbial communities, Rice soil.
INTRODUCTION
Methane (CH4) is one of the most important
greenhouse gases after carbon dioxide (CO2)
(Singh et al., 2010), with global warming potential of 25 over a
100 year period (IPCC, 2007). The methane molecule traps infrared radiation emitted from the earth toward the atmosphere
after receiving and absorbing a portion of solar
radiation by the earth. Otherwise, the infrared radiation could
escape to the space. In fact, methane molecules are energized
and then begin to emit heat in all directions including back
towards the Earth (Nema et al., 2012). The concentration of
methane in the atmosphere increased by 1070 part
per billion by volume (ppbv) between pre-industrial times
and 2008 (Singh and Dubey, 2012).
Rice fields are one of the important sources for
atmospheric methane (Rajagopal et al., 1988; Datta et al.,
2009; Tyagi et al., 2010). Furthermore, paddy fields are
responsible for approximately 15–20% of the global
total anthropogenic CH4 emission (Xu et al., 2007;
Li et al., 2011) and an estimated annual methane
emission of 25–100 Tg (Xu et al., 2007). Methanogens and
methanotrophs are two microbial communities, both
involved in the biogeochemical methane cycle in soil.
Methanogens are responsible for producing methane. These
microorganisms are obligate anaerobes and thus they are
active in flooded and high-reduced environments with a
low soil redox potential (Pazinato et al., 2010). In contrast,
methanotrophs account for methane oxidization before
methane is released from the soil into the atmosphere. In
contrast with methanogens, methanotrophs are mostly
aerobic unicellular microorganisms which are active
in oxic area of soil. Methanogens and methanotrophs
have been investigated frequently in different
ecosystems and conditions including sludge digesters
(Hwang et al., 2008), peat land (Godin et al., 2012), fresh
water and marine sediments (Newby et al., 2004), lakes
(Carini et al., 2005; Antony et al., 2012) and rice soil
(Vishwakarma et al., 2010; Wang et al., 2010). However,
different methods have been applied to evaluate the
methanogenic and methanotrophic communities in
the rice ecosystem. These methods include fluorescence
in situ hybridization (FISH), phospholipid-derived
fatty acids (PLFA), real-time polymerase chain reaction
(RT-PCR), and DNA fingerprinting techniques
(such as denaturing gradient gel electrophoresis (DGGE),
* Author for correspondence: Pardis Fazli, DDepartment of Biological and
Agricultural Engineering, Universiti Putra Malaysia, 43400 UPM Serdang,
Selangor, Malaysia Fax: +603-40411280, Email - [email protected].
4
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
terminal restriction fragment length polymorphism
(T-RFLP) and temperature gradient gel electrophoresis)
(Fey and Conrad, 2000; Lu and Conrad, 2005; Conrad
et al., 2006; Wu et al., 2009; Surakasi et al., 2010; Bodelier,
2011; Kumar et al., 2011; Ma and Lu, 2011).
Methanogens and methanotrophs seem worthy of study
as the organisms directly responsible for the emission of
methane from soil. As a result of these studies, some solutions
are expected to be developed to reduce methanogenic activity
or motivate oxidation of methane by methanotrophs to reduce
the methane emission from flooded soils, especially rice fields.
MOLECULAR
ANALYSES
AND
CULTURE-INDEPENDENT
DNA Fingerprinting Techniques. One of the most widely
used culture-independent molecular techniques is T-RFLP,
first developed in 1997 for studying the structure and
diversity of bacterial communities in the environment
(Dickie and Fitz John, 2007). It is a high-throughput
technique with the ability to monitor changes in the
microbial communities’ structure and composition
(Schütte et al., 2008). On the other hand, the
application of this method solely for study of
methanogens can be misleading due to the production
of the same terminal restriction fragments (T-RFs) by
different groups (e.g. Methanomicrobiales and RC-I).
Some solutions for this problem are the application of
T-RFLP analysis using different restriction enzymes, using
multiple fluorescent labelled primers, targeting both 16S
rRNA and mcrA genes, and targeting archaeal 16S rRNA
genes to identify the relative abundance of particular T-RFs
(Conrad et al., 2006; Schütte et al., 2008). Some groups
have successfully used T-RFLP for methanogens and
methanotrophs. For instance, Ma and Lu (2011) applied
both T-RFLP and Quantitative (real-time) PCR analysis
to identify nine principal T-RFs in the T-RFLP profiles of
archaeal 16S rRNA genes.
The DGGE technique has been frequently and
successfully applied for the detection of methanogens
and methanotrophs (Hales et al., 1996; Wise et al., 1999;
Bodelier et al., 2005; Sugano et al., 2005; Yu et al., 2005;
Imachi et al. 2006; Jouttonenetal, 2006; Watanabe et al.,
2006; Sakai et al., 2007; Hwang et al., 2008; Vishwakarma
et al., 2009; Watanabe et al., 2010; Yun et al., 2010). In
spite of some advantages (e.g. sensitivity and resultant high
detection rate, simplicity of the methodology, safety
because of the lack of need for radioactivity)
(Kumar et al., 2011), this method has some weaknesses.
For instance, it is not able to detect a specific group of
functioning microbes (Conrad et al., 2006). This technique
can turn into a successful tool by performing PCR as a
pre-process (Imachi et al., 2006; Watanabe et al., 2006;
Sakai et al., 2007; Wang et al., 2010; Watanabe et al., 2010;
Methanogens and Methanotrophs in Rice Fields
Table 1). Consequently, several microbial communities can
be detected (Table 2). For example, Surakasi et al. (2010)
identified methanotrophs (Methylomicrobium buryaticum
and Beijerinckiaceae) in Lonar crater lake using PCR-DGGE
based on protein-coding genes (pmoA and mxaF) where
previously cultural and non-cultural methods had failed to
detect methanotrophs in this environment.
FISH is a powerful tool for the detection of
microbial communities. This technique allows direct
cell counting and identification of specific or general
taxonomic groups of microorganisms in their natural habitat
(Chen et al., 2003; Kumar et al., 2011). Detecting microbial
communities in soil samples by FISH had was previously very
challenging. For example, the high autofluorescence of soil
particles may be indistinguishable from the probe signal,
bacteria which associate with soil particles could be excluded
from counting, and some loss of materials including bacteria
may occur during the process (Chen et al., 2003; Eickhorst
and Tippkotter, 2008a). Fortunately, this technique has
been modified for soil samples by the application of some
strategies such as the use of a membrane filter equipped
with a container (Millicell, Millipore), the combination of
FISH and micropedological methods (which allow the soil
structure to be preserved as it is embedded in resin),
catalyzed reporter deposition-FISH (CARD-FISH)
and the use of specific filter sets for epifluorescence
microscopy (Chen et al., 2003; Eickhorst and Tippkotter,
2008a; 2008b).
In general, molecular analyses apply different
oligonucleotide probes (e.g. FISH) or primers (e.g. PCR,
T-RFLP and DGGE) to target phylogenetic markers of
methanogens (e.g. 16S rRNA, 16S rRNA gene, α-subunit
gene of methyl coenzyme M reductase (mcrA)).
Consequently, different taxonomic levels of microbial
communities such as methanogens and methanotrophs
can be detected (Narihiro and Sekiguchi, 2011). Tables
2 and 3 present some primers which can be used for the
identification of methanogens and methanotrophs. Kumar
et al. (2011) also list general oligonucleotide probes used for
targeting methanogens and they describe the FISH method
for detection of these microbes.
METHANOGENS
The methanogenic archaea are anaerobic unicellular
organisms (Garcia, 1990) belonging to the Euryarchaeota
kingdom of the Archaea domain (Ferry, 2010). According
to Borrel et al. (2011) currently cultivated methanogenic
archaea consist of six orders and 31 genera all belonging to
the Euryarchaeota phylum based on comparative 16S rRNA
sequence analysis and some distinct phenotypic properties
(Rosenzweig and Ragsdale, 2011a; Table 4). Between
these six orders, Methanocellales was recently proposed by
Sakai et al. (2008) as a result of analysis of a single isolate
from a rice paddy soil (Ferry, 2010).
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Methanogens and Methanotrophs in Rice Fields
Table 1. Detected methanogens applying different primer sets
Primer set
0357F-GC clamp / 0691R
1
Target
-
2
Detected methanogens
RC-I, Methanomicrobiales,
Methanosarcinales
0357F GC4 / 0691R
Archaea
1106F-GC4 / 1378R
methanogenic
archaeal 16S
rRNA genes
Methanomicrobiales, Methanosarcinaceae,
Methanosaetaceae and Rice cluster-I
GC-ARC787F ARC1059R
Archaea
(Highest similarity) Methanosaeta concil- Yu et al. 2005; Hwang
li, Methanosarcina mazei, Methanocalculus et al. 2008
pumilus, Methanocorpusculum bavaricum,
Methanogenium marinum,
Methanoplanus petrolearius, Methanolobus oregonensis, Methanosaeta harundinacea,
Methanobacterium Subterraneum,
Methanosphaera stadtmanae,
Methanobrevibacter smithii,
Methanobrevibacter arborihilus,
Methanobacterium oryzae, Uncultured archaeon
clone F9T20L415, Uncultured archaeon clone
OuO-39, Methanofollis liminatans
1106F-GC/1378R
methanogenic archaeal 16SrDNA
and mcrA
fragments
Methanomicrobiales, Methanosarcinales,
Methanocellales (Rice cluster I), mrtA cluster
(isoenzyme genes) and
Methanobacteriaceae
Watanabe et al. 2009
1106F-GC / 1378R
methanogenic
archaeal 16S
rRNA genes
Methanosaetaceae, Methanocellales,
Methanomicrobiales and
Methanosarcinaceae
Wang et al. 2010
PCR-DGGE3
mcrA,
methanogens 5
Ar109f / 1490R
T-RFLP
Ar109f
PCR
Ar109f / Ar915r (labelled with
6-carboxyfluorescein)
ARDRA6
ARCH21f / ARCH958r
Archaea
Archaea
Archaea
-
Hales et al. 1996; Jouttonen et al. 2006
Imachi et al. 2006;
Watanabe et al. 2006;
Sakai et al. 2007; Watanabe et al. 2010
Imachi et al. 2006; Sakai
et al. 2007
Methanosarcinaceae, Methanosaetaceae,
Methanobacteriales, Methanocellales
(Rice Cluster I), Rice Cluster II,
Crenarchaeota Group I.3 and
Crenarchaeota Group I.1b
Conrad et al. 2009
65% phylum Crenarchaeota (genera
Dessulfurococcus, Pyrodictium, Sulfolobus,
Thermococcus, Thermofilum and
Thermoproteus); 35% Euryarchaeota
(Methanococci and Methanomicrobia)
Pazinato et al. 2010
- Eschericha coli position: 340–357
- E.coli position: 707–691A 40-bp
3
- DGGE-denaturing gradient gel electrophoresis
4
- GC clamp underlined was attached to the 5’ end of the forward or reverse primer of each target group
5
- Forward MCR a-subunit gene primer
1
2
6
Sugano et al. 2005
ME1 f / ME2 r
0357F-GC / 0915aR
-
Reference
- ARDRA: Amplified ribosomal DNA restriction analysis technique
5
6
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Methanogens and Methanotrophs in Rice Fields
Table 2. Sequence of primers utilized for detection of methanogens
Primer set
Sequence(5′→3′)
Reference
0357F-GC clamp (Eschericha coli
position: 340–357)
5’-CGC CCG CCG CGC GCG GCG GGC GGG
GCG GGG GCA CGG GGGG CCC TAC GGG
GCG CAG CAG-3’
Sugano et al. 2005
ME1 f
5’GCMATGCARATHGGWATGTC
Hales et al. 1996; Jouttonenetal,
2006
0357F GC1
5’-CCC TAC GGG GCG CAG CAG-3’
Watanabe et al. 2006;
Watanabe et al. 2010
1106F-GC1
5’-TTW AGT CAG GCA ACG AGC-3’
Watanabe et al. 2009
1106F
5’-TTW AGT CAG GCA ACG AGC-3’
Wang et al. 2010
Ar109f
5’-AMDGCTCAGTAACACGT-3’
Imachi et al. 2006; Sakai et al. 2007;
Conrad et al. 2009
1378R
5’-TGT GCA AGG AGC
AGG GAC-3’
Watanabe et al. 2009
GC-1378R
5’-GGA TTA CAR GAT TTC AC-3’
Wang et al. 2010
0691R
5’-GGA TTA CAR GAT TTC AC-3’
Sugano et al. 2005; Imachi et al.
2006; Watanabe et al. 2006; Sakai
et al. 2007; Watanabe et al. 2010
ME2 r
5’TCATKGCRTAGTTDGGRTAGT
Hales et al. 1996;
Jouttonenetal, 2006
1
- A 40-bp GC clamp underlined was attached to the 5’ end of the forward or reverse primer of each target group
Methanogens are responsible for methane
production through different metabolic pathways in
soil termed the methanogenesis process (Singh, 2009).
The methanogenesis pathways include acetoclastic
methanogenesis (the conversion of acetate to CH4 and
CO2), and hydrogenotrophic methanogenesis (conversion
of H2 and CO2 to CH4) (Dubey, 2005; Conrad et al., 2006).
Although, there are other methanogenesis pathways
involving the reduction of substances such as
methanol and methylamide, they are not usually
quantitatively significant. H2 and CO2, CO, formate,
methanol, ethanol, isopropanol and methylamides are
all energy sources for methanogens (Wang and Adachi,
2000; Conrad, 2007; Borrel et al., 2011). In fact, these
microorganisms play a significant role in the last step of the
biodegradation of organic matters in anaerobic condition
such as in natural wetlands and paddy fields (Rosenzweig
and Ragsdale, 2011a). Methane is an end product of these
processes (Conrad et al., 2006). Dubey (2005) has
described in detail the role of methanogens and their metabolic
pathways in paddy fields.
Methanogens in Paddy Soil.
Several types of
methanogen have been identified in rice soil by
different methods and primer sets. One of the most important
methanogens in rice soil is Rice Cluster I (RC-I).
The RC-I equivalent in the order
Methanocellales
(Sakai et al., 2008; Conrad et al., 2009; Borrel et al., 2011) are
hydrogenotrophic methanogens, which use H2 and
CO2 or formate as their carbon source (Liu et al., 2010).
The rice plant rhizosphere is an important habitat for
Methanocellales (Liu et al., 2010; Watanabe et al., 2010;
Ma and Lu, 2011), possibly due to the decomposition of
rice roots and thus the production of H2 and CO2, which
are substrates for methanogenesis (Watanabe et al., 2010).
These methanogens are the most predominant group
(Ma and Lu, 2011). More information about RC-I
has been provided by Conrad et al. (2006). These
microorganisms have been detected by targeting two
different genes of 16s rRNA or mcrA genes in paddy soil
(Conrad et al., 2006). On the other hand, there are several
reports of higher populations of acetoclastics than that of the
hydrogenotrophs methanogens in Indian rice soil
(Das et al., 2011; Datta et al., 2013). Also, it has been
stated that acetoclastic methanogenesis is responsible for
more than two thirds of methane production and the rest
is produced through hydrogenotrophic methanogenesis.
Accordingly, Das and Adhya (2012) knew the acetoclastic
methanogens to be predominant methanogenic archaea
in rice soil. However, at high temperatures (40-50 0C) the
methanogenesis is done only by hydrogenotrophic
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Methanogens and Methanotrophs in Rice Fields
Table 3. primer sets that have been used for detection of methanotrophs
Method
Primer
Target
Sequence(5′→3′)
DGGE
341F-GC /
907R
methanotroph
16S rRNA genes
CGC CCG CCG CGC CCC
GCG
CCC GTC CCG CCG CCC
CCG CCC GCC TAC GGG
AGG CAG CAG / CCG
TCA ATT CMT TTG
AGT TT
A189F2 /
A6822
pmoA ; pMMO/ GGN GAC TGG GAC TTC
AMO
TGG / GAA SGC NGA
GAA GAA SGC
A189 F with
GC clamp /
A682 R
pmoA ; pMMO/
AMO
MethT1dF /
MethT1BrGC1
Location/Detected methanotroph
Reference
Rhizosphere / type I and type II* Vishwakarma
methanotrophs of the genera Methy- et al. 2009
lobacter, Methylomonas, Methylosarcina, Methylosphaera, Methylomicrobium
and Methylocystis
-
Holmes et al.
1995
-
Rice Field / the type-I methanotrophs Methylobacter, Methylomicrobium, Methylococcus and Methylocaldum, and the type-II methanotrophs
Methylocystis and Methylosinus
Hoffmann et al.
2002
Type I MOB
CCTTCGGGMGCYGACGAGT / GATTCYMTGSATGTCAAGG
-
Wise et al. 1999;
Bodelier et al.
2005
1003 f /
1561 r
MxaF: All
methylotrophs
GCG GCA CCA ACT GGG
GCT GGT / GGG CAG
CAT GAA GGG CTC CC
-
Mc Donald and
Morrel, 1997;
Dubey, 2005
Am976-GC1
Type II MOB
GTCAAAAGCTGGTAAGGTTC
-
Wise et al. 1999;
Bodelier et al.
2005
MethT2RGC1
Type II MOB
CATCTCTGRCSAYCATACCGG
-
Gulledge et al.
2001; Bodelier et
al. 2005
A189F3 /
Mb661R3
pmoA ; pMMO/ GGN GAC TGG GAC TTC
AMO
TGG / CCG GMG CAA
CGT
PCR
C-SRFLP4
A189 f
And A682r5
-
M13f /
M13r
-
A189F
/ Mb661R
5’-GTAAAACGACGGCCAG-3’ / 5’-CAGGAAACAGCTATGAC-3′
T-RFLP
pmoA ; pMMO/ GGN GAC TGG GAC TTC
AMO
TGG
/ CCG GMG CAA CGT CYT
TAC C
Zoige wetland soils / Dominantly Yun et al. 2010
type I*
methanotrophs, genera Methylobacter,
Methylococcus (99% similarity),
Methanotrophic
proteobacterium
-
Vishwakarma et
al. 2010
Rice Field / type I* and type II
methanotrophs
Vishwakarma et
al. 2010
type I genera
Methylococcus,
Methylocaldum, Methylomicrobium and Methylobacter and
type II genera Methylocystis and
Methylosinus
Ma and Lu, 2011
alkaline hypersaline lake_rice
field/ type I methanotrophs
Lin et al. 2005;
Wu et al. 2009
- The following GC-clamp was attached at the 50-prime end of the primer sequence to facilitate DGGE analysis:
cgcccgccgcgccccgcgcccggcccgccgcccccgcccc
2
- A189f-A682r : Amplifies both pmoA and amoA sequences high degree of sequence identity between pmoA and amoA and largest
retrieval of methanotroph diversity of all of the primer sets ( Holmes et al. 1995; Bourne et al. 2001)
3
- A189f-mb661r : largest recovery of pmoA gene diversity, it failed to amplify sequences related to ‘high affinity’ methanotrophs
(Bourne et al. 2001)
4
- Cloning, screening, and RFLP
5
- used for first round and at second round reverse primer mb661 used for specific detection
*Dominant methanotrophic group
1
7
8
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Methanogens and Methanotrophs in Rice Fields
Table 4. Methanogens orders (Borrel et al. 2011; Rosenzweig and Ragsdale, 2011a)
Phylum
Euryarchaeota
Orders
Methanogenesis pathway
Methanomicrobiales
hydrogenotrophic
Methanosarcinales
Facultative hydrogenotrophic, primary
methylotrophs or acetotrophs
Methanocellales (RC-I)
hydrogenotrophic
Methanobacteriales
hydrogenotrophic
Methanococcales
hydrogenotrophic
Methanopyrales
hydrogenotrophic
methanogens (Conrad and Klose, 2011). Besides, with
rising CO2 concentration in the atmosphere the
hydrogenotrophic methanogens will be more active
(Das and Adhya, 2012).
Some findings suggest that methanogens and their
activity can be affected by environmental conditions.
For instance, both acetoclastic and hydrogenotrophic
methanogens’
populations
are
higher
at
the
flowering stage than at earlier stages (Das et al., 2011;
Datta et al., 2013). Similarly, comparison of the methanogenic
population size at different growth stages has been suggested by
Singh et al. (2012) to decrease in the following order: flowering,
ripening, tillering, postharvest and pre-plantation stage.
Soil depth is the other influencing factor, so that
methanogens usually occur at a higher population in the
top soil in wetlands than at 20cm below the soil; the higher
level of dissolved organic carbon at this depth range might
be the reason (Liu et al., 2011). Besides, methanogens may
display different community structure based on the soil depth
profile (Bodelier et al., 2005). For example,
Methanocellales, Methanomicrobiales, Methanosarcinales and
Methanobacteriaceae have been detected in the ploughed
layer of rice soil (Watanabe et al., 2010). Although,
all types of methanogen can be found in the ploughed
layer of soil, the Methanocellales display a preference for
rhizosphere. In the other work, the methanogenic
communities of different soil depths have been
studied and the soil at a depth of 0-5 cm differed from
those found at a depth of 5-10 and 10-20 cm. In fact,
the occurrence of Methylobacter-related sequences
showed a relationship with the soil profile; the decrease in
methane-oxidizing activity with depth might be a reason
for this.
Although methanogens are distributed relatively
universally, their type may differ between locations.
For instance, Watanabe et al. (2006) detected
Methanomicrobiales, Methanosarcinales and RC-I in
Japan. On the other hand, Wang et al. (2010) detected the
following methanogens in a Chinese paddy field:
Methanosaetaceae, Methanomicrobiales, Zoige cluster I
(ZC-I), Methanocellales, Methanosarcinaceae. Surprisingly,
there was a significant difference between the methanogen
communities found in Chinese and Japanese rice fields.
Therefore, methanogens’ structure appears to differ with soil
type and sampling location (Wang et al., 2010).
Soil moisture content and temperature has been shown
to be more effective than other influencing factors (Das and
Adhya, 2012), and so, for example, mid-season drainage
can modify the communities of methanogens in rice soil.
In this regards, Sugano et al. (2005) indicated that before
mid-season drainage methanogens communities included
Rice cluster I, Methanomicrobiales and Methanosarcinales,
but after this period only the Methanomicrobiales were
detected. Methanomicrobiales and Rice cluster I are the
methanogens most responsible for decomposition of rice
straw under flooded conditions. Water management can
affect the methanogenic community structure by
altering the water content of soil, so that it is a key factor for
methane emissions (Yao et al., 2006; Zhao et al., 2011).
For instance, alternate wetting and drying of the soil could
change the composition, population and transcriptional
activities of the methanogenic archaea (Watanabe
et al., 2010). In general, methanogens are more active
under flooding conditions compared to their activity in
dry soil (Watanabe et al., 2009). Thus, draining the soil
decreases methane emission from paddy soil (Neue et al., 1996;
Wassmann et al., 2000; 2009; Xu et al., 2007; Tyagi et al.,
2010; Khosa et al., 2011; Zhang et al., 2011). Methane
production is decreased by drainage not only because of
suppression of methanogen growth but also due to the
simultaneous
increase
in
the
methanotrophic
population (Ma and Lu, 2011).
In contrast with this promising observation, drainage
might also increase the Nitrous oxide (N2O) emission of
soil (Johnson-Beebout, 2009; Zhao et al., 2011). In fact,
N2O forms due to denitrification of nitrate in anaerobic
conditions (Malla et al., 2005; Fangueiro et al., 2010).
Therefore, there is high production of N2O during flooding of rice soil; however, the overall emission is low due to
the standing water pressure. The situation is reversed by
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
drainage (Ghosh et al., 2003). Therefore, this case requires
more investigation to achieve a reduction in methane
emission along with prevention of N2O production.
In this regard, Ghosh et al. (2003) suggested that
application of nitrification inhibitors, such as
dicyandiamide, might have a reducing effect on both CH4
and N2O production. Dicyandiamide plays a role as a sink
for methane (Malla et al., 2005). Likewise, another study
indicated that application of dicyandiamide during the 21
days after urea application could mitigate N2O emission by
82% (Smith et al., 1997). Polymer-coated fertilizers also
have the potential to decrease N2O emission due to the
release of nutrients occurring at a controlled rate,
and thus increasing the efficiency of nitrogen usage
(Akiyama et al., 2010). Another mitigation option would
be to maintain the soil in a moderately wet state instead
of alternating between flooding and drying, which would
potentially decrease both CH4 and N2O emission
(Klemedtsson et al., 2009). It has been indicated that a low
C:N ratio in soil enhances N2O emission (Klemedtsson
et al., 2009). Therefore, by imposing an appropriate
ratio a reduced emission might be achieved,
though the threshold ratio needs to be investigated.
Consequently, water management could be used to
decrease methane emission if some side strategies were taken
(e.g. optimisation of the C:N ratio, maintenance of wet but
not flooded soil, and application of nitrification inhibitors).
In contrast to methanogenic growth
suppression by drainage, there have been some reports on the
stability of some methanogenic archaea community structures
in paddy soils and their survival under adverse conditions
(such as drained rice soil) (Watanabe et al., 2009; Ma and
Lu, 2011). The methanogen populations change during the
rice growing season, increasing slowly from the beginning of
the rice season until the heading stage, and then declining
(Yue et al., 2007). This pattern is consistent among rice
fields with different soil properties and climatic conditions.
This fact suggests that water management has a greater
effect on seasonal changes of methanogen populations in
rice fields than the soil type or climatic conditions. A water
regime which regulates the soil redox potential (Eh) and soil
temperature could create
favourable conditions for
methanogens during the period of increasing population
(Minamikawa and Sakai, 2005; Yue et al., 2007;
Zhao et al., 2011). In fact, flooding of soil decreases
the soil redox potential (Husin et al., 1995), so that,
Neue et al. (2000) demonstrated that reduction of
soil Eh enhances methane production above a threshold
of -150mV to -200mV. On the other hand,
Eh increases after heading stage with draining of the soil
(Hadi et al., 2010; Zhang et al., 2011), and
Asakawa et al. (1997) showed that a high
Eh value suppresses the production of methane by
methanogens. Nevertheless, other factors such as plant
biomass and alterations in methanogenic activity and
density might be involved (Singh et al., 2012).
Methanogens and Methanotrophs in Rice Fields
9
Application of fertilizer can impose changes on the
methanogenic bacteria found in soil. Nitrogen (N)
fertilizer stimulates the denitrifying bacteria, which are more
capable of outcompeting methanogens for growth
substrates. As a result, N fertilizer could indirectly suppress
methanogenic activity. Besides, N2O and NO will
be generated as intermediates which are toxic to
methanogens (Wu et al., 2009). Nevertheless, N2O is a
potent greenhouse gas with GWP of 310 over a 100 year
period (IPPC, 2007). Several groups have proposed
solutions to this problem, described previously
(Smith et al., 1997; Ghosh et al., 2003; Malla et al., 2005;
Klemedtsson et al., 2009; Akiyama et al., 2010). The type
of N fertilizer can also determine the methane emission
rate. For example, ammonium sulphate causes less methane
emission than urea fertilizer (Ghosh et al., 2003).
Increases in greenhouse gases, especially CO2, are a
serious concern. Enhanced atmospheric CO2 can
simultaneously increase the methanogenesis and reduce
the methane oxidation in rice soil. This is a warning sign,
because CO2 elevation could increase methane emission
in the future. This problem could be made worse by increases
in temperature (Das and Adhya, 2012). In this situation, the
application of water management (e.g. drainage) as a
suppressing tool for methane production might be a
promising solution (Tyagi et al., 2010; Epule et al., 2011;
Zhao et al., 2011).
Temperature as an influencing factor on biological
processes can control the methane production by
influencing methanogenic activity (Schrope et al.,
1999; Tian et al., 2011). It has been indicated that
methane emission would increase from 4ºC to reach a
maximum at 37ºC (Yang and Chang, 1998).
Furthermore, in anaerobic zones of rice soils, methane
formation starts at 15 to 20ºC (Nozhevnikova et al., 2007).
Thus, soil temperature seems to regulate methane emissions
(Schotz et al., 1990; Khalil et al., 1998; Yang and Chang,
1998).
METHANOTROPHS
Methanotrophs
include
aerobic
methanotrophic
bacteria and anaerobic methanotrophic archaea.
Bodelier et al. (2005) identified eleven genera of
methanotrophic bacteria which were unknown until then, but
McDonald et al. (2008) reported fourteen genera
(Table 5). All identified genera of methanotrophic
bacteria have been classified into two groups:
type
I
(i.e.
phylogenetically
identified
as
gammaproteobacteria which assimilate one-carbon
compounds via the ribulose monophosphate cycle) and type
II (i.e. phylogenetically identified as alphaproteobacteria
which assimilate C1 intermediates via the serine pathway)
10
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
(Rosenzweig and Ragsdale, 2011b). Nevertheless, Hanson
and Hanson, (1996) reported type X as a further group of
methanotrophs. The genera of Methylococcus and
Methylocaldum are termed type X because these
microorganisms occupy an intermediate position
(Hanson
and
Hanson,
1996;
Dubey,
2005;
Bowman, 2006). In fact, type X can be considered as a
subdivision of type I, because in spite of some similarities, such
as possessing low levels of enzymes of the serine
pathway, there are some differences between the members of
group X and other methanotrophs. For example, there are
differences in phylogeny, chemotaxonomy, internal
ultrastructure, carbon assimilation pathways, and certain
other biochemical characteristics (Bowman, 2006).
For instance, group X members grow at higher temperatures
than type I or type II organisms. Besides, they possess DNA
with higher molar percentage G + C content (56–65) than
most type I (43–60) but less than type II (60–67) organisms
(Hanson and Hanson, 1996; Bowman, 2006). As a result,
in recent reports methanotrophic bacteria are reported
as consisting of two subgroups, type I and type II, with
the two genera of type X being categorized as type I
methanotrophs (Wu et al., 2009; Semrau et al., 2010;
Vishwakarma and Dubey, 2010; Rosenzweig and
Ragsdale, 2011b). Verrucomicrobia are methanotrophs
which have been isolated from geothermal locations. These
methanotrophs are able to fix nitrogen and grow at a
temperature range of 37-65 oC and pH values between 0.8
and 6.0. Nevertheless, the knowledge about this group is still
incomplete (Semrau et al., 2010).
Methanotrophs account for oxidization of the
methane produced by methanogenic archaea in the
shallow layers of soil (1-3 mm thick) and the rhizosphere
of
root-oxygen-releasing
plants
(e.g.
rice)
(Bodelier et al., 2005; Conrad et al., 2006). In addition,
these microorganisms have a significant role in regulating
methane emission from submerged soils such as natural
wetlands and paddy fields (Hoffmann et al., 2002).
After all, Rosenzweig and Ragsdale (2011b) demonstrated
methanotrophs’ assimilation pathways in detail.
Methanotrophs in Rice Soil.
Both types I and II of
methanotrophs have been detected in rice soil (Table 3).
Nevertheless, they live in different niches depending on
oxygen and methane concentration (Mayumi et al., 2010).
In fact, the type I methanotrophs tend to be more active
in environments with higher oxygen and lower methane
levels compared to type II organisms which survive well
in anoxic bulk soil (Mayumi et al., 2010). This fact could
result in the selection of rice roots by type I methanotrophs
(Horz et al., 2001; Wu et al., 2009 Vishwakarma and
Dubey, 2010). In addition, transfer of oxygen from the
atmosphere to the root by aeranchyma texture might produce a
suitable environment for methanotrophic activity in the
roots and rhizosphere (Wu et al., 2009). Consequently,
in flooded conditions, there is more methanotrophic
Methanogens and Methanotrophs in Rice Fields
activity by methanotrophs type II than type I, and in drained
soil type I are more active compared to type II organisms
(Mayumi et al., 2010).
The population of methanotrophs decreases gradually
during the period of flooding rice soil (Yue et al., 2007).
Furthermore, a positive correlation has been reported
between methanotrophic population levels and the age of
rice plants in tropical rice soils. This was due to an increase
in plant biomass, decrease in soil moisture content and
decrease in ammonium ion concentration (Yue et al., 2007).
The specific rice plant cultivar has been suggested as an
influencing factor on methane oxidation activity and
methanotrophic bacteria populations in rice root and
rhizosphere (Win et al., 2011). Conversely, in other work
the rice variety was seen to have no significant effect on the
dynamics
of
the
methanotrophic
community
(Wu et al., 2009). The community structure of soil
microbial methnotrophs can be affected by plant
type more generally, and different crop rotation
may change the population structure. For example,
Xuan et al. (2011) reported the presence of different
populations of Verrucomicrobia in different rotation
patterns. This effect might be due to different root
exudates between crops and their effect on the soil microbial
community (Kozdroj and Dirk van Elsas, 2000;
Landi et al., 2006; Doornbos et al., 2012).
Type I methanotrophs have shown to possess
sensitivity to environmental factors (Wu et al., 2009),
but type II methanotrophs show more stability
(Vishwakarma and Dubey, 2010). Several factors
could affect methanotrophs such as temperature, pH,
rice cultivar, crop rotation and incorporation of organic
matters (Min et al., 2002; Singh et al., 2010; Xuan et al.,
2011). The optimum conditions for aerobic oxidation of
methane can be obtained at temperatures of 25-35 oC and
pH 6-8 in paddy rice soil (Min et al., 2002). Providing the
optimum conditions for oxidation of methane (e.g. pH 6-8)
as much as possible in paddy soil might lead to mitigation of
methane emission. For instance, rice soil with a pH value
lower than 6 needs to be adjusted (e.g. by applying sufficient
lime to neutralise the soil).
Incorporation of pyrite, crop residues and other
organic amendments may enhance the abundance of
methanotrophic organisms in alkaline paddy soils, and
also increase the rice crop productivity (Singh et al., 2010).
On the other hand, it has also been reported that
incorporation of crop residue increases the methane
emission because of an increase in the substrate for
methanogens (Singh et al., 2003; Li et al., 2011).
Fertilizing the soil could influence the methanotrophic
bacteria. For example, application of a nitrogen fertilizer
such as urea may inhibit the methanotrophic abundance.
However, the application of nitrogen and potassium
together (e.g. potassium chloride) or the combination of
nitrogen, phosphate, potassium, and crop residue stimulate the
growth of methanotrophic communities (Zheng et al., 2008).
Application
of
ammonium-containing
nitrogen
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Methanogens and Methanotrophs in Rice Fields
11
Table 5. Types of methanotrophs (Wu et al. 2009, Semrau et al. 2010; Vishwakarma et al. 2010; Rosenzweig and
Ragsdale, 2011b)
Methanotrophs
Anaerobic
archaea
Aerobic bacteria
type I1 (Gammaproteobacteria)
type II (Alphaproteobacteria)2
Group a
Group b
Verrucomicrobial
strain Methylacidiphilaceae
Methylacidiphilum
the genera Methylobacter,
the genera
Beijerinckaceae,
Methylomicrobium,
Methylocystacea,
Methylocapsa,
Methylomonas, Methylocaldum,
Methylosinus,
Methylocella
Methylosphaera, Methylothermus,
Methylocystis
Methylosarcina, Methylohalobius,
Methylosoma, and Methylococcus
1
Type X is considered as a subgroup of type I
2
TypeII has devided to two groups based on differences in intracytoplasmic membrane formation, carboxysome-like structures
or vesicles, major PLFAs and G+C mol% (Semrau et al. 2010)
fertilizers at a high rate can decrease methane emissions
(Xie et al., 2010). This could not be done by stimulation of
methanotropic activity, because ammonium-based fertilizers
decrease the soil pH to a value outside the methanotrophs’
optimum range. Nevertheless, it can be done through
suppression of methanogens through changes in the soil
C:N ratio and by encouraging the predomination of
denitrifying bacteria (Singh et al., 2003; Wu et al., 2009).
CONCLUSION
This review presents the current understanding of the
ecological
characteristics
of
methanogens
and
methanotrophs in the paddy field ecosystem. Lots of studies
have been done on these microbial communities during last
two decades. These studies could help to identify direct or
indirect, single or multi-pronged approaches to reduction of
methane emissions from soil. The general idea is that methane
mitigation is theoretically achievable through suppression of
methanogens (methane producers) and/or stimulation of
methanotrophs (methane oxidizers). The next step would be
to find practical ways to induce the correct conditions in
the field without havng harmful effects on the environment.
However, this could be extremely complicated because
several influencing factors are involved. For example,
biological control based on the competitive capability of
different microbial communities seems to possible through
microbial competition. Providing a suitable situation for
advantageous microbes such as denitrifying bacteria
(e.g. by application of N fertilizer) could allocate the
carbon source to the competing community rather than to the
methanogens. Therefore, methane production would be
reduced. Moreover, water management (e.g. intermittent
drainage or an alternating wet and dry period irrigation
system) may be an effective technique to cut methane
emissions from soil. However, both drying the soil and
adding N fertilizer leads to increased production of N2O.
This problem might be overcome by implementation of
some N2O mitigation strategies in parallel. Therefore,
multilateral management strategies consisting of the
available mitigation options suitable to each situation would
be preferable to implementation of a single approach.
There are still some gaps in knowledge which need
to be filled. For example, the characteristics of some
methanotrophs such as Verrucomicrobia and nitrogen
fixing methanotrophs should be described more
completely, because these microbial communities might
have some potential, directly or indirectly, to mitigate
methane emission.
Additionally, further studies by research groups in
different environmental conditions are required to
define the environmental side effects, conflicts and
restrictions
of
indicated
methane
mitigation
approaches. For example, rice intensification is suggested
as a methane-decreasing cultivation system with a
suppressing effect on methanogenic activity. However,
this method needs to be evaluated in different locations
and weather conditions to understand its limitations or
benefits. Furthermore, understanding the characteristics
of other soil microbial communities and their interactions
(e.g. possible synergies or negative upshots) with
methanogens and methanotrophs could be beneficial.
The effect of different soil properties on the dynamics and
structure of microbial communities in different locations
would be helpful. These studies might result in development
of a multilateral control management and comprehensive
field methods towards providing a more environmentally
friendly or ‘green’ environment.
12
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Methanogens and Methanotrophs in Rice Fields
REFERENCES
Akiyama, H., Yan, X. and Yag, K. 2010. Evaluation of
effectiveness of enhanced-efficiency fertilizers as
mitigation options for N2O and NO emissions from
agricultural soils: meta-analysis. Global Change Biology
16: 1837–1846.
Chen, A.C., Ueda, K., Sekiguchi, Y., Ohashi, A. and Harada,
H. 2003. Molecular detection and direct enumeration
of methanogenic archaea and methanotrophic Bacteria
in domestic solid waste landfill soils. Biotechnology Letters 25: 1563–1569.
Antony, C.P., Murrell, J.C. and Shouche, Y.S. 2012.
Molecular diversity of methanogens and identification
of Methanolobus sp. as active methylotrophic archaea
in Lonar crater lake sediments. FEMS Microbiology
Ecology 81: 43–51.
Conrad, R. 2007. Microbial ecology of methanogens and
methanotrophs. Advances in Agronomy 96: 1–63.
Asakawa, S., Koga, Y. and Hayono, K. 1997. Enumeration
of methanogenic bacteria in paddy field soil by the most
probable number (MPN) method. (in Japanese) Soil
Microorganism 47: 31–36.
Bodelier, P.L. 2011. Interactions between nitrogenous
fertilizers and methane cycling in wetland and upland
soils. Current Opinion in Environmental Sustainability
3: 379–388.
Bodelier, P.L.E., Meima-Franke, M., Zwart, G. and
Laanbroek, H.J. 2005. New DGGE strategies for the
analyses of methanotrophic microbial communities
using different combinations of existing 16S
rRNA-based primers. FEMS Microbiology Ecology 52:
163–174.
Borrel ,G., Je´ze´quel, D., Biderre-Petit, C.,
Morel-Desrosiers, N., Morel, J.P., Peyret, P.,
Fonty, G. and Lehours, A.C. 2011. Production
and consumption of methane in freshwater lake
ecosystems. Research in Microbiology 162: 832-847.
Bourne, D.G., McDonald, I.R. and Murrell, J.C. 2001.
Comparison of pmoA PCR primer sets as tools for
investigating methanotroph diversity in three
Danish soils. Applied and Environmental Microbiology
67: 3802-3809.
Bowman, J. 2006.The Methanotrophs—The Families
methylococcaceae and methylocystaceae. Prokaryotes 5:
266–289.
Carini, S., Bano, N., LeCleir, G. and Joye, S.B. 2005.
Aerobic methane oxidation and methanotroph
community
composition
during
seasonal
stratification in Mono Lake, California (USA).
Environmental Microbiology 7(8): 1127–1138.
Conrad, R., Erkel, C. and Liesack, W. 2006. Rice
Cluster I methanogens, an important group of Archaea
producing greenhouse gas in soil. Current Opinion in
Biotechnology 17: 262–267.
Conrad, R. and Klose M. 2011. Stable carbon isotope
discrimination in rice field soil during acetate
turnover by syntrophic acetate oxidation or acetoclastic
methanogenesis. Geochimica et Cosmochimica Acta 75:
1531–1539.
Conrad, R., Klose, M., Claus, P. and Dan, J. 2009.
Activity and composition of the methanogenic archaeal
community in soil vegetated with wild versus cultivated
rice. Soil Biology & Biochemistry 41: 1390–1395.
Coolen, M.J.L., Hopmans, E.C., Rijpstra, W.I.C.,
Muyzer, G., Schouten, S., Volkman, J.K. and Sinninghe
Damste, J.S. 2004. Evolution of the methane
cycle in Ace Lake (Antarctica) during the holocene:
Response of methanogens and methanotrophs to
environmental change organic. Geochemistry 35:
1151–1167.
Das, S. and Adhya, T.K. 2012. Dynamics of
methanogenesis and methanotrophy in tropical paddy
soils as influenced by elevated CO2 and temperature
interaction. Soil Biology & Biochemistry 47: 36–45.
Das, S., Ghosh A. and Adhya, T.K. 2011. Nitrous
oxide and methane emission from a flooded rice field
as influenced by separate and combined application
of herbicides bensulfuron methyl and pretilachlor.
Chemosphere 84: 54–62.
Datta, A., Nayak, D.R., Sinhababu, D.P. and Adhya, T.K.
2009. Methane and nitrous oxide emissions from
an integrated rainfed rice–fish farming system of
Eastern India. Agriculture, Ecosystems & Environment
129: 228–237.
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Datta, A., Santrac, S.C. and Adhya, T.K. 2013. Effect of
inorganic fertilizers (N, P, K) on methane
emission from tropical rice field of India. Atmospheric
Environment 66: 123–130.
Dickie, I.A. and Fitz John, R. G. 2007.Using terminal
restriction fragment length polymorphism (T-RFLP)
to identify mycorrhizal fungi: a methods review.
Mycorrhiza 17(4): 259–270.
Doornbos, R.F., Cornelis van Loon, L. and Bakker, P.A.H.M.
2012. Impact of root exudates and plant defense
signalling on bacterial communities in the rhizosphere.
A review. Agronomy for Sustainable Development 32:
227–243.
Dubey, S.K. 2005. Microbial ecology of methane emission
in rice agroecosystem: A review. Applied Ecology and
Environmental Research 3(2): 1–27.
Eickhorst, T. and Tippkotter, R. 2008a. Detection of
microorganisms
in
undisturbed
soil
by
combining fluorescence in situ hybridization (FISH) and
micropedological methods. Soil Biology & Biochemistry
40: 1284–1293.
Eickhorst, T. and Tippkotter, R. 2008b. Improved
detection of soil microorganisms using fluorescence
in situ hybridization (FISH) and catalyzed reporter
deposition (CARD-FISH). Soil Biology & Biochemistry
40: 1883–1891.
Epule, E.T., Peng, C. and Mafany, N. M. 2011. Methane
emissions from paddy rice fields: Strategies towards
achieving a win-win sustainability scenario between rice
production and methane emission reduction. Journal of
Sustainable Development 4(6): 188–196.
Fangueiro, D., Chadwick, D., Dixon, L., Grilo, J., Walter,
N. and Bol, R. 2010.Short term N2O, CH4 and CO2
production from soil sampled at different depths and
amended with a fine sized slurry fraction. Chemosphere
81: 100–108.
Ferry, J.G. 2010.
The chemical biology of
methanogenesis. Review article. Planetary and Space
Science 581: 775–1783.
Fey, A. and Conrad, R. 2000. Effect of temperature on
carbon and electron flow and on the archaeal
community in methanogenic rice field soil. Applied
and Environmental Microbiology 66(11): 4790–4797.
Methanogens and Methanotrophs in Rice Fields
13
Garcia, I.L. 1990. Taxonomy and ecology of methanogens.
FEMS Microbiology Reviews 87: 297–308.
Ghosh, S., Majumdar, D. and Jain, M.C. 2003. Methane
and nitrous oxide emissions from an irrigated rice of
North India. Chemosphere 51: 181–195.
Godin, A., McLaughlin, J.W., Webster, K., Packalen, M.
and Basiliko, N. 2012. Methane and methanogen
community dynamics across a boreal peatland nutrient
gradient. Soil Biology & Biochemistry 48: 96–105.
Gulledge, J., Ahmad, A., Steudler, P.A., Pomerantz,
W.J. and Cavanaugh, C.M. 2001. Family- and
genus-level 16S rRNAtargeted oligonucleotide probes for
ecological studies of methanotrophic bacteria.
Applied and Environmental Microbiology 67:
4726–4733.
Hadi, A., Inubushi, K. and Yagi, K. 2010. Effect of water management on greenhouse gas emissions and
microbial properties of paddy soils in Japan and
Indonesia. Paddy and Water Environment 8: 319–324.
Hanson, R.S. and Hanson, T.E. 1996. Methanotrophic
bacteria. Microbiological reviews 62: 439–471.
Hoffmann, T., Horz, H.P.,
Kemnitz, D. and
Conrad, R. 2002. Diversity of the particulate methane
monooxygenase gene in methanotrophic samples from
different rice field soils in China and the Philippines.
Systematic and Applied Microbiology 25: 267–274.
Holmes, A.J., Costello, A., Lidstrom, M.E. and
Murrell, J.C. 1995. Evidence that particulate methane
monooxygenase and ammoniamonooxygenase may
be evolutionarily related. FEMS Microbiology Letters
132: 203–208.
Horz, H.P., Tchawa Yimga, M. and Liesack, W. 2001.
Detection of methanotroph diversity on roots of
submerged rice plants by molecular retrieval of
pmoA, mmoX, mxaF, and 16S rRNA and ribosomal
DNA, including pmoA-Based terminal restriction
fragment length polymorphism profiling. Applied and
Environmental Microbiology 67(9): 4177–4185.
Husin, Y.A., Murdiyarso, D., Khalil, M.A.K.,
Rasmussen, R.A., Shearer, M.J., Sabiham, S.,
Sunar, A. and Adijuwana, H. 1995. Methane flux from
Indonesian wetland rice: The effect of water
management and rice variety. Chemosphere 31(4):
3153–3180.
14
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Hwang, K., Shin, S.G., Kim, J. and Hwang, S. 2008.
Methanogenic profiles by denaturing gradient gel
electrophoresis using order-specific primers in
anaerobic sludge digestion. Applied Microbiology and
Biotechnology 80: 269–276.
Intergovernmental Panel on Climate Change (IPCC).
2007. Working Group. I. The physical science basis.
Summary for policymakers. http://ipcc-wgI.ucar.edu/
wgI/wgI-report.html.
Johnson-Beebout, S.E., Angeles, O.R., Alberto, M.C.R.
and Buresh, R.J. 2009. Simultaneous minimization of
nitrous oxide and methane emission from rice paddy
soils is improbable due to redox potential changes with
depth in a greenhouse experiment without plants.
Geoderma 149: 45–53.
Khalil, M.A.K., Rasmussen, R. A., Shearer, M.J.,
Dalluge, R.W., Ren, L. and Duan, C.L. 1998. Factors
affecting methane emissions from rice fields. Journal of
Geophysical Research: Atmospheres 103 (D19): 25219–
25231.
Khosa, M.K., Sidhu, B.S. and Benbi, D.K. 2011. Methane
emission from rice fields in relation to management of
irrigation water. Journal of Environmental Biology 32:
169–172.
Kozdroj, J. and Dirk van Elsas, J. 2000. Response of the
bacterial community to root exudates in soil polluted
with heavy metals assessed by molecular and cultural
approaches. Soil Biology & Biochemistry 32: 1405–1417.
Kumar, S., Dagar, S.S., Mohanty, A.K., Sirohi, S.K.,
Puniya, M. Kuhad, R.C., Sangu, K.P.S.,
Griffith, G.W. and Puniya, A.K. 2011. Enumeration of
methanogens with a focus on fluorescence in situ
hybridization Naturwissenschaften 98: 457–472.
Klemedtsson, A.K., Weslien, P. and Klemedtsson, L. 2009.
Methane and nitrous oxide fluxes from a farmed
Swedish Histosol. European Journal of Soil Science
60: 321–331.
Kumar, S., Puniya, A.K., Puniya, M., Dagar, S.S.,
Sirohi, S.K., Singh, K. and Griffith, G.W. 2009. Factors
affecting rumen methanogens and methane
mitigation strategies. World Journal of Microbiology and
Biotechnology 25: 1557–1566.
Landi, L., Valori, F., Ascher, J., Renella, G., Falchini, L.
and Nannipieri, P. 2006. Root exudate effects on the
bacterial communities, CO2 evolution, nitrogen
transformations and ATP content of rhizosphere and
bulk soils. Soil Biology & Biochemistry 38: 509–516.
Methanogens and Methanotrophs in Rice Fields
Li, D., Liu, M., Cheng, Y., Wang, D., Qin, J., Jiao, J., Li, H.
and Hua, F. 2011. Methane emissions from double-rice
cropping system under conventional and no tillage in
southeast China. Soil and Tillage Research 113: 77–81.
Lin, J.L., Joye, S.B., Scholten, J.C.M., Schafer, H.,
McDonald, I.R. and Murrell, J.C. 2005. Analysis of
methane monooxygenase genes in mono lake suggests
that increased methane oxidation activity may correlate
with a change in methanotroph community structure.
Applied and Environmental Microbiology 71(10): 6458–
6462.
Liu, D.Y., Ding, W.X., Jia, Z.J. and Cai, Z.C. 2011.
Relation between methanogenic archaea and
methane production potential in selected natural wetland
ecosystems across China. Biogeosciences 8: 329–338.
Liu, Y., Timmis, K.N. Eds. and McGenity, T. section
Eds. 2010. Handbook of hydrocarbon and lipid
microbiology-taxonomy of methanogens.
Lu, Y. and Conrad, R. 2005.
In situ stable isotope
probing of methanogenic archaea in the rice rhizosphere.
Science 309: 1088–1090.
Ma, K. and Lu, Y. 2011. Regulation of microbial methane
production and oxidation by intermittent drainage in
rice field soil FEMS Microbiology Ecology 75: 446–456.
Malla, G., Bhatia, A., Pathak, H., Prasad, S., Jain, N.
and Singh, J. 2005. Mitigating nitrous oxide and
methane emissions from soil in rice–wheat system of the
Indo-Gangetic plain with nitrification and urease
inhibitors. Chemosphere 58: 141–147.
Mayumi, D., Yoshimoto, T., Uchiyama, H., Nomura, N.
and Nakajima-Kambe, T. 2010. Seasonal change in
methanotrophic diversity and populations in a rice
field soil assessed by DNA-stable isotope probing and
quantitative Real-Time PCR. Microbes and
Environments 25(3): 156–163.
Macalady, J.L., McMillan, A.M.S., Dickens, A.F., Tyler,
S.C. and Scow, K.M. 2002. Population dynamics of
type I and II methanotrophic bacteria in rice soils.
Environmental Microbiology 4(3): 148–157.
McDonald, I.R., Bodrossy, L., Chen, Y. and Murrell, J.C.
2008. Molecular ecology techniques for the study of
aerobic methanotrophs. Applied and Environmental
Microbiology 1305–1315.
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Methanogens and Methanotrophs in Rice Fields
15
Min, H., Chen, Z.Y., Wu, W.X. and Chen, M.C. 2002.
Microbial aerobic oxidation of methane in paddy soil.
Nutrient Cycling in Agroecosystems 64(1-2): 79–85.
Rosenzweig, A. and Ragsdale, S.W. 2011a. Methanogenesis. Methods in methane metabolism, Part A:
Methanogenesis. Academic Press Science p 424.
Minamikawa, K. and Sakai, N. 2005. The effect of
water management based on soil redox potential on
methane emission from two kinds of paddy soils in Japan.
Agriculture, Ecosystems & Environment 107: 397–407.
Rosenzweig, A. and Ragsdale, S.W. 2011b. Methods in
methane metabolism, Part B: Methanotrophy P 308.
Narihiro, T. and Sekiguchi, Y. 2011. Oligonucleotide
primers, probes and molecular methods for the
environmental
monitoring
of
methanogenic
archaea. Microbial Biotechnology 4(5): 585–602.
Nema, P., Nema, S. and Roy, P. 2012. An overview of
global climate changing in current scenario and
mitigation action. Renewable & Sustainable Energy
Reviews 16: 2329– 2336.
Neue, H.U., Wassmann, R. and Lantin, R.S. 2000.
Methane emissions from major rice ecosystems in Asia.
Developments in Plant and Soil Sciences 394 p.
Newby, D.T., Reed, D.W., Petzke, L.M., Igoe, A.L.,
Delwiche, M.E., Roberto, F.F.,
McKinley, J.P.,
Whiticar,
M.J. and Colwell, F.S. 2004.
Diversity of methanotroph communities in a basalt
aquifer FEMS Microbiology Ecology 48: 333–344.
Nozhevnikova, A.N., Nekrasova, V., Ammann, A.,
Zehnder, A.J.B., Wehrli, B., Holliger, C. 2007.
Infuence of temperature and high acetate
concentrations on methanogenensis in lake sediment
slurries. FEMS Microbiology Ecology 62: 336–344.
Pazinato, J.M., Paulo, E.N., Mendes, L.W., Vazoller, R.F.
and Tsai, S.M. 2010. Molecular characterization of the
archaeal community in an amazonian wetland Soil and
culture-dependent isolation of methanogenic archaea.
Diversity 2: 1026–1047.
Peng, J., Lu, Z., Rui, J. and Lu, Y. 2008. Dynamics of
the methanogenic archaeal community during plant
residue decomposition in an anoxic rice field soil.
Applied and Environmental Microbiology 2894–2901.
Rajagopal, B.S., Belay, N. and Daniels, L. 1988. Isolation
and characterization of methanogenic bacteria from
rice paddies. FEMS Microbiology Ecology 53: 153–158.
Sakai, S., Imachi, H., Hanada, S., Ohashi, A., Harada,
H. and Kamagata, Y. 2008. Methanocella paludicola
gen. nov., sp. nov., a methane-producing archaeon,
the first isolate of the lineage ‘Rice Cluster I’, and
proposal of the new archaeal order Methanocellales ord. nov.
International Journal of Systematic and Evolutionary
Microbiology 58: 929–936.
Schotz, H., Wolfgang, S. and Conrad, R. 1990. Influence of
soil temperature on methane emission from rice paddy
fields. Biogeochemistry 11: 11–95.
Schrope, M.K., Chanton, J.P., Allen, L.H. and Baker,
J.T. 1999. Effect of CO2 enrichment and ele-vated
temperature on methane emissions from rice, Oryza
sativa. Global Change Biology 5: 587–599.
Schütte, U.M.E., Abdo, Z., Bent, S.J., Shyu, C., Williams,
C.J., Pierson, J.D. and Forney, L.J. 2008. Advances
in the use of terminal restriction fragment length
polymorphism (T-RFLP) analysis of 16S rRNA
genes to characterize microbial communities. Applied
Microbiology and Biotechnology 80: 365–380.
Semrau, J.D., DiSpirito, A.A. and Yoon, S. 2010.
Methanotrophs and copper. FEMS Microbiology
Reviews 34: 496–531.
Singh, A. and Dubey, S.K. 2012. Temporal variation in
methanogenic community structure and methane
production potential of tropical rice ecosystem.
Soil Biology & Biochemistry 48: 162–166
Singh, A., Singh, R.S., Upadhyay, S.N., Joshi, C.G.,
Tripathi, A.K. and Dubey,
S.K. 2012.
Community structure of methanogenic archaea and
methane production associated with compost-treated
tropical rice-field soil. FEMS Microbiology Ecology
1–17.
16
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Singh, J.S., Pandey, V.C., Singh, D.P. and Singh, R.P.
2010. Influence of pyrite and farmyard manure on
population dynamics of soil methanotroph and rice yield
in saline rain-fed paddy field. Agriculture, Ecosystems &
Environment 139: 74–79.
Singh, S.N. 2009. Environmental science and engineering,
Climate change and crops. 384 p.
Singh, S.N., Verma, A. and Tyagi, L. 2003. Investigating
options for attenuating methane emission from Indian
rice fields. Environment International 29: 547– 553.
Smith, K.A., McTaggart, I.P. and Tsuruta, H. 1997.
Emissions of N2O and NO associated with nitrogen
fertilization in intensive agriculture, and the potential
for mitigation. Soil Use and Management 13: 296–304.
Sugano, A., Tsuchimoto, H., Cho, T.C., Kimura, M. and
Asakawa, S. 2005.Succession of methanogenic archaea
in rice straw incorporated into a Japanese rice field:
estimation by PCR-DGGE and sequence analyses.
Archaea 1: 391–397.
Surakasi, V.P., Antony, C.P., Sharma, S., Patole, M.S. and
Shouche, Y.S. 2010.Temporal bacterial diversity and
detection of putative methanotrophs in surface mats
of Lonar crater lake. Journal of Basic Microbiology 50:
465–474.
Tian, J., Chen, H., Wang, Y. and Zhou, X. 2011. Methane
production in relation with temperature, substrate and
soil depth in Zoige wetlands on Tibetan Plateau. Acta
Ecologica Sinica 31(2): 121–125.
Tyagi, L., Kumari, B. and Singh, S.N. 2010. Water
management — A tool for methane mitigation from
irrigated paddy fields. Science of the Total Environment
408: 1085–1090.
Vishwakarma, P. and Dubey, S.K. 2010. Diversity of
methanotrophs in urea-fertilized tropical rice
agroecosystem. Indian Journal of Microbiology 50:
205–211.
Vishwakarma, P., Dumont, M.G., Bodrossy, L.,
Stralis-Pavese, N., Murrell, J.C. and Dubey, S. K. 2009.
Ecological and molecular analyses of the rhizospheric
methanotroph community in tropical rice soil: effect of
crop phenology and land-use history. Current Science
96 (8): 1082–1089.
Methanogens and Methanotrophs in Rice Fields
Vishwakarma, P., Singh, M. and Dubey, S.K. 2010.
Changes in methanotrophic community composition
after rice crop harvest in tropical soils. Biology and
Fertility of Soils 46: 471–479.
Wang, G., Watanabe, T., Jin, J., Liu, X., Kimura, M.
and Asakawa, S. 2010. Methanogenic archaeal
communities in paddy field soils in north-east
China as evaluated by PCR-DGGE, sequencing and
real-time PCR analyses. Soil Science & Plant Nutrition
56: 831–838.
Wassmann, R., Hosen, Y. and Sumfleth, K. 2009. Reducing
methane emissions from irrigated rice. Agriculture and
Climate Change. Focus 16. Brief 3.
Wassmann, R., Neue, H.U., Lantin, R.S., Buendia, L.V.
and Rennenberg, H. 2000. Characterization of
methane emissions from rice fields in Asia. I.
Comparison among field sites in five countries. Nutrient Cycling in Agroecosystems 58: 1–12.
Watanabe, T., Hosen, Y., Agbisit, R., Llorca, L., Fujita,
D., Asakawa, S. and Kimura, M. 2010. Changes in
community structure and transcriptional activity of
methanogenic archaea in a paddy field soil brought
about by a water-saving practice – Estimation by
PCR-DGGE and qPCR of 16S rDNA and 16S rRNA.
19th World Congress of Soil Science, Soil solutions
for a changing world 1 – 6 August 2010, Brisbane,
Australia. Published on DVD.
Watanabe, T., Kimura, M. and Asakawa, S. 2006.
Community structure of methanogenic archaea in
paddy field soil under double cropping (rice–wheat).
Soil Biology & Biochemistry 38: 1264–1274.
Watanabe, T., Kimura, M. and Asakawa, S. 2009.
Distinct members of a stable methanogenic archaeal
community transcribe mcrA genes under flooded
and drained conditions in Japanese paddy field soil.
Soil Biology & Biochemistry 41: 276–285.
Watanabe, T., Kimura, M. and Asakawa, S. 2010.
Diversity
of
methanogenic
archaeal
communities in Japanese paddy field ecosystem,
estimated by denaturing gradient gel electrophoresis.
Biology and Fertility of Soils 46: 343–353.
AsPac J. Mol. Biol. Biotechnol. Vol. 21 (1), 2013
Win, K.T., Nonaka, R., Win, A.T., Sasada, Y.,Toyota,
K., Motobayashi, T. and Hosomi, M. 2011.
Comparison of methanotrophic bacteria, methane
oxidation activity, and methane emission in rice fields
fertilized with anaerobically digested slurry between a
fodder rice and a normal rice variety. Paddy and Water
Environment DOI 10.1007/s10333-011-0279-x.
Wise, M.G., McArthur, J.V. and Shimkets, L.J. 1999.
Methanotroph diversity in landfill soil: isolation of
novel type I and type II methanotrophs whose presence
was suggested by cultureindependent 16S ribosomal
DNA analysis. Applied and Environmental Microbiology
65: 4887–4897.
Wright, A.D.G. and Pimm, C. 2003. Improved strategy for
presumptive identification of methanogens using 16S
riboprinting. Journal of Microbiological Methods 55:
337– 349.
Wu, L., Ma, K., Li, Q., Ke, X. and Lu, Y. 2009.
Composition of archaeal community in a paddy field
as affected by rice cultivar and N fertilizer. Microbial
Ecology 58: 819–826.
Wu, L., Ma, K. and Lu, Y. 2009. Rice roots select for typeI methanotrophs in rice field soil. Systematic and
Applied Microbiology 32: 421–428.
Xie, B., Zheng, X., Zhou, Z., Gu, J., Zhu, B., Chen, X.,
Shi, Y., Wang, Y., Zhao, Z., Liu, C., Yao, Z. and Zhu,
J. 2010. Effects of nitrogen fertilizer on CH4 emission
from rice fields: multi-site field observations. Plant and
Soil 326: 393–401.
Xu, S., Jaff´e, P.R. and Mauzerall, D.L. 2007. A
process-based model for methane emission from
flooded rice paddy systems. Ecological Modelling 205:
475–491.
Xuan, D.T., Guong, V.T., Rosling, A., Alström, S., Chai,
B. and Högberg, N. 2011. Different crop rotation
systems as drivers of change in soil bacterial community
structure and yield of rice, Oryza sativa. Biology and
Fertility of Soils DOI 10.1007/s00374-011-0618-5.
Yang, S.S. and Chang H.L. 1998. Effect of environmental
conditions on methane production and emission from
paddy soil. Agriculture, Ecosystems and Environment
69: 69–80.
Yao, H., Wen, Z., Xunhua, Z., Shenghui, H. and
Yongqiang, Y. 2006. Estimates of methane emissions
from Chinese rice paddies by linking a model to GIS
database. Acta Ecologica Sinica 26(4): 980−988.
Methanogens and Methanotrophs in Rice Fields
17
Yu, Y., Lee, C., Kim, J. and Hwang, S. 2005.
Group-specific primer and probe sets to detect
methanogenic communities using quantitative real
time polymerase chain reaction. Biotechnology and
Bioengineering 189: 670–679.
Yue, J., Shi, Y., Zheng, X., Huang, G. and Zhu, J.
2007. The influence of free-air CO2 enrichment on
microorganisms of a paddy soil in the rice-growing
season. Applied Soil Ecology 35: 154–162.
Yun, J., Ma, A., Li, Y., Zhuang, G., Wang, Y. and Zhang,
H. 2010. Diversity of methanotrophs in Zoige wetland
soils under both anaerobic and aerobic conditions.
Journal of Environmental Sciences 22(8): 1232–1238.
Zhao, X., Jia, H., Cao, J. 2011. Study on mitigation
strategies of methane emission from rice paddies in
the Implementation of ecological agriculture. Energy
Procedia 5: 2474–2480.
Zhang, J.S., Zhang, F.P., Yang, J.H., Wang, J.P., Cai, M.L.,
Li, C.F. and Cao, C.G. 2011. Emissions of N2O
and NH3, and nitrogen leaching from direct seeded
rice under different tillage practices in central China.
Agriculture, Ecosystems & Environment 140: 164–173.
Zheng, Y., Zhang, L.M., Zheng, Y.M., Di, H. and
He, J.Z. 2008. Abundance and community
composition of methanotrophs in a Chinese paddy soil
under long-term fertilization practices. Journal of Soils
and Sediments 8: 406–414.