Zootaxa 3636 (1): 144–170
www.mapress.com / zootaxa /
Copyright © 2013 Magnolia Press
ISSN 1175-5326 (print edition)
Article
ZOOTAXA
ISSN 1175-5334 (online edition)
http://dx.doi.org/10.11646/zootaxa.3636.1.6
http://zoobank.org/urn:lsid:zoobank.org:pub:FF3A24CC-6545-4B77-83C5-2503143E7F16
A new species of Diadema (Echinodermata: Echinoidea: Diadematidae)
from the eastern Atlantic Ocean and a neotype designation of
Diadema antillarum (Philippi, 1845)
ADRIANA RODRÍGUEZ1,3, JOSÉ CARLOS HERNÁNDEZ1, SABRINA CLEMENTE1
& SIMON EDWARD COPPARD2
1
Biodiversidad, Ecología Marina y Conservación (BIOECOMAC). Departamento de Biología Animal. Facultad de Biología,
Universidad de La Laguna, Avenida Astrofísico Francisco Sánchez sn, La Laguna 38206. Spain
2
Smithsonian Tropical Research Institute, Post Box 0843-03092, Balboa, Ancon, Republic of Panama
3
Corresponding author. E-mail:[email protected]
Abstract
Diadema africanum sp. nov. Rodríguez et al. 2013 occurs in the eastern Atlantic Ocean at depths of 1–80 meters off Madeira Islands, Salvage Islands, Canary Islands, Cape Verde Islands, Sâo Tome Islands and at the continental coast off Senegal and Ghana. This species was previously considered an eastern Atlantic population of D. antillarum. Genetic distances
between the holotype of D. africanum and the neotype of D. antillarum herein designated, measured 3.34% in Cytochrome
oxidase I, 3.80% in ATPase-8 and 2.31% in ATPase-6. Such divergence is similar to that already highlighted between other
accepted species of Diadema. Morphometric analysis of test, spine and pedicellarial characters also separated D. africanum from D. antillarum and reveals that this new species is morphologically similar to D. antillarum ascensionis from the
mid Atlantic. The tridentate pedicellariae, which have been shown to have diagnostic characters which discriminate
among species of Diadema, occur as both broad and narrow valved forms in D. antillarum from the western Atlantic. In
D. africanum the tridentate pedicellariae occur only as a single form which is characterized by moderately broad and
curved valves, with an expanded distal gripping region. This form of tridentate pedicellaria is very similar to that of D.
antillarum ascensionis from the central Atlantic, with only slight variations in valve serration and valve curvature differentiating the two forms.
Key words: Diadematidae, Diadema antillarum, Diadema africanum sp. nov. eastern Atlantic Ocean, test, spines, pedicellariae, taxonomy
Resumen
Di. africanum sp. nov. Rodríguez et al. 2013 se encuentra en el noreste del Océano Atlántico a 1–80 metros de
profundidad en las islas de Madeira, Salvajes, Canarias, Cabo Verde y Sâo Tome y en la plataforma continental de Senegal
y Ghana. Esta especie fue previamente considerada como una población del Atlántico oriental de Diadema antillarum. La
distancia genética entre el holotipo de Diadema africanum y el neotipo de Diadema aff. antillarum aquí designadas,
midieron 3.34% en Citocromo oxidasa I, 3.80% en ATPasa-8 y un 2.31% en ATPasa-6. Estas divergencias son similares
a las ya encontradas entre otras especies aceptadas de Diadema. El análisis de los caracteres morfométricos del caparazón,
púas y pedicelarios separa D. africanum de D. antillarum e indica que esta nueva especie se encuentra muy próxima a D.
antillarum ascensionis del Altántico medio. Los pedicelarios tridentados, usados normalmente como carácter diagnóstico
discriminante entre especies de Diadema se encuentran sólo en una forma en D. africanum los cuales se caracterizan por
tener unas valvas moderadamente anchas y valvas curvadas, con una amplia región distal de agarre. Esta forma de
pedicelario tridentado es muy similar al de Diadema antillarum ascensionis del Atlántico central, con solo ligeras
variaciones en el aserramiento de las valvas y la curvatura de las mismas que diferencian las dos formas.
144
Accepted by M. Eleaume: 23 Jan. 2013; published: 3 Apr. 2013
Introduction
Diadema Gray, 1825 is a genus of sea urchin in the family Diadematidae Peters, 1855. Species of this genus are
distinctive in having inflated tests that resemble a crown or diadem, with a depressed apical region, a small inflated
periproctal cone, and raised ambulacra aborally. Ambulacral plating in this genus is trigeminate, with nonconjugated pore-pairs and phyllodes developed adorally. Both primary and secondary spines are verticillate and
have a hollow axial cavity.
Diadema is one of the most abundant, widespread, and ecologically important genera among tropical sea
urchins that live in shallow water habitats (Lawrence & Sammarco 1982; Lessios et al. 2001; Coppard &
Campbell, 2005a, 2007; Muthiga & McClanahan 2007; Hernández et al. 2008). However, much confusion has
arisen in the literature concerning species identifications. This is because morphological differences between some
species are slight (Pearse 1970, 1998; Lessios et al. 2001). Based on morphology, the genus was considered to
consist of seven species with the following distributions: D. setosum (Leske, 1778) and D. savignyi Michelin, 1845
from the mid-Pacific to the East African coasts; D. paucispinum A. Agassiz, 1863 was thought to be endemic to
Hawaii (Mortensen, 1940); D. palmeri Baker, 1967 from the northern coasts of New Zealand (Baker 1967) and
southeast coasts of Australia (Rowe & Gates 1995); D. mexicanum A. Agassiz, 1863 distributed off the tropical
eastern Pacific coasts, from the Sea of Cortez to Ecuador including the islands of Revillagigedos, Clipperton, Isla
del Coco, and the Galapagos; D. antillarum (Philippi, 1845) distributed on both coasts of the Atlantic Ocean, on the
western coasts from Florida and Bermuda to Brazil, and on the eastern coasts from Madeira to the Gulf of Guinea
(this species was erroneously recorded by Mortensen (1940) in the Azores, see Wirtz & Martins 1993); and D.
ascensionis Mortensen, 1909, from the mid-Atlantic Ascension, St. Helena and Fernando Noronha Islands, which
was designated as a subspecies of D. antillarum by Pawson (1978). Considerable debate occurred in the early
literature over whether eastern Atlantic D. antillarum should be considered a subspecies (Koehler 1914, Clark
1925, Mortensen 1933). However, these authors ultimately concluded that it was insufficiently different from
western Atlantic D. antillarum.
A molecular study of Diadema by Lessios et al. (2001), using both mitochondrial DNA (mtDNA) and
isozymes revealed that the genus is composed of ten species. Six of these are nominal species, with an additional
four species that are undescribed (see Fig. 1). Populations of Diadema from the Central Atlantic islands of
Ascension and St. Helena were found to be a monophyletic entity nested within a Brazilian clade of D. antillaruma, supporting the designation of D. antillarum ascensionis as a subspecies. Diadema paucispinum, D. savignyi, D.
antillarum-a from the west and central Atlantic, and D. antillarum-b (also referred to as D. aff. antillarum sensu
Hernández, 2006; Clemente, 2007) from the east Atlantic, were found to form a polytomy. This suggests that D.
antillarum-a and D. antillarum-b should be recognised as separate species as their mitochondrial DNA is as
different from each other as among three accepted species.
Studies by Coppard & Campbell (2004, 2006a, 2006b) have described in detail morphological differences in
test, spine and tridentate pedicellarial structures among established species and subspecies of Diadema. However,
it remains to be determined whether morphological differences can be established for the new species identified
through their divergent mtDNA.
In this study we undertook to identify diagnostic characters that differentiate eastern Atlantic Diadema from
those of the western Atlantic. We initially searched for the holotype of D. antillarum, but after searching through
all known records of Philippi’s collections we believe that the type material of D. antillarum has been lost or
destroyed. Therefore, to stabilize the nomenclature, and following Article 75 of the International Code for
Zoological Nomenclature (International Commission on Zoological Nomenclature 1999), we hereby designate a
neotype of D. antillarum. To verify that the neotype of D. antillarum was congruent with D. antillarum-a and that
D. africanum conforms to D. antillarum-b, we sequenced the same part of Cytochrome oxidase I and Lysine tRNA-ATPase-6 and ATPase-8 regions used by Lessios et al. (2001). Sequences were aligned and phylogenetically
analysed to confirm that type specimens belong to respective mitochondrial clades.
Methods
Two specimens of D. antillarum were collected by scuba diving off Juventud Island, Cuba (21°33'55.92"N, 83°
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
145
9'54.46"W), near Matanzas, the type locality of D. antillarum, as designated by Philippi in the original description.
One of these specimens (TFMCBMEQ/00237) has been deposited as the neotype of D. antillarum in the Museo de
Ciencias Naturales de Tenerife (TFMC), Tenerife Island, (TFMCBMEQ/00237)
Twenty-five specimens of D. aff. antillarum were collected by scuba diving: fourteen individuals at three sites
of the Canary Islands (Abades 28º 08´ 27.94´´N, 16º 26´ 10.77´´W, Las Galletas 28º 00´ 28.87´´N, 16º39´43.75´´W
in Tenerife Island; and Costa Teguise 28º 59´32.65´´N, 13º 29´19.04´´W in Lanzarote Island), six specimens in
Madeira Island (Playa Tivoli 32º 38´03.58´´N, 16º 56´04.20´´W), and five specimens in Cape Verde (Mindelo 16º
54´37.20´´N, 24º 58´54.85´´W in Sâo Vicente Island).
Morphology. The methodology used was modified from Coppard & Campbell (2004, 2006a, 2006b). Fifty-six
morphological characters were measured including features of the test, spines (ambulacral and interambulacral)
and tridentate pedicellariae. Twenty-seven morphological characters of the test were measured from living and
denuded specimens (Table 1). All characters were examined and measured using a binocular light microscope.
Tests were carefully cleaned using a solution of 50% Sodium Hypochlorite, to reveal test characters which hold
important morphological information. The arrangement of test plates in the ambulacra and interambulacra were
carefully studied. This was aided by adding small quantities of 70% ethanol to the naked test, which as it
evaporated helped define the edges and features of individual plates. Photographs were taken to provide a visual
record of test structures that are typical of species, allowing for a direct comparison.
Four ambulacral and four interambulacral spines from each twenty-five specimens were equally cut into four
regions comprising the total length of the spine’s shaft (distal, proximal and two intermediate regions). All regions
were embedded in Agar 100 resin (Agar Scientific) (William et al., 1991) and allowed to harden for four days.
Transverse sections of 10–30 µm were cut from each of the four regions using an Ultracut microtome. Sections
were mounted on slides using Agar 100 resin and dried on a hot plate for two days. The slides were examined using
a binocular light microscope. Sections were not cut from the neck or base of the spines as such regions have been
reported to show little variation among species within genera (Agassiz, 1872; Mackintosh, 1875; Mortensen, 1940;
Moreno et al., 1980). The axial cavity, solid wedges, trabeculae, and presence/absence of reticular tissue were
studied and photographed. The size and proportion of the different features displayed by transverse sections were
also measured (Table 2).
Five tridentate pedicellariae and five triphyllous pedicellariae were studied from each specimen. These were
stored in vials and preserved in 70% ethanol. In total, 125 pedicellariae of each type and their skeletal ossicles were
observed by scanning electron microscopy (SEM). The pedicellariae were placed in 20% hydrogen peroxide
(H2O2) to remove the soft tissue and expose the underlying calcareous ossicles. To avoid overexposure to H2O2,
which might damage the ossicles, the cleaning process was observed under a binocular microscope. The
pedicellarial ossicles were then washed three times in distilled water and dried in absolute ethanol. They were left
overnight (in air) before being mounted on stubs and sputter coated in gold. Preparations were observed using
scanning electron microscopy (SEM), and pictures of each sample were taken. Sixteen morphological characters
used by Coppard & Campbell (2006b) were measured on the images (Table 3). The peripheral gripping area was
calculated from the measured dimensions, as a percentage of the distal peripheral area.
The morphological characters of test, spines and pedicellariae were measured using “Image J” software. Data
were statistically analysed using the software PRIMER (Plymouth Routines In Multivariate Ecological Research;
Clarke & Warwick, 1994). Principal Components Analyses (PCA) was applied only to the quantitative variables to
assess the similarity of morphological characters between the neotype of D. antillarum and D. africanum. These
morphological characters were as follows. Spine characters: spine diameter, number of solid wedges, axial cavity
mean diameter (% spine diameter), percentage of spine’s diameter comprised by solid wedges and percentage of
the spine’s diameter comprised by foraminated ring; pedicellarial characters: types of pedicellariae, length of distal
region (mm), width of distal region (mm), length of proximal region (mm), width of proximal region (mm), total
area of distal region (mm2), internal area of distal region (mm2)¸ peripheral area of distal region (that does not grip
(mm2), peripheral gripping area (mm2), total area of proximal region (mm2), adductor muscle insertion area (mm2),
keel and peripheral area of proximal region (mm2), peripheral gripping area as % of distal peripheral area (mm2),
height of teeth (mm) and width of teeth (mm); test characters: horizontal test diameter (mm), vertical test diameter
(mm), mean number of tubercles on genital plates, height to width (at widest point) ratio of genital plate, diameter
of gonopores (as a percentage of the genital plate’s height), apical system (as a percentage of the test’s horizontal
diameter), periproct (as a percentage of test’s horizontal diameter), peristome (as a percentage of the test’s
146 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
horizontal diameter) and relative percentage of ambulacra to interambulacra at the ambitus. Morphological
differences among species were tested for the quantitative variables using the ANOSIM procedure (Clarke, 1993).
DNA extraction, sequencing and alignment. Genomic DNA was extracted from the tube feet of the holotype
of D. africanum and from the neotype of D. antillarum using a DNeasy tissue kit (Qiagen). Two regions of
mitochondrial DNA (mtDNA) were amplified by polymerase chain reaction (PCR) using the protocol of Lessios et
al. (1998) and the primers of Lessios et al. (2001). Cytochrome oxidase I (COI) was amplified using the CO1f
5’CCTGCAGGAGGAG GAGAYCC and CO1a5’AGTATAAGCGTCTGGGTAGTC primers, while the LysinetRNA, ATPase-6 and 8 region was amplified using LYSa 5’AAGCTTTAAACTCTTAATTTAAAAG and ATP6b
5’GCCAGGTAGAACCC GAGAAT primers. The PCR products were purified, and then cycle sequenced using the
PCR primers and Applied Biosystems (ABI) PRISM BigDye Terminators. Nucleotides were sequenced in both
directions three times to check for consistency, on an ABI automatic sequencer. The sequences have been deposited
into GenBank with the accession numbers: KC622669 – KC622344. The sequences of both respective mtDNA
regions from Lessios et al. (2001) were downloaded from GenBank (accession numbers AY012728-AY013241)
and aligned using ClustalX 2.0.9 (Larkin et al., 2007). Sequence alignments were then compared in MacClade
(Maddison & Maddison 2001). jMODELTEST V. 2.1.1 (Posada, 2011) was used to determine the best model of
molecular evolution for each gene based on the AIC criterion (Akaike, 1974). From the tRNA, ATPase region, the
coding ATPase-6 and ATPase-8 genes were assessed independently. Tamura and Nei’s (1993) model was
suggested, for both COI (TrN+G) and ATPase-6 (TrN+I+G), with a gamma distribution shape parameter 0.0970 in
COI, with a proportion of invariable sites (I=0.5100) and gamma correction (G=1.2230) in ATPase-6. A transition/
transversion model TIM1+I+G was suggested for ATPase-8, where I=0.3890 and G=3.5380. Genetic distances
were calculated between the neotype of D. antillarum and the holotype of D. africanum, and among closely related
species of Diadema in PAUP* (Swofford, 2002), using maximum likelihood and the models, base frequencies,
proportion of invariable sites and gamma correction suggested by jMODELTEST.
Phylogenetic analysis. Bayesian phylogenetic analyses were carried out on all unique haplotypes from the
COI data and concatenated ATPase-6 and ATPase-8 coding regions using MRBAYES V. 3.2.1. and the models
suggested by jMODELTEST. These analyses were conducted on the species identified by Lessios et al. (2001) to
form a polytomy with D. antillarum and D. africanum (D. savignyi, D. paucispinum-a & b, D. antillarum-a & b). A
single haplotype of D. mexicanum was randomely chosen as an outgroup (only one outgroup is permitted in
MRBAYES), with heating parameter T=0.2. The analysis was started with Dirichlet priors for rates and nucleotide
frequencies and run for 8 million generations, sampling every 100th tree from two runs. Convergence was assessed
on the average standard deviation of slit frequencies <0.01 and the potential scale reduction factor (Gelman &
Rubin, 1992) reaching 1.00 for all parameters. The first 25% of trees were discarded from both runs as burn-in and
a 50% majority rule tree constructed, while clades with less than 85% support were collapsed.
A partitioned maximum likelihood analysis was also carried out in GARLI V.2.0 (Zwickl, 2006) using the
models suggested by jMODELTEST. Three replicate runs of one million iterations were conducted. Branch support
values were calculated in GARLI based on 400 bootstrap replicates, and the bootstrap consensus tree calculated in
PAUP*.
Results
Morphology
Diadema from the eastern Atlantic were found to be morphologically very close to D. antillarum from the western
Atlantic, but even closer to D. antillarum ascensionis from the mid Atlantic. However, small differences were
found to support its designation as a distinct species. Figure 1 illustrates the neotype (whole sea urchin) of D.
antillarum and Fig. 2 a denuded test of D. antillarum from the type locality, Figs 3 and 4 show the spines and
pedicellariae of D. antillarum respectively. Figure 5 illustrates the holotype of D. africanum (whole sea urchin) and
Fig. 6 the paratype of D. africanum (denuded test). Figure 7 shows details of the apical system and the iridophore
pattern. Figure 8 illustrates ambulacral spines and interambulacral spines of D. africanum with transverse sections
and Fig. 9 the pedicellariae. Figure 10 shows PCA plots of quantitative morphological characters of test, spines and
pedicellariae of D. antillarum (neotype) of D. africanum.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
147
FIGURE 1. NHMTFMCBMEQ/00237, neotype of D. antillarum: A, aboral view; B, oral view; C, lateral view.
148 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
FIGURE 2. NHMTFMCBMEQ/00237, neotype of D. antillarum: A, aboral view; B, oral view; C, lateral view centered on
ambulacrum V; D, lateral view centered on interambulacrum V; E, oral view showing auricle; F, apical system.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
149
FIGURE 3. NHMTFMCBMEQ/00237 neotype of D. antillarum. Ambulacral spines (A–G): A–C, proximal, medium and
distal parts of an ambulacral spine respectively; D, entire ambulacral spine; E–G, proximal, medium and distal ambulacral spine
transverse sections respectively. Interambulacral spines (H–N): H–J, proximal, medium and distal parts of an interambulacral
spine respectively; K, entire interambulacral spine; L–N, proximal, medium and distal interambulacral spine transverse
sections respectively.
150 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
FIGURE 4. Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous
pedicellariae of the neotype of D. antillarum NHMTFMCBMEQ/00237: A–H, tridentate pedicellariae; A–B, external and
internal views of a broad form; C–D, side views of a broad form; E–F, narrow form (external views); G, internal view of a
narrow form; H, side view of a narrow form; I, details of a narrow tridentate pedicellaria showing lateral teeth; J–K, Triphyllous
pedicellariae, internal and external views respectively; L, details of a triphyllous pedicellaria showing peripheral teeth.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
151
Diadema Gray, 1825
Gray 1825 p.246
Type species: Echinometra setosa Leske, 1778, by ruling of the ICZN, 1954.
Assigned species: D. setosum (Leske, 1778); D. savignyi, Michelin 1845; D. paucispinum A. Agassiz, 1863; D. palmeri Baker,
1967; D. mexicanum A. Agassiz, 1863; D. antillarum (Philippi, 1845); D. ascensionis Mortensen 1909, designated D.
antillarum ascensionis by Pawson (1978).
Diadema antillarum (Philippi, 1845)
Figs 1–4, tables 1–3
Cidaris (Diadema) antillarum Philippi, 1845. Arch. F. Naturg., 11 (1), p. 355.
Diadema antillarum, A. Agassiz 1863. Bull. M.C.Z., 1, p.19. Nutting, 1895, Bull. Univ. Iowa, Lab. Nat. Hist. (3), p.224,
unnumbered plate, fig.1 (young Diadema, labelled Aspidodiadema sp.)
Neotype diagnosis. Test and spines typically black with a red tinge. However, spines vary in colour, from white/
brown to black. Iridophores occur as a pentamerous ring around the apical disc. Arch-shaped depressions are found
on the apical disc along the inner edges of genital plates only in juveniles and young adults. This character fades
with age. In transverse section, ambulacral and interambulacral spines show an isosceles triangle-shaped solid
wedges that constitute the shaft. These wedges typically number sixteen in ambulacral spines and twenty in the
largest interambulacral spines. Only tridentate and triphyllous pedicellariae are present. Tridentate pedicellariae
occur as two forms, one with broad valves and a narrow form. Both forms have moderately curved valves, and
serrations along the edges of the valves.
Material examined. Neotype: (TFMCBMEQ/00237) in the ‘Museo de Ciencias Naturales de Tenerife’
(TFMC), Santa Cruz de Tenerife, Canary Islands, Spain.
Other material. One specimen of the Zoological Collection in the ‘Departamento de Biología Animal
(Ciencias Marinas)’, Universidad de La Laguna, Tenerife, Canary Islands.
Etymology. The species name refers to the species occurrence in The Antilles Islands.
Ecology. Diadema antillarum is a key herbivore on Caribbean reefs. Until 1983 this species was abundant on
Caribbean coral reefs and in seagrass beds. In 1983, a non-identified pathogenic infection resulted in a mass die-off
of this species which reduced population sizes by more than 97% in the Caribbean Sea and western Atlantic
(Lessios 1984b, 1988). Such population have failed to recover to pre-die-off numbers (Lessios 2005). Following
the mass mortality of D. antillarum there was an immediate increase in algal growth, particularly in areas where
herbivorous fish had been reduced in numbers through intense fishing pressure. In such regions, a reduction of
algal-free areas suitable for coral settlement has been reported, and is believed to be responsible for the reduction in
coral-cover (Lessios, 1988).
Diadema antillarum spawns around the time of the new moon, typically on the first two days of the first lunar
quarter (Lessios, 1984a). Settlement times and levels of recruitment of D. antillarum have been found to vary in
different localities (Lewis 1966; Bauer 1976; Lessios 1981, 1984b).
Distribution. Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean, including the
Caribbean Sea, tropical coasts of South America down to Brazil, and from Bermuda to Florida. It is typically found
in shallow waters on coral reefs, but has been reported from depths of 70 m (Mortensen, 1940).
Neotype description. The test is hemispherical, with a horizontal diameter of 45.0 mm and a vertical diameter
of 20.5 mm (Fig 1). The epithelium of the test is black (Fig. 1A–C) with a red tinge. In living specimens, narrow
blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring
around the apical disc. The apical system is hemicyclic and measures 23.94 mm, 24% of the test’s horizontal
diameter (Fig. 2D & Table 1). The genital plates are wider than long, with one to three tubercles along their inner
edge (Table 1 & Fig. 2F) and a genital pore that measures 45% the genital plate length. A faint arch-shaped
depression occurs on the inner edge of each genital plate, forming the corners of the apical ring. Ocular plates are
pentagonal in shape with two small tubercles in the centre of the plate. The periproctal cone is small and black, and
does not have any platelets or markings on the skin (Fig. 1A & Table 1). The ambulacra are slightly raised aborally;
and measure 22% of the width of interambulacral measured at the ambitus (Table 1 & Fig. 2). They have two rows
of large crenulate and perforate primary tubercles (Fig. 2), with an offset inner series of small tubercles. The
152 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles, with an
offset inner series of small tubercles. Each series contains 14 primary tubercles with areoles of moderate size (Fig.
2 & Table 1). The peristome measures 21.9 mm at the ambitus, 48.1% of the horizontal diameter. It is subcircular in
shape and has five pairs of buccal tube feet. The peristomial membrane is black and is covered with a large number
of triphyllous pedicellariae. Auricles are robust with high processes (Fig. 2E).
Ambulacral and interambulacral spines differ in their width and ornamentation. Ambulacral spines are black
with a red tinge (Fig. 3), the longest measures 28.52 mm in length (63.34% of the test horizontal) on the neotype,
0.9 mm in width proximally and 0.5 mm distally (Fig. 3E–G). These are verticillate with barbs distally (Fig.
3A–C), and are typically composed of sixteen solid wedges.
Interambulacral spines are predominantly black with a red tinge, but a number of brown and white spines are
present aborally (Figs 1 & 3). They are long and slender, the longest measuring 47.37 mm in length on the neotype.
The spines are verticillate, formed by 20 solid wedges, which radiate out from a hollow axial cavity. Spine width
varies from 1.4 mm in diameter proximally to 0.9 mm distally, with numerous barbs present distally (Figs 3H–J).
Only tridentate and triphyllous pedicellariae were found on the neotype, with no claviform ophicephalous
pedicellariae observed (Fig. 4 &table 3). Tridentate pedicellariae occur as two forms, one with broad valves (Fig.
4A–D) and a long broad neck on a short stalk, and a narrow form (comparing valves of equal length) with narrow
valves, a short neck and a long stalk (Fig. 4E–H). Both forms have moderately curved valves with serrations along
edges of the blades of the valves (Figs 4G–I). Both forms occur orally and aborally. However, the broad form is
less abundant. Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally,
with numerous small peripheral teeth that occur in two rows. (Figs 4J–L). The head of each pedicellaria is
supported by a long muscular neck attached to a long stalk.
Diadema africanum sp. nov.
Figs 5–10, tables 1–3.
Diagnosis. Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight.
The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas, as a
pentamerous ring around the apical disc and as lines along some plate boundaries. Apical disc is hemicyclic with
arch-shaped depressions on the denuded genital plates in both adults and juveniles. Gonopores measure 33% of the
length of the genital plates. The periproctal cone is black with no markings. The Peristome is proportionally large
measuring 40–60% of the test’s horizontal diameter. Spines are verticillate and hollow with distal barbs.
Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse
section. These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines.
Only tridentate and triphyllous pedicellariae are present. The tridentate pedicellariae occur as a single form with
reasonably broad, curved valves, with almost straight edges, that can either be smooth or serrated, with an
expanded distal gripping region. The blades of the valves meet only along the upper fifth of their length. The head
of each pedicellaria is supported by a long muscular neck, attached to a mid-length stalk.
Holotype: TFMCBMEQ/00232 in the ‘Museo de Ciencias Naturales de Tenerife’ (TFMC), Santa Cruz de
Tenerife, Canary Islands, Spain.
Paratypes: TFMCBMEQ /00233, TFMCBMEQ /00234, TFMCBMEQ /00235 in the ‘Museo de Ciencias
Naturales de Tenerife’ (TFMC), Santa Cruz de Tenerife, Canary Islands, Spain.
Other material. Twenty-one specimens in the Zoological Collection in the ‘Departamento de Biología Animal
(Ciencias Marinas)’, Universidad de La Laguna, Tenerife, Canary Islands.
Etymology. Species name refers to the geographical distribution of the species on the western coasts of Africa.
It is distributed on islands and continental coasts along the African continental shelf.
Ecology. Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the
West African coasts. In the eastern Atlantic islands, and particularly in Madeira and the Canary Islands, the species
is distributed throughout the islands at densities that can reach more than 12 individuals / m2 (Brito et al. 1984;
Alves et al. 2001; Hernández 2006; Clemente 2007; Hernández et al. 2008). The species can therefore dramatically
reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren
grounds (Hernández et al. 2008). This phenomenon is especially relevant in Madeira, Salvage and the Canary
Islands, where macroalgal beds represent the main ecosystem. Diadema africanum also occurs on coral dominated
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
153
reefs in Cape Verde and Sâo Tome, where sea urchin control of macroalgae via grazing is beneficial for coral
settlement and growth. Only a few studies have looked at the abundance and ecological role of D. africanum along
the tropical western African coasts (e.g. John et al. 1977; 1992), with further investigations needed.
Distribution. Diadema africanum occurs in the Eastern Atlantic islands, from Madeira Islands to the Guinean
Gulf including Salvage Islands, Canary Islands, Cape Verde Islands (Hernández et al. 2008), and Sâo Tome Island
(Lessios et al. 2001). It has also been also recorded in continental areas of Ghana (John et al. 1977, 1992) and in
Ngor Island, Senegal (P. Wirtz, pers. com).
Description. The test is hemispherical, with a horizontal diameter of 66.73 mm and a vertical diameter of
32.78 mm in the paratype and 61.23 mm h.d. and 31.36 mm v.d. in the holotype. The base colour of the test
epithelium is black with a red tinge (Fig. 5A–C), while the denuded test is white (Fig. 6A–E). The apical system
measures 18.14 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig. 6A). The genital
plates are wider than long, and have up to four small tubercles along their inner-edge (Table 1& Fig. 7A–B) with
large genital pores that measure 33% of the genital plate length (Fig. 7A). The ocular plates are pentagonal with a
small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate
(Fig. 7B).
On the naked test, distinct arch-shaped depressions are present on the genital plates of both adults and
juveniles (Table 5 &Fig. 7B). These depressions correspond to the corners of the pentamerous apical ring of
iridophores seen in living sea urchins (Fig. 7C–E). The iridophore pattern is bold and bright on the apical system
when viewed in sunlight. The periproct is 11.26 mm wide in the paratype (approximately 16% of the test’s
horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig. 5A).
The ambulacra are slightly raised aborally (Fig. 6C) and measure 30% of the width of the interambulacra (8.65
mm) at the ambitus in the paratype. They have two rows of large primary tubercles and an offset inner series of
small tubercles that are perforated and crenulated, with non-conjugate pore-pairs and phyllodes developed adorally.
The interambulacra are broader than the ambulacra at the ambitus (Fig. 6C–D), with 5–6 series (the inner
median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles.
Tubercles are perforate and crenulate and have areoles of moderate size (Fig. 7A). During the day blue lines of
iridophores can be seen down either side of the naked median regions.
The peristome is subcircular (Fig. 6B) and in the paratype it measures 26.9 mm in diameter, 40% of the test’s
horizontal diameter. The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig.
5B), with abundant triphyllous pedicellariae. The auricles are robust and have high processes (Fig. 6F).
In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight. In
juveniles, spines are banded red and white, which is typical of the genus. Ambulacral spines measure 43.21 mm in
length in the paratype (28.83% of the test horizontal diameter). These spines are strongly verticillate with barbs
pointing distally (Fig. 8A–D). Proximally these spines have a mean diameter of 0.89 mm that decreases distally
(Fig. 8E–G). The axial cavity comprises 28.8% of the horizontal diameter, which increases to 35.22% in the distal
region (Fig. 8E–G). The solid wedges are urn-shaped, and typically number twenty comprising 63.42% of the
spine’s horizontal diameter in the proximal section.
Interambulacral spines (Fig. 8H–N), are long and slender, with a maximum diameter of 2 mm proximally, and
taper distally (Fig. 8K–N). These spines measure 58.62 mm in the paratype. In transverse section the axial cavity
comprises 29.92% of the horizontal diameter proximally, but increases to 39.17% in the distal region (Table 2; Fig.
8L–N). The solid wedges are urn-shaped and typically number twenty-four, 62.57% of the of the spine’s horizontal
diameter in the proximal section.
Both tridentate and triphyllous pedicellariae are present in D. africanum (Fig. 9). No ophicephalous
pedicellariae were found, either true ophicephalous or of the claviform type, which have been reported in other
species of Diadema (Mortensen, 1940). Only a single form of tridentate pedicellaria is found in this species (Fig.
9A–I), which are abundant orally and aborally, but particularly around the periproct and around the peristome. This
form of tidentate pedicellaria has a long, muscular neck on a long stalk, which allows a high degree of movement
(Fig. 9A). The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length.
The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal
gripping region (Fig. 9D–I). Triphyllous pedicellariae are more abundant than the tridentate form and are
distributed all over the sea urchin test, but occur in particularly large numbers around the peristome. Their valves
are small and broad (Fig. 9J–N), with numerous small peripheral teeth that form two rows along the edges of the
valves, which interlock when the valves are closed (Fig. 9L–N).
154 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
FIGURE 5. NHMTFMCBMEQ/00232, holotype of Diadema africanum: A, aboral view; B, oral view; C, lateral view.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
155
FIGURE 6. NHMTFMCBMEQ/00233, paratype of Diadema africanum: A, aboral view; B, oral view; C, lateral view centered
on ambulacrum V; D, lateral view centered on interambulacrum V; E, oral view showing auricle. F, auricle.
156 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
FIGURE 7. NHMTFMCBMEQ/00233, paratype of Diadema africanum. Apical system and pattern of iridophores: A, genital
plate, gonopore and an ambulacrum; B, close-up of the apical system (paratype), C & D, pattern of iridophores around the
apical system on a living specimen in daylight; E, pattern of iridophores at night; F, pattern of iridophore on a living specimen
in daylight.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
157
FIGURE 8. NHMTFMCBMEQ/00233, paratype of Diadema africanum. Ambulacral spines (A–G): A–C, proximal, medium
and distal parts of an ambulacral spine respectively; D, entire ambulacral spine; E–G, proximal, medium and distal ambulacral
spine transverse sections respectively. Interambulacral spines (H–L): H–J, proximal, medium and distal parts of an
interambulacral spine respectively; K, entire interambulacral spine; L–N, proximal, medium and distal interambulacral spine
transverse sections respectively .
158 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
FIGURE 9. Pedicellariae: A–B, tridentate pedicellariae; C–I, scanning electron microscopy images (SEMs) of tridentate
pedicellariae; C, a tridentate pedicellaria; D–E, individual valves of a tridentate pedicellaria (side view); F–H, individual valves
of tridentate pedicellariae (internal views); I, peripheral teeth on the blade of a tridentate pedicellaria; J–K, triphyllous
pedicellariae; L–N, SEM images of triphyllous pedicellariae; L, triphyllous pedicellaria; M, internal view of a triphyllous
pedicellaria and N, close-up of peripheral teeth.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
159
Comparisons between D. antillarum and D. africanum using a PCA ordination based on 29 morphological
characters of the test, spines and pedicellariae are illustrated in Fig. 10. Overall differences observed in the
ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1, p<0.5), which
shows that D. africanum is morphologically distinct from D. antillarum. The PCA shows differences between
groups of individuals. Mean diameter of axial cavity (% spine diameter) (3) and the percentage of the spine’s
diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1, which means that the
two species highly differ on this variables. Diadema africanum specimens have wider diameters of spines and a
larger portion of the spine comprised of solid wedges. The peripheral gripping area as % of distal peripheral area
(mm2) (18) and the diameter of gonopores (% of genital plate height) (25) are negatively correlated with axis 1,
meaning that D. africanum shows reduced peripheral gripping area and narrower gonopores than D. antillarum.
There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22)
for both species, which can be seen in the ordination plot as vertical spread of the points following axis 2.
FIGURE 10. Principal Components Analyses (PCA) showing the first 2 axes that explain the 76.1 of variability (54.9 first axis,
21.3 second axis and 7.3 third axis) based on 29 quantitative variables including morphological characters of the test, spines
and pedicellariae in D. antillarum (two specimens: neotype plus another individual) and D. africanum (17 specimens). The
numbers correspond to: 1–5 spine characters; 6–20 pedicellarial characters and 21–29 test characters: 1. Spine diameter; 2.
Number of solid wedges; 3. Mean diameter of axial cavity (% spine diameter); 4. Percentage of the spine’s diameter comprised
of solid wedges; 5. Percentage of the spine’s diameter comprised by the foraminated ring; 6. Number of types of pedicellariae;
7. Length of distal region (mm); 8. Width of distal region (mm); 9. Length of proximal region (mm); 10. Width of proximal
region (mm); 11. Total area of distal region (mm2); 12. Internal area of distal region (mm2)¸13. Peripheral area of distal region
(that does not grip; mm2); 14. Peripheral gripping area (mm2); 15. Total area of proximal region (mm2);16. Adductor muscle
insertion area (mm2); 17. Keel and peripheral area of proximal region (mm2); 18. Peripheral gripping area as % of distal
peripheral area (mm2), 19. Height of teeth (mm); 20. Width of teeth (mm); 21. Horizontal test diameter (mm); 22. Vertical test
diameter (mm); 23. Number of tubercles on genital plate; 24. Height to width (at widest point) ratio of genital plate; 25.
Diameter of gonopores (% of genital plate height); 26. Apical system (% of horizontal test diameter); 27. Periproct (% of
horizontal test diameter); 28. Peristome (% of horizontal test diameter).; 29. Ambulacra % of interambulacra (at ambitus).
160 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
161
162 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
163
164 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
165
mtDNA analysis
Sequencing of the a–f COI region produced 633 bp of protein coding sequence. Bayesian inference (BI) and
Maximum likelihood (ML) analysis produced an identical polytomy consisting of D. savignyi, D. africanum, D.
antillarum and D. paucispinum (a & b) (see Fig. 11), with high posterior support for subclades. Using the COI data
we calculated a genetic distance of 3.34% between the holotype of D. africanum and the neotype of D. antillarum,
with mean genetic difference between the holotype of D. africanum and other species in this polytomy measuring
3.56% for D. savignyi, 5.59% for D. paucispinum-a and 5.03 % for D. paucispinum-b. The COI sequence of the
holotype of D. africanum had 100% maximum identity, over 99% coverage to sequences of D. antillarum-b (sensu
Lessios et al., 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731). The
neotype of D. antillarum formed a well-supported clade with the sequences of D. antillarum-a, and had 99%
maximum identity, over 99% coverage to sequences of COI from Fort Randolph, Panama (accession number
AY012728 and AY012728).
FIGURE 11. Partial phylogeny of Diadema using COI data of unique haplotypes, reconstructed with MRBAYES. Clade
credibility values (BI/ML) >85% shown (clades with <85% collapsed), scale bar reflects changes per site.
Sequencing the Lysine-tRNA, ATPase-6 and 8 region produced 581 bp of nucleotides. Within this region, the
protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively. These genes overlapped
by 10 bp. Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and
ATPase-6 data indicate that D. africanum forms a polytomy with D. savignyi, and D. paucispinum (a & b) (see Fig.
12), nested within a clade of D. antillarum. Within this clade is a subclade consisting of Brazilian D. antillarum and
D. antillarum ascensionis. No BI support was found for the D. paucispinum-a clade; however, ML methods
produced a clade credibility of 88%. Genetic distance between the holotype of D. africanum and the neotype of D.
antillarum measured 3.80% in ATPase-8 and 2.31% in ATPase-6. Mean genetic difference in ATPase-8 and
ATPase-6 between the holotype of D. africanum and other species in this polytomy measured 4.04% and 2.78% in
D. savignyi; 5.59% and 3.33% in D. paucispinum-a, and 7.40% and 3.36% in D. paucispinum-b. The ATPase-8 and
ATPase-6 sequences of the holotype of D. africanum were identical to those from specimens from Sâo Tome, The
Canary Islands, Cape Verde and Madeira, with haplotype accession number AY012873, while the neotype of D.
antillarum had 99% identity over 99% coverage to a haplotype from San Blas Panama (accession number
AF366131).
166 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
FIGURE 12. Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes,
reconstructed with MRBAYES. Clade credibility values (BI/ML) >85% shown (clades with <85% collapsed), scale bar reflects
changes per site.
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
167
Discussion
Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2% and more
typically less than 1% (Avise 2000), with a mean intraspecific divergence of 0.62% recorded from fifty-one species
of echinoderm (Ward et al. 2008). Our molecular data revealed a genetic difference of 3.34% in COI between the
holotype of D. africanum and the neotype of D. antillarum. Such divergence is similar to that of between D.
africanum (eastern Atlantic) and D. savignyi (southwest to mid-South Pacific). The genetic distances in ATPase-8
and ATPase-6 between the holotype of D. africanum and the neotype of D. antillarum are also similar to that
between D. africanum and D. savignyi, and provides further evidence to justify recognising D. africanum as a
separate species.
Divergence between D. antillarum and D. africanum occurred in the Pleistocene or Late Pliocene, probably
due to the isolation of population as the result of low sea levels and changes in the direction of currents during
glacial cycles (Lessios et al., 2001). Today these species are isolated from one another by the mid-Atlantic barrier.
This barrier has also more recently isolated D. antillarum ascensionis in the central Atlantic islands of Ascension
and St. Helena from Brazilian D. antillarum (Lessios et al., 2001). Contrary to the molecular phylogenetic analysis,
D. africanum is morphologically closer to D. antillarum ascensionis than to other species of Diadema, suggesting a
morphological convergence through environmental constraints in the mid and eastern Atlantic. Both species have
spines with an almost identical internal structure and similar tridentate pedicellariae. These are rostrate-like in D.
antillarum ascensionis (see Coppard & Campbell, 2006b), with highly curved valves and no peripheral teeth, while
in D. africanum the valves are only moderately curved, with the presence of peripheral serrations varying among
members.
The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical
ring of iridophores observed in D. africanum, D. savignyi, D. antillarum ascensionis and D. mexicanum. Such
markings are fainter or absent on the denuded genital plates of D. antillarum corresponding to a narrower ring of
iridophores in life. Iridophores are absent on the genital plates of D. paucispinum, and occur as dots of iridophores
on the genital plates of D. setosum and D. palmeri (Coppard & Campbell, 2006a).
In all species of Diadema, the spines taper distally (Coppard & Campbell, 2004). However, in D. africanum
this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other
species (Table 2). Mortensen (1940) reported specimens of D. antillarum with spine lengths that varied from 300 to
400 mm. Coppard & Campbell (2004) observed specimens of D. antillarum with a test diameter of 96 mm with
spines of 196 mm in length. Individuals with such large spines were not found in this study in the eastern Atlantic
islands; the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm. Therefore,
spines in D. africanum appear to be proportionally shorter, relative to test diameter, than in other species of
Diadema.
Morphometric analysis of the test revealed a proportionally broader range of variability in D. africanum than
has previously been recorded in other Diadema species (see Table 1). Notably the width of the peristome, periproct
and ambulacra, which can attain a proportionally larger size than reported in closely related species. The apical
system of D. africanum is similar in size (21–28% h.d.) to that of D. savignyi (22–28% h. d.), D. antillarum
ascensionis (20–26% h. d.) and D. mexicanum (20–25% h. d.), but is proportionally larger than in D. antillarum
(18–23% h.d., 23% h.d. in the neotype). However, it should be noted that in D. antillarum, data were recorded from
larger individuals. Therefore, such differences may reflect allometric growth.
Acknowledgments
We thank to A. Brito for his comments on an early version of this paper and to A. Vicente, D. Girard, K. Toledo and
J.M. Landeira for their help in the field. We are grateful to the ‘Departamento de Microbiología y Biología
Celular”, especially to M.C. Alfayate, for help with cutting spine sections. We are indebted to N. Dollahan
(Villanova University) for his advice on scanning electron microscopy. Thanks to O. Monterroso for aiding in
collecting samples in Cape Verde Islands and to R. Pestano Fariña for clarifications concerning species Latin
names. To also thank A. Pérez-Ruzafa for allowing us access to his private collection of sea urchins from Azores
and Madeira Islands and to P. Salinas for collecting D. antillarum from Cuba. We dedicate this paper to our friend
and colleague I. Lozano who recently passed away and to the newcomer Saulo.
168 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.
References
Agassiz, A. (1872) Revision of the Echini. Illustrated Catalogue of the Museum of Comparative Zoology, Harvard College, 7
Cambridge, M.A: Harvard University Press 7, 423–458 & 618–620.
Alves, F.M.A., Chícharo, L.M., Serrao.E & Abreu, A.D. (2001) Algal cover and sea urchin spatial distribution at Madeira
Island (NE Atlantic). Scientia Marine, 65, 383–392.
Avise, J.C. (2000) Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge, MA. 447 pp.
Baker, A.N. (1967) Two new echinoids from northern New Zealand, incluiding new species of Diadema.Transactions of the
Royal Society of New Zealand (Zoology), 8 (23), 239–245.
Bauer, J.C. (1976) Growth,agregration and maduration in the echinoid Diadema antillarum Philippi.Bulletin Marine Science,
26,273–277
Brito, A., Cruz, T., Moreno, E. & Pérez, M. (1984) Fauna Marina en las Islas Canarias. In: Edirca (Eds.), Fauna marina y
terrestre del Archipiélago Canario. Las Palmas de Gran Canaria, pp.42–65.
Clark, H.L. (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History). Oxford
University Press.250 pp.
Clarke, K.R. (1993) Non-parametric multivariate analyses of changes in community structure.Australian Journaly of Ecology,
18, 117–143.
http://dx.doi.org/10.1111/j.1442-9993.1993.tb00438.x
Clarke, K.R. & Warwick, R.M. (1994) Change in marine Communities: an Approach to Statistical Analysis and
Interpretation.Plymouth Marine Laboratory, Plymouth;Bourne Press Limited, Bournemouth, United Kingdom,144p.
Clemente, S. (2007) Evolución de las poblaciones del erizo Diadema aff. antillarum en Canarias y valoración de la
depredación como factor de control. PhD thesis, University of La Laguna, 421pp.
Coppard, S.E. & Campbell, A.C. (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and
Echinothrix.Invertebrate Biology, 123(4), 357–371.
http://dx.doi.org/10.1111/j.1744-7410.2004.tb00168.x
Coppard, S.E. & Campbell, A.C. (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji.
Micronesica, 37 (2), 249–269.
Coppard, S.E. & Campbell, A.C. (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and
Echinothrix. Zoosystema, 28, 93–112.
Coppard, S.E. & Campbell, A.C. (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diadema
and Echinotrix. Invertebrate Biology, 125(4), 363–378.
http://dx.doi.org/10.1111/j.1744-7410.2006.00068.x
Coppard, S.E. & Campbell, A.C. (2007) Grazing preferences of diadematid echinoids in Fiji. Aquatic Botany, 86, 204–212.
http://dx.doi.org/10.1016/j.aquabot.2006.10.005
Hernández, J.C. (2006) Estrategia reproductiva de la población canaria del erizo Diadema aff. antillarum Philippi, 1845:
maduración gonadal, asentamiento larvario y reclutamiento. PhD thesis, University of La Laguna, 241pp.
Hernández, J.C., Clemente, S., Sangil, C. & Brito, A. (2008) Actual status of the sea urchin Diadema aff.antillarum populations
and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic
Ocean).Aquatic Conservation: Marine and Freshwater Research, 66, 259–270.
International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition.
Available from: http://www.iczn.org/iczn/index.jsp (25/March/2013).
John, D.M., Lieberman, D. & Lieberman, M. (1977) A Quantitative study of the structure and dynamics of benthic subtidal
algal vegetation in Ghana (Tropical west Africa). Journal of Ecology, 65, 497–521.
http://dx.doi.org/10.2307/2259497
John, D.M., Price, J.H & Lawson, G.W. (1992) Tropical east Atlantic and Islands: plant-animal interactions on tropical shores
free of biotic reef. In: Jonh, P.M., Hawkins, S.J. & Price, J.H. (Eds.), Animal Interactions in the Marine Benthos. Oxford
Clarendon.Press.Oxford, pp.87–99.
Koehler, R. (1914) Echinoderma. I. In: WBeiträge zur Kenntnis der Meeresfauna Westafrikas. Michaelsen (Eds), L.
Friederichsen and Co, Hamburg, pp. 129–303.
Larkin, M.A., Blackshields, G., Brown, N.P. et al. (2007) ClustalW and ClustalX version 2.0. Bioinformatics, 23, 2947–2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Lawrence, J.M. & Sammarco, P.W. (1982) Effects of feeding in the environment. In: Jangoux, M. & Lawrence, J.M.(Eds.),
Echinoderm Nutrition. A. A. Balkema, Rotterdam, pp. 499–519.
Lessios, H.A. (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of
Panama.Journal of Experimental Marine Biology and Ecology, 50, 47–61.
http://dx.doi.org/10.1016/0022-0981(81)90062-9
Lessios, H.A. (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama. Evolution,
38, 1144–1148.
http://dx.doi.org/10.2307/2408446
A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN
Zootaxa 3636 (1) © 2013 Magnolia Press ·
169
Lessios, H.A., Cubir, J.D., Robertson, D.R., Shulman, M.J., Parker, M.R., Garrity, S.D. & Levings, S.C. (1984b) Mass
mortality of Diadema antillarum on the Caribbean coast of Panama. Coral Reefs, 3, 173–182.
http://dx.doi.org/10.1007/BF00288252
Lessios, H.A. (1988) Mass mortality of Diadema antillarum in the Caribbean: what have we learned? Annual Review of
Ecology, Evolution and Systematics, 19, 371–393.
http://dx.doi.org/10.1146/annurev.es.19.110188.002103
Lessios, H.A. (1990) Adaptation and phylogeny as determinants of egg size in echinoderms from two sides of isthmus of
Panama. American Naturalist, 135, 1–13.
http://dx.doi.org/10.1086/285028
Lessios, H.A. (2005) Echinoids of the Pacific Waters of Panama: Status of knowledge and new records. International Journal
Tropical Biology, 53(3), 147–170.
Lessios, H.A., Kessing, B.D. & Robertson D.R.(1998)Massive gene flow across the world’s most potent marine biogeographic
barrier. Proceedings of the Royal Society of London,265(B), 583–588.
Lessios, H.A., Kessing, B.D. & Pearse, J.S. (2001) Population structure and speciation in tropical seas, global phylogeography
of the sea urchin Diadema. Evolution, 55, 955–975.
http://dx.doi.org/10.1554/0014-3820(2001)055[0955:PSASIT]2.0.CO;2
Lewis, J.B. (1966) Growth and breeding in the tropical echinoid Diadema antillarum Philippi. Bulletin of Marine Science, 16,
151–157.
Mackintosh, H.W. (1875) Researches on the Structure of the spines of the Diadematidae (Peters).Transactions of the Royal
Irish Academy. 25, 519–556.
Maddison, D.R. & Maddison W.P. (2001) MacClade 4: analysis of phylogeny and character evolution. Version 4.03.Sunderlan
(MA): Sinauer Associates.
Muthiga, N.A. & McClanahan, T.R. (2007) Ecology of Diadema. In: Lawrence, J.M. (Eds). Edible Sea Urchins: Biology and
Ecology. Elsevier, Amsterdam, The Netherlands, pp 205–225.
http://dx.doi.org/10.1016/S0167-9309(07)80075-5
Moreno, E., Fernández Palacios, H. & Bacallado, J.J. (1980) Estudio morfológico de las púas de ocho especies de
equinodermos de las islas Canarias. Vieraea, 10, 39–52.
Mortensen, T. (1933) Papers from Dr. Th. Mortensen’s Pacific Expedition 1914–18. LXVI. The echinoderms of St. Helena.
(Other than crinoids).Vidensk.Medd. Dan. Nathist.Foren. 93, 473 pp.
Mortensen, T. (1940) A Monograph of the Echinoidea, Vol. 3: Aulodonta 1. CA Reitzel, Copenhagen, 370 pp.
Pawson, D.L. (1978) The echinoderm fauna of Ascension Island, South Atlantic Ocean. Smithsonian Contributions to the
marine sciences, 2, 1–31.
http://dx.doi.org/10.5479/si.01960768.2.1
Pearse, J.S. (1970) Reproductive periodicities of Indo-Pacific invertebrates in the gulf of Suez III.The echinoid Diadema
setosum (Leske). Bulletin of Marine Science, 20, 679–720.
Pearse, J.S. (1998) Distribution of Diadema savignyi and D.setosum in the tropical Pacific. In: Mooi, R. & Telford, M. (Eds.),
Echinoderms: San Francisco. A,A, Balkema, Rotterdam, pp. 778–782.
Rowe, F.W.E. & Gates, J. (1995) Echinodermata.In: Wells. A. (Eds.), Zoological catalogue of Australia. CSIRO, Melbourne,
pp.1–510.
Swofford, D.L. (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Sinauer Associates,
Sunderland, Massachusetts.
Tamura, K. & Nei, M. (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA
in humans and chimpanzees. Molecular Biology and Evolution 10, 512–526.
Ward, R.D., Holmes, B.H. & O'Hara, T.D. (2008) DNA barcoding discriminates echinoderm species. Molecular Ecology
Resources, 8, 1202–1211.
http://dx.doi.org/10.1111/j.1755-0998.2008.02332.x
William, L.J.Mc., Curry, A., Rowland, P.L. & Watson, J.S. (1991) Spinous injury caused by a sea urchin.Journal of clinical
Patology, 44, 428.
Wirtz, P. & Martins, H.M. (1993) Notes on some rare and little known marine invertebrates from the Azores, with a discussion
of the zoogeography of the region. Arquipélago, 11A, 55–63.
170 · Zootaxa 3636 (1) © 2013 Magnolia Press
RODRÍGUEZ ET AL.