Am J Physiol Gastrointest Liver Physiol 303: G1312–G1321, 2012.
First published September 27, 2012; doi:10.1152/ajpgi.00035.2012.
Telomere shortening is associated with reduced duodenal HCO⫺
3 secretory but
normal gastric acid secretory capacity in aging mice
Biguang Tuo,1,3,5 Zhenyu Ju,2,3 Brigitte Riederer,3 Regina Engelhardt,3 Michael P. Manns,3
K. Lenhard Rudolph,3,4 and Ursula Seidler3
1
Department of Gastroenterology, Affiliated Hospital of Zunyi Medical College, Zunyi, China; 2Max-Planck-Partner-Group
on Stem Cell Aging, Institute of Aging Research, College of Medicine, Hangzhou Normal University, Hangzhou, China;
3
Department of Gastroenterology, Hepatology, and Endocrinology, Medical School of Hannover, Hannover, Germany;
4
Institute of Molecular Medicine and Max-Planck-Research Department on Stem Cell Aging, University of Ulm, Ulm,
Germany; and 5Digestive Disease Institute of Guizhou Province, Zunyi, China
Submitted 30 January 2012; accepted in final form 22 September 2012
telomere shortening; gastric acid secretion; duodenal HCO⫺
3 secretion; duodenal ulcer; aging
PEPTIC ULCER, ESPECIALLY DUODENAL
ulcer, is a common disease.
The majority of duodenal ulcer is widely considered as related
to Helicobacter pylori infection (3, 4, 8, 10, 20, 26). However,
in parallel with higher hygiene and socioeconomic status, and
more effective eradication of H. pylori, the prevalence of H.
pylori is decreasing, as well as overall ulcer incidence in most
countries (3, 4, 8, 10, 20, 44, 45). In contrast, the percentage of
Address for reprint requests and other correspondence: B. Tuo, Dept. of
Gastroenterology, Affiliated Hospital, Zunyi Medical College, Dalian Rd. 149,
Zunyi 563003, China (e-mail: [email protected]).
G1312
H. pylori-negative duodenal ulcers among all endoscopically
verified duodenal ulcers is increasing worldwide, from a few
percent to up to almost 30% in recent years (3, 8, 10, 26, 50).
Additionally, the incidence of duodenal ulcer, especially H.
pylori-negative idiopathic duodenal ulcer, strongly increases
with age (20, 34, 50, 51). The study of the pathophysiology of
aging-associated duodenal ulcer disease has been hampered by
the lack of animal models, because the short life span of most
laboratory animals and a scarcity of typical signs of human
organismal senescence, renders them ill suitable to study aspects of human aging.
The imbalance between various aggressive and protective
factors acting on the mucosa is believed to play a decisive role
in the pathogenesis of duodenal ulcer. Gastric acid is considered as the major direct injury-causing factor against the
duodenal mucosa, both in the absence and presence of H.
pylori infection (15). On the other hand, duodenal mucosal
HCO⫺
3 secretion is currently accepted as one of the most
important protective mechanisms against acid-induced mucosal injury (2, 39).
Telomeres consist of small tandem nucleotide repeats located at each chromosome end of eukaryotic cells. The main
function of telomeres is to cap the ends of chromosomes, thus
preventing chromosomal fusions, chromosomal instability, and
the activation of DNA-damage responses (6, 14, 48). Shortening of telomeres leads to telomere dysfunction (uncapping of
chromosomal ends). Dysfunctional telomeres are recognized as
DNA damage and induce signaling via p53/p21 and other
molecules leading to cell cycle arrest or apoptosis (6, 9, 25,
37). In addition, short telomeres may influence intrinsic cell
functions such as hormone secretion, mitochondrial membrane
potential, Ca2⫹ release, etc. (22, 30, 31, 38). Interestingly, the
decline of telomere length occurs with different dynamics in
different human individuals as well as different human organs
(1, 12, 46). In general, telomere length has been associated
with longevity (37, 46) and a rapid decline in telomere length
due to organ disease associated with earlier development of
organ dysfunction (22, 29, 40, 49). However, the absolute
telomere length does not correlate with cell turnover rates of
the different organs, indicating that rapidly proliferating organs
must have means to elongate their telomeres via telomerase
activity (24, 46), as well as by other means (7, 17). In addition,
it has become clear, at least for cells that can be taken into
primary culture, that in vitro telomere shortening during cell
divisions is more rapid than in vivo decline of telomere length
during aging (46). This indicates that special research tools are
0193-1857/12 Copyright © 2012 the American Physiological Society
http://www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
Tuo B, Ju Z, Riederer B, Engelhardt R, Manns MP, Rudolph KL,
Seidler U. Telomere shortening is associated with reduced duodenal HCO⫺
3
secretory but normal gastric acid secretory capacity in aging mice. Am J
Physiol Gastrointest Liver Physiol 303: G1312–G1321, 2012. First published
September 27, 2012; doi:10.1152/ajpgi.00035.2012.—The incidence of
duodenal ulcer, especially Helicobacter pylori-negative duodenal ulcer, strongly increases with age. In humans, telomere length shortening is considered to be one critical factor in cellular senescence and
organ survival. In this study, we compared basal and stimulated
gastric acid and duodenal HCO⫺
3 secretory rates in aged late-generation (G3) telomerase-deficient (mTERC⫺/⫺) mice, which are characterized by severe telomere dysfunction due to the inability to elongate
telomeres during cell division. We found that basal and forskolinstimulated HCO⫺
3 secretion and short-circuit current (Isc) in isolated
duodenal mucosa of G3 mTERC⫺/⫺ mice were markedly reduced
compared with age-matched wild-type mice. In contrast, basal and
forskolin-stimulated acid secretory rates in isolated G3 mTERC⫺/⫺
gastric mucosa were not significantly altered. Correspondingly, duodenal mucosa of G3 mTERC⫺/⫺ mice showed slimming and shortening of villi, whereas gastric mucosal histology was not significantly
altered. However, the ratios of cystic fibrosis transmembrane conductance regulator (CFTR) and solute-linked carrier 26 gene family
(Slc26a6) mRNA expression in relation to cytokeratin-18 were not
altered in duodenal mucosa. The further knockout of p21, which is a
downstream effector of telomere shortening-induced senescence, rescued villus atrophy of duodenal mucosa, and basal and forskolin⫺/⫺
p21⫺/⫺
stimulated duodenal HCO⫺
3 secretion and Isc in mTERC
double-knockout mice were not different from wild-type controls. In
conclusion, genetic ablation of telomerase resulted in p21-dependent
duodenal mucosal atrophy and reduced duodenal HCO⫺
3 secretory
capacity, whereas gastric morphology and acid secretory function
were preserved. This suggests that telomere shortening during aging
may result in an imbalance between aggressive and protective secretions against duodenal mucosa and thus predispose to ulcer formation.
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
MATERIALS AND METHODS
Chemicals and solutions. All reagents were purchased from SigmaAldrich (Deisenhofen, Germany) and Merck (Darmstadt, Germany).
The mucosal solution used in Ussing chamber experiments contained
the following (in mmol/l): 140 Na⫹, 5.4 K⫹, 1.2 Ca2⫹, 1.2 Mg2⫹, 120
Cl⫺, 25 gluconate, and 10 mannitol. The serosal solution contained (in
mmol/l): 140 Na⫹, 5.4 K⫹, 1.2 Ca2⫹, 1.2 Mg2⫹, 120 Cl⫺, 25
2⫺
⫺
HCO⫺
3 , 2.4 HPO 4 , 2.4 H 2PO 4 , 10 glucose, 0.0001 tetrodotoxin,
and 0.0001 indomethacin. The osmolalities for both solutions were
⬃305 mosmol/l.
Animals. All studies were approved by Hannover Medical School
Committee on Investigations Involving Animals, as well as an independent committee of the regulatory authorities for animal welfare.
Experiments were performed on third-generation telomerase-deficient
mice (G3 mTERC⫺/⫺), age-matched wild-type, and third-generation
mTERC⫺/⫺ p21⫺/⫺ double-knockout mice, congenic on the C57BL6
background, and age-matched wild-type mice from the same ancestors. All mice were ⬃12–15 mo of age. Equal numbers of male and
female mice were used in the experiments. The genotype of
mTERC⫺/⫺ and mTERC⫺/⫺ p21⫺/⫺ was verified by PCR according
to published protocols that can be found under the standard PCR
protocol given at http://jaxmice.jax.org/strain/004132.html. The mice
were housed in a standard animal care room with a 12:12-h light-dark
cycle and were allowed free access to food and water.
Ussing chamber experiments. The preparation of isolated duodenal
mucosa and the measurement of duodenal HCO⫺
3 secretion were
exactly performed as described previously in detail (23). The measurement of gastric acid secretion was performed as described previously (35). Experiments were performed under continuous shortcircuited conditions to maintain the electrical potential difference
(PD) at zero, except for a brief period (⬍2 s) at each time point when
the open-circuit PD was measured. Luminal pH was maintained at
7.40 by the continuous infusion of 1 mmol/l HCl (for duodenum) or
NaOH (for gastric mucosa) under the automatic control of a pH-stat
system (PHM290, pH-Stat Controller; Radiometer, Copenhagen,
Denmark). The volume of the titrant infused per unit time was used to
⫺
quantitate HCO⫺
3 or HCl secretion. The rate of luminal HCO3 or HCl
secretion is expressed as micromole per centimeter per hour
(␮mol·cm⫺1·h⫺1). Transepithelial short-circuit current (Isc; reported
as ␮eq·cm⫺2·h⫺1) and PD (expressed as mV) were measured via an
automatic voltage clamp (Voltage-Current Clamp, EVC-4000; World
Precision Instruments, Berlin, Germany). Tissue conductance (Gt,
reported as ohm·cm2) was calculated according to values of Isc and
PD. After a 30-min measurement of basal parameters, 10 ␮M forskolin was added to the serosal side of tissue in Ussing chambers.
Changes in duodenal HCO⫺
3 or HCl secretion, Isc, and PD during the
40-min period ensuing after the addition of stimulants were determined.
For measurement of jejunal short-circuit current response to luminal glucose, the tissues were stripped in an identical fashion as the
duodenum, but the tissues were voltage clamped to zero voltage
continuously. Gassing was 95% O2-5% CO2 bilaterally, and the
serosal solution was used bilaterally, except that mannitol was used in
the luminal bath at equimolar concentrations to the glucose in the
serosal bath. At the indicated time, 25 mM glucose was added to the
luminal bath.
RNA extraction and real-time RT-PCR. Expression of solute-linked
carrier 26 gene family (Slc26a6) and cystic fibrosis transmembrane
conductance regulator (CFTR) mRNA in duodenum of mTERC⫺/⫺
mice and their wild-type littermates was determined by real-time
RT-PCR. Segments of duodenal mucosae were dissected free of
seromuscular layers as described above for Ussing chamber experiments. Total RNA was extracted as previously described (24). Quantitative real-time RT-PCR was performed on a Bio-Rad iQ5 real-time
PCR detection system (Bio-Rad) using a SYBR Premix Ex Taq II Kit
(Takara Bio) following the manufacturer’s instruction. The expression
level of CFTR and Slc26a6 mRNA was normalized to that of cytokeratin-18 and was expressed as a ratio relative to the epitheliumspecific cytokeratin-18 (36). The primers were as follows: CFTR
forward, AAGGCGGCCTATATGAGGTT and reverse, AGGACGATTCCGTTGATGAC; Slc26a6 forward, CCAGCAATCAAGAAGATGCC and reverse, ACACTTCCACTTCAATCTCCC; cytokeratin-18 forward, GGACTCCATGAAAAACCAGAAC and reverse,
TCTGCCATCCACGATCTTAC. To confirm the purity and size of
the PCR products, each PCR reaction mixture was analyzed by
electrophoresis in 3% agarose gel, and the gel was subjected to
autoradiography.
Histological analysis. For histological analysis, gastric and duodenal tissues were fixed in 4% paraformaldehyde, embedded in paraffin.
Sections were stained with Harris hematoxylin and eosin.
Statistics. All results are expressed as means ⫾ SE. ⌬HCO⫺
3 and
⌬Isc refer to stimulated peak responses minus basal levels. Basal
values for HCO⫺
3 and Isc refer to an average taken over the 30-min
baseline period. Data were analyzed by Student’s t-tests for unpaired
experiments. Normal distribution of the values was assessed before
determination of significance. P ⬍ 0.05 was considered statistically
significant.
RESULTS
Effects of telomere shortening on duodenal mucosal HCO⫺
3
secretion and gastric mucosal acid secretion in mice. In 12- to
15-mo-old G3 mTERC⫺/⫺ mice, basal duodenal mucosal HCO⫺
3
secretory rate (0.93 ⫾ 0.09 ␮mol·cm⫺2·h⫺1) and Isc (1.84 ⫾ 0.18
␮eq·cm⫺2·h⫺1) were lower than those in age-matched wild-type
(mTERC⫹/⫹) mice (1.27 ⫾ 0.11 ␮mol·cm⫺2·h⫺1 and 2.45 ⫾
0.24 ␮eq·cm⫺2·h⫺1, respectively) (P ⬍ 0.05). Moreover, forskolin-stimulated duodenal mucosal HCO⫺
3 secretion and Isc in
mTERC⫺/⫺ mice were reduced by 43 and 47%, respectively,
compared with mTERC⫹/⫹ mice (P ⬍ 0.0001; Fig. 1, A and B).
The concomitant reduction in HCO⫺
3 secretory rate and Isc suggests that electrogenic anion secretion, which consists of Cl⫺ as
well as HCO⫺
3 , is compromised. In contrast, basal and forskolinstimulated gastric acid secretion in mTERC⫺/⫺ mice was not
significantly altered (P ⬎ 0.05; Fig. 2, A and B).
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
necessary to study the influence of telomere length shortening
on organ function in vivo.
For this purpose, telomerase-deficient mice (mTERC⫺/⫺)
have been established that carry homozygous deletion of telomerase RNA component (TERC) and thus lack telomerase
activity (7). In contrast to humans, where the critical telomere
length that induces cellular senescence and limits organ regeneration can be reached during the lifetime of the individual (37,
46), the very long telomeres in mice prevent obvious telomereinduced organ failure in the first generations of mTERC⫺/⫺
mice. However, in later generations of homozygous intercross
of mTERC⫺/⫺ mice, telomere shortening produces critically
short telomeres, leading to decline of cellular regenerative
capacity, with ensuing organ dysfunction and shorter life span
(9, 37, 38).
For this study, we used third-generation telomerase knockout mice (G3 mTERC⫺/⫺) on a C57Bl-6J background, which,
in this generation, exhibit defects in organ homeostasis and
regeneration, and mainly in rapidly proliferating organs (9).
Here, we examined the effects of telomere shortening on the
aggressive and protective secretory processes in the gastroduodenal mucosa in aged G3 mTERC⫺/⫺ mice.
G1313
G1314
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
Telomere shortening induced duodenal but not gastric mucosal morphological abnormality. In mTERC⫺/⫺ mice, but not
in age-matched wild-type mice, histological analysis of the
duodenum revealed mucosal abnormality. Figure 3A shows a
section of duodenum with normal number and distribution of
villi and glands in age-matched wild-type mice and a representative image of the duodenum of a 12-mo-old G3
mTERC⫺/⫺ mouse. The section shows villous atrophy and
decrease with shortening of the villi and mucosa flattening in
duodenal mucosa in mTERC⫺/⫺ mice.
In contrast, gastric mucosal histology in G3 mTERC⫺/⫺
mice was not significantly altered compared with wild-type
mice (Fig. 3B). Specifically, we did not observe significant
changes in the length of the gastric glands or the composition
of epithelial cell types between age-matched wild-type and
mTERC⫺/⫺ mice.
Expression of CFTR and Slc26a6 in mTERC⫺/⫺ mice. The
cellular origin of duodenal HCO⫺
3 secretion is under debate.
While CFTR is essential for duodenal HCO⫺
3 secretion, it may
be that a large part of the secreted HCO⫺
actually
gets into the
3
lumen via Cl⫺/HCO⫺
3 exchangers from the Slc26 gene family,
which are coupled to the function of CFTR via Cl⫺ recycling
(16, 41, 42). While CFTR is crypt-predominant, the duodenal
Slc26 isoforms are villus predominant (41, 43). Thus, it is
⫺/⫺
feasible that a decrease in HCO⫺
3 secretion in TERC
duodenum may be due to the defective expression of cryptpredominant CFTR or the villus-predominant Slc26 members.
To investigate whether telomere shortening and senescence
impaired duodenal HCO⫺
3 secretion by inducing downregulation Slc26a6 and CFTR, we further measured the expression of
CFTR and Slc26a6 mRNA in duodenal mucosa of mTERC⫺/⫺
mice, in relation to the epithelial gene cytokeratin-18. Interest-
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
Fig. 1. Effect of telomere shortening on basal and forkolin-stimulated duodenal mucosal HCO⫺
3 secretion (A) and short-circuit current (Isc) (B). The data represent
⫺
the time course of changes of HCO⫺
3 secretion (a1) and Isc (b1) and the net maximal increases in HCO3 secretion (a2) and Isc (b2) observed. Forskolin (10 ␮M)
was added at the time indicated by the arrow. Values are expressed as means ⫾ SE and n ⫽ 10 –11 in each series. In third-generation (G3) telomerase-deficient
⫺
(mTERC⫺/⫺) mice, basal duodenal HCO⫺
3 secretion and Isc were lower than those in wild-type mice, and forskolin-stimulated duodenal HCO3 secretion
(⌬HCO⫺
3 ) and Isc (⌬Isc) were reduced by 43 and 47%, respectively, compared with aged-matched wild-type mice (****P ⬍ 0.0001).
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
G1315
DISCUSSION
Fig. 2. Effect of telomere shortening on basal and forkolin-stimulated gastric
acid secretion. The data represent the time course of change of gastric acid
secretion and the net maximal increases in acid secretion observed. Forskolin
(10 ␮M) was added at the time indicated by the arrow. Values are expressed
as means ⫾ SE and n ⫽ 6 –7 in each series. There were no significant
differences in basal and forskolin-stimulated gastric acid secretion (⌬HCl)
between G3 mTERC⫺/⫺ mice and wild-type mice (#P ⬎ 0.05).
ingly, both CFTR and Slc26a6 mRNA expression were not
altered in G3 TERC⫺/⫺ duodenum compared with the wild
type (P ⬎ 0.05, Fig. 4, A and B). This indicates that the atrophy
that is obvious by histological examination is perfectly balanced in that the relative mRNA expression of villus-predominant and crypt-predominant genes is not changed and that no
downregulation of transporter genes CFTR and Slc26a6 compared with cytokeratin (or villin, data not shown) is seen.
Glucose-induced Isc in proximal jejunal mucosa in mTERC⫺/⫺
mice. Glucose-induced Isc is a measure of electrogenic Na⫹
glucose cotransport, mediated by the Na⫹ glucose cotransporter SGLT1, which is strongly expressed in the brush-border
membrane of villous enterocytes. Therefore, glucose-induced
Isc is often measured as a parameter of villous integrity. To
In this paper, we demonstrate that aging third-generation
TERC-deficient mice, in which telomeres are known to be
shorter than in wild-type mice at birth and become progressively shorter over the lifespan of the mouse (7, 9), display
markedly reduced basal and stimulated duodenal HCO⫺
3 secretory rates but normal gastric acid secretory rates compared with
wild-type controls of the same age. The reduction in HCO⫺
3
secretion was accompanied by, and is probably secondary to, a
marked slimming of the duodenal villous architecture because
the additional deletion of the cyclin-dependent kinase inhibitor
p21, which is a downstream target for telomere shortinginduced signaling (9, 25), prevented the reduction in HCO⫺
3
secretion as well as the mucosal atrophy. These findings
suggest that telomere shortening may lead to a relative imbalance of the secretory capacity for protective and aggressive
secretory products in the upper gastrointestinal tract. If telomere shortening, which occurs during the normal lifespan in
humans, has a similar effect on human gastrointestinal tissues,
this may be one factor predisposing to duodenal ulcer development in advanced age.
Duodenal mucosal HCO⫺
3 secretion is currently accepted as
an important protective factor on duodenal mucosa against
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
study absorptive capacity of the small intestine in G3
mTERC⫺/⫺ mice, we measured the changes of Isc and Gt
induced by 25 mM glucose added to the luminal bath in
jejunum. While variability was high, possibly because of the
relatively high age of the mice, there was no significant
difference in glucose-induced Isc and Gt between age-matched
G3 mTERC⫺/⫺ and wild-type mice, suggesting that the vitality
of the epithelium was preserved and that major nutrient absorptive function was preserved (Fig. 5, A and B). In agreement
with this assumption, calorimetries of mouse feces did not
reveal evidence for an impaired uptake of energy in ad libitumfed G3 mTERC⫺/⫺ mice compared with age-matched wildtype mice (Missios P, Sakk V, Klaus S, Rudolph KL, unpublished observation).
Effect of p21 knockout on duodenal mucosal HCO⫺
3 secretion in mTERC⫺/⫺ mice. To find out if the predominant reason
for the decrease in HCO⫺
3 secretion was the overall thinning
and shortening of duodenal villi and thus loss of secretory
surface, TERC/p21 double-knockout mice were studied. p21
(Cdkn1a) is a downstream effector of senescence signaling
resulting in cell cycle arrest. It has been shown that p21
knockout partially rescued villi and crypt atrophy in aged mice
with dysfunctional telomeres (9). To investigate whether the
defect in HCO⫺
3 secretion could be restored by p21 ablation, we
⫺/⫺
analyzed duodenal mucosal HCO⫺
3 secretion in G3 mTERC
⫺/⫺
p21
double-knockout mice. There was no significant difference in basal duodenal mucosal HCO⫺
3 secretion between G3
mTERC⫺/⫺ p21⫺/⫺ mice (1.08 ⫾ 0.09 ␮mol·cm⫺2·h⫺1) and
wild-type mice (1.17 ⫾ 0.08 ␮mol·cm⫺2·h⫺1) (P ⬎ 0.05). Likewise, in G3 mTERC⫺/⫺ p21⫺/⫺ mice, forskolin-stimulated
HCO⫺
3 secretion and Isc were not different from wild-type controls (P ⬎ 0.05, Fig. 6, A and B). This demonstrates that the
decrease in basal and forskolin-stimulated duodenal HCO⫺
3 secretion is due to p21 checkpoint-controlled epithelial atrophy and not
due to a direct effect of short telomere signaling to the secretory
process.
G1316
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
Fig. 3. A: histology of duodenal mucosa. Duodenal
tissues were fixed in 4% paraformaldehyde and
embedded in paraffin. Sections were stained with
hematoxylin and eosin. a1 and a2: Representative
images of transverse and longitudinal sections of
the duodenum from a G3 mTERC⫺/⫺ mouse. The
section shows rarefication and shortening of the
villi as well as shortening of the crypts. a3 and a4:
Representative images of transverse and longitudinal sections of duodenum in an age-matched wildtype mouse, with normal number and distribution
of villi and glands. B: histology of gastric mucosa.
Giemsa stain better outlines the gastric cell types,
with the parietal cells in light blue and the zymogen (chief) cells in a darker blue. b1 and b2:
Representative images of transverse and longitudinal sections of stomach in an age-matched wildtype mouse, with normal number and distribution
of villi and glands. b3 and b4: Representative
images of transverse and longitudinal sections of
the stomach from a G3 mTERC⫺/⫺ mouse. No
significant differences were seen in any of the
studied sections between the mucosae of the G3
mTERC⫺/⫺ and wild-type mouse.
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
G1317
changes in prostaglandin (PGE2 and PGF2) production of
gastric and duodenal biopsies in humans and found a decrease
in gastric and duodenal postbulbar prostaglandin production in
the aged population. Duodenal HCO⫺
3 secretion was not measured in this study, and no information exists on the influence
of age alone on human HCO⫺
3 secretion. Tuo et al. (47) found
a higher basal and stimulated duodenal HCO⫺
3 secretory rate in
young women compared with postmenopausal women.
In this study, we found that, in G3 mTERC⫺/⫺ mice, basal
and stimulated duodenal mucosal HCO⫺
3 secretory rates were
markedly reduced compared with age-matched wild-type mice,
whereas gastric acid secretory rates were not different. Because
the mucosa was muscle stripped and chemically denervated,
and endogenous prostaglandin synthesis was suppressed, these
secretory rates reflect the secretory capacity of the epithelium
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
Fig. 4. Effect of telomere shortening on expression of cystic fibrosis transmembrane conductance regulator (CFTR) (A) and solute-linked carrier 26 gene
family (Slc26a6) (B) in duodenal mucosa. Expression of CFTR and Slc26a6
mRNA in duodenum of mTERC⫺/⫺ mice and their wild-type littermates was
determined by real-time RT-PCR as described in MATERIALS AND METHODS.
The epithelial marker cytokeratin-18 was used as an internal standard. The
results were expressed as the ratio of CFTR/cytokeratin-18 or Slc26a6/
cytokeratin. Data shown are means ⫾ SE and n ⫽ 6 – 8 in each series. No
significant change in CFTR and Slc26a6 mRNA expression of duodenal
mucosa between G3 mTERC⫺/⫺ mice and their wild-type littermates was
observed (#P ⬎ 0.05).
gastric acid-induced damage (2, 39), but little is known about
the effects of age on duodenal HCO⫺
3 secretion. Kim et al. (28)
studied duodenal HCO⫺
secretion
in anesthetized rats and
3
found a decrease in luminal acid-stimulated HCO⫺
3 secretory
response with age, whereas the basal HCO⫺
3 secretion and
agonist-stimulated HCO⫺
3 secretion was unchanged, suggesting a change in the acid-induced signaling pathways rather than
the duodenal mucosa itself. However, the change was observed
early (i.e., largest change between 3 mo and 1 year), so that it
may not relate to the changes that occur in human aging, i.e.,
after the sixth decade of life. Cryer et al. (13) studied the
Fig. 5. Glucose-induced Isc and tissue conductance (Gt) in the proximal
jejunum of G3 mTERC⫺/⫺ and wild-type mice. Values are expressed as
means ⫾ SE and n ⫽ 3 in each series. A: basal and glucose-induced Isc varied
substantially but were not statistically different between G3 mTERC⫺/⫺ and
wild-type mice. B: Gt increased after glucose application, but again was not
significantly different between mTERC⫺/⫺ and wild-type mice.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
G1318
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
itself. Changes of secretory capacity are generally due either to
a decreased production or increased destruction of the molecular machinery of the secretory process, i.e., the transporters
and/or their regulatory proteins, or due to alterations of mucosal morphology. When we studied duodenal mucosal morphology, we found a clear difference between the architecture of G3
mTERC⫺/⫺ and wild-type mice at the same age. In the G3
mTERC⫺/⫺ mice, villi were slimmer and appeared both less
abundant and shorter than in the wild-type mice. Together with
normal CFTR and Slc26a6/cytokeratin-18 mRNA expression
ratios, the findings suggest a reduction of the overall surface
area with no predilection of selective villous or crypt cell loss.
Other studies in these mice have shown a decrease in the
number of proliferating cells in the crypts of the small intestine, observed in the fourth generation of TERC⫺/⫺ mice (9).
How do these finding compare to reports of duodenal mucosa in aging humans and laboratory animals? Studies on
duodenal morphology have reported a high incidence of pathologic lesions in the duodenum in the older population, which
may reflect the high percentage of H. pylori-infected persons in
the studied cohorts (32). A more recent study found normal
villus length in the distal duodenum of elderly individuals but
a strong increase in the cells that stained positive for proliferating cell nuclear antigen, suggesting that the percentage of
undifferentiated enterocytes in the duodenum may increase
with age and absorptive capacity decrease (11). However, the
sample size was small. To assess whether the strong decrease
in duodenal HCO⫺
3 secretory rate may be due to an increase in
nondifferentiated enterocytes, or due to a change in transporter
expression, we measured the expression levels of two key
duodenal HCO⫺
3 transport proteins, the anion channel CFTR
and the Cl⫺/HCO⫺
3 exchanger Slc26a6. Because Slc26a6 is
most strongly expressed in the upper villous region and CFTR
most strongly in the cryptal region (41, 43), we would be able
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
⫺/⫺
Fig. 6. Effects of p21 knockout on forskolin-stimulated duodenal mucosal HCO⫺
mice. The data represent the time
3 secretion (A) and Isc (B) in G3 mTERC
⫺
course of changes of HCO⫺
3 secretion (a1) and Isc (b1) and the net maximal increases in HCO3 secretion (a2) and Isc (b2) observed. Forskolin (10 ␮M) was
⫺/⫺
added at the time indicated by the arrow. Values are expressed as means ⫾ SE and n ⫽ 6 –7 in each series. In mTERC
p21⫺/⫺ mice, both basal and
#
forskolin-stimulated HCO⫺
secretion
and
I
were
not
different
from
wild-type
controls
(
P
⬎
0.05).
sc
3
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
seen in gastric biopsies, but the decrease in ratio was less in the
stomach than in blood, and was largest in the duodenum. On
possible explanation indicates that proliferation rates are higher
in duodenal compared with gastric mucosa. However, it has
also been reported that the yearly reduction rates in small
intestine and in stomach are similar in both organs in the range
of 50 base pairs/yr (46). Aida et al. (1) used an advanced
technique to study telomere length in human gastric mucosa
from different age populations. They found that gastric fibroblasts had the longest telomeres and fundic surface cells the
shortest. However, the same group observed that the comparison of rapidly vs. slowly proliferating gastric cells, coming
from the same stem cell pool, does not explain these differences in telomere length (1, 46). This suggests that telomerase
activity may be present in proliferating, not just in stem, cells
as has been reported for the intestine (24). It is conceivable that
differences in telomerase activity and/or regulation in gastric
vs. intestinal mucosa could also impact on telomere shortening
rates during aging. Nevertheless, the presence of telomerase in
gastrointestinal epithelial cells in the proliferative zone does
not prevent telomere shortening in human intestine and gastric
mucosa (1, 12, 46), indicating that telomerase expression levels
are insufficient to maintain stable telomere length during aging
of the gastrointestinal tract. In addition, chronic disease such as
H. pylori infection, liver disease, or psychological stress may
affect telomere shortening (6, 14, 21, 25, 28, 40).
How does our study relate to duodenal ulcer pathophysiology in humans? As indicated in the last paragraphs, it is known
that telomere length is influenced by age and within an age
group, by genetic and environmental factors, and chronic
disease, and the same factors have been shown to increase
ulcer incidence. Our study demonstrates that telomerase ablation results in a strong weakening of a major duodenal defense
mechanism, namely basal and stimulated HCO⫺
3 secretion at
the level of the isolated mucosa. All other protective and
aggressive mechanisms such as the neural regulation of HCO⫺
3
secretion, motility, mucosal restitution, etc., will then be faced
with the problem that the capacity of the duodenal mucosa to
neutralize a given acid load is reduced by half. On the other
hand, the capacity of the isolated gastric mucosa to secrete acid
upon stimulation is not affected to the same degree. Other basal
functions of the intestine such as Na⫹, glucose absorption were
not disturbed to the same degree, possibly because reserve
capacity for this function is large. Telomere shortening thus
may have a differential effect on gastroduodenal ion transport
functions, resulting in an imbalance between aggressive and
protective secretions and predisposing to duodenal ulcer formation.
GRANTS
This work was supported by the National Natural Science Foundation of
China (30860092) and the International Scientific and Technological Cooperation Program of China (2008DFA32260) to B. Tuo and the Deutsche
Forschungsgemeinschaft Grants SFB621-C9 and Se460/13–2 and 13– 4 to U.
Seidler and Ru745–10 to K. L. Rudolph.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
Author contributions: B.T. and U.S. conception and design of research;
B.T., Z.J., B.R., and R.E. performed experiments; B.T., M.P.M., and U.S. ana-
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
to detect a selective change in cryptal or villous transporter
mRNA expression by measuring their mRNA expression levels
in G3 TERC⫺/⫺ and wild-type duodenum. Rather, to our
surprise, the mRNA expression of either transporter was not
changed in relation to cytokeratin-18. This argues against the
notion that the enterocytes have a differentiation defect and
suggests that the reduction in proliferation rate is the likely
reason for the reduced overall duodenal mucosal surface area.
Is it plausible that the decrease in the epithelial surface area,
found in the duodenum of G3 mTERC⫺/⫺ mice, may be the
major reason for a strong decrease in duodenal HCO⫺
3 secretion? Short telomeres may also cause direct defects in cellular
signaling pathways, irrespective of the effect on proliferation
(22, 30, 31, 38), and thus potentially interfere with duodenal
HCO⫺
3 secretion. To discriminate between these possibilities,
we made use of the fact that the cyclin-dependent kinase
inhibitor p21 is an important checkpoint downstream of p53
mediating the effects of dysfunctional telomeres on cell cycle
arrest, and it has been shown that p21 induction leads to a
depletion of stem/progenitor cells in intestinal epithelia and the
hematopoietic system in response to telomere dysfunction (9,
25). Knockout of p21 in late-generation mTERC⫺/⫺ mice was
able to prevent the decrease in proliferating stem cell maintenance in the small intestine, and it rescued normal villous
architecture (9). In this study, we found that the additional
knockout of p21 in G3 mTERC⫺/⫺ mice resulted in basal and
forskolin-stimulated duodenal HCO⫺
3 secretory rates that were
not significantly different from aged-matched wild-type controls, and it normalized mucosal architecture, as already shown
in Choudhury et al. (9). This indicates that the short telomeres
themselves are not the reason for the decrease in basal and
forskolin-stimulated duodenal HCO⫺
3 secretion but that the
predominant reason for the strong decline in basal and forskolin-stimulated duodenal HCO⫺
3 secretory rates is the decrease
in epithelial surface area.
On the other hand, no significant change in gastric acid
secretion was observed in the G3 mTERC⫺/⫺ mice. This is
consistent with the observation that gastric acid secretory
capacity does not decrease in non-H. pylori-infected individuals during aging (19, 52). Likewise, no significant differences
were observed in gastric mucosal morphology between 12- and
15-mo-old G3 mTERC⫺/⫺ and wild-type mice in our study.
This suggests that it is the reduction in proliferation and the
reduced duodenal surface area that interfere with HCO⫺
3 secretory rate, not another function of short telomeres.
What happens in the gastric mucosa of aging laboratory
animals and humans? Changes in gastric morphology with age
in normal laboratory mice have been studied, and it was found
in one study that parietal cell numbers decrease while mucus
cell number increase, but only at very old age (⬃3 yr) of the
mice (27). Human gastric biopsies of patients from different
age groups have also been studied; parietal cell numbers were
found to increase and mucous cell number to decrease in the aging
population (18), but no H. pylori status was reported in these
patients. More recent studies concluded that the H. pylori infection status determined whether atrophic changes occur in the
human gastric epithelium, and not the age of the individual (5).
The influence of age on telomere length in human stomach
and duodenum has also been assessed and compared with that
in other organs in previous studies (1, 32, 33, 46) The ratio of
telomeric to total DNA was assessed. The lowest ratio was
G1319
G1320
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
lyzed data; B.T., K.L.R., and U.S. interpreted results of experiments; B.T. and
U.S. prepared figures; B.T. and U.S. drafted manuscript; B.T., K.L.R., and U.S.
edited and revised manuscript; B.T., Z.J., B.R., R.E., M.P.M., K.L.R., and U.S.
approved final version of manuscript.
REFERENCES
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
1. Aida J, Izumiyama-Shimomura N, Nakamura K, Ishii A, Ishikawa N,
Honma N, Kurabayashi R, Kammori M, Poon SS, Arai T, Takubo K.
Telomere length variations in 6 mucosal cell types of gastric tissue
observed using a novel quantitative fluorescence in situ hybridization
method. Hum Pathol 38: 1192–200, 2007.
2. Allen A, Flemstrom G. Gastroduodenal mucus bicarbonate barrier: protection against acid and pepsin. Am J Physiol Cell Physiol 288: C1–C19,
2005.
3. Arents NLA, Thijs JC, van Zwet AA, Kleibeuker JH. Does the
declining prevalence of Helicobacter pylori unmask patients with idiopathic peptic ulcer disease? Trends over an 8 year period. Eur J Gastroenterol Hepatol 16: 779 –783, 2004.
4. Aro P, Storskrubb T, Ronkainen J, Bolling-Sternevald E, Engstrand
L, Vieth M, Stolte M, Talley NJ, Agréus L. Peptic ulcer disease in a
general adult population: the Kalixanda study: a random population-based
study. Am J Epidemiol 163: 1025–1034, 2006.
5. Asaka M, Kato M, Kudo M, Katagiri M, Nishikawa K, Koshiyama H,
Takeda H, Yoshida J, Graham DY. Atrophic changes of gastric mucosa
are caused by Helicobacter pylori infection rather than aging: studies in
asymptomatic Japanese adults. Helicobacter 1: 52–56, 1996.
6. Aubert G, Lansdorp PM. Telomeres and Aging. Physiol Rev 88: 557–
579, 2008.
7. Blasco MA, Lee HW, Hande MP, Samper E, Lansdorp PM, DePinho
RA, Greider CW. Telomere shortening and tumor formation by mouse
cells lacking telomerase RNA. Cell 91: 25–34, 1997.
8. Chen TS, Luo JC, Chang FY. Prevalence of Helicobacter pylori infection in duodenal ulcer and gastro-duodenal ulcer diseases in Taiwan. J
Gastroenterol Hepatol 25: 919 –922, 2010.
9. Choudhury AR, Ju Z, Djojosubroto MW, Schienke A, Lechel A,
Schaetzlein S, Jiang H, Stepczynska A, Wang C, Buer J, Lee HW, von
Zglinicki T, Ganser A, Schirmacher P, Nakauchi H, Rudolph KL.
Cdkn1a deletion improves stem cell function and lifespan of mice with
dysfunctional telomeres without accelerating cancer formation. Nat Genet
39: 99 –105, 2007.
10. Choung RS, Talley NJ. Epidemiology and clinical presentation of stressrelated peptic damage and chronic peptic ulcer. Curr Mol Med 8: 253–257,
2008.
11. Corazza GR, Ginaldi L, Quaglione G, Ponzielli F, Vecchio L, Biagi F,
Quaglino D. Proliferating cell nuclear antigen expression is increased in
small bowel epithelium in the elderly. Mech Ageing Dev 104: 1–9, 1998.
12. Craig WL, McKinlay A, Vickers MA. Cellular turnover of normal
gastrointestinal epithelium assessed by changes in telomeric: total DNA
signal ratios. Eur J Gastroenterol Hepatol 15: 1195–1201, 2003.
13. Cryer B, Redfern JS, Goldschmiedt M, Lee E, Feldman M. Effect of
aging on gastric and duodenal mucosal prostaglandin concentrations in
humans. Gastroenterology 102: 1118 –1123, 1992.
14. Dahse R, Fiedler W, Ernst G. Telomeres and telomerase: biological and
clinical importance. Clin Chem 43: 708 –714, 1997.
15. Del Valle Chey WD J, Scheiman JM. Acid peptic disorders. In: Textbook
of Gastroenterology, (4th ed.). New York, NY: Williams & Wilkins,
chapt. 66, p. 1381–1377.
16. Dorwart MR, Shcheynikov N, Yang D, Muallem S. The solute carrier
26 family of proteins in epithelial ion transport. Physiology 23: 104 –114,
2008.
17. Durant ST. Telomerase-independent paths to immortality in predictable
cancer subtypes. J Cancer 3: 67–82, 2012.
18. Farinati F, Formentini S, Della Libera G, Valiante F, Fanton MC, Di
Mario F, Vianello F, Pilotto A, Naccarato R. Changes in parietal and
mucous cell mass in the gastric mucosa of normal subjects with age: a
morphometric study. Gerontology 39: 146 –151, 1993.
19. Feldman M, Cryer B, McArthur KE, Huet BA, Lee E. Effects of aging
and gastritis on gastric acid and pepsin secretion in humans: a prospective
study. Gastroenterology 110: 1043–152, 1996.
20. Garrow D, Delegge MH. Risk factors for gastrointestinal ulcer disease in
the US population. Dig Dis Sci 55: 66 –72, 2010.
21. Gilley D, Herbert BS, Huda N, Tanaka H, Reed T. Factors impacting
human telomere homeostasis and age-related disease. Mech Ageing Dev
129: 27–34, 2008.
22. Guo N, Parry EM, Li LS, Kembou F, Lauder N, Hussain MA,
Berggren PO, Armanios M. Short telomeres compromise ?-cell signaling
and survival. PLoS One 6: e17858, 2011.
23. Hillesheim J, Riederer B, Tuo B, Chen M, Manns M, Biber J, Yun C,
Kocher O, Seidler U. Down regulation of small intestinal ion transport in
PDZK1- (CAP70/NHERF3) deficient mice. Pflugers Arch 454: 575–586,
2007.
24. Hiyama E, Tatsumoto N, Kodama T, Hiyama K, Shay J, Yokoyama T.
Telomerase activity in human intestine. Int J Oncol 9: 453–458, 1996.
25. Ju Z, Choudhury AR, Rudolph KL. A dual role of p21 in stem cell
aging. Ann NY Acad Sci 1100: 333–344, 2007.
26. Jyotheeswaran S, Shah AN, Jin HO, Potter GD, Ona FV, Chey WY.
Prevalence of Helicobacter pylori in peptic ulcer patients in greater
Rochester, NY: is empirical triple therapy justified? Am J Gastroenterol
93: 574 –578, 1998.
27. Khanna PB, Davies I, Faragher EB. Age-related changes in the stomach
of the laboratory mouse: a quantitative morphological study. Age Ageing
17: 257–264, 1988.
28. Kim SK, Parekh D, Townsend CM Jr, Thompson JC. Effects of aging
on duodenal bicarbonate secretion. Ann Surg 212: 332–337, 1990.
29. Kitada T, Seki S, Kawakita N, Kuroki T, Monna T. Telomere shortening in chronic liver diseases. Biochem Biophys Res Commun 211:
33–39, 1995.
30. Kuhlow D, Florian S, von Figura G, Weimer S, Schulz N, Petzke KJ,
Zarse K, Pfeiffer AF, Rudolph KL, Ristow M. Telomerase deficiency
impairs glucose metabolism and insulin secretion. Aging (Albany NY) 2:
650 –658, 2010.
31. Lou Z, Wei J, Riethman H, Baur JA, Voglauer R, Shay JW, Wright
WE. Telomere length regulates ISG15 expression in human cells. Aging
(Albany NY) 1: 608 –621, 2009.
32. Majumdar APN, Jaszewski R, Dubick MA. Effect of aging on the
gastrointestinal tract and the pancreas. Proc Soc Exp Biol Med 215:
134 –144, 1997.
33. Maruyama Y, Hanai H, Fujita M, Kaneko E. Telomere length and
telomerase activity in carcinogenesis of the stomach. Jpn J Clin Oncol 27:
216 –20, 1997.
34. McColl KE. Helicobacter pylori-negative non-steroidal anti-inflammatory
drug-negative ulcer. Gastroenterol Clin North Am 38: 353–361, 2009.
35. McDaniel N, Pace AJ, Spiegel S, Engelhardt R, Koller BH, Seidler U,
Lytle C. Role of Na-K-2Cl cotransporter-1 in gastric secretion of nonacidic fluid and pepsinogen. Am J Physiol Gastrointest Liver Physiol 289:
G550 –G560, 2005.
36. Moll R, Franke WW, Schiller DL, Geiger B, Krepler R. The catalog of
human cytokeratins: patterns of expression in normal epithelia, tumors and
cultured cells. Cell 31: 11–24, 1982.
37. Rudolph KL, Chang S, Lee HW, Blasco M, Gottlieb GJ, Greider C,
DePinho RA. Longevity, stress response, and cancer in aging telomerasedeficient mice. Cell 96: 701–712, 1999.
38. Sahin E, Colla S, Liesa M, Moslehi J, Muller FL, Guo M, Cooper M,
Kotton D, Fabian AJ, Walkey C, Maser RS, Tonon G, Foerster F,
Xiong R, Wang YA, Shukla SA, Jaskelioff M, Martin ES, Heffernan
TP, Protopopov A, Ivanova E, Mahoney JE, Kost-Alimova M, Perry
SR, Bronson R, Liao R, Mulligan R, Shirihai OS, Chin L, DePinho
RA. Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 470: 359 –365, 2009.
39. Seidler U, Sjöblom M. Gastroduodenal bicarbonate secretion. In: Physiology of the Gastrointestinal TractJohnson L. New York, NY: Elsevier,
2012, chapt. 48, p. 1311–1341.
40. Simon NM, Smoller JW, McNamara KL, Maser RS, Zalta AK,
Pollack MH, Nierenberg AA, Fava M, Wong KK. Telomere shortening
and mood disorders: preliminary support for a chronic stress model of
accelerated aging. Biol Psychiatry 60: 432–435, 2006.
41. Simpson JE, Gawenis LR, Walker NM, Boyle KT, Clarke LL. Chloride conductance of CFTR facilitates basal Cl⫺/HCO⫺
3 exchange in the
villous epithelium of intact murine duodenum. Am J Physiol Gastrointest
Liver Physiol 288: G1241–G1251, 2005.
42. Singh AK, Riederer B, Chen M, Xiao F, Krabbenhöft A, Engelhardt
R, Nylander O, Soleimani M, Seidler U. The switch of intestinal Slc26
exchangers from anion absorptive to HCO⫺
3 secretory mode is dependent
on CFTR anion channel function. Am J Physiol Cell Physiol 298: C1057–
C1065, 2010.
43. Singh AK, Riederer B, Krabbenhoft A, Rausch B, Bonhagen J,
Lehmann U, de Jonge HR, Donowitz M, Yun C, Weinman EJ, Kocher
O, Hogema BM, Seidler U. Differential roles of NHERF1, NHERF2, and
TELOMERE SHORTENING AND GASTRODUODENAL SECRETION
44.
45.
46.
47.
48.
PDZK1 in regulating CFTR-mediated intestinal anion secretion in mice. J
Clin Invest 119: 540 –550, 2009.
Sonnenberg A. Time trends of ulcer mortality in Europe. Gastroenterology 132: 2320 –2327, 2007.
Sonnenberg A. Time trends of ulcer mortality in non-European countries.
Am J Gastroenterol 102: 1101–1107, 2007.
Takubo K, Aida J, Izumiyama-Shimomura N, Ishikawa N, Sawabe M,
Kurabayashi R, Shiraishi H, Arai T, Nakamura K. Changes of telomere length with aging. Geriatr Gerontol Int 10, Suppl 1: S197–S206,
2010.
Tuo B, Wen G, Wei J, Liu X, Wang X, Zhang Y, Wu H, Dong X, Chow
JY, Vallon V, Dong H. Estrogen regulation of duodenal bicarbonate
secretion and sex-specific protection of human duodenum. Gastroenterology 141: 854 –863, 2011.
Urquidi V, Tarin D, Goodison S. Role of telomerase in cell senescence
and oncogenesis. Annu Rev Med 51: 65–79, 2000.
G1321
49. Wiemann SU, Satyanarayyana A, Tsahuridu M, Tillmann HL,
Zender L, Klempnauer J, Flemming P, Franco S, Blasco MA,
Manns MP, Rudolph KL. Hepatocyte telomere shortening and senescence are general markers of human liver cirrhosis. FASEB J 16:
935–942, 2002.
50. Wong GL, Wong VW, Chan Y, Ching JY, Au K, Hui AJ, Lai LH,
Chow DK, Siu DK, Lui YN, Wu JC, To KF, Hung LC, Chan HL, Sung
JJ, Chan FK. High incidence of mortality and recurrent bleeding in
patients with Helicobacter pylori-negative idiopathic bleeding ulcers.
Gastroenterology 137: 525–531, 2009.
51. Wu HC, Tuo BG, Wu WM, Gao Y, Xu QQ, Zhao K. Prevalence of
peptic ulcer in dyspeptic patients and the influence of age, sex and H.
pylori infection. Dig Dis Sci 53: 2650 –2656, 2008.
52. Yakabi K, Sakurada T, Takabayashi H, Kani K, Kawashima J.
Change in function of gastric acid secretion by aging. Nihon Rinsho 68:
2001–2005, 2010.
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.6 on June 16, 2017
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00035.2012 • www.ajpgi.org