University of Veterinary Medicine Hannover
Department of Physiological Chemistry
Molecular basis of the heterogeneity in congenital sucraseisomaltase deficiency
THESIS
Submitted in partial fulfilment of the requirements for the degree of
Doctor of Natural Sciences
Doctor rerum naturalium
(Dr. rer. nat.)
awarded by the University of Veterinary Medicine Hannover
by
Birthe Gericke
Hannover
Hannover, Germany 2016
Supervisor:
Prof. Dr. Hassan Y. Naim
Supervision Group:
Prof. Dr. Hassan Y. Naim
Prof. Dr. Pablo Steinberg
PD Dr. med. Klaus-Peter Zimmer
1st Evaluation:
Prof. Dr. Hassan Y. Naim
Department of Physiological Chemistry,
University of Veterinary Medicine Hannover,
Germany
Prof. Dr. Pablo Steinberg
Institute for Food Toxicology and
Analytical Chemistry,
University of Veterinary Medicine Hannover,
Germany
Prof. Dr. med. Klaus-Peter Zimmer
Department of General Pediatrics and Neonatology,
University Hospital Giessen,
Germany
2nd Evaluation:
Prof. Dr. Dr. Reinhold Erben
Unit of Physiology, Pathophysiology and Experimental
Endocrinology
University of Veterinary Medicine Vienna,
Austria
Date of final exam:
05.10.2016
II
Table of contents
Table of contents..................................................................................................................... III
List of abbreviations................................................................................................................ V
List of figures ....................................................................................................................... VIII
List of tables ............................................................................................................................. X
Abstract ................................................................................................................................... XI
Zusammenfassung ............................................................................................................... XIII
1. General Introduction ........................................................................................................... 1
1.1 Mammalian intestinal tract ............................................................................................... 2
1.1.1 Intestinal physiology and function ............................................................................ 2
1.1.2 Digestion of dietary carbohydrates ........................................................................... 3
1.1.3 Physiological and molecular basis of terminal carbohydrate digestion .................... 6
1.1.4 Protein biosynthesis of cell surface proteins ............................................................. 7
1.1.5 Protein glycosylation, folding and degradation......................................................... 8
1.1.6 Protein sorting and lipid microdomains .................................................................... 9
1.2 Sucrase-isomaltase ......................................................................................................... 11
1.2.1 Classification, structure and expression .................................................................. 11
1.2.2 Enzymatic activities and catalytic mechanism ........................................................ 12
1.2.3 Biosynthesis ............................................................................................................ 14
1.3 Carbohydrate malabsorption .......................................................................................... 16
1.3.1 Malfunction of disaccharidases ............................................................................... 16
1.4 Congenital sucrase-isomaltase deficiency ...................................................................... 17
1.4.1 Molecular basis and prevalence .............................................................................. 17
1.4.2 Etiology of disease and symptoms .......................................................................... 19
1.4.3 Diagnosis and therapy ............................................................................................. 20
1.5 Aim of the study ............................................................................................................. 21
2. Molecular basis of genetic sucrase-isomaltase malfunction ........................................... 31
3. Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues .......... 58
III
4. General Discussion ............................................................................................................. 76
4.1 Congenital sucrase-isomaltase deficiency and challenges in diagnosis and therapy ..... 77
4.2 Biochemical analysis and phenotypic classification of novel SI variants in a mammalian
cell model ............................................................................................................................. 80
4.3 Modification of protein localization in human disease as therapeutic option for CSID 85
4.4 CSID is a multifactorial disease ..................................................................................... 87
4.5 Modulation of sucrase-isoaltase enzymatic activities by aspartic acid residues ............ 88
5. Conclusion ......................................................................................................................... 106
6. Appendix ........................................................................................................................... 109
6.1 Supplementary figure ................................................................................................... 110
6.2 Affidavit ....................................................................................................................... 111
6.3 Acknowledgement ........................................................................................................ 112
IV
List of abbreviations
AAT
Alpha-1 antitrypsin
AMPs
Antimicrobial peptides
BBM
Brush border membrane
BiP
Binding immunoglobulin protein
CAZY
Carbohydrate-active enzyme classification system
CDD
Congenital diarrheal disorders
CFTR
Cystic fibrosis transmembrane conductance regulator
CSID
Congenital sucrase-isomaltase deficiency
CYT
Cytoplasmic tail
DNA
Desoxyribonucleic acid
DRMs
Detergent resistant membranes
Endo H
Endo-β-Nacetylglucosaminidase H
ER
Endoplasmic reticulum
ERAD
Endoplasmatic reticulum associated degradation
GH
Glycoside hydrolase
GLUT-5
Glucose transporter 5
GPI
Glycosyl-phosphoinositol
IBD
Irritable bowel disease
IM
Isomaltase
LPH
Lactase-phlorizin hydrolase
V
MGAM
Maltase glucoamylase
NB-DNJ
N-butyl deoxynojirimycin
PCR
Polymerase chain reaction
PNGase F
Peptide-N-Glycosidase F
qHTS
Quantitative high-throughput screening
SCFA
Short chain fatty acids
SGLT-1
Sodium dependent glucose transporter 1
SI
Sucrase-isomaltase
SIc
Complex glycosylated sucrase-isomaltase
SIh
High-mannosylated sucrase-isomaltase
SR
Signal recognition particle receptor
SRP
Signal recognition particle
SUC
Sucrase
TGN
Trans-Golgi network
TM
Transmembrane domain
WT
Wild type
X
Chain termination codon
VI
Amino acid:
Three letter code:
One letter code:
Alanine
Ala
A
Argnine
Arg
R
Asparagine
Asn
N
Aspartic Acid
Asp
D
Cysteine
Cys
C
Glutamic acid
Glu
E
Glutamine
Gln
Q
Glycine
Gly
G
Histidine
His
H
Isoleucine
Ile
I
Leucine
Leu
L
Lysine
Lys
K
Methionine
Met
M
Phenylalanine
Phe
F
Proline
Pro
P
Serine
Ser
S
Threonine
Thr
T
Tryptophan
Trp
W
Tyrosine
Tyr
Y
Valine
Val
V
VII
List of figures
Figure 1.1
Morphological structure of the small intestinal surface
3
(Yu et al. 2012, adapted and modified)
Figure 1.2
Structure and glycosidic linkage of dietary starch and common dietary
4
disaccharides
Figure 1.3
Structure of sucrase-isomaltase and orientation in the plasma
12
membrane (Graphic by Jacob and Naim, modified)
Figure 1.4
Retaining mechanism of family 31 α-glycoside hydrolases
13
(Withers and Williams 2014, adapted)
Figure 1.5
Biosynthesis of sucrase-isomaltase in an enterocyte
15
Figure 1.6
Clinical consequences of malabsorbed carbohydrates in the intestine
19
(Ebert and Witt 2016, adapted and modified)
Figure 2.1
The studied mutations target mainly highly conserved amino acid
52
residues in consensus motifs of SI
Figure 2.2
Maturation rate of the SI protein variants compared to the wild type SI
53
Figure 2.3
Intracellular localization of the SI variants
54
Figure 2.4
Examination of the protein folding of the SI variants by trypsin
55
treatment
Figure 2.5
Association of SI variants with cholesterol-enriched membrane
56
microdomains or lipid rafts
VIII
Figure 2.6
Specific activities of the SI variants versus wild type SI
57
Figure 2.7
Classification of SI variants into three major biosynthetic phenotypes
57
Figure 3.1
Localization of analyzed aspartic acid residues within SI and overview
72
of generated mutants
Figure 3.2
Trafficking of the SI catalytic site mutants compared to that of
73
wild type SI
Figure 3.3
Tryptic structural analysis to determine the folding of SI catalytic site
74
variants
Figure 3.4
Sucrase, maltase and palatinase activities of SI mutants compared to
75
the wild type
Figure 3.5
Glucose can inhibit the enzyme activity of the SI protein
75
Figure 4.1
Classification model of the 15 novel SI variants into three in vitro
81
biosynthetic phenotypes, according to intracellular trafficking
Figure 4.2
Overview of intracellular localization, maturation and enzyme
85
activities of the 15 novel human SI variants and their localization
within the SI protein
Figure S 6.1
Amino acid sequence and internal homology of human SI
110
IX
List of tables
Table 1.1
Carbohydrate composition of the human diet and percentages of
5
energy supply by the different components
Table 1.2
Enzymatic activities of the disaccharidases, known substrates and
6
cleavage products
Table 1.3
Examples of primary disaccharidase deficiencies and intestinal
17
disorders causing secondary disaccharidase deficiencies
Table 2.1
Sequence of the forward oligonucleotides used for mutagenesis PCR of
49
SI wild type
Table 2.1
Comparison of the activities of purified SI mutants versus their
50
counterparts in the patients’ intestinal biopsy specimens
Table 2.3
Overview of the biochemical and functional features of the single SI
51
variants compared to the wild type
Table 3.1
Oligonucleotide primers used in site-directed mutagenesis for
71
generation of aspartic acid SI variants
X
Abstract
Birthe Gericke - Molecular basis of the heterogeneity in congenital sucrase-isomaltase
deficiency
Carbohydrates are essential components of the human diet and are broken down into
their building monosaccharides during transit through the gastrointestinal tract. The
monosaccharides, mainly glucose, can then be utilized as energy sources for the human body.
Sucrase-isomaltase (SI) is an enzyme complex anchored in the small intestinal brush border
membrane that essentially contributes to the final step of carbohydrate digestion and the
release of glucose. SI is a highly glycosylated type II integral membrane protein that consists
of two functional subunits, isomaltase and sucrase. The SI protein is synthesized in the rough
endoplasmic reticulum and is transported along the secretory pathway to the cell surface.
Defects of SI cause carbohydrate malabsorption that oftentimes goes along with a clinical
onset of osmotic-fermentative diarrhea, abdominal pain and cramps in patients. Congenital
sucrase-isomaltase deficiency (CSID) is a form of carbohydrate malabsorption elicited by
genetic alterations in the SI gene. The disease is described as rare autosomal recessively
inherited disorder that is characterized by reduced or absent activities of SI. The molecular
processes underlying dietary carbohydrate digestion in human health and disease with focus
on SI are not fully understood and will be studied in this thesis.
The first part of this thesis investigates the molecular pathogenesis of 15 SI mutations,
found in CSID patients with reduced or absent α-glyosidic activities of SI, in a cellular in
vitro model system. The 15 single nucleotide polymorphisms target the coding region of the
SI gene and result in protein variants with single amino acid exchanges and in two cases in the
introduction of a chain termination codon. The effect of the genetic alteration on the SI
protein function, involving different cellular processes like protein trafficking and folding into
an active conformation, was reflected by the definition of three biosynthetic phenotypes in our
study. With a complete loss of in vitro SI protein function by intracellular blockage and
enzymatic inactivation, that is matching to absent activities in patients’ biopsies, mutations
grouped in biosynthetic phenotype III had the highest molecular pathogenic potential.
Mutations grouped in biosynthetic phenotypes I and II lead to mild to intermediate effects on
the SI function by reduced activities and a normal to delayed trafficking to the cell surface.
XI
Some mutations from phenotype II and III were enzymatically active but not properly
trafficked, rendering them as potential candidates to test chemical or pharmacological
chaperone therapy for CSID in future, alternatively or additionally to enzyme replacement
therapy or nutritional restrictions to restore the SI activities at the cell surface.
The second part of the thesis elucidates the SI catalytic site properties under
physiological conditions in a cellular system. Here, the focus was on two aspartic acid
residues (D) at amino acid positions 604 (D604) and 1500 (D1500) within the isomaltase and
sucrase catalytic sites, with predicted proton donor functions. The experimental mutational
replacement of aspartic acid in the conserved catalytic site motifs of SI led to a complete loss
of activities of the targeted SI subunit, while the activities of the respective other subunit was
not influenced. These data indicate that D604 and D1500 in the two catalytic sites of SI have
an essential role in substrate catalysis by SI and prove the proton donor function of these
residues. The generated single active site variants of SI provided a good model to study
enzymatic capacities of both SI subunits separately. The proportion of maltose digestion
carried out by each subunit was not known so far. The sucrase subunit showed a higher
maltose digestive capacity compared to the isomaltase subunit. Increased combined activities
of both single-active site variants lead to the investigation of product inhibition of SI. In fact,
analysis of SI activities in human brush border membrane preparations revealed a reduction of
both sucrase and isomaltase activities under addition of glucose, suggesting product inhibition
as new mechanism for SI. This so far undescribed mechanism of SI may function to regulate
the glucose release from carbohydrate digestion in the intestine and balance the blood glucose
level.
Taken together, this thesis provides insights into the catalytic properties and
mechanisms of human SI during carbohydrate digestion and into the molecular basis of an
impaired human SI function during the pathogenesis of CSID and may help to find new
targets for therapy.
XII
Zusammenfassung
Birthe Gericke - Die molekulare Basis der Heterogenität bei kongenitaler SaccharaseIsomaltase-Defizienz
Kohlenhydrate sind wesentliche Bestandteile der menschlichen Ernährung und werden
während der Passage durch den Gastrointestinaltrakt in ihre Bestandteile, die Monosaccharide
zerlegt. Die freigesetzten Monosaccharide, überwiegend Glukose, können als Energiequelle
für den menschlichen Körper genutzt werden. Saccharase-Isomaltase (SI) ist ein
Enzymkopmlex, der in der Bürstensaummembran des menschlichen Dünndarms verankert ist
und maßgeblich zum letzten Schritt des Kohlenhydratverdaus und der Freisetzung von
Glukose beiträgt. SI ist ein Typ II Transmembranprotein, das aus zwei funktionellen
Untereinheiten, der Isomaltase und der Saccharase, besteht und entlang des sekretorischen
Transportweges gebildet und transportiert wird. Defekte der Saccharase-Isomaltase führen zu
Kohlenhydratmalabsorption, welche oftmals mit dem klinischen Erscheinungsbild einer
osmotischen Diarrhoe sowie Bauchschmerzen und Krämpfen bei Patienten einhergeht. Eine
Form von Kohlenhydratmalabsorption ist die kongenitale Saccharase-Isomaltase-Defizienz
(CSID), die durch Veränderungen im SI-Gen ausgelöst wird. CSID ist als seltene und
autosomal-rezessiv vererbte Krankheit beschrieben, die durch eine verminderte oder nicht
vorhandene
Aktivität
Nahrungskohlenhydraten
des
SI-Proteins
unterliegenden
charakterisiert
ist.
physiologischen
Die
und
dem
Verdau
von
pathophysiologischen
molekularen Prozesse im Menschen sind nicht komplett erforscht und wurden in dieser These
mit dem Fokus auf SI genauer untersucht.
Der erste Teil der vorliegenden These beschäftigt sich mit der Untersuchung, der
molekularen Pathogenese von 15 SI-Genmutationen, die in CSID Patienten mit reduzierter
oder defizienter SI Aktivität gefunden wurden. Diese Untersuchung wurde in einem in vitro
Zellmodell durchgeführt. Alle 15 Punktmutationen wurden in der kodierenden Region des SIGens gefunden und führten zu der Translation von SI-Proteinvarianten mit einzelnen
Aminosäureaustauschen und in zwei Fällen zu der Einführung eines Terminationscodons. Der
Effekt der jeweiligen Genmutationen auf die Funktion des resultierenden SI-Proteins, spiegelt
sich in drei hier definierten biosynthetischen Phänotypen wieder. Eine physiologische
Funktion des SI-Proteins erfordert verschiedene zelluläre Prozesse, einschließlich des
XIII
intrazellulären Proteintransports und der Faltung in eine aktive Proteinstruktur. Mutationen,
die durch intrazelluläre Blockade und Inaktivierung des SI-Proteins zu einem kompletten in
vitro Funktionsverlust der SI führen, wurden in den biosynthetischen Phänotyp III gruppiert
und wiesen die höchste molekulare Pathogenität auf. Übereinstimmend mit den molekularen
Daten ist in den Dünndarm-Biopsieproben der CSID Patienten mit Mutationen des Phänotyps
III keine SI Aktivität messbar gewesen. Mutationen, die zu dem biosynthetischen Phänotyp I
oder II führen, gehen mit einer reduzierten enzymatischen Aktivität und einem normalen bis
verzögerten Transport der SI-Proteinvarianten einher und haben jeweils milde oder
mittelschwere Einflüsse auf die in vitro SI Funktion. Einige SI-Proteinvarianten des
Phänotyps II oder III sind enzymatisch aktiv, werden aber nicht oder nur vermindert zur
Zelloberfläche transportiert, was diese Proteinvarianten zu potentiellen Kandidaten zum Test
einer pharmakologischen oder chemischen Chaperon-Therapie für CSID in der Zukunft
macht. Eine mögliche Chaperon-Therapie für CSID könnte eine Alternative oder ein Zusatz
zur Enzymersatztherapie oder der strikten Reduktion von Saccharose und Stärke in der
Ernährung von CSID Patienten sein, um die Aktivität von SI im Darmlumen wieder
herzustellen oder zu erhöhen.
Der zweite Teil der These befasst sich mit der Analyse der katalytischen Spezifitäten
von SI in einem Zellsystem. Der Fokus war dabei auf zwei Asparaginsäureresten (D) an
Aminosäurepositionen 604 (D604) und 1500 (D1500) innerhalb der aktiven Zentren von SI
mit potentieller Funktion als Protonendonor. Der separate experimentelle Austausch dieser
Aminosäuren in den aktiven Zentren führte zu einem kompletten Verlust der Enzymaktivität
der durch die Mutation betroffenen SI Untereinheit, während die Aktivität der jeweils anderen
Untereinheit nicht verändert war. Diese Ergebnisse zeigen, dass D604 und D1500 in den
beiden aktiven Zentren von SI eine essentielle Rolle in der Substartkatalyse spielen und
bestätigen ihre Funktion als Protonendonor. Die resultierenden Proteinvarianten mit nur einer
aktiven Untereinheit bieten ein gutes Modell, um die enzymatischen Kapazitäten jeder SI
Untereinheit einzeln zu studieren. Diese Analysen führten zu der Entdeckung einer möglichen
Produktinhibition von SI durch Glukose. Dieser Mechanismus könnte daran beteiligt sein, die
Glukosefreisetzung durch den Kohlenhydratverdau im Dünndarm zu kontrollieren und den
Glukoselevel im Blut zu regulieren.
Zusammengefasst bietet die vorliegende These Einblicke in die katalytischen
XIV
Eigenschaften und Mechanismen der humanen SI im Kohlenhydratverdau und in die
molekulare Grundlage der Fehlfunktion von SI in CSID und zeigt neue mögliche
Ansatzpunkte für eine entsprechende Therapie auf.
XV
Chapter 1
General Introduction
Chapter 1: Introduction
1.1 Mammalian intestinal tract
1.1.1 Intestinal physiology and function
The mammalian gastrointestinal tract is essentially a cylindrical tube, extending from
the oral cavity, through the esophagus, the stomach, the small and the large intestine (colon)
to the rectum and the anus. Its primary function is to digest and absorb ingested nutrients, yet,
intestinal functions also include secretion of enzymes, immune responses and barrier
protection. These diverse capabilities are reflected in the unique physiology of the
mammalian gastrointestinal tract. The intestinal surface, that spans about 200 m2 to 300 m2 in
adults, represents the largest surface area of the human body in contact with the exterior
milieu and such, has various implications in human health and disease (Caspary, 1992;
Gebbers and Laissue, 1989). The intestinal tract is divided into the small intestine, where 95%
of dietary nutrient absorption takes place and the colon, where mainly water reabsorption
occurs (Vereecke et al., 2011). The small intestine is additionally partitioned into the
duodenum, jejunum and the ileum. The distal part of the intestinal tract, basically the ileum
and colon, is colonized by symbiotic commensal bacteria, referred to as the gut microbiota
(Sartor, 2008). The microbiota is involved in the metabolism of various nutrients by
fermentation and also plays a role in the prevention of intestinal colonization by pathogenic
microorganisms (Jandhyala et al., 2015).
The intestinal surface in mammals is lined by an epithelium, which is formed by a
single layer of closely packed and specialized cells. In contrast its flat colonic counterpart, the
intestinal epithelium is enlarged by villi, which are protrusions reaching into the intestinal
lumen and thereby increase the absorptive surface (van der Flier and Clevers, 2009) (Figure
1.1). The invaginations between the villi are called crypts of Lieberkühn. The intestinal
epithelium acts as a selective permeable barrier separating the luminal contents from the body
interior. This physical barrier at the same time prevents pathogens or antigens from entering
the cells and invading to the underlying tissue and allows a selective transport of dietary
nutrients, water and electrolytes (Groschwitz and Hogan, 2009). For the maintenance of the
epithelial barrier, the mammalian intestinal epithelium is constantly renewed every 4-5 days
(Vereecke et al., 2011). This process includes cell proliferation, apoptosis and cell shedding
from the villus tips into the intestinal lumen (Hall et al., 1994). Differentiation, migration and
polarization of the cells occur along the crypt-villus axis (Crosnier et al., 2006) (Figure 1.1).
2
Chapter 1: Introduction
Besides digestion and absorption, the intestinal epithelial cells are also involved in
secretion of hormones, mucins and antimicrobial peptides (AMPs), as well as in the immune
response (Peterson and Artis, 2014). These functions are reflected by the organization of the
intestinal epithelium, which consists of four main cell types (Figure 1.1). The cells
responsible for secretion are paneth cells, goblet cells and endocrine cells (van der Flier and
Clevers, 2009). The most common cell type, with functions in nutrient digestion and
absorption are the absorptive enterocytes (Salim and Soderholm, 2011; Sanz and De Palma,
2009). Differentiated endocrine cells, goblet cells and absorptive enterocytes are located at the
villus tips, whereas differentiated paneth cells reside in the crypts (van der Flier and Clevers,
2009). The underlying tissue of the intestinal epithelium, called lamina propria, is rich in a
lymphatic and vascular network, which finally absorbs and transports the digestive products
(Kohan et al., 2011).
Figure 1.1 Morphological structure of the small intestinal surface. The small intestinal
surface is lined by an epithelium and is enlarged by villar and microvillar structures. Yu et al. 2012,
adapted and modified.
1.1.2 Digestion of dietary carbohydrates
An essential function of the mammalian gastrointestinal tract is the conversion of dietary
nutrients to energy by digestion and absorption. Digestion describes the breakdown of
3
Chapter 1: Introduction
nutrients into absorbable units that are subsequently able to cross the intestinal epithelial cells
to the circulatory system (absorption).
Carbohydrates are the main caloric sources for the human body, and along with
proteins and fat, they are the major components of the human diet (Caspary, 1992).
Carbohydrates are built from several sugar monomers connected via glycosidic linkages. With
the exception of the β-glycosidically linked lactose, which is mainly important for the
nutrition of newborns, the building blocks of all other dietary carbohydrates with nutritional
importance, such as starch and sucrose, are linked via α-glycosidic bonds (Figure 1.2).
Depending on the number of their sugar units, carbohydrates are referred to as mono- and
disaccharides (simple carbohydrates) or oligo- and polysaccharides (complex carbohydrates).
Figure 1.2 Structure and glycosidic linkage of dietary starch and common dietary
disaccharides. Carbohydrates consist of sugar monomers that are connected via glycosidic linkages.
The linkages are formed between the α- or β-anomeric form of the C-1 carbon in one sugar monomer
and the hydroxyl oxygen atom of a carbon from another sugar monomer. Glucose monomers are
depicted in blue, fructose in green and galactose in red. Maltose and isomaltose are products from
starch digestion. Lactose is the main carbohydrate of mammalian milk.
Notably, the majority of dietary carbohydrates are present as starch, which is composed of a
mixture of linear glucose polymers connected via α-1,4-glycosidic linkages called amylose
and amylopectin. Amylopectin has a branched configuration due to a high amount of α-1,6linkages. Indeed only a small portion of dietary carbohydrates are present as disaccharides
4
Chapter 1: Introduction
and a negligible amount as monosaccharides (Table 1.1). The total energy supply by the
different dietary carbohydrate components for the human body is also listed in Table 1.1.
Since complex carbohydrates are excluded from intestinal absorption, the polymers as well as
oligo- and disaccharides need to be cleaved to monosaccharides during the transit through the
gastrointestinal tract for use by the body.
Table 1.1 Carbohydrate composition of the human diet and percentages of energy
supply by the different components. Values for dietary carbohydrate composition are from
Caspary 1992. The values for the total energy supply are adapted from Walkers pediatric
gastrointestinal disease.
Carbohydrate
Polysaccharides
Starch
Disaccharides
Sucrose
Lactose
Maltose
Monosaccharides
Glucose
Fructose
Composition [%]
Total energy supply [%]
52.6
50-60
33.2
6.6
1.8
30-40
0-20 adults; 40-50 infants
4.2
1.6
Digestion and absorption of carbohydrates mainly occur in the proximal small
intestine. In healthy individuals, about 60% of carbohydrates have been shown to be absorbed
in the proximal duodenum (Keller and Layer, 2014). Carbohydrate digestion and absorption
rely on hydrolysis by secreted amylases and hydrolases that are anchored in the intestinal
epithelium, as well as specific membrane transporters, facilitating the absorption of the
released luminal monosaccharides across the intestinal epithelium. Such monosaccharide
transporters are the sodium-dependent glucose transporter SGLT-1 or the glucose transporter
GLUT-5 (Drozdowski and Thomson, 2006).
Basically the cleavage of carbohydrates takes place in two main steps (i) the
enzymatic breakdown of starch to oligosaccharides by secreted α-amylases and (ii) the more
important release of monosaccharides by membrane bound enzymes in the small intestine.
The digestion starts directly after ingestion of carbohydrates in the mouth by salivary αamylase and is continued by pancreatic α-amylase. Since α-amylases are endo-glycosidases
and exclusively cleave internal α-1,4-glycosidic bonds of starch, ingested sucrose and lactose
5
Chapter 1: Introduction
are excluded from this first digestive step. Thus, digestion of starch by α-amylases produces
oligosaccharides, maltose and maltotriose. High amounts of monosaccharides are at first
released in the final step of carbohydrate digestion, carried out by four enzyme complexes
also referred to as disaccharidases. These exo-glucosidases are anchored in the epithelium of
the small intestine. The two disaccharidases sucrase-isomaltase (SI) and maltaseglucoamylase (MGAM) display α-glycosidic activities and are the main enzymes for the
cleavage of products from α-amylase digestion and sucrose (Table 1.2).
Table 1.2 Enzymatic activities of the disaccharidases, known substrates and cleavage
products.
Disaccharidase
Activity
Substrate
Product
Sucrase-isomaltase (SI)
α-1,2
α-1,4
α-1,6
sucrose
maltose, maltooligosaccharides
isomaltose
glucose
fructose
Maltase-glucoamylase (MGAM)
α-1,4
maltose, maltooligosaccharides
glucose
Lactase-phlorizin hydrolase (LPH)
β-1,4
lactose
Threalase
α-1,1
threalose
glucose
galactose
glucose
The third α-glucosically active disaccharidase with a rudimentary function in digestion is
threalase (Caspary, 1992). The β-glycosidic linkages of lactose are cleaved by lactasephlorizin hydrolase (LPH) (Colombo et al., 1973; Skovbjerg et al., 1981) (Table 1.2). Defects
of one or more disaccharidases can cause carbohydrate malabsorption in humans, which can
lead to gastrointestinal symptoms, such as chronic diarrhea or abdominal pain (Cohen, 2016;
Diekmann et al., 2015; Overeem et al., 2016; Sander et al., 2006).
1.1.3 Physiological and molecular basis of terminal carbohydrate digestion
The intestinal epithelium, mainly consisting of absorptive enterocytes, constitutes the
major site for absorption and digestion. The epithelial cell layer is lined with villar protrusions
of the intestinal surface that help in enlarging the absorptive area. Similar to all other
6
Chapter 1: Introduction
epithelial cells, the intestinal enterocytes comprise two distinct membrane domains allowing
the cell to perform specialized functions (Caplan, 1997). Both membrane domains, basolateral
and apical, are separated by tight junctions and have a different lipid and protein composition
(Farquhar and Palade, 1963; Tsukita et al., 2001) (Figure 1.1). The microvillar apical
membrane domain of the intestinal epithelial cell layer is also called brush border membrane
(BBM) and is highly enriched in the previously mentioned disaccharidases and monomeric
sugar transporter proteins. The generation and maintenance of this polarized organization
requires different cellular processes that guarantee the correct sorting of proteins to their
functional sites. Before delivery of cell surface proteins from their site of synthesis to their
destination, a series of cellular processes and modifications need to be undergone in the
endoplasmic reticulum (ER) and Golgi intracellular compartments.
1.1.4 Protein biosynthesis of cell surface proteins
The route of integral cell surface proteins and secretory proteins to their final
destinations begins with co-translational synthesis of the nascent polypeptide on ribosomes of
the rough ER. The preceding targeting of the cytosolic translating ribosome to the ER
membrane is mediated by signal sequences in the polypeptide, that are recognized by a signal
recognition particle (SRP) as soon as they emerge (High, 1995). The ribosome-polypeptideSRP complex is successively recognized by a SRP receptor (SR) in the ER membrane. The
signal sequence binds to the sec61 unit of a translocon and initiates the translocation of the
polypeptide (Mothes et al., 1998). Integration and orientation of the immature proteins in the
ER membrane is maintained during the transport to the final sites and is determined by
different types of signal sequences. Signal sequences of transmembrane proteins commonly
contain ≥8 hydrophobic amino acids in the core, flanked by different other amino acids
(Martoglio and Dobberstein, 1998). Signal sequences are immediately cleaved in type I
proteins, which acquire a Nluminal-Ccytosol orientation or serve as a signal anchor in type II and
III proteins (Goder and Spiess, 2001). Type II proteins achieve a Ncytosol-Cluminal and type III
proteins a similar orientation to type I proteins (Goder and Spiess, 2001). In contrast to the
afore mentioned single spanning transmembrane proteins type IV proteins constitute multipass membrane domains (Tan et al., 2008).
7
Chapter 1: Introduction
1.1.5 Protein glycosylation, folding and degradation
Glycosylation is the most common modification of proteins in eukaryotic cells and can
occur in the ER or/and Golgi compartments (Apweiler et al., 1999; Helenius and Aebi, 2001).
It has critical roles in folding, transport and activity as well as in the stability of proteins
(Wujek et al., 2004). The process of glycosylation includes enzyme-based attachment of
sugars to certain amino acids of the protein as well as subsequent enzymatic processing of the
oligosaccharide structures. N- and O-glycosylation, named according to the linkage atom of
the sugar binding amino acid, are the basic types of glycosylation (Ohtsubo and Marth, 2006).
Both types differ in their biosynthesis structure and the sugar binding amino acid residue.
N-glycosylation begins co-translationally in the ER and is continued in the Golgi
apparatus (Vagin et al., 2009). In the ER lumen, a precursor oligosaccharide of 14 sugar
residues is linked to the amide nitrogen of susceptible asparagine (Asn) residues within AsnX-Thr/Ser (X, any amino acid except proline) consensus motifs of the immature protein
(Kornfeld and Kornfeld, 1985; Yan and Lennarz, 2005). The preassembled sugar block
consists of two N-acetylglucosamines, nine mannose residues and three glucoses and is
further trimmed in the ER by removal of three glucose and one mannose residue before
transport and further processing in the Golgi apparatus (Ferris et al., 2014). This early
biosynthetic form of N-glycosylated proteins in the ER and early Golgi compartment is
referred to as high-mannose or mannose-rich (Zhu and Desaire, 2015). By removal of various
mannose residues and addition of further sugars including galactose and finally sialic acid, Nlinked oligosaccharides acquire a more complex structure in the Golgi apparatus (Roth et al.,
2012). Proteins of this biosynthetic state are accordingly called complex N-glycosylated and
can be further transported on their way to the cell surface. A third hybrid type, with branches
of both high-mannose and complex oligosaccharides, can also occur (Zhu and Desaire, 2015).
Different glycoforms of a protein are specific for certain cellular compartments and
thus the glycosylation status can be used as a marker for protein trafficking and cellular
localization. Analysis of the N-glycosylation status can be experimentally performed by
enzymatic deglycosylation with endoglycosidase H (endo H) or peptide-N-Glycosidase F
(PNGase F). Endo H cleaves N-glycans from mannose-rich glycosylated proteins of the ER or
early Golgi compartment and hybrid N-glycan structures but no complex oligosaccharide
chains of proteins, which underwent further processing in the Golgi apparatus (Tarentino and
Plummer, 1994). In contrast, PNGase F is able to cleave both high-mannose as well as
8
Chapter 1: Introduction
complex N-glycans from proteins (O'Neill, 1996). A subsequent shift in the molecular weight
of glycoproteins after experimental deglycosylation can be detected by SDS-PAGE and
western blotting.
Another essential maturation process is the folding of the nascent protein into its
native functional conformation. The final conformation is determined by the amino acid
sequence of the protein. Folding normally begins right after the polypeptide is translocated
into the ER lumen and includes the formation of secondary structures, disulfide bonds and the
oligomerization of proteins. The formation of disulfide bonds is favored by the oxidative
milieu in the ER lumen. A proper protein folding is additionally facilitated by molecular
chaperones. Such chaperones include heat shock proteins like BiP and two mannose-binding
lectins, the membrane bound calnexin and the luminal calreticulin (Williams, 2006). Both last
mentioned chaperones can use N-glycan structures for quality control to monitor a proper
protein folding (Aebi et al., 2010). Terminally misfolded proteins can be targeted for ER
associated degradation (ERAD) in cytosolic proteasomes (Ruggiano et al., 2014). After the
folding, cell surface proteins are transported to the Golgi apparatus.
In contrast to N-linked glycosylation, O-glycans are attached one at a time to the
protein in a post-translational event in the cis-Golgi compartment after folding of the protein.
O-glycosylation includes a stepwise enzymatic addition of sugar residues to hydroxyl groups
of certain serine or threonine residues (Zauner et al., 2012). To a lesser extend also
hydroxylysine or -proline can be glycosylated (Van den Steen et al., 1998). O-glycans are
generally short and usually start with N-acetylglucosamine, added first followed by a variable
number of additional sugar residues (Roth et al., 2012). O-glycans comprise no conserved
core saccharide structure like N-glycans but different types exist (Zhu and Desaire, 2015).
Mammalian O-glycans are typically composed of 3-6 sugar units and can have implications in
further transport and sorting of glycoproteins to the cell surface. The same protein can be Nand O-glycosylated at different positions.
1.1.6 Protein sorting and lipid microdomains
The surface of eukaryotic cells is composed of a heterogeneous bilayer with regions of
different structure and function in terms of lipid and protein composition. Epithelial cells are
characterized by a polar membrane organization into two distinct domains, apical and
9
Chapter 1: Introduction
basolateral (Caplan, 1997; Mostov et al., 2003). This organization necessitates a polarized
sorting of proteins and lipids to maintain the physiological function of the cell. Protein
transport from one compartment to the other is mediated by different membrane vesicles
budding from one compartment and fusing to the next (Mellman and Nelson, 2008; Szul and
Sztul, 2011). The trans-Golgi network (TGN) is considered to be the main sorting station for
cell surface proteins that have passed processing in the ER and Golgi compartments (Griffiths
and Simons, 1986; Keller et al., 2001). Their delivery to the correct membrane domain
depends on different sorting determinants and mechanisms. Biochemical and live cell imaging
studies have shown that apical and basolateral protein transport from the TGN occur via
different membrane vesicles (Jacob and Naim, 2001; Paladino et al., 2006).
Sorting signals for basolateral protein delivery are usually located in the cytoplasmic
tail and include tyrosine-based and di-hydrophobic based motifs (Hunziker and Fumey, 1994;
Matter et al., 1992). In contrast, apical sorting signals are pleomorphic and can be located in
each portion of the protein. Among others, glycosyl-phosphoinositol (GPI) lipid anchors of
proteins and N- as well as O-glycans are described as such apical delivery determinants
(Benting et al., 1999; Paladino et al., 2006; Yeaman et al., 1997). Lipid microdomains are
described to serve as apical sorting platforms for proteins from the TGN (Surma et al., 2012).
This delivery mechanism depends on preferential association of proteins to the microdomains,
also called lipid rafts. Lipid rafts are described as highly dynamic, nanoscale, sterol- and
sphingolipid-enriched ordered assemblies (Lenne et al., 2006; Lingwood and Simons, 2010).
They are proposed to form ordered phases of certain lipids and proteins with specific
functions, in the non-raft disordered phase of the cell surface (Ahmed et al., 1997; Prior et al.,
2003). The concept of lipid rafts as apical protein carriers is supported by the finding that
apical transport is highly sensitive to cholesterol depletion or blockage of sphingolipid
synthesis (Hansen et al., 2000; Keller and Simons, 1997; Lipardi et al., 2000). Moreover,
advanced imaging techniques have allowed the visualization of lipid microdomains in living
cells (Eggeling et al., 2009; Pralle et al., 2000; Schutz et al., 2000). Lipid rafts can be
experimentally isolated as detergent resistant membranes (DRMs), commonly used detergents
are for example Lubrol WX or Triton X-100 (Delaunay et al., 2008). DRMs obtained with
different detergents differ in their protein and lipid content (Schuck et al., 2003) and proteins
of different biosynthetic states were shown to associate with distinct DRMs (Alfalah et al.,
2005; Castelletti et al., 2008). Besides membrane trafficking and cell polarization, lipid rafts
10
Chapter 1: Introduction
are also implicated in signaling and other membrane processes (Brown and London, 2000;
Hanzal-Bayer and Hancock, 2007; Lingwood and Simons, 2010; Simons and Ikonen, 1997).
1.2 Sucrase-isomaltase
1.2.1 Classification, structure and expression
The sucrase-isomaltase enzyme complex (EC3.2.1.48-10) is a type II transmembrane
protein and the most abundant glycoprotein in the intestinal brush border membrane (Naim et
al., 1988b; Naim et al., 1988d). The enzyme is almost exclusively expressed in differentiated
enterocytes of the small intestine and has a dominant role in terminal digestion of starch and
sucrose in higher organisms. SI is one of the four previously mentioned brush border
disaccharidases belonging to the glycoside hydrolase family 31 (GH31), that also includes all
other characterized eukaryotic α-glucosidases (Ernst et al., 2006). The classification into this
family is based on amino acid sequence similarities. The SI complex is comprised of two
similar but not identical catalytic subunits, isomaltase and sucrase and has an overlapping
activity with the MGAM enzyme complex. Both SI subunits share 40% amino acid
similarities and overlapping substrate specificities with each other and the SI and MGAM
subunits even share 60% of sequence identities (Ernst et al., 2006; Heymann et al., 1995;
Robayo-Torres et al., 2006). These similarities in the structure and functions lead to the
assumption that SI and MGAM genes evolved from duplication and divergence of an ancestral
gene, which underwent tandem duplication (Nichols et al., 2003). The gene coding for human
SI consists of 48 exons and was found to be located on chromosome 3 (3q25-26) (West et al.,
1988). When translated into a protein, SI is built by a total of 1827 amino acids and is
composed of a short N-terminal cytoplasmic tail (12 amino acids) followed by a
transmembrane domain of 20 mostly hydrophobic amino acids and a huge extracellular
domain (Hunziker et al., 1986). The single spanning transmembrane domain acts as an
uncleavable membrane anchor signal sequence in the ER and directly interacts with the
isomaltase subunit by a serine- and threonine-rich stretch domain (stalk region). The stalk
region is highly O-glycosylated and is suggested to stabilize the protein. The isomaltase
subunit is directly connected to the C-terminal sucrase subunit and both are oriented into the
intestinal lumen (Figure 1.3). The SI amino acid sequence is depicted in Figure S 6.1 (see
appendix).
11
Chapter 1: Introduction
Figure 1.3 Structure of sucrase-isomaltase and orientation in the plasma membrane. The
sucrase-isomaltase protein consists of a highly N- and O-glycosylated extracellular domain, a
transmembrane domain and a N-terminal cytoplasmatic tail. The extracellular domain is subdivided
into the catalytic isomaltase and sucrase subunits and a stalk region. At the cell surface sucraseisomaltase is located in cholesterol-sphingolipid rich microdomains (lipid rafts). Luminal trypsin
cleaves in between the isomaltase and sucrase subunit. CYT: cytoplasmic tail, TM: transmembrane
domain. Graphic by Jacob and Naim, modified.
1.2.2 Enzymatic activities and catalytic mechanism
The two globular subunits of SI comprise one catalytic domain or active site
respectively and share a common exo-hydrolase activity against linear α-1,4-linked maltose,
maltotriose or maltooligosaccharides (Gray et al., 1979; Jones et al., 2012; Sim et al., 2010).
The sucrase subunit additionally cleaves α-1,2-linkages of sucrose and the isomaltase subunit
has a specific activity against α-1,6-glycosidic bonds of isomaltose (Gray et al., 1979; Jones et
al., 2012; Sim et al., 2010). In vivo, SI is responsible for 60%-80% of the hydrolytic maltase
digestion in the small intestine (Quezada-Calvillo et al., 2007; Semenza et al., 1965), all
neutral sucrase activity and almost all isomaltase activity (Semenza and Auricchio, 1989).
12
Chapter 1: Introduction
MGAM accounts for the remaining 20%-40% of maltose digestion.
SI is a configuration-retaining α-glucosidase, which acts at the non-reducing ends of
its sugar substrates (Sim et al., 2010). The substrate catalysis follows a double replacement
mechanism. In a first step a glycosyl-enzyme intermediate is formed (glycosylation) and in a
second step free monosaccharides are released by hydrolysis of the intermediate
(deglycosylation) (Frandsen and Svensson, 1998) (Figure 1.4). The mechanism typically
involves two catalytic carboxylic acids acting as nucleophile or acid/base catalyst,
respectively (Lee et al., 2001).
Figure 1.4 Retaining mechanism of family 31 α-glycoside hydrolases. Substrate catalysis of
these enzymes follows a double replacement mechanism including two steps, glycosylation and
deglycosylation. In the first step the acid/base catalyst protonates the glycosidic oxygen with bond
cleavage, while the nucleophile attacks the anomeric carbon and forms a glycosyl enzyme
intermediate. In the second step the intermediate is attacked by an incoming water molecule that is
deprotonated by the base catalyst. Both steps proceed through oxacarbenium-like transition states.
Withers and Williams 2014, adapted.
13
Chapter 1: Introduction
From active site directed inhibition or labeling studies aspartic acid (Asp/D) was described to
act as catalytic residue in the catalytic reaction of SI (Quaroni et al., 1974; Quaroni and
Semenza, 1976). Aspartic acid at amino acid position 505 (Asp 505) in the isomaltase subunit
and aspartic acid 1394 (Asp 1394) in the sucrase subunit were described to act as catalytic
nucleophiles (Sim et al., 2010). The localization of these residues within the SI amino acid
sequence is depicted in Figure S 6.1 in the appendix. Both catalytic residues are found within
a GH31 characteristic catalytic site signature sequences (Ernst et al., 2006). This catalytic site
consensus motif is made up by the amino acids tryptophan, isoleucine, aspartic acid,
methionine, asparagine and glutamic acid also known as WIDMNE (Figure S 6.1, appendix).
By the resolution of the three-dimensional structure of the isomaltase subunit Asp 604 was
predicted to be the proton donor residue for substrate cleavage of carbohydrates by the
isomaltase catalytic site (Sim et al., 2010). Due to a lack of the three-dimensional structure of
sucrase the corresponding residue to Asp 604 in the sucrase subunit was deduced by sequence
similarities (Figure S 6.1, appendix). Thus, Asp 1500 was suggested as potential proton donor
residue for catalytic activity of the sucrase subunit. Both predicted proton donor residues in
the two SI subunits were located within a WLGDN consensus motif (Figure S 6.1, appendix),
made up by the amino acids tryptophan, leucine, glycine, aspartic acid and asparagine. The
catalytic consensus motifs, WIDMNE and WLGDN, found once in each catalytic subunit of
SI, were located about 100 amino acids away from each other and are brought into close
proximity during folding than forming the two catalytic sites of SI.
1.2.3 Biosynthesis
Before SI can fulfill its function at the intestinal cell surface, it is processed and
trafficked intracellularly along the secretory pathway. SI matures from a mannose-rich single
chain precursor in the ER (pro-SIh, 210 kDa) to a complex N- and O-glycosylated protein in
the Golgi apparatus (pro-SIc, 245 kDa) (Naim et al., 1988c) (Figure 1.5). N- and O-glycans
attached to the protein aid in acquiring its final functional protein conformation in the ER as
well as assist in the acquisition of transport competence of the protein to the cell surface. Oglycans of pro-SI occur mainly in the serine and threonine-rich stalk region, whereas Nglycosylation sites can be found in both active subunits. Analysis of the SI peptide sequence
revealed a total of 18 potential N-glycosylation sites (Chantret et al., 1992).
14
Chapter 1: Introduction
Figure 1.5 Biosynthesis of sucrase-isomaltase in an enterocyte. The SI protein is synthesized
as a single chain precursor in the rough ER, where it becomes N-glycosylated. The resulting early
high-mannosylated protein form of SI (SIh) is detectable as a lower SI band by western blotting. SIh is
folded and further transported to the Golgi apparatus, where it acquires complex N- and Oglycosylation (SIc). Finally the complex glycosylated protein is transported to the apical cell surface.
SIc is detectable as an upper band after western blotting. BBM: brush border membrane, ER:
endoplasmic reticulum, SI: sucrase-isomaltase.
From the trans-Golgi network 90% to 95% of de novo synthesized pro-SI is
transported to the apical cell membranes in association with lipid rafts (Naim et al., 2012).
The preferential association of SI with these cholesterol- and sphingomyelin-enriched apical
sorting platforms is described to be mediated by O-linked glycans (Alfalah et al., 1999). A
biochemical inhibition of O-glycosylation via benzyl-N-acetyl-α-D-galactosaminide (benzylGalNAc) treatment leads to an undirected distribution of SI to both membrane domains
(Alfalah et al., 1999). Besides the essential role of O-glycans for lipid raft association and
sorting, the integration of SI into lipid microdomains is also accompanied by a substantial
increase in enzymatic SI activities, up to 3-fold in the colonic carcinoma Caco-2 cell line
(Wetzel et al., 2009). A disruption of DRMs or an improper N- or O-glycosylation lead to a
drastic reduction of sucrase and isomaltase activities (Wetzel et al., 2009), highlighting the
relevance of a complex N- and O-glycosylation of SI for its function. Finally, upon delivery
to the apical cell surface, the already fully active human pro-SI is proteolytically cleaved by
luminal trypsin to its two active subunits protruding into the intestinal lumen. The cleavage
15
Chapter 1: Introduction
site is located in between an arginine and an isoleucine residue at the interface of isomaltase
and sucrase of human SI. Both subunits stay associated with each other via non-covalent ionic
interactions. SI is expressed throughout the full length of the small intestine with a proximal
to distal gradient of SI activities (Skovbjerg, 1981). The highest SI activities are detected in
the proximal jejunum (Rana et al., 2001). Defects in SI at several points along its biosynthetic
pathway have been associated with carbohydrate malabsorption, a topic that will be explored
in the next sections.
1.3 Carbohydrate malabsorption
1.3.1 Malfunction of disaccharidases
The etiology of non-specific abdominal complaints such as abdominal pain and
diarrhea can be triggered by carbohydrate malabsorption. Strikingly, about 70% of the human
population is expected to be affected by some form of carbohydrate malabsorption (Heyman,
2006), which can result from malfunction of one or more disaccharidases. The malfunction of
disaccharidases like SI result from (i) congenital or primary defects, which are caused by
genetic alterations already occurring at birth or (ii) by acquired environmental factors, which
arise later in life or as consequences of genetic deficiencies with negative influences on the
intestinal physiology. Environmental factors include inflammation, enzyme inhibition by
dietary components or drugs, as well as physical injuries of the intestinal epithelium (Gericke
et al., 2016). Examples for primary and secondary intestinal disorders associated with
disaccharidase deficiencies and carbohydrate malabsorption are summarized in Table 1.3.
This study focuses on carbohydrate maldigestion and -absorption caused by genetic
deficiencies of SI.
16
Chapter 1: Introduction
Table 1.3 Examples of primary disaccharidase deficiencies and intestinal disorders
causing secondary disaccharidase deficiencies.
Disease /
Pathological
factor
Description and potential
consequences
Congenital
sucrase-isomaltase
deficiency
- Genetic alterations of the SI gene
- Functional impairment of the sucraseisomaltase protein
(Alfalah et
al., 2009)
Congenital lactase
Primary
deficiency
disaccharidase
deficiency
Congenital
maltase deficiency
- Genetic alterations of the LCT gene
- Functional impairment of the lactasephlorizin hydrolase protein
(Behrendt
et al., 2009)
Celiac disease
Secondary
deficiency
(with potential
effects on
disaccharidase
function)
- Genetic alterations of the MGAM
gene
- Functional impairment of the maltase
glucoamylase protein
- Autoimmune disorder triggered by
hypersensitivity to ingested gliadins
from wheat and other cereals
- Cause villus atrophy
Irritable bowel
disease
- Imbalance between anti- and
proinflammatory cytokines results in
severe organ pathology and loss of
barrier function in intestinal tissue
- Loss of SI expression and activity
Rotavirus
infection
- Rotavirus infection lead to reduced
disaccharidase expression at the BBM
by perturbing protein targeting and
organization of the microvillar
cytoskeleton
Giardiasis
- Infection with Giardia lead to
shortened microvilli and a reduction
in disaccharidase activity
Reference
(Lebenthal
et al., 1994)
(Cornell et
al., 1988;
Vriezinga et
al., 2015)
(AmitRomach et
al., 2006;
Neurath,
2014)
(Jourdan et
al., 1998)
(Daniels
and
Belosevic,
1995)
1.4 Congenital sucrase-isomaltase deficiency
1.4.1 Molecular basis and prevalence
Congenital sucrase-isomaltase deficiency (CSID) is a primary human intestinal
disorder that was first described by Weijers and colleagues in 1960 (Weijers et al., 1960).
CSID is characterized as a rare autosomal recessively inherited disease (Kerry and Townley,
17
Chapter 1: Introduction
1965) that can be caused by point mutations within the coding region of the SI gene. The SI
gene mutations can elicit single amino acid exchanges in the protein.
Mutational defects in SI are associated with an improper digestion of carbohydrates
along with malabsorption and a gradient of gastrointestinal symptoms in CSID patients
common to those of other gastrointestinal disorders such as irritable bowel disease (IBD) or
food intolerances. Generally, mutations can affect each of the 1827 building amino acids of
the SI protein but do not necessarily lead to a complete impairment of SI expression and
activity at the BBM (Fransen et al., 1991; Keiser et al., 2006).
In previous studies, some naturally occurring SI variants were analyzed by staining of
SI in small bowel biopsies from patients with carbohydrate malabsorption and examination of
the SI localization within the enterocytes, as well as by biochemical analysis of SI on a
cellular and biochemical level. The studies showed that the analyzed mutations interfere to a
different extent with normal posttranslational processing, maturation and activity, and thereby
prevent normal SI function in luminal carbohydrate digestion (Hauri et al., 1985a; Keiser et
al., 2006; Propsting et al., 2003; Ritz et al., 2003). According to these analyses the mutations
were assigned into diverse biochemical phenotypes (Fransen et al., 1991; Hauri et al., 1985a;
Naim et al., 2012; Spodsberg et al., 2001).
About 83% of CSID patients with European ethnicity are estimated to be carriers of
one out of four common mutations. This mutations are p.V577G, p.G1073D and p.F1745C
with severe influence on the SI function by intracellular blockage of the protein (Alfalah et
al., 2009) and p.R1124X, which introduces a chain termination codon (Uhrich et al., 2012).
Initially reported cases of CSID mostly demonstrated compound heterozygous or less
often homozygous patterns of inheritance (Alfalah et al., 2009; Jacob et al., 2000b; Ritz et al.,
2003). In the recent years feasibility of gene sequencing has led to the identification of true
heterozygote SI mutations, affecting only one allele (Sander et al., 2006). The prevalence of
CSID is a topic of debate, and was considered as rare in the past years. Only 0.02% of
Americans of European descents (Peterson and Herber, 1967) and 5% to 10% of native
populations of Greenland, Alaska and Canada were estimated to suffer from CSID
(Gudmand-Hoyer et al., 1987; McNair et al., 1972). However, the high genetic diversity of
CSID and common symptoms to other intestinal diseases, which may lead to misdiagnosis,
raise the assumption that CSID is more common than initially expected (Ament et al., 1973;
Sander et al., 2006).
18
Chapter 1: Introduction
1.4.2 Etiology of disease and symptoms
The clinical presentation of CSID and other carbohydrate malabsorption disorders is
oftentimes an osmotic-fermentative diarrhea upon ingestion of carbohydrates. The associated
symptoms can vary from mild to severe and include vomiting, flatulence and abdominal pain
(Treem, 1996; Treem, 2012). High amounts of incompletely digested carbohydrates cannot be
absorbed and lead to an increased osmotic load in the intestinal lumen and colon, causing a
flow of water and electrolytes into the lumen (Figure 1.6). This affects the gut motility by
accelerating the small intestinal transit and lead to diarrhea, after the absorptive capacity of
the intestine is overwhelmed. Other symptoms like gaseous abdominal distension, flatulence
and cramps are caused by bacterial fermentation of unabsorbed carbohydrates, which
produces hydrogen (H2), carbon dioxide (CO2), methane and short-chain fatty acids (SCFAs)
(Ebert and Witt, 2016; Treem, 1995) (Figure 1.6). High amounts of SCFAs additionally
increase the osmotic pressure. The accelerated transit further increases the degree of improper
digestion of starch and monosaccharides and may also affect the absorption of other nutrients
and the hormonal gastrointestinal regulation (Layer et al., 1986; Treem, 1995). Chronic
diarrhea can lead to a risk of malnutrition, dehydration and failure to thrive in patients
(Belmont et al., 2002).
Figure 1.6 Clinical consequences of malabsorbed carbohydrates in the intestine. Defects
of sucrase-isomaltase lead to maldigestion of carbohydrates in the intestinal lumen. Carbohydrates,
other than monosaccharides, cannot be absorbed and induce an osmotic water influx from the
underlying tissues into the intestinal lumen. An increased water load goes along with an accelerated
transit and diarrhea. Bacterial fermentation of unabsorbed carbohydrates produces gases and short
chain fatty acids (SCFA), additionally causing symptoms like abdominal pain and flatulence in
patients. Ebert and Witt 2016, adapted and modified.
19
Chapter 1: Introduction
Children are suggested to be especially susceptible to severe symptoms based on the
shorter length of their small intestine, making this a key pediatric concern (Berni Canani et
al., 2016). The onset of CSID depends on different factors, including the degree of residual
enzyme activity of SI, the quantity of ingested carbohydrates and other food components and
the absorptive capacity of the colon (Treem, 1995). Additionally, the rate of gastric emptying,
the metabolic activity of fermenting bacteria as well as coexisting intestinal disorders or
inflammation may play a role in the outcome of CSID (Treem, 1995).
1.4.3 Diagnosis and therapy
The current gold standard for the diagnosis of CSID is the assessment of duodenal
endoscopic biopsy samples for disaccharidase activities and histology. CSID is clinically
characterized by a reduction or absence of SI activities along with a normal intestinal
morphology (Treem, 2012). In contrast, secondary disorders are commonly associated with an
impaired intestinal morphology (D'Inca et al., 1995; Scott et al., 2004; Wahab et al., 2002).
Thus, the histological analysis of the biopsy specimens allows the differentiation of primary
from secondary disorders. Confocal laser endomicroscopy (CLE) is another novel endoscopic
technique to visualize the intestinal morphology (Dunbar and Canto, 2008). Non-invasive
diagnostic approaches for carbohydrate malabsorption disorders, including CSID, are stool
testing and the sucrose breath hydrogen test. A low pH of the stool between 5.0 and 6.0,
caused by the presence of SCFAs is indicative for carbohydrate malabsorption, as well as the
presence of reducing sugars (e.g. glucose, fructose) (Castro-Rodriguez et al., 1997; Terrin et
al., 2012). Nevertheless this screening has a high degree of false negative results. The
hydrogen breath test measures the exhaled H2 levels produced by bacterial fermentation after
ingestion of a test carbohydrate such as sucrose. An increased hydrogen of more than 20 part
per million is considered to indicate carbohydrate malabsorption (Levitt and Donaldson,
1970). An improved, more precise breath test for CSID was developed by labeling the sucrose
substrate with 13C and measuring the changes in 13C labeled CO2 concentrations in the breath
(Robayo-Torres et al., 2009). With the improvement of genetic testing in the past few years,
mutations in the SI gene can be identified by genetic screenings using saliva or blood of
patients (Sander et al., 2006; Uhrich et al., 2012). Prior to the mentioned diagnostic methods,
20
Chapter 1: Introduction
a dietary assessment by food exclusion in context of the patient’s symptoms can give first
hints to carbohydrate malabsorption.
There are different treatment options for CSID. One possibility is dietary management
by a life-long sucrose- and starch-restricted diet adapted to the requirements of the patient. A
good alternative to the avoidance of malabsorbed sugars, which may not be easy especially
for children, is an enzyme replacement therapy to compensate for the malfunction of SI.
Sucraid (sacrosidase), which is a liquid preparation from Saccharomyces cerevisiae is
frequently used as therapy for intestinal disorders associated with carbohydrate malabsorption
and helps to resolve or reduce the symptoms (Lucke et al., 2009; Puntis and Zamvar, 2015).
1.5 Aim of the study
The study is divided into two parts, both concerning the function of sucrase-isomaltase
in human health and disease on a molecular and cellular basis. In the first part, the influence
of mutations in the human SI gene on the function of the protein relevant to CSID should be
analyzed. In the second part, the catalytic site properties of SI are resolved by functional and
biochemical analyses of catalytic aspartic acid SI variants.
Part I:
This part of the study aims to expand the current knowledge on the cellular and
molecular basis of congenital sucrase-isomaltase deficiency as well as of similar
malabsorption or protein trafficking disorders. Therefore the molecular pathogenesis in a
selection of 15 novel natural occurring mutations within the SI gene coding region is resolved.
The mutations were identified in a screening of 31 patients with a confirmed biopsy diagnosis
of congenital sucrase-isomaltase deficiency. A sequencing of the SI gene coding region of
these patients revealed 56 abnormal alleles. The 15 selected mutations affected different
regions of the SI gene. The effect of the selected mutations on the enzymatic function of the
SI protein, its structure, the protein trafficking and lipid rafts association are resolved in a
cellular in vitro system and the data are analyzed in correlation with the available patients’
data, which includes inheritance information and enzymatic sucrase-isomaltase activities from
21
Chapter 1: Introduction
small bowel biopsies. To evaluate the disease-causing potential of the novel mutations a
classification based on their functional consequences on the SI protein should be performed.
Part II:
The aim in this part of the study is to experimentally prove the catalytic site function
of two aspartic acid residues predicted to participate in the α-glycosidic activity of the
isomaltase or sucrase subunit of SI, with focus on validating the proton donor residue. So far
the structure-function properties of SI are not completely resolved. A resolution of these
properties may give better insights into the physiological function of SI and other GH31
family members and their association in pathological conditions like CSID. The single active
site properties of SI are characterized by specific mutational inactivation of aspartic acid in
catalytic sites of the SI protein with normal transport and folding. The predicted proton donor
residues in sucrase and isomaltase subunits are separately exchanged by either glutamic acid,
tyrosine, serine or asparagine by site-directed mutagenesis PCR. The assessment of transport
and folding to prove the native functionality of the SI protein and the measurement of
enzymatic activities against maltose, sucrose and isomaltose are performed in a mammalian
COS-1 cell system.
In summary, the specific aims of the current study focus on two points:
1) Investigation of the molecular pathogenesis of CSID by biochemical analysis of 15 novel
mutations within the coding region of the SI gene found in patients with confirmed CSID
diagnosis.
2) Elucidation of the active site characteristics of the native sucrase-isomaltase protein by
analysis of two aspartic acid residues predicted to function as proton donors for isomaltase
and sucrase activities.
22
Chapter 1: Introduction
References
Aebi, M., R. Bernasconi, S. Clerc, and M. Molinari. 2010. N-glycan structures: recognition and
processing in the ER. Trends in biochemical sciences. 35:74-82.
Ahmed, S.N., D.A. Brown, and E. London. 1997. On the origin of sphingolipid/cholesterol-rich
detergent-insoluble cell membranes: physiological concentrations of cholesterol and
sphingolipid induce formation of a detergent-insoluble, liquid-ordered lipid phase in model
membranes. Biochemistry. 36:10944-10953.
Alfalah, M., R. Jacob, U. Preuss, K.P. Zimmer, H. Naim, and H.Y. Naim. 1999. O-linked glycans mediate
apical sorting of human intestinal sucrase-isomaltase through association with lipid rafts.
Current biology : CB. 9:593-596.
Alfalah, M., M. Keiser, T. Leeb, K.P. Zimmer, and H.Y. Naim. 2009. Compound heterozygous
mutations affect protein folding and function in patients with congenital sucrase-isomaltase
deficiency. Gastroenterology. 136:883-892.
Alfalah, M., G. Wetzel, I. Fischer, R. Busche, E.E. Sterchi, K.P. Zimmer, H.P. Sallmann, and H.Y. Naim.
2005. A novel type of detergent-resistant membranes may contribute to an early protein
sorting event in epithelial cells. The Journal of biological chemistry. 280:42636-42643.
Ament, M.E., D.R. Perera, and L.J. Esther. 1973. Sucrase-isomaltase deficiency-a frequently
misdiagnosed disease. J Pediatr. 83:721-727.
Amit-Romach, E., R. Reifen, and Z. Uni. 2006. Mucosal function in rat jejunum and ileum is altered by
induction of colitis. International journal of molecular medicine. 18:721-727.
Apweiler, R., H. Hermjakob, and N. Sharon. 1999. On the frequency of protein glycosylation, as
deduced from analysis of the SWISS-PROT database. Biochimica et biophysica acta. 1473:4-8.
Behrendt, M., M. Keiser, M. Hoch, and H.Y. Naim. 2009. Impaired trafficking and subcellular
localization of a mutant lactase associated with congenital lactase deficiency.
Gastroenterology. 136:2295-2303.
Belmont, J.W., B. Reid, W. Taylor, S.S. Baker, W.H. Moore, M.C. Morriss, S.M. Podrebarac, N. Glass,
and I.D. Schwartz. 2002. Congenital sucrase-isomaltase deficiency presenting with failure to
thrive, hypercalcemia, and nephrocalcinosis. BMC pediatrics. 2:4.
Benting, J.H., A.G. Rietveld, and K. Simons. 1999. N-Glycans mediate the apical sorting of a GPIanchored, raft-associated protein in Madin-Darby canine kidney cells. J Cell Biol. 146:313320.
Berni Canani, R., V. Pezzella, A. Amoroso, T. Cozzolino, C. Di Scala, and A. Passariello. 2016.
Diagnosing and Treating Intolerance to Carbohydrates in Children. Nutrients. 8:157.
Brown, D.A., and E. London. 2000. Structure and function of sphingolipid- and cholesterol-rich
membrane rafts. The Journal of biological chemistry. 275:17221-17224.
Caplan, M.J. 1997. Membrane polarity in epithelial cells: protein sorting and establishment of
polarized domains. The American journal of physiology. 272:F425-429.
Caspary, W.F. 1992. Physiology and pathophysiology of intestinal absorption. The American journal of
clinical nutrition. 55:299s-308s.
Castelletti, D., M. Alfalah, M. Heine, Z. Hein, R. Schmitte, G. Fracasso, M. Colombatti, and H.Y. Naim.
2008. Different glycoforms of prostate-specific membrane antigen are intracellularly
transported through their association with distinct detergent-resistant membranes. The
Biochemical journal. 409:149-157.
Castro-Rodriguez, J.A., E. Salazar-Lindo, and R. Leon-Barua. 1997. Differentiation of osmotic and
secretory diarrhoea by stool carbohydrate and osmolar gap measurements. Archives of
disease in childhood. 77:201-205.
23
Chapter 1: Introduction
Chantret, I., M. Lacasa, G. Chevalier, J. Ruf, I. Islam, N. Mantei, Y. Edwards, D. Swallow, and M.
Rousset. 1992. Sequence of the complete cDNA and the 5' structure of the human sucraseisomaltase gene. Possible homology with a yeast glucoamylase. The Biochemical journal. 285
( Pt 3):915-923.
Cohen, S.A. 2016. The clinical consequences of sucrase-isomaltase deficiency. Molecular and cellular
pediatrics. 3:5.
Colombo, V., H. Lorenz-Meyer, and G. Semenza. 1973. Small intestinal phlorizin hydrolase: the "betaglycosidase complex". Biochimica et biophysica acta. 327:412-424.
Cornell, H.J., R.S. Auricchio, G. De Ritis, M. De Vincenzi, L. Maiuri, V. Raia, and V. Silano. 1988.
Intestinal mucosa of celiacs in remission is unable to abolish toxicity of gliadin peptides on in
vitro developing fetal rat intestine and cultured atrophic celiac mucosa. Pediatr Res. 24:233237.
Crosnier, C., D. Stamataki, and J. Lewis. 2006. Organizing cell renewal in the intestine: stem cells,
signals and combinatorial control. Nature reviews. Genetics. 7:349-359.
D'Inca, R., G.C. Sturniolo, D. Martines, V. Di Leo, A. Cecchetto, C. Venturi, and R. Naccarato. 1995.
Functional and morphological changes in small bowel of Crohn's disease patients. Influence
of site of disease. Dig Dis Sci. 40:1388-1393.
Daniels, C.W., and M. Belosevic. 1995. Disaccharidase activity in male and female C57BL/6 mice
infected with Giardia muris. Parasitology research. 81:143-147.
Delaunay, J.L., M. Breton, G. Trugnan, and M. Maurice. 2008. Differential solubilization of inner
plasma membrane leaflet components by Lubrol WX and Triton X-100. Biochimica et
biophysica acta. 1778:105-112.
Diekmann, L., K. Pfeiffer, and H.Y. Naim. 2015. Congenital lactose intolerance is triggered by severe
mutations on both alleles of the lactase gene. BMC gastroenterology. 15:36.
Drozdowski, L.A., and A.B. Thomson. 2006. Intestinal sugar transport. World J Gastroenterol.
12:1657-1670.
Dunbar, K., and M. Canto. 2008. Confocal endomicroscopy. Current opinion in gastroenterology.
24:631-637.
Ebert, K., and H. Witt. 2016. Fructose malabsorption. Molecular and cellular pediatrics. 3:10.
Eggeling, C., C. Ringemann, R. Medda, G. Schwarzmann, K. Sandhoff, S. Polyakova, V.N. Belov, B.
Hein, C. von Middendorff, A. Schonle, and S.W. Hell. 2009. Direct observation of the
nanoscale dynamics of membrane lipids in a living cell. Nature. 457:1159-1162.
Ernst, H.A., L. Lo Leggio, M. Willemoes, G. Leonard, P. Blum, and S. Larsen. 2006. Structure of the
Sulfolobus solfataricus alpha-glucosidase: implications for domain conservation and
substrate recognition in GH31. Journal of molecular biology. 358:1106-1124.
Farquhar, M.G., and G.E. Palade. 1963. Junctional complexes in various epithelia. J Cell Biol. 17:375412.
Ferris, S.P., V.K. Kodali, and R.J. Kaufman. 2014. Glycoprotein folding and quality-control mechanisms
in protein-folding diseases. Disease models & mechanisms. 7:331-341.
Frandsen, T.P., and B. Svensson. 1998. Plant alpha-glucosidases of the glycoside hydrolase family 31.
Molecular properties, substrate specificity, reaction mechanism, and comparison with family
members of different origin. Plant molecular biology. 37:1-13.
Fransen, J.A., H.P. Hauri, L.A. Ginsel, and H.Y. Naim. 1991. Naturally occurring mutations in intestinal
sucrase-isomaltase provide evidence for the existence of an intracellular sorting signal in the
isomaltase subunit. J Cell Biol. 115:45-57.
Gebbers, J.O., and J.A. Laissue. 1989. Immunologic structures and functions of the gut. Schweizer
Archiv fur Tierheilkunde. 131:221-238.
Gericke, B., M. Amiri, and H.Y. Naim. 2016. The multiple roles of sucrase-isomaltase in the intestinal
physiology. Molecular and cellular pediatrics. 3:2.
24
Chapter 1: Introduction
Goder, V., and M. Spiess. 2001. Topogenesis of membrane proteins: determinants and dynamics.
FEBS Lett. 504:87-93.
Gray, G.M., B.C. Lally, and K.A. Conklin. 1979. Action of intestinal sucrase-isomaltase and its free
monomers on an alpha-limit dextrin. The Journal of biological chemistry. 254:6038-6043.
Griffiths, G., and K. Simons. 1986. The trans Golgi network: sorting at the exit site of the Golgi
complex. Science (New York, N.Y.). 234:438-443.
Groschwitz, K.R., and S.P. Hogan. 2009. Intestinal barrier function: molecular regulation and disease
pathogenesis. The Journal of allergy and clinical immunology. 124:3-20; quiz 21-22.
Gudmand-Hoyer, E., H.J. Fenger, P. Kern-Hansen, and P.R. Madsen. 1987. Sucrase deficiency in
Greenland. Incidence and genetic aspects. Scand J Gastroenterol. 22:24-28.
Hall, P.A., P.J. Coates, B. Ansari, and D. Hopwood. 1994. Regulation of cell number in the mammalian
gastrointestinal tract: the importance of apoptosis. J Cell Sci. 107 ( Pt 12):3569-3577.
Hansen, G.H., L.L. Niels-Christiansen, E. Thorsen, L. Immerdal, and E.M. Danielsen. 2000. Cholesterol
depletion of enterocytes. Effect on the Golgi complex and apical membrane trafficking. The
Journal of biological chemistry. 275:5136-5142.
Hanzal-Bayer, M.F., and J.F. Hancock. 2007. Lipid rafts and membrane traffic. FEBS Lett. 581:20982104.
Hauri, H.P., J. Roth, E.E. Sterchi, and M.J. Lentze. 1985. Transport to cell surface of intestinal sucraseisomaltase is blocked in the Golgi apparatus in a patient with congenital sucrase-isomaltase
deficiency. Proceedings of the National Academy of Sciences. 82:4423-4427.
Helenius, A., and M. Aebi. 2001. Intracellular functions of N-linked glycans. Science (New York, N.Y.).
291:2364-2369.
Heyman, M.B. 2006. Lactose intolerance in infants, children, and adolescents. Pediatrics. 118:12791286.
Heymann, H., D. Breitmeier, and S. Gunther. 1995. Human small intestinal sucrase-isomaltase:
different binding patterns for malto- and isomaltooligosaccharides. Biological chemistry
Hoppe-Seyler. 376:249-253.
High, S. 1995. Protein translocation at the membrane of the endoplasmic reticulum. Progress in
biophysics and molecular biology. 63:233-250.
Hunziker, W., and C. Fumey. 1994. A di-leucine motif mediates endocytosis and basolateral sorting of
macrophage IgG Fc receptors in MDCK cells. The EMBO journal. 13:2963-2969.
Hunziker, W., M. Spiess, G. Semenza, and H.F. Lodish. 1986. The sucrase-isomaltase complex: primary
structure, membrane-orientation, and evolution of a stalked, intrinsic brush border protein.
Cell. 46:227-234.
Jacob, R., and H.Y. Naim. 2001. Apical membrane proteins are transported in distinct vesicular
carriers. Current biology : CB. 11:1444-1450.
Jacob, R., K.P. Zimmer, J. Schmitz, and H.Y. Naim. 2000. Congenital sucrase-isomaltase deficiency
arising from cleavage and secretion of a mutant form of the enzyme. The Journal of clinical
investigation. 106:281-287.
Jandhyala, S.M., R. Talukdar, C. Subramanyam, H. Vuyyuru, M. Sasikala, and D. Nageshwar Reddy.
2015. Role of the normal gut microbiota. World J Gastroenterol. 21:8787-8803.
Jones, K., R. Eskandari, H.Y. Naim, B.M. Pinto, and D.R. Rose. 2012. Investigations of the structures
and inhibitory properties of intestinal maltase glucoamylase and sucrase isomaltase. Journal
of pediatric gastroenterology and nutrition. 55 Suppl 2:S20-24.
Jourdan, N., J.P. Brunet, C. Sapin, A. Blais, J. Cotte-Laffitte, F. Forestier, A.M. Quero, G. Trugnan, and
A.L. Servin. 1998. Rotavirus infection reduces sucrase-isomaltase expression in human
intestinal epithelial cells by perturbing protein targeting and organization of microvillar
cytoskeleton. Journal of virology. 72:7228-7236.
25
Chapter 1: Introduction
Keiser, M., M. Alfalah, M.J. Propsting, D. Castelletti, and H.Y. Naim. 2006. Altered folding, turnover,
and polarized sorting act in concert to define a novel pathomechanism of congenital sucraseisomaltase deficiency. The Journal of biological chemistry. 281:14393-14399.
Keller, J., and P. Layer. 2014. The Pathophysiology of Malabsorption. Viszeralmedizin. 30:150-154.
Keller, P., and K. Simons. 1997. Post-Golgi biosynthetic trafficking. J Cell Sci. 110 ( Pt 24):3001-3009.
Keller, P., D. Toomre, E. Diaz, J. White, and K. Simons. 2001. Multicolour imaging of post-Golgi sorting
and trafficking in live cells. Nat Cell Biol. 3:140-149.
Kerry, K.R., and R.R.W. Townley. 1965. GENETIC ASPECTS OF INTESTINAL SUCRASE-ISOMALTASE
DEFICIENCY. Journal of Paediatrics and Child Health. 1:223-235.
Kohan, A.B., S.M. Yoder, and P. Tso. 2011. Using the lymphatics to study nutrient absorption and the
secretion of gastrointestinal hormones. Physiology & behavior. 105:82-88.
Kornfeld, R., and S. Kornfeld. 1985. Assembly of asparagine-linked oligosaccharides. Annual review of
biochemistry. 54:631-664.
Layer, P., A.R. Zinsmeister, and E.P. DiMagno. 1986. Effects of decreasing intraluminal amylase
activity on starch digestion and postprandial gastrointestinal function in humans.
Gastroenterology. 91:41-48.
Lebenthal, E., U. Khin Maung, B.Y. Zheng, R.B. Lu, and A. Lerner. 1994. Small intestinal glucoamylase
deficiency and starch malabsorption: a newly recognized alpha-glucosidase deficiency in
children. J Pediatr. 124:541-546.
Lee, S.S., S. He, and S.G. Withers. 2001. Identification of the catalytic nucleophile of the Family 31
alpha-glucosidase from Aspergillus niger via trapping of a 5-fluoroglycosyl-enzyme
intermediate. The Biochemical journal. 359:381-386.
Lenne, P.F., L. Wawrezinieck, F. Conchonaud, O. Wurtz, A. Boned, X.J. Guo, H. Rigneault, H.T. He, and
D. Marguet. 2006. Dynamic molecular confinement in the plasma membrane by
microdomains and the cytoskeleton meshwork. The EMBO journal. 25:3245-3256.
Levitt, M.D., and R.M. Donaldson. 1970. Use of respiratory hydrogen (H2) excretion to detect
carbohydrate malabsorption. The Journal of laboratory and clinical medicine. 75:937-945.
Lingwood, D., and K. Simons. 2010. Lipid rafts as a membrane-organizing principle. Science (New
York, N.Y.). 327:46-50.
Lipardi, C., L. Nitsch, and C. Zurzolo. 2000. Detergent-insoluble GPI-anchored proteins are apically
sorted in fischer rat thyroid cells, but interference with cholesterol or sphingolipids
differentially affects detergent insolubility and apical sorting. Mol Biol Cell. 11:531-542.
Lucke, T., M. Keiser, S. Illsinger, M.J. Lentze, H.Y. Naim, and A.M. Das. 2009. Congenital and putatively
acquired forms of sucrase-isomaltase deficiency in infancy: effects of sacrosidase therapy.
Journal of pediatric gastroenterology and nutrition. 49:485-487.
Martoglio, B., and B. Dobberstein. 1998. Signal sequences: more than just greasy peptides. Trends in
cell biology. 8:410-415.
Matter, K., W. Hunziker, and I. Mellman. 1992. Basolateral sorting of LDL receptor in MDCK cells: the
cytoplasmic domain contains two tyrosine-dependent targeting determinants. Cell. 71:741753.
McNair, A., E. Gudmand-Hoyer, S. Jarnum, and L. Orrild. 1972. Sucrose malabsorption in Greenland.
British medical journal. 2:19-21.
Mellman, I., and W.J. Nelson. 2008. Coordinated protein sorting, targeting and distribution in
polarized cells. Nature reviews. Molecular cell biology. 9:833-845.
Mostov, K., T. Su, and M. ter Beest. 2003. Polarized epithelial membrane traffic: conservation and
plasticity. Nat Cell Biol. 5:287-293.
Mothes, W., B. Jungnickel, J. Brunner, and T.A. Rapoport. 1998. Signal sequence recognition in
cotranslational translocation by protein components of the endoplasmic reticulum
membrane. J Cell Biol. 142:355-364.
26
Chapter 1: Introduction
Naim, H.Y., M. Heine, and K.P. Zimmer. 2012. Congenital sucrase-isomaltase deficiency:
heterogeneity of inheritance, trafficking, and function of an intestinal enzyme complex.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S13-20.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988a. Biosynthesis of the human sucrase-isomaltase
complex. Differential O-glycosylation of the sucrase subunit correlates with its position
within the enzyme complex. Journal of Biological Chemistry.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988b. Biosynthesis of the human sucrase-isomaltase
complex. Differential O-glycosylation of the sucrase subunit correlates with its position
within the enzyme complex. The Journal of biological chemistry. 263:7242-7253.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988c. Structure, biosynthesis, and glycosylation of human
small intestinal maltase-glucoamylase. The Journal of biological chemistry. 263:19709-19717.
Neurath, M.F. 2014. Cytokines in inflammatory bowel disease. Nature reviews. Immunology. 14:329342.
Nichols, B.L., S. Avery, P. Sen, D.M. Swallow, D. Hahn, and E. Sterchi. 2003. The maltase-glucoamylase
gene: common ancestry to sucrase-isomaltase with complementary starch digestion
activities. Proceedings of the National Academy of Sciences of the United States of America.
100:1432-1437.
O'Neill, R.A. 1996. Enzymatic release of oligosaccharides from glycoproteins for chromatographic and
electrophoretic analysis. Journal of chromatography. A. 720:201-215.
Ohtsubo, K., and J.D. Marth. 2006. Glycosylation in cellular mechanisms of health and disease. Cell.
126:855-867.
Overeem, A.W., C. Posovszky, E.H. Rings, B.N. Giepmans, and I.S.C. van. 2016. The role of enterocyte
defects in the pathogenesis of congenital diarrheal disorders. Disease models & mechanisms.
9:1-12.
Paladino, S., T. Pocard, M.A. Catino, and C. Zurzolo. 2006. GPI-anchored proteins are directly targeted
to the apical surface in fully polarized MDCK cells. J Cell Biol. 172:1023-1034.
Peterson, L.W., and D. Artis. 2014. Intestinal epithelial cells: regulators of barrier function and
immune homeostasis. Nature reviews. Immunology. 14:141-153.
Peterson, M.L., and R. Herber. 1967. Intestinal sucrase deficiency. Transactions of the Association of
American Physicians. 80:275-283.
Pralle, A., P. Keller, E.L. Florin, K. Simons, and J.K. Horber. 2000. Sphingolipid-cholesterol rafts diffuse
as small entities in the plasma membrane of mammalian cells. J Cell Biol. 148:997-1008.
Prior, I.A., R.G. Parton, and J.F. Hancock. 2003. Observing cell surface signaling domains using
electron microscopy. Science's STKE : signal transduction knowledge environment. 2003:Pl9.
Propsting, M.J., R. Jacob, and H.Y. Naim. 2003. A glutamine to proline exchange at amino acid residue
1098 in sucrase causes a temperature-sensitive arrest of sucrase-isomaltase in the
endoplasmic reticulum and cis-Golgi. The Journal of biological chemistry. 278:16310-16314.
Puntis, J.W., and V. Zamvar. 2015. Congenital sucrase-isomaltase deficiency: diagnostic challenges
and response to enzyme replacement therapy. Archives of disease in childhood. 100:869-871.
Quaroni, A., E. Gershon, and G. Semenza. 1974. Affinity labeling of the active sites in the sucraseisomaltase complex from small intestine. The Journal of biological chemistry. 249:6424-6433.
Quaroni, A., and G. Semenza. 1976. Partial amino acid sequences around the essential carboxylate in
the active sites of the intestinal sucrase-isomaltase complex. The Journal of biological
chemistry. 251:3250-3253.
Quezada-Calvillo, R., C.C. Robayo-Torres, Z. Ao, B.R. Hamaker, A. Quaroni, G.D. Brayer, E.E. Sterchi,
S.S. Baker, and B.L. Nichols. 2007. Luminal substrate "brake" on mucosal maltaseglucoamylase activity regulates total rate of starch digestion to glucose. Journal of pediatric
gastroenterology and nutrition. 45:32-43.
27
Chapter 1: Introduction
Rana, S.V., D.K. Bhasin, R. Katyal, and K. Singh. 2001. Comparison of duodenal and jejunal
disaccharidase levels in patients with non ulcer dyspepsia. Tropical gastroenterology : official
journal of the Digestive Diseases Foundation. 22:135-136.
Ritz, V., M. Alfalah, K.P. Zimmer, J. Schmitz, R. Jacob, and H.Y. Naim. 2003. Congenital sucraseisomaltase deficiency because of an accumulation of the mutant enzyme in the endoplasmic
reticulum. Gastroenterology. 125:1678-1685.
Robayo-Torres, C.C., A.R. Opekun, R. Quezada-Calvillo, X. Villa, E.O. Smith, M. Navarrete, S.S. Baker,
and B.L. Nichols. 2009. 13C-breath tests for sucrose digestion in congenital sucrase
isomaltase-deficient and sacrosidase-supplemented patients. Journal of pediatric
gastroenterology and nutrition. 48:412-418.
Robayo-Torres, C.C., R. Quezada-Calvillo, and B.L. Nichols. 2006. Disaccharide digestion: clinical and
molecular aspects. Clinical gastroenterology and hepatology : the official clinical practice
journal of the American Gastroenterological Association. 4:276-287.
Roth, Z., G. Yehezkel, and I. Khalaila. 2012. Identification and Quantification of Protein Glycosylation.
International Journal of Carbohydrate Chemistry. 2012:10.
Ruggiano, A., O. Foresti, and P. Carvalho. 2014. Quality control: ER-associated degradation: protein
quality control and beyond. J Cell Biol. 204:869-879.
Salim, S.Y., and J.D. Soderholm. 2011. Importance of disrupted intestinal barrier in inflammatory
bowel diseases. Inflammatory bowel diseases. 17:362-381.
Sander, P., M. Alfalah, M. Keiser, I. Korponay-Szabo, J.B. Kovacs, T. Leeb, and H.Y. Naim. 2006. Novel
mutations in the human sucrase-isomaltase gene (SI) that cause congenital carbohydrate
malabsorption. Human mutation. 27:119.
Sanz, Y., and G. De Palma. 2009. Gut microbiota and probiotics in modulation of epithelium and gutassociated lymphoid tissue function. International reviews of immunology. 28:397-413.
Sartor, R.B. 2008. Microbial influences in inflammatory bowel diseases. Gastroenterology. 134:577594.
Schuck, S., M. Honsho, K. Ekroos, A. Shevchenko, and K. Simons. 2003. Resistance of cell membranes
to different detergents. Proceedings of the National Academy of Sciences of the United States
of America. 100:5795-5800.
Schutz, G.J., G. Kada, V.P. Pastushenko, and H. Schindler. 2000. Properties of lipid microdomains in a
muscle cell membrane visualized by single molecule microscopy. The EMBO journal. 19:892901.
Scott, K.G., L.C. Yu, and A.G. Buret. 2004. Role of CD8+ and CD4+ T lymphocytes in jejunal mucosal
injury during murine giardiasis. Infection and immunity. 72:3536-3542.
Semenza, G., and S. Auricchio. 1989. The metabolic basis of inherited disease (II). Hill Inc., New York.
2975-2997.
Semenza, G., S. Auricchio, and A. Rubino. 1965. MULTIPLICITY OF HUMAN INTESTINAL
DISACCHARIDASES. I. CHROMATOGRAPHIC SEPARATION OF MALTASES AND OF TWO
LACTASES. Biochimica et biophysica acta. 96:487-497.
Sim, L., C. Willemsma, S. Mohan, H.Y. Naim, B.M. Pinto, and D.R. Rose. 2010. Structural basis for
substrate selectivity in human maltase-glucoamylase and sucrase-isomaltase N-terminal
domains. The Journal of biological chemistry. 285:17763-17770.
Simons, K., and E. Ikonen. 1997. Functional rafts in cell membranes. Nature. 387:569-572.
Skovbjerg, H. 1981. Immunoelectrophoretic studies on human small intestinal brush border proteins-the longitudinal distribution of peptidases and disaccharidases. Clinica chimica acta;
international journal of clinical chemistry. 112:205-212.
Skovbjerg, H., H. Sjostrom, and O. Noren. 1981. Purification and characterisation of amphiphilic
lactase/phlorizin hydrolase from human small intestine. European journal of biochemistry /
FEBS. 114:653-661.
28
Chapter 1: Introduction
Spodsberg, N., R. Jacob, M. Alfalah, K.P. Zimmer, and H.Y. Naim. 2001. Molecular basis of aberrant
apical protein transport in an intestinal enzyme disorder. The Journal of biological chemistry.
276:23506-23510.
Surma, M.A., C. Klose, and K. Simons. 2012. Lipid-dependent protein sorting at the trans-Golgi
network. Biochimica et biophysica acta. 1821:1059-1067.
Szul, T., and E. Sztul. 2011. COPII and COPI traffic at the ER-Golgi interface. Physiology (Bethesda,
Md.). 26:348-364.
Tan, S., H.T. Tan, and M.C. Chung. 2008. Membrane proteins and membrane proteomics. Proteomics.
8:3924-3932.
Tarentino, A.L., and T.H. Plummer, Jr. 1994. Enzymatic deglycosylation of asparagine-linked glycans:
purification, properties, and specificity of oligosaccharide-cleaving enzymes from
Flavobacterium meningosepticum. Methods in enzymology. 230:44-57.
Terrin, G., R. Tomaiuolo, A. Passariello, A. Elce, F. Amato, M. Di Costanzo, G. Castaldo, and R.B.
Canani. 2012. Congenital diarrheal disorders: an updated diagnostic approach. International
journal of molecular sciences. 13:4168-4185.
Treem, W.R. 1995. Congenital sucrase-isomaltase deficiency. Journal of pediatric gastroenterology
and nutrition. 21:1-14.
Treem, W.R. 1996. Clinical heterogeneity in congenital sucrase-isomaltase deficiency. J Pediatr.
128:727-729.
Treem, W.R. 2012. Clinical aspects and treatment of congenital sucrase-isomaltase deficiency.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S7-13.
Tsukita, S., M. Furuse, and M. Itoh. 2001. Multifunctional strands in tight junctions. Nature reviews.
Molecular cell biology. 2:285-293.
Uhrich, S., Z. Wu, J.Y. Huang, and C.R. Scott. 2012. Four mutations in the SI gene are responsible for
the majority of clinical symptoms of CSID. Journal of pediatric gastroenterology and nutrition.
55 Suppl 2:S34-35.
Vagin, O., J.A. Kraut, and G. Sachs. 2009. Role of N-glycosylation in trafficking of apical membrane
proteins in epithelia. American journal of physiology. Renal physiology. 296:F459-469.
Van den Steen, P., P.M. Rudd, R.A. Dwek, and G. Opdenakker. 1998. Concepts and principles of Olinked glycosylation. Critical reviews in biochemistry and molecular biology. 33:151-208.
van der Flier, L.G., and H. Clevers. 2009. Stem cells, self-renewal, and differentiation in the intestinal
epithelium. Annual review of physiology. 71:241-260.
Vereecke, L., R. Beyaert, and G. van Loo. 2011. Enterocyte death and intestinal barrier maintenance
in homeostasis and disease. Trends in molecular medicine. 17:584-593.
Vriezinga, S.L., J.J. Schweizer, F. Koning, and M.L. Mearin. 2015. Coeliac disease and gluten-related
disorders in childhood. Nature reviews. Gastroenterology & hepatology. 12:527-536.
Wahab, P.J., J.W. Meijer, and C.J. Mulder. 2002. Histologic follow-up of people with celiac disease on
a gluten-free diet: slow and incomplete recovery. American journal of clinical pathology.
118:459-463.
Walker W.A. 2008. Pediatric gastrointestinal disease. Fifth edn. Hamilton, Ontario: BC Decker.
Weijers, H.A., K.J. va de, D.A. Mossel, and W.K. Dicke. 1960. Diarrhoea caused by deficiency of sugarsplitting enzymes. Lancet (London, England). 2:296-297.
West, L.F., M.B. Davis, F.R. Green, R.H. Lindenbaum, and D.M. Swallow. 1988. Regional assignment of
the gene coding for human sucrase-isomaltase (SI) to chromosome 3q25-26. Annals of
human genetics. 52:57-61.
Wetzel, G., M. Heine, A. Rohwedder, and H.Y. Naim. 2009. Impact of glycosylation and detergentresistant membranes on the function of intestinal sucrase-isomaltase. Biol Chem. 390:545549.
29
Chapter 1: Introduction
Williams, D.B. 2006. Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic
reticulum. J Cell Sci. 119:615-623.
Withers, S. and Williams, S. 2014. "Glycoside Hydrolases" in CAZypedia, available at URL
www.cazypedia.org/index.php/Glycoside Hydrolases, accessed 15 June 2016.
Wujek, P., E. Kida, M. Walus, K.E. Wisniewski, and A.A. Golabek. 2004. N-glycosylation is crucial for
folding, trafficking, and stability of human tripeptidyl-peptidase I. The Journal of biological
chemistry. 279:12827-12839.
Yan, A., and W.J. Lennarz. 2005. Unraveling the mechanism of protein N-glycosylation. The Journal of
biological chemistry. 280:3121-3124.
Yeaman, C., A.H. Le Gall, A.N. Baldwin, L. Monlauzeur, A. Le Bivic, and E. Rodriguez-Boulan. 1997. The
O-glycosylated stalk domain is required for apical sorting of neurotrophin receptors in
polarized MDCK cells. J Cell Biol. 139:929-940.
Yu, L.C., J.T. Wang, S.C. Wie, ans Y.H. Ni. 2012. Host-microbial interactions and regulation of intestinal
epithelial barrier function: From physiology to pathology. World journal of gastrointestinal
pathophysiology. 3:27-43.
Zauner, G., R.P. Kozak, R.A. Gardner, D.L. Fernandes, A.M. Deelder, and M. Wuhrer. 2012. Protein Oglycosylation analysis. Biol Chem. 393:687-708.
Zhu, Z., and H. Desaire. 2015. Carbohydrates on Proteins: Site-Specific Glycosylation Analysis by Mass
Spectrometry. Annual review of analytical chemistry (Palo Alto, Calif.). 8:463-483.
30
Chapter 2
Molecular pathogenicity of novel sucraseisomaltase mutations found in congenital
sucrase-isomaltase deficiency patients
Birthe Gericke1§, Mahdi Amiri1§, C. Ronald Scott2 & Hassan Y. Naim1*
1
Department of Physiological Chemistry, University of Veterinary Medicine Hannover,
Germany, 2Department of Pediatrics, University of Washington, Seattle, WA 98195, USA
§
These authors contributed equally to this work
*Correspondence:
Hassan Y. Naim, Ph.D.
Department of Physiological Chemistry,
University of Veterinary Medicine Hannover
Short title: Molecular basis of genetic sucrase-isomaltase malfunction
Author contributions: BG and MA performed the experiments, interpreted results and
drafted the first version of the manuscript. CRS provided patients’ data and revised the
manuscript. HYN designed the study, planned experiments and interpreted results. All authors
read and approved the manuscript.
Was submitted to Cellular and Molecular Gastroenterology and Hepatology (CMGH) (with
the title: Congenital sucrase-isomaltase deficiency is a multifaceted disease with varying
degrees of severity).
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
ABSTRACT
BACKGROUND & AIMS: Chronic diarrhea and abdominal pain in humans can be caused by
carbohydrate malabsorption including congenital sucrase-isomaltase deficiency (CSID). CSID
is an autosomal recessively inherited disorder that is caused by mutations in the sucraseisomaltase (SI) gene. The diagnosis of congenital diarrheal disorders like CSID is difficult
due to unspecific symptoms and usually requires invasive biopsy sampling of the patient.
Sequencing of the SI gene coding region and molecular analysis of the resulting potentially
pathogenic SI protein variants may facilitate a diagnosis in future. The present study aimed to
categorize SI gene mutations based on their functional consequences.
METHODS: Complementary DNAs encoding 15 SI mutants were expressed in mammalian
COS-1 cells. The molecular pathogenicity of the resulting SI mutants was defined by
analyzing their biosynthesis, cellular localization, structure and enzymatic functions.
RESULTS: Three biosynthetic phenotypes for the novel SI mutations were identified. The
first biosynthetic phenotype was defined by mutants that are intracellularly transported in a
fashion similar to wild type SI and with normal, but varying, levels of enzymatic activity. The
second biosynthetic phenotype was defined by mutants with delayed maturation and
trafficking kinetics and reduced enzymatic activity. The third group of mutants is entirely
transport incompetent and functionally inactive.
CONCLUSIONS: CSID can be caused by mutations within the SI gene resulting in SI
proteins with varying functionality, reflected by three biosynthetic phenotypes in our study.
The present work provides a framework to understand the primary defect caused by genetic
alterations within SI on a cellular level. Molecular analysis of the SI protein can help to
predict potential disease-causing implications of a genetic mutation within SI.
KEYWORDS: Sucrase-isomaltase; carbohydrate malabsorption; genetic intestinal disorders;
protein trafficking.
32
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
INTRODUCTION
About 70% of the human population is affected by some form of carbohydrate
malabsorption (Heyman, 2006). Malabsorption of carbohydrates can result from genetic or
environmental factors that inhibit the catalytic activity of intestinal disaccharidases. Sucraseisomaltase (SI) (Naim et al., 1988b), maltase-glucoamylase (MGAM) (Naim et al., 1988d)
and lactase-phlorizin hydrolase (LPH) (Naim et al., 1987) are the prominent intestinal
disaccharidases, which contribute to the final step of carbohydrate breakdown. SI is
predominantly expressed at the apical membrane of enterocytes. The isomaltase subunit of SI
is the major enzyme for cleavage of branched α-1,6-linkages while the sucrase subunit of SI
mainly hydrolyses α-1,2-glucosidic bonds of sucrose.
Functionally, the combined units account for 60% to 80% of maltose digestion (Lin et
al., 2012; Nichols et al., 2002; Sim et al., 2010). The SI protein is translated, folded and Nglycosylated in the ER (SIh, ~210 kDa) and transported from the ER to the Golgi apparatus
where complex N- and O-glycosylation takes place. The mature protein (SIc, ~245 kDa) is
then transported via cholesterol- and sphingolipid-enriched membrane microdomains mainly
to the apical cell surface (Alfalah et al., 1999).
Genetic defects of SI can lead to congenital sucrase-isomaltase deficiency (CSID)
(Alfalah et al., 2009; Sander et al., 2006). Patients with this disorder show a substantial
reduction or absence of the sucrase and/or isomaltase activities linked to reduced digestive
capacity of the small intestine in general (Treem, 2012). The failure of digestion and impaired
absorption of maldigested carbohydrates triggers osmotic diarrhea. The patients may also
suffer from vomiting, flatulence or abdominal pain ranging from mild to severe (Treem, 1995;
Treem, 2012). Occasionally dehydration, failure to thrive, developmental retardation and
muscular hypotonia have been observed (Antonowicz et al., 1972; Treem, 1995). The
maldigestion of sugars can also affect the absorption of other nutrients and can influence the
hormonal regulation of the intestinal function (Layer et al., 1986; Treem, 1995). The chronic
malabsorption of carbohydrates can lead to malnutrition in CSID patients (Newton et al.,
1996). Common symptoms of CSID with other congenital diarrheal disorders like congenital
lactase deficiency (Mikko et al., 2005) and glucose-galactose malabsorption (Vallaeys et al.,
2013) or with secondary acquired intestinal disorders like inflammation and food allergies
(Hering et al., 2016; Samasca et al., 2011) complicate the diagnosis and therapy of CSID
(Terrin et al., 2012). A univocal diagnosis of CSID mostly requires invasive biopsy sampling
33
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
of the patients and subsequent analysis of disaccharidase activities and intestinal histology
(Treem, 1996; Treem, 2012).
Mutations in the coding region of the SI gene are the major cause of CSID (Hamaker et al.,
2012; Naim et al., 2012). Genetically altered SI protein may exhibit perturbations in
intracellular transport, polarized sorting and abnormal processing (Fransen et al., 1991; Jacob
et al., 2000b; Naim et al., 1988a).
Population studies have estimated the frequency of CSID as 0.2% of individuals of
European descents, 5% to 10% in indigenous Greenlanders and 3% to 7% of Inuits of Alaska
and Canada (Gudmand-Hoyer et al., 1987; Peterson and Herber, 1967; Treem, 1995; Uhrich
et al., 2012; Welsh et al., 1978). Four common mutations, p.G1073D, p.V577G, p.F1745C
and p.R1124X, are suggested to account for 83% of disease alleles in European descendants
diagnosed with CSID. Gene sequencing and molecular analysis in patients with suspected
CSID can help to identify pathogenic protein variants and aid to functionally categorize SI
mutations. This may facilitate a diagnosis and subsequent earlier treatment of CSID.
Some of the naturally occurring SI mutants have been previously identified and
characterized at the molecular level by our group (Alfalah et al., 2009; Keiser et al., 2006;
Propsting et al., 2003; Ritz et al., 2003).
In the present study we revealed the molecular pathogenesis in a selection of 15 novel
SI mutations from patients with confirmed biopsy diagnosis of CSID and defined three
biosynthetic phenotypes according to the molecular pathogenicity of the respective mutation.
The analyzed mutations also included the R1124X mutation, which is described as one of the
four most common mutations in European descendants. The in vitro pathogenicity was
determined based on the effect of the mutation on the SI functionality. Therefore we
expressed cDNAs, encoding the different SI mutants, in a COS-1 cell system and analyzed the
biosynthesis, structure and enzymatic activity of the SI protein variants.
MATERIALS AND METHODS
Materials and reagents
Tissue culture dishes were obtained from Sarstedt (Nuembrecht, Germany),
Dulbecco's Modified Eagle's Medium (DMEM), methionine-free DMEM, penicillin,
streptomycin, fetal calf serum, trypsin-EDTA for cell culture, protease inhibitors, DEAEdextran, protein A-sepharose, trypsin, and Triton X-100 were purchased from Sigma-Aldrich
34
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
(Deisenhofen, Germany). Acrylamide, TEMED, SDS, Tris, paraformaldehyde, Dithiothreitol
(DTT), polyvinyl difluoride (PVDF) membrane, ProLong Gold Antifade Reagent with DAPI,
as well as sucrose and isomaltose were purchased from Carl Roth GmbH (Karlsruhe,
Germany). [35S]-methionine (>1000 Ci/mmol) was obtained from PerkinElmer (Waltham,
Massachusetts). Glucose oxidase-peroxidase mono-reagent was obtained from Axiom GmbH
(Bürstadt, Germany). Restriction enzymes, molecular weight standards for SDS-PAGE, Isis
proofreading DNA polymerase and SuperSignalTM West Fermento maximum sensitivity
western blot chemiluminescence substrate were obtained from Thermo Fisher Scientific
GmbH (Schwerte, Germany). Endo-β-N-acetylglucosaminidase H (endo H) was acquired
from Roche Diagnostics (Mannheim, Germany). Lubrol WX was purchased from MP
Biomedicals (Eschwege, Germany). All other reagents were of superior analytic grade.
Immunochemical reagents
The monoclonal mouse anti-SI antibodies (mAb) hSI2, HBB1/691/79, HBB2/614/88,
HBB2/219/20, and HBB3/705/60 (Beaulieu et al., 1989; Hauri et al., 1985b) were kindly
provided by Dr. H.P. Hauri and Dr. E.E. Sterchi (Bern, Switzerland). To recognize all
conformations and glycoforms of the SI mutants a mixture of these antibodies was used for
immunoprecipitation. Anti-calnexin antibody produced in rabbit was obtained from SigmaAldrich Chemie GmbH (Munich, Germany). Secondary antibodies coupled to Alexa Fluor
dyes were obtained from Invitrogen (Karlsruhe, Germany) and horseradish peroxidase
conjugated secondary antibodies were from Thermo Fisher Scientific (Schwerte, Germany).
Recruitment of CSID patients and identification of mutations in the SI gene
A total of 31 probands with a confirmed biopsy diagnosis of CSID were recruited by
different attempts, including a letter to gastroenterologists, booth and literature at
gastroenterology meetings, package inserts in Sucraid boxes, and notices on patient listservs
by families participating in the study. All patients had bowel biopsies with normal lactase but
reduced or absent sucrase and/or isomaltase activities and a normal histology. DNA for
sequencing of the entire SI gene coding region was extracted from blood or saliva of the
patients. DNA sequencing was performed by Sanger dideoxy sequencing (Slatko et al., 2011)
using an ABI Prism 3130xl genetic analyzer (Applied Biosystems, Carlsbad, CA). The
35
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
sucrase-isomaltase exons and flanking introns were compared to the GeneBank number
NM_001041.3 to detect nucleotide alterations (Uhrich et al., 2012).
Construction of cDNA clones
SI mutations were generated by site-directed mutagenesis PCR using a full length
cDNA encoding SI in a pSG8 vector as template (Ouwendijk et al., 1996) and Isis
proofreading polymerase for the PCR amplification. Sequences of single strand
oligonucleotide pairs used for mutagenesis are presented in Table 2.1. For analytical digestion
of the resulting clones particular restriction sites were introduced or deleted in the vicinity of
the target site by silent mutations within in the oligonucleotide pairs. SI mutations were
finally validated by Sanger sequencing.
Cell culture, transient transfection and biosynthetic labeling
COS-1 cells were grown in 100-mm culture dishes and maintained in vitro by serial
passages at 37°C in a humidified atmosphere with 5% CO2. The cells were cultivated in
DMEM containing 1 g/L glucose, 10% fetal calf serum (v/v), 100 U/mL penicillin and 100
μg/mL streptomycin. Transient transfection of the cells was performed by the DEAE-dextran
method as described previously (Naim et al., 1991b). 48 hours after transfection the COS-1
cells were used for different analyses including biosynthetic labeling with [35S]-methionine as
described before (Jacob et al., 2002a).
Cell lysis and immunoprecipitation
Solubilization of the cells and immunoprecipitation of SI from the lysates has been
essentially performed as described previously (Jacob et al., 2000a; Naim et al., 1988b;
Spodsberg et al., 2001). For endoglycosydase studies, the immunoprecipitants were subjected
to endo-β-N-acetylglucosaminidase H (endo H) treatment as described before (Naim et al.,
1988b).
SDS-PAGE and protein detection
For unlabeled samples, cell lysates or immunoprecipitants were mixed with Laemmli
buffer and DTT, cooked 5 min at 95°C and resolved on 6% slab gels. After protein transfer to
the PVDF membrane, immune-detection of SI was performed by either HBB2/614/88
36
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
(recognizing the sucrase subunit) or HBB3/705/60 (recognizing the isomaltase subunit)
primary antibodies followed by HRP-conjugated secondary antibody incubation and washing
steps after each incubation. The corresponding bands were detected by a ChemiDoc XRS
System (Bio-Rad, Munich, Germany) after addition of chemiluminescent substrate. The
radioactive labeled samples were similarly resolved on SDS-PAGE, dried on filter papers,
exposed to phosphor plates and detected by a phosphor imager (Bio-Rad, Munich, Germany).
Isolation of detergent-resistant membrane microdomains
Transiently transfected COS-1 cells were solubilized at 4°C for 4 hours with 1%
Lubrol WX or Triton X-100 in 10 mM Tris buffer pH 8.0 with 150 mM NaCl. Lipid rafts
were isolated using sucrose discontinuous gradient as described before (Amiri and Naim,
2014). Fractions of 1 mL were collected from top and denoted 1 to 10. For SDS-PAGE
analysis, a part from fractions 1 to 3, 4 to 7 and 8 to 10 was pooled separately and the proteins
were extracted and precipitated using chloroform-methanol precipitation (Fic et al., 2010).
The protein pellet was dissolved in Laemmli buffer plus DTT, resolved on SDS-PAGE and
immunoblotted for SI, flotillin-2 and Rho A proteins.
Enzyme activity measurements
Immunoprecipitants of SI were washed with PBS containing 0.5% Triton X-100 and
incubated with either sucrose (150 mM) or isomaltose (30 mM) substrates for 1 hour at 37°C.
Activities were calculated based on the detection of the released glucose by adding glucose
oxidase-peroxidase mono-reagent and measuring of 492 nm absorbance with a microplate
reader. The activities were normalized to the protein amount in each sample, which was
detected by western blotting.
Confocal fluorescence microscopy
COS-1 cells were seeded on coverslips, transfected with SI constructs and fixed 48
hours post-transfection with 4% paraformaldehyde. The samples were prepared as described
before (Schmidt et al., 2013) using a combination of mouse anti-SI primary antibodies to
detect SI and rabbit anti-calnexin antibody as an ER marker. ProLong Gold Antifade Reagent
with DAPI was used to visualize the cell nucleus and for mounting of the coverslips. The
37
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
samples were examined by a Leica TCS SP5 confocal microscope with a HCPL APO 63×1.3
glycerol immersion objective.
Tryptic structural analysis
Transfected COS-1 cells were labeled for 6 hours with [35S]-methionine. Then SI was
immunoprecipitated, washed and treated with 500 BAEE units of trypsin for 1 hour at 37°C.
The reaction was stopped by the addition of Laemmli buffer plus DTT and cooking for 5 min
at 95°C. The samples were finally analysed by SDS-PAGE. For differential identification of
the bands corresponding to the sucrase or the isomaltase subunit, lysates of unlabeled cells
were similarly treated with trypsin and subjected to immunoblotting with either HBB2/614/88
or HBB3/705/60 antibodies to visualize sucrase or isomaltase derived fragments, respectively.
Bioinformatic and statistical analysis
Alignment of the SI sequences has been performed by PRofile ALIgNEment
(PRALINE) multiple sequence alignment application (Simossis and Heringa, 2005).
Immunoblot bands were quantified by the Quantity One 1-D Analysis Software (Bio-Rad
Laboratories GmbH). Data analysis was performed by Microsoft Excel and the indicated error
bars were calculated according to the standard error of the mean (SEM) from at least three
independent repeats. Results are expressed as means ± SEM of n≥3 independent experiments.
Statistical analysis was performed using paired Student t-test compared to a wild type control.
*p˂0.05; ** p˂0.01; ***p˂0.001.
RESULTS
Description of the SI mutations
The focus of this study was to define the molecular pathogenicity of 15 missense
mutations in the SI gene. Therefore the functional influence of the genetic defect on the
resulting SI protein variant was analyzed in vitro. The 15 mutations were among 56 different
abnormal alleles, which were identified by screening the entire SI gene coding region in 31
patients with confirmed small bowel biopsy diagnosis of CSID (Uhrich et al., 2012). The
biopsies from the patients revealed no histological changes and reduced or absent enzymatic
activities of isomaltase and sucrase (Uhrich et al., 2012). Most of the mutations were found to
be inherited in a compound heterozygous pattern (Table 2.2). Two of the cases R774G and
38
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
F875S were found in combination with a wild type allele, however it cannot be excluded, that
an intronic or another mutation was missed by sequencing. For the mutations Q307Y, F139Y
and S594P no ex vivo data are available. All amino acid exchanges targeted motifs of the SI
protein which are highly conserved among different species, indicating structural or
functional importance of these regions (Figure 2.1).
Biosynthetic studies reveal three trafficking-relevant classes of SI mutants
Investigation of the maturation of each individual SI variant from the mannose-rich
glycosylated SI precursor protein (SIh, ~210 kDa) to its complex N- and O-glycosylated
mature form (SIc, ~245 kDa) in transiently transfected COS-1 cells led to the identification of
three distinct biosynthetic phenotypes of the novel mutants. After 8 hours of biosynthetic
labeling 70% of the SI wild type protein was complex glycosylated and reached the Golgi
apparatus or the cell surface (Figure 2.2). SI variants grouped in the first biosynthetic
phenotype (W105C, F139Y, D536V, R774G and Q930R) mature in the cell at essentially
similar maturation rates to the wild type SI. A proportion of 50% to 70% of total SI is present
as the mature complex glycosylated protein after 8 hours of labeling (Figure 2.2). In two other
SI protein variants (Q307Y and C1531Y) the genetic alteration elicited a partial and delayed
maturation of SI with low amounts of complex glycosylated protein after 8 hours of labeling.
These SI variants were grouped in a second biosynthetic phenotype. A third biosynthetic
phenotype was caused by SI variants (S594P, L741P, F875S, W931R, R1544C and T1606I)
that do not traverse the Golgi and persist as mannose-rich glycosylated proteins concomitant
with their block in the early secretory pathway, most likely in the ER (Figure 2.2). The third
phenotype comprised also two stop codon mutations, R1124X and W931X. These mutations
resulted in truncated protein variants that revealed no sucrase subunit and respectively only a
small part of the isomaltase subunit (Figure 2.2). The R1124X variant was even not detectable
by all our monoclonal antibodies utilized under native conditions, indicating a severe
malfolding. Both SI variants are likely targeted to ER associated degradation.
The cellular localization of the SI mutants was found to be concomitant with the
biosynthetic labeling data representing three classes with (i) strong Golgi-like and cell surface
appearance of SI (ii) partial Golgi-like localization, and (iii) complete co-localization with
calnexin and ER arrest (Figure 2.3).
As shown in Figure 2.4, tryptic profiles of the SI mutant varied from a complete or
39
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
partial degradation to a wild type-like cleavage pattern. The results are summarized in Table
2.3. Notably, misfolding as represented by the level of sensitivity to trypsin has a direct
association with trafficking arrest in the ER and loss of function.
From the trans-Golgi network, the sorting of SI to the apical cell surface requires
association with membrane microdomains or, lipid rafts, as a trafficking platform (Alfalah et
al., 1999). We examined the association of the SI mutants with lipid microdomains to seek for
any correlation between the mutation and the biosynthetic phenotype in terms of the
trafficking and ultimately function. Figure 2.5 demonstrates that SI mutants that have
acquired complex glycosylation were associated to a large extent with the lipid rafts revealed
in the floating fractions of the sucrose gradients. Other mutants displayed substantially lower
levels or no incorporation into the lipid rafts (Figure 2.5). Here, flotillin-2 in fractions 1-3
serves as lipid raft marker (Sasaki et al., 2008) and Rho A in fractions 8-10 delineates the
non-raft fractions. We conclude that the lipid rafts association of SI variants correlate well
with their maturation pattern and constitute another criterion that describes the impact of a
particular mutation on the SI function.
Functional variations elicited by the mutations
The digestive capacities of the individual SI mutants were assessed in vitro and
correlated with the sucrase (SUC) and isomaltase (IM) ex vivo activities measured in small
bowel biopsies of CSID patients (Table 2.2). For this purpose, wild type SI or SI variants
were purified by immunoprecipitation from the transiently transfected COS-1 cells and the
SUC and IM specific activities were determined. Figure 2.6 demonstrates that mutants from
phenotype I and phenotype II showed reduced but varying enzymatic activities of SUC and
IM. Only two of the mutants from phenotype I, Q930R and R774G showed normal activities.
Nearly all transport incompetent mutants from phenotype III, S594P, L741P, F875S, W931R,
W931X and R1124X, were also enzymatically inactive. The two remaining mutants from
phenotype III, R1544C and T1606I, displayed isomaltase activity but cannot reach the cell
surface due to their trafficking defect to fulfil their functions (Figure 2.6). The loss of in vitro
function of phenotype III mutants was reflected by the enzymatic activities measured in small
bowel biopsies of the CSID patients (Table 2.2). Patients with inheritance of one mutation
from phenotype III on each allele also showed a complete loss of intestinal SI activities in
vivo. The combination of mutations from phenotype III with that of phenotype I or II in
40
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
patients led to reduced but varying activities matching to a certain extent with our in vitro data
(Table 2.2). The F875S and R774G mutations respectively, were found in a heterozygous
background of inheritance. However, another mutation on the second allele missed by
sequencing cannot be excluded.
Notably, our in vitro modelling revealed that mutations in one subunit can also
influence the activity of the other subunit most likely by imposing structural changes.
Interestingly, mutations in the IM affected activities in both subunits and that in SUC mostly
led to loss of the SUC activity, with preserved the IM activity.
The IM-located mutations, Q307Y and D536V, completely abolished the IM activity
and substantially reduced the SUC activity. The SUC mutations on the other hand C1531Y,
R1544C and T1606I were associated with complete reduction in SUC, while IM was either
not affected or its activity was only slightly reduced (Figure 2.6).
Moreover the detection of IM activity in some mannose-rich glycosylated transport
incompetent mutants suggests that complex N- and O- glycosylation of IM is required for
proper transport but not essentially for its enzyme activity. Nevertheless, the active enzyme
will not be available at the cell surface, which is required for disaccharide digestion in the
intestinal lumen.
DISCUSSION
In the present study we analyzed the pathobiochemistry of 15 naturally occurring
missense mutations in SI to define their cellular and molecular in vitro pathogenicity. This
study has unravelled a remarkable heterogeneity in the molecular pathogenesis of CSID
revealing the unique molecular etiologies of this multifaceted intestinal malabsorption
disorder. CSID belongs to a group of protein misfolding diseases that can be triggered by
improper folding like CFTR in cystic fibrosis and β-glucosidase in Gaucher disease (Du et al.,
2005; Piepoli et al., 2007; Qu et al., 1997; Ron and Horowitz, 2005), improper targeting and
localization like AAT deficiency (Lomas et al., 1992), dominant negative mutations like
Keratin in epidermolysis bullosa simplex (Werner et al., 2004) or accumulation of aggregated
proteins like amyloid accumulation (Glabe, 2001). Unlike many of the aforementioned
diseases, however, multiple mechanisms can elicit CSID rendering this intestinal disorder
unique among other protein folding diseases. In fact, mutations identified in patients of CSID
can be associated with severe biosynthetic defects of altered folding, aberrant trafficking,
41
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
missorting and even functional deficits in a correctly folded protein (Hauri et al., 1985a;
Jacob et al., 2000b; Keiser et al., 2006; Propsting et al., 2003; Ritz et al., 2003).
With the feasibility of exome sequencing in the recent years, mutations within SI can
be easily identified by screening of patients with suspected CSID. However, the identification
of a novel mutation by sequencing of the SI gene coding region allows no immediate
assumption concerning its potential effect on the expression or function of the SI protein
product. In regard to clinical consequences mutations can be benign or pathogenic. For
example, molecular analysis of the T231A and I1532M SI mutations in a previous study,
revealed that these mutations have no effect on the in vitro SI function and are most likely not
involved in the development of CSID (Ritz et al., 2003; Sander et al., 2006).
In vitro functional evaluation of the protein variants can help to predict the pathogenic
potential of a newly identified mutation and can reveal disease underlying mechanism. The
pathogenicity of a mutation can differ and may range from a complete loss of protein function
to a mild functional impairment of the mutated protein.
The molecular and cellular analyses of the 15 novel SI mutations have led to the
categorization of CSID into three major biosynthetic phenotypes (Figure 2.7) based on criteria
that comprised protein trafficking, enzyme function and lipid rafts association of the SI
protein.
The first biosynthetic phenotype is defined by SI mutations that likely cause the
mildest in vitro effect on the SI function and includes W105C, F139Y, D536V, R774G and
Q930R with comparable maturation rates to wild type SI. These mutants do not reveal gross
structural alterations and are trafficked along the secretory pathway relatively similar to the
wild type. However, the normal maturation is not always associated with normal activity
levels. In fact, while the Q930R and R774G variants are almost as active as wild type SI, the
remaining mutants of this category reveal reduced activities of down to 30% of the wild type
SI (Table 2.3). The second group includes Q307Y and C1531Y and is characterized by
delayed maturation and reduced digestive capability. The third biosynthetic phenotype
defined by our study includes the mutations L741P, S594P, R1544C, T1606I, F875S, W931R,
W931X, and R1124X, that result in a non-functional protein product due to cellular
mislocalization. The complete loss of function of mutations grouped into phenotype III
indicates a high molecular pathogenicity of these mutants. The major characteristics of the
mutants in this group are their intracellular block in the ER as immature mannose-rich
42
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
glycosylated forms as well as the functional deficits with complete loss of SUC and IM
activities. The residual enzymatic activities of a few mutants will not be made accessible to
the substrate in vivo due to the failure of these mutants to reach the cell surface.
The high molecular in vitro pathogenicity of phenotype III mutations was reflected by
the CSID patients’ SUC and IM activities from small bowel biopsies. The combined
inheritance of one phenotype III mutation on each individual allele led to a complete loss of
enzymatic SI activities in the patients’ bowel biopsies. The combined inheritance of a
mutation from phenotype III with a mutation from phenotype I or II caused varying but
reduced SUC and IM activities in the biopsy samples of the CSID patients reflecting the in
vitro data to a certain extent. The comparison of our molecular and genetic data to the severity
of CSID patients’ symptoms would help to resolve a possible correlation of the SI molecular
defect to the clinical in vivo presentation of CSID.
In previous studies a number of other SI variants were analyzed on a cellular and
molecular level. These mutants can be similarly categorized into the here defined biosynthetic
phenotypes (I-III). For example, the G1073D, V577G and F1745C mutations, with an
estimated frequency of 83% in patients of European descents (Alfalah et al., 2009; Uhrich et
al., 2012), can be assigned to phenotype III that includes mutations with the highest
pathogenic potential due to a complete loss of the in vitro SI function. The R1124X mutation,
with a similar frequency to the three before mentioned mutations (Uhrich et al., 2012), was
analyzed in the current study and also belongs to phenotype III.
Our classification system of the SI mutations by molecular analysis may facilitate a
primary evaluation of the pathogenicity of an SI variant, and may help in the differentiation of
CSID from other intestinal diseases.
The current study demonstrates that mutations in the SI gene coding region can have
mild to severe in vitro effects on the SI function. The molecular pathogenicity of the
mutations is reflected by the different biosynthetic phenotypes (I-III). A single variant can
affect multiple cellular processes, leading to the in vitro phenotypic variations.
The variation of the SI function in CSID patients is most likely attributed to the
genotype, including the pattern of inheritance but also environmental and patient specific
factors can influence the onset of CSID. Clinical symptoms of CSID may vary due to the
residual SI activities in the intestinal lumen, reflected by the biosynthetic phenotypes, but also
based on the quantity of ingested carbohydrates, or the rate of gastric emptying in patients.
43
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
The classification system of mutations identified by sequencing can be a useful
approach for CSID and other genetic disorders with difficulties in diagnosis. A related system
for classification of mutant protein variants is also applied for protein variants of the calcium
channel, cystic fibrosis transmembrane conductance regulator (CFTR), that elicit cystic
fibrosis, one of the most common and fatal genetic disorders in humans (De Boeck et al.,
2014; Derichs, 2013; Welsh and Smith, 1993). The use of sequencing techniques to identify
potentially disease-causing mutations in patients with diarrheal disorders combined with the
molecular analysis of mutated protein variants and functional classification of the most
frequent mutations for SI may help to differentiate pathogenic CSID cases from other
intestinal diseases with common symptoms in future.
In conclusion, the current data propose that the pathogenesis of CSID is a
multifactorial network of events that altogether elicit the wide heterogeneity in the overall
pattern of CSID. The classification of the mutants into three biosynthetic phenotypes provides
an explanation for the variations in the enzymatic activities and subsequently the underlying
pathomechanisms that may elicit severe, intermediate or mild symptoms in several cases of
CSID. The biosynthetic, trafficking, functional features as well as the lipid rafts association of
the individual mutants comprise most essential elements in the regulation of the carbohydrate
digestive capacity of the SI isoforms.
ACKNOWLEDGEMENTS
We thank Alexander Prokscha for technical assistance. This work was partially supported by
a grant from QOL Medical LLC, Vero Beach, Florida, USA and intramural funds of the
University of Veterinary Medicine Hannover, Germany.
44
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
References
Alfalah, M., R. Jacob, U. Preuss, K.P. Zimmer, H. Naim, and H.Y. Naim. 1999. O-linked glycans mediate
apical sorting of human intestinal sucrase-isomaltase through association with lipid rafts.
Current biology : CB. 9:593-596.
Alfalah, M., M. Keiser, T. Leeb, K.P. Zimmer, and H.Y. Naim. 2009. Compound heterozygous
mutations affect protein folding and function in patients with congenital sucrase-isomaltase
deficiency. Gastroenterology. 136:883-892.
Amiri, M., and H.Y. Naim. 2014. Long term differential consequences of miglustat therapy on
intestinal disaccharidases. J Inherit Metab Dis. 37:929-937.
Antonowicz, I., J.D. Lloyd-Still, K.T. Khaw, and H. Shwachman. 1972. Congenital sucrase-isomaltase
deficiency. Observations over a period of 6 years. Pediatrics. 49:847-853.
Beaulieu, J.F., B. Nichols, and A. Quaroni. 1989. Posttranslational regulation of sucrase-isomaltase
expression in intestinal crypt and villus cells. The Journal of biological chemistry. 264:2000020011.
Dahlqvist, A. 1984. Assay of intestinal disaccharidases. Scandinavian journal of clinical and laboratory
investigation. 44:169-172.
De Boeck, K., A. Zolin, H. Cuppens, H.V. Olesen, and L. Viviani. 2014. The relative frequency of CFTR
mutation classes in European patients with cystic fibrosis. Journal of cystic fibrosis : official
journal of the European Cystic Fibrosis Society. 13:403-409.
Derichs, N. 2013. Targeting a genetic defect: cystic fibrosis transmembrane conductance regulator
modulators in cystic fibrosis. European respiratory review : an official journal of the European
Respiratory Society. 22:58-65.
Du, K., M. Sharma, and G.L. Lukacs. 2005. The DeltaF508 cystic fibrosis mutation impairs domaindomain interactions and arrests post-translational folding of CFTR. Nature structural &
molecular biology. 12:17-25.
Fic, E., S. Kedracka-Krok, U. Jankowska, A. Pirog, and M. Dziedzicka-Wasylewska. 2010. Comparison of
protein precipitation methods for various rat brain structures prior to proteomic analysis.
Electrophoresis. 31:3573-3579.
Fransen, J.A., H.P. Hauri, L.A. Ginsel, and H.Y. Naim. 1991. Naturally occurring mutations in intestinal
sucrase-isomaltase provide evidence for the existence of an intracellular sorting signal in the
isomaltase subunit. J Cell Biol. 115:45-57.
Glabe, C. 2001. Intracellular mechanisms of amyloid accumulation and pathogenesis in Alzheimer's
disease. Journal of molecular neuroscience : MN. 17:137-145.
Gudmand-Hoyer, E., H.J. Fenger, P. Kern-Hansen, and P.R. Madsen. 1987. Sucrase deficiency in
Greenland. Incidence and genetic aspects. Scand J Gastroenterol. 22:24-28.
Gupta, S.K., S.K. Chong, and J.F. Fitzgerald. 1999. Disaccharidase activities in children: normal values
and comparison based on symptoms and histologic changes. Journal of pediatric
gastroenterology and nutrition. 28:246-251.
Hamaker, B.R., B.H. Lee, and R. Quezada-Calvillo. 2012. Starch digestion and patients with congenital
sucrase-isomaltase deficiency. Journal of pediatric gastroenterology and nutrition. 55 Suppl
2:S24-28.
Hauri, H.P., J. Roth, E.E. Sterchi, and M.J. Lentze. 1985a. Transport to cell surface of intestinal
sucrase-isomaltase is blocked in the Golgi apparatus in a patient with congenital sucraseisomaltase deficiency. Proceedings of the National Academy of Sciences. 82:4423-4427.
Hauri, H.P., E.E. Sterchi, D. Bienz, J.A. Fransen, and A. Marxer. 1985b. Expression and intracellular
transport of microvillus membrane hydrolases in human intestinal epithelial cells. The
Journal of Cell Biology. 101:838-851.
45
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Hering, N.A., A. Fromm, J. Kikhney, I.F. Lee, A. Moter, J.D. Schulzke, and R. Bucker. 2016. Yersinia
enterocolitica Affects Intestinal Barrier Function in the Colon. The Journal of infectious
diseases. 213:1157-1162.
Heyman, M.B. 2006. Lactose intolerance in infants, children, and adolescents. Pediatrics. 118:12791286.
Jacob, R., K. Peters, and H.Y. Naim. 2002. The prosequence of human lactase-phlorizin hydrolase
modulates the folding of the mature enzyme. The Journal of biological chemistry. 277:82178225.
Jacob, R., J.R. Weiner, S. Stadge, and H.Y. Naim. 2000a. Additional N-glycosylation and its impact on
the folding of intestinal lactase-phlorizin hydrolase. The Journal of biological chemistry.
275:10630-10637.
Jacob, R., K.P. Zimmer, J. Schmitz, and H.Y. Naim. 2000b. Congenital sucrase-isomaltase deficiency
arising from cleavage and secretion of a mutant form of the enzyme. The Journal of clinical
investigation. 106:281-287.
Keiser, M., M. Alfalah, M.J. Propsting, D. Castelletti, and H.Y. Naim. 2006. Altered folding, turnover,
and polarized sorting act in concert to define a novel pathomechanism of congenital sucraseisomaltase deficiency. The Journal of biological chemistry. 281:14393-14399.
Layer, P., A.R. Zinsmeister, and E.P. DiMagno. 1986. Effects of decreasing intraluminal amylase
activity on starch digestion and postprandial gastrointestinal function in humans.
Gastroenterology. 91:41-48.
Lin, A.H., B.R. Hamaker, and B.L. Nichols, Jr. 2012. Direct starch digestion by sucrase-isomaltase and
maltase-glucoamylase. Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S4345.
Lomas, D.A., D.L. Evans, J.T. Finch, and R.W. Carrell. 1992. The mechanism of Z alpha 1-antitrypsin
accumulation in the liver. Nature. 357:605-607.
Mikko, K., B. Ralf, R. Heli, M. Krzysztof, N. Mef, M. Susanne, L. Jan, and J. Irma. 2005. Lactase
persistence and ovarian carcinoma risk in Finland, Poland and Sweden. International Journal
of Cancer. 117:90-94.
Naim, H.Y., M. Heine, and K.P. Zimmer. 2012. Congenital sucrase-isomaltase deficiency:
heterogeneity of inheritance, trafficking, and function of an intestinal enzyme complex.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S13-20.
Naim, H.Y., S.W. Lacey, J.F. Sambrook, and M.J. Gething. 1991. Expression of a full-length cDNA
coding for human intestinal lactase-phlorizin hydrolase reveals an uncleaved, enzymatically
active, and transport-competent protein. The Journal of biological chemistry. 266:1231312320.
Naim, H.Y., J. Roth, E.E. Sterchi, M. Lentze, P. Milla, J. Schmitz, and H.P. Hauri. 1988a. Sucraseisomaltase deficiency in humans. Different mutations disrupt intracellular transport,
processing, and function of an intestinal brush border enzyme. The Journal of clinical
investigation. 82:667-679.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1987. Biosynthesis and maturation of lactase-phlorizin
hydrolase in the human small intestinal epithelial cells. Biochem. J.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988b. Biosynthesis of the human sucrase-isomaltase
complex. Differential O-glycosylation of the sucrase subunit correlates with its position
within the enzyme complex. Journal of Biological Chemistry.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988c. Structure, biosynthesis, and glycosylation of human
small intestinal maltase-glucoamylase. The Journal of biological chemistry. 263:19709-19717.
Newton, T., M.S. Murphy, and I.W. Booth. 1996. Glucose polymer as a cause of protracted diarrhea in
infants with unsuspected congenital sucrase-isomaltase deficiency. J Pediatr. 128:753-756.
46
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Nichols, B.L., S.E. Avery, W. Karnsakul, F. Jahoor, P. Sen, D.M. Swallow, U. Luginbuehl, D. Hahn, and
E.E. Sterchi. 2002. Congenital maltase-glucoamylase deficiency associated with lactase and
sucrase deficiencies. Journal of pediatric gastroenterology and nutrition. 35:573-579.
Ouwendijk, J., C.E. Moolenaar, W.J. Peters, C.P. Hollenberg, L.A. Ginsel, J.A. Fransen, and H.Y. Naim.
1996. Congenital sucrase-isomaltase deficiency. Identification of a glutamine to proline
substitution that leads to a transport block of sucrase-isomaltase in a pre-Golgi
compartment. Journal of Clinical Investigation. 97:633641.
Peterson, M.L., and R. Herber. 1967. Intestinal sucrase deficiency. Transactions of the Association of
American Physicians. 80:275-283.
Piepoli, A., E. Schirru, A. Mastrorilli, A. Gentile, R. Cotugno, M. Quitadamo, A. Merla, M. Congia, P.
Usai Satta, and F. Perri. 2007. Genotyping of the lactase-phlorizin hydrolase c/t-13910
polymorphism by means of a new rapid denaturing high-performance liquid
chromatography-based assay in healthy subjects and colorectal cancer patients. J Biomol
Screen. 12:733-739.
Propsting, M.J., R. Jacob, and H.Y. Naim. 2003. A glutamine to proline exchange at amino acid residue
1098 in sucrase causes a temperature-sensitive arrest of sucrase-isomaltase in the
endoplasmic reticulum and cis-Golgi. The Journal of biological chemistry. 278:16310-16314.
Qu, B.H., E.H. Strickland, and P.J. Thomas. 1997. Localization and suppression of a kinetic defect in
cystic fibrosis transmembrane conductance regulator folding. The Journal of biological
chemistry. 272:15739-15744.
Ritz, V., M. Alfalah, K.P. Zimmer, J. Schmitz, R. Jacob, and H.Y. Naim. 2003. Congenital sucraseisomaltase deficiency because of an accumulation of the mutant enzyme in the endoplasmic
reticulum. Gastroenterology. 125:1678-1685.
Ron, I., and M. Horowitz. 2005. ER retention and degradation as the molecular basis underlying
Gaucher disease heterogeneity. Human molecular genetics. 14:2387-2398.
Samasca, G., M. Bruchental, A. Butnariu, A. Pirvan, M. Andreica, V. Cristea, and D. Dejica. 2011.
Difficulties in Celiac Disease Diagnosis in Children - A case report. Maedica. 6:32-35.
Sander, P., M. Alfalah, M. Keiser, I. Korponay-Szabo, J.B. Kovacs, T. Leeb, and H.Y. Naim. 2006. Novel
mutations in the human sucrase-isomaltase gene (SI) that cause congenital carbohydrate
malabsorption. Human mutation. 27:119.
Sasaki, Y., Y. Oshima, R. Koyama, R. Maruyama, H. Akashi, H. Mita, M. Toyota, Y. Shinomura, K. Imai,
and T. Tokino. 2008. Identification of flotillin-2, a major protein on lipid rafts, as a novel
target of p53 family members. Molecular cancer research : MCR. 6:395-406.
Schmidt, S., G. Fracasso, M. Colombatti, and H.Y. Naim. 2013. Cloning and characterization of canine
prostate-specific membrane antigen. Prostate. 73:642-650.
Sim, L., C. Willemsma, S. Mohan, H.Y. Naim, B.M. Pinto, and D.R. Rose. 2010. Structural basis for
substrate selectivity in human maltase-glucoamylase and sucrase-isomaltase N-terminal
domains. The Journal of biological chemistry. 285:17763-17770.
Simossis, V.A., and J. Heringa. 2005. PRALINE: a multiple sequence alignment toolbox that integrates
homology-extended and secondary structure information. Nucleic acids research. 33:W289294.
Slatko, B.E., J. Kieleczawa, J. Ju, A.F. Gardner, C.L. Hendrickson, and F.M. Ausubel. 2011. "First
generation" automated DNA sequencing technology. Current protocols in molecular biology /
edited by Frederick M. Ausubel ... [et al.]. Chapter 7:Unit7.2.
Spodsberg, N., R. Jacob, M. Alfalah, K.P. Zimmer, and H.Y. Naim. 2001. Molecular basis of aberrant
apical protein transport in an intestinal enzyme disorder. The Journal of biological chemistry.
276:23506-23510.
Terrin, G., R. Tomaiuolo, A. Passariello, A. Elce, F. Amato, M. Di Costanzo, G. Castaldo, and R.B.
Canani. 2012. Congenital diarrheal disorders: an updated diagnostic approach. International
journal of molecular sciences. 13:4168-4185.
47
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Treem, W.R. 1995. Congenital sucrase-isomaltase deficiency. Journal of pediatric gastroenterology
and nutrition. 21:1-14.
Treem, W.R. 1996. Clinical heterogeneity in congenital sucrase-isomaltase deficiency. J Pediatr.
128:727-729.
Treem, W.R. 2012. Clinical aspects and treatment of congenital sucrase-isomaltase deficiency.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S7-13.
Uhrich, S., Z. Wu, J.Y. Huang, and C.R. Scott. 2012. Four mutations in the SI gene are responsible for
the majority of clinical symptoms of CSID. Journal of pediatric gastroenterology and nutrition.
55 Suppl 2:S34-35.
Vallaeys, L., S. Van Biervliet, G. De Bruyn, B. Loeys, A.S. Moring, E. Van Deynse, and L. Cornette. 2013.
Congenital glucose-galactose malabsorption: a novel deletion within the SLC5A1 gene.
European journal of pediatrics. 172:409-411.
Welsh, J.D., J.R. Poley, M. Bhatia, and D.E. Stevenson. 1978. Intestinal disaccharidase activities in
relation to age, race, and mucosal damage. Gastroenterology. 75:847-855.
Welsh, M.J., and A.E. Smith. 1993. Molecular mechanisms of CFTR chloride channel dysfunction in
cystic fibrosis. Cell. 73:1251-1254.
Werner, N.S., R. Windoffer, P. Strnad, C. Grund, R.E. Leube, and T.M. Magin. 2004. Epidermolysis
bullosa simplex-type mutations alter the dynamics of the keratin cytoskeleton and reveal a
contribution of actin to the transport of keratin subunits. Mol Biol Cell. 15:990-1002.
48
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Table 2.1 Sequence of the forward oligonucleotides used for mutagenesis PCR of SI wild type.
The reverse oligonucleotides have the reverse complementary sequence. The mutagenic base pair
codons are underlined and the corresponding amino acids are listed below.
SI
mutant
W105C
F139Y
Q307Y
D536V
S594P
L741P
R774G
F875S
Q930R
W931R
W931X
R1124X
C1531Y
R1544C
T1606I
Oligonucleotide sequences used for mutagenesis (5‘-3‘)
CGTGGAATGACTCTCTTATTCCTGTTGCTTCTTCGTTGATAATCATG
Cys
CCTTCACCTACACTATACGGAAATGATATCAACAGTGTTC
Tyr
GTTTTTTTAATGAATTCCAACGCAATGGAGATTTTTATCTATCCTACACCAATAGTAAC
Tyr
CACCGTTTACTCCTGATATCCTTGTCAAACTCATGTATTCCAA
Val
CTCAACATTTGCTGGTCCTGGTCGACATGCTGCTCATTGG
Pro
CTGAGTTTTTGTGGGGACCTGCATTACCTATTACTCCTGTTCTA
Pro
GAATCTGGTGCAAAAAGGCCTTGGGGGAAACAACGGGTTG
Gly
CAGGAAGGAACTACGCTAGCATCACAAACTGTAAAAATCCTT
Ser
GAAACTTTAGTGTTCGATGGAATCAGATCTTCTCAGAAAATG
Arg
GCAGATCTCAAGCTTAATCTCGGAAGAAACTTTAGTGTTCAACGGAATCAAATTT
Arg
CTTTAGTGTTCAATAGAATCAGATCTTCTCAGAAAATGA
Stop
GAACATACAGCATTTAAGTGATATCTGAACTGGAATAC
Stop
TGTTTGGAATGTCATATACTGGGCAGATATCTATGGTTTTTTCAACAACTC
Tyr
GAATATCATCTCTGTACCTGTTGATGCAGCTGGGAGCATTTTATCCA
Cys
CATGAAATTCATGCTAATGGTGGCATTGTTATCCG
Ile
49
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Table 2.2 Comparison of the activities of purified SI mutants versus their counterparts
in the patients’ intestinal biopsy specimens. The individual SI mutants were
immunoprecipitated and their activities towards sucrose and isomaltose were measured. These
activities are shown as a percentage of the SI wild type activities. Activities of SI in the biopsy
specimens were measured using sucrose and palatinose (instead of isomaltose) and are shown in units.
References for sucrase (35-131 U) and isomaltase (32-139 U) activities are according to Dahlqvist
(Dahlqvist, 1984), palatinose (3.8-41.54 U) activities are according to Gupta (Gupta et al., 1999).
L741P
F1745C
patient
R1124X
G1073D
patient
D536V
V577G
patient
W105C
W931X
patient
G1073D
C1531Y
patient
Q930R
R1544C
patient
W931R
T1606I
patient
F875S
WT
patient
R774G
WT
patient
Phenotype
Sucrase
III
III
5
0
0
0
0
0
58
0
0
30
0
2.61
0
7
5.9
80
3
15.3
0
19
0
5
100
0
88
100
14.7
III
III
I
III
I
III
III
II
I
III
III
III
III
I
Isomaltase/
palatinase
6
0
0
0
4
2
1
0
0
61
0
7.17
4
109
3.5
58
71
22.5
11
76
0
1
100
0
110
100
4
50
Biosynthetic
phenotype III
Biosynthetic
phenotype II
Biosynthetic
phenotype I
WT
isomaltase
isomaltase
sucrase
isomaltase
sucrase
sucrase
isomaltase
isomaltase
isomaltase
isomaltase
isomaltase
sucrase
R774G
D536V
C1531Y
Q307Y
T1606I
R1544C
S594P
W931R
L741P
F875S
W931X
R1124X
0
0
0
0
0
0
0
0
20
16
70
80
87
97
isomaltase
F139Y
isomaltase
96
trefoil 1
W105C
Q930R
100
Maturation
[%]
-
Domain of
mutation
-
SI mutation
0
0
1
6
11
4
71
76
2
109
1
110
98
66
61
100
Isomaltase
activity [%]
0
0
1
6
11
4
3
19
22
7
58
88
102
47
30
100
Sucrase activity
[%]
30
part. degraded
degraded
degraded
degraded
degraded
degraded
0
0
0
0
0.1
20
39
normal
42
normal
35
part. degraded
part. degraded
77
102
107
63
92
100
Lipid raft
association [%]
normal
normal
normal
normal
normal
normal
Tryptic cleavage
pattern
A categorization of the SI mutants into 3 biosynthetic phenotypes was performed according to the influence of the respective mutation on the SI
biochemical features and overall function.
Table 2.3 Overview of the biochemical and functional features of the single SI variants compared to the wild type.
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
51
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
A.
B.
Figure 2.1 The studied mutations target mainly highly conserved amino acid residues in
consensus motifs of SI. (A) Schematic presentation of the position of the mutations within the SI
molecule. CYT: cytosolic tail, TM: transmembrane domain, Trf1: trefoil 1. (B) Homology-extended
multiple sequence alignment of the primary structure of SI among different mammalian species for the
motifs containing the mutation site (dark arrow). The color spectrum represents the degree of amino
acid conservation in these motifs.
52
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Figure 2.2 Maturation rate of the SI protein variants compared to the wild type SI.
Detection of SI from transiently transfected COS-1 cells after biosynthetic labeling. The stop codon
variants W931X and R1124X were transiently expressed in COS-1 cells and detected by
immunoblotting. The W931X mutant could be only detected in western blots as an ER-located endo Hsensitive protein and the R1124X mutant was partially degraded in the cell and detectable only when
tagged with YFP at its N-terminus. SIh: immature mannose-rich form, SIc: mature complex N- and Oglycosylated form, n≥3.
53
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Figure 2.3 Intracellular localization of the SI variants. Confocal microscopic analysis of the SI
wild type and mutants expressed in COS-1 cells. SI (green) was visualized in combination with the cell
nucleus (blue) and endogenous calnexin (red) as an ER marker using indirect fluorescence. Scale bars:
25 µm, G: Golgi apparatus, N: nucleus.
54
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
A.
B.
Figure 2.4 Examination of the protein folding of the SI variants by trypsin treatment. (A)
After biosynthetic labeling and immunoprecipitation, the wild type and different variants of SI were
treated with 500 BAEE units trypsin for 1 hour. IMc/Succ: complex N- and O-glycosylated isomaltase
and sucrase subunits, IMh/Such: mannose-rich forms of the isomaltase and sucrase subunits. (B) The
single-band cleavage products of C1531Y, R1544C and T1606I SI variants were further characterized
using differential immunoblotting of the trypsinized unlabeled material with anti-isomaltase
(HBB3/705/60) or anti-sucrase (HBB2/614/88) monoclonal antibodies.
55
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
A.
B.
C.
Figure 2.5 Association of SI variants with cholesterol-enriched membrane microdomains
or lipid rafts. (A) Transiently transfected COS-1 cells were solubilized with 1% Lubrol WX
and lipid raft and non-raft fractions were separated using sucrose density gradients. Lipid raft
fractions (1-3) and non-raft fractions (4-7, 8-10) were pooled and analyzed by immunoblotting
with anti-SI antibodies. (B) Graphical presentation of the lipid raft enrichment factor of SI
mutants versus the wild type. The lipid raft associated protein amount of SI mutants was
normalized to that of the wild type SI. (C) Representative control immunoblot for the lipid raft
preparations illustrating the distribution of flotillin-2 which is mainly associated with lipid
rafts and Rho A as a non-raft marker.
56
Chapter 2: Molecular basis of genetic sucrase-isomaltase malfunction
Figure 2.6 Specific activities of the SI variants versus wild type SI. Wild type or mutants of
SI were immunoprecipitated from transfected COS-1 cells and assessed for sucrase and isomaltase
activities. The relative SI content of each sample was determined by immunoblotting. Relative specific
activities are recorded in comparison to wild type SI. SI mutants are grouped based on their similar
trafficking characteristics.
Figure 2.7 Classification of SI variants into three major biosynthetic phenotypes. In this
model SI mutants are classified based on their molecular and functional characteristics in vitro. For
expression of functional SI at the brush border membrane of the intestinal epithelium, the polypeptide
should be properly folded, complex N- and O-glycosylated along the secretory pathway and sorted to
the apical cell surface via association with cholesterol- and sphingolipid-enriched membrane
microdomains. The intracellular trafficking behaviour of the mutants within the enterocyte is depicted.
Representative radioactive micrographs show the maturation of SI. SIc: complex N- and Oglycosylated SI; SIh: mannose-rich immature form of SI.
57
Chapter 3
Modulation of sucrase-isomaltase enzymatic
activities by aspartic acid residues in the
catalytic sites
Birthe Gericke1§, Mahdi Amiri1§ & Hassan Y. Naim1*
1
Department of Physiological Chemistry, University of Veterinary Medicine Hannover,
Germany
*Correspondence:
Hassan Y. Naim, Ph.D.
Department of Physiological Chemistry,
University of Veterinary Medicine Hannover
Short title: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Author contributions: BG and MA performed the experiments, interpreted results and wrote
the manuscript. HYN designed the study and interpreted results. All authors read and
approved the manuscript.
In preparation for submission to Biochemica et Biophysica Acta (BBA)-General subjects.
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
ABSTRACT
BACKGROUND: Sucrase-isomaltase (SI) is an intestinal brush border membrane
glycoprotein with two functional subunits, which both belong to the glycoside hydrolase
family 31 (GH31). The SI subunits have different substrate specificities and differentially
contribute to digestion of dietary di- and oligosaccharides. All GH31 enzymes share a
common consensus sequence that harbors an aspartic acid residue as catalytic nucleophile. In
crystallographic structural analysis of the isomaltase subunit, another aspartic acid is
predicted to function as proton donor for the hydrolysis.
METHODS: The predicted proton donor residues as well as the nucleophilic catalyst residues
in each subunit of SI were separately substituted by site-directed mutagenesis PCR. The SI
variants were expressed in a COS-1 cell system and analyzed for their structural, transport
and functional characteristics.
RESULTS: The generated SI mutants were transport competent and functionally active in
their non-mutated subunit. Substitution of the predicted proton donor residues inactivates the
related subunit. The residual activity of each mutant represents the rate and the substrate
specificity for the single-active-subunit. The sum of maltase activity from sucrase and
isomaltase single-active-subunits separately is higher than that of the intact SI protein.
CONCLUSIONS: The predicted proton donor residues are confirmed to directly contribute to
the catalysis. Glucose is determined to slower the function of SI in a product inhibition
manner.
GENERAL SIGNIFICANCE: This study reports the kinetic features specific for each subunit
of SI as member of the GH31 family. Product inhibition is described as new mechanism for
the GH31 family member SI.
KEYWORDS: Glycoside hydrolase family 31, sucrase-isomaltase, product inhibition, starch
digestion
59
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
INTRODUCTION
Sucrase-isomaltase (SI; EC 3.2.1.48 and 3.2.1.10) is a glycoprotein anchored in the
intestinal brush border membrane (Hunziker et al., 1986; Naim et al., 1988c; Treem, 1995).
This enzyme catalyzes the final step of carbohydrate digestion by breaking disaccharides and
oligosaccharides to absorbable monosaccharides. Insufficiency of SI leads to carbohydrate
malabsorption with gastrointestinal symptoms (Cohen, 2016). For instance, the human
intestinal disorder congenital sucrase-isomaltase deficiency (CSID) is elicited by mutations in
the SI gene (Ouwendijk et al., 1996; Sander et al., 2006; Uhrich et al., 2012). Mutations
interfere with the physiological function of the SI protein by a direct effect on the enzymatic
activity and/or by influencing protein folding and/or trafficking (Alfalah et al., 2009; Naim et
al., 2012; Valentina et al., 2003; William, 2012). Moreover, other intestinal disorders like
inflammatory bowel disease (IBD) are associated with defects of SI, due to impairment of the
brush border membrane integrity (Amit-Romach et al., 2006).
SI belong to the glycoside hydrolases of family 31 (GH31) and is composed out of two
luminal catalytic subunits namely isomaltase and sucrase (Naim et al., 1988c). The GH31
family comprises enzymes present in each domain of life and include all eukaryotic αglucosidases, which cleave terminal carbohydrate moieties from substrates of different length
and of different glycosidic binding types (Ernst et al., 2006). Other examples of this group are
the endoplasmic reticulum glucosidase II (Trombetta et al., 1996), lysosomal α-glucosidase
(Trombetta et al., 2001) and intestinal maltase-glucoamylase (Nichols et al., 2003). Different
members of this group possess one or a combination of α-1,2, α-1,3, α-1,4 or α-1,6
glucosidase activities (Quezada-Calvillo et al., 2008; Song et al., 2013). Despite different
substrate specificity, all GH31 enzymes function via an acid/base catalyzed double
replacement mechanism, involving a glycosyl-enzyme intermediate (Lovering et al., 2005;
Okuyama, 2011). Retaining enzymes have typically two carboxylic acid residues surrounded
by consensus motifs. One residue is acting as catalytic nucleophile and the other one as proton
donor or acid/base catalyst (Lee et al., 2001; Okuyama et al., 2001). From active site-directed
inhibition or labeling studies aspartic acid (D) within the [GFY]-[LIVMF]-W-x-D-M-[NSA]E consensus motif of GH31 (PROSITE PS00129) is predicted to function as the catalytic
nucleophile (Hermans et al., 1991; Iwanami et al., 1995) .
The N-terminal located isomaltase subunit of SI is suggested to be the main digestive
enzyme responsible for cleaving α-1,6-linked saccharides including starch branches (Gray et
60
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
al., 1979; Quezada-Calvillo et al., 2008). The sucrase subunit at the C-terminal end of SI is
the major α-1,2-glucosidase of the intestinal lumen (Gray et al., 1979). Also 60%-80% of
maltose hydrolysis in the intestine is taken over by both of the SI subunits (Quezada-Calvillo
et al., 2007; Quezada-Calvillo et al., 2008), though the level of contribution for each subunit
to the α-1,4-glucosidase activity is not described yet.
Based on sequence similarities, Asp 505 in the isomaltase subunit and Asp 1394 in
sucrase subunit within the conserved motif of DGLWIDMNE constitute the catalytic
nucleophile residues in the active site (Quaroni and Semenza, 1976; Sim et al., 2010). By
resolving the crystal structure of the isomaltase subunit, Asp 604 in the HWLGDN motif was
predicted to be the proton donor in the active site cleft for the acid/base catalysis (Sim et al.,
2010). For the sucrase subunit the crystal structure is still not determined, however based on
sequence homologies Asp 1500 within the same conserved motif as of isomaltase is thought
to be the corresponding residue with proton donor function.
Both active sites of SI may share what is known to be the general function of this
protein. Functional characterization of single active sites in SI requires specific inactivation of
one of the subunits. High structural homology between the two active sites hinders application
of chemical inhibitors towards only one of them (Amiri and Naim, 2012). On the other hand
biochemical analyses have revealed complex domain-domain interactions within the SI
protein during folding and transport and thus generation and expression of separate single
subunits cannot fully reflect the native characteristics of the protein (Jacob et al., 2002b).
In this study we have used site directed mutagenesis to experimentally prove the
catalytic function of the two aspartic acid residues predicted to participate in the αglucosidase activity of the isomaltase or sucrase subunits with the focus on validating the
proton donor residue. The mutants also provided a model to study detailed characteristics of
each active site without the functional overlapping of the other subunit.
EXPERIMENTAL PROCEDURES
Materials and reagents
Tissue culture dishes were obtained from Sarstedt (Nümbrecht, Germany). Dulbecco's
modified Eagle medium (DMEM), penicillin, streptomycin, fetal calf serum (FCS), trypsinEDTA, protease inhibitors, DEAE-dextran and protein A sepharose were purchased from
Sigma-Aldrich GmbH (Deisenhofen, Germany). Acrylamide, Tetramethylethylendiamin
61
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
(TEMED), sodium dodecyl sulfate (SDS), Tris, dithiothreitol (DTT), polyvinyl difluoride
(PVDF) membranes, sucrose, palatinose and maltose were purchased from Carl Roth GmbH
(Karlsruhe, Germany). Glucose oxidase-peroxidase monoreagent (GO-PAD) was obtained
from Axiom GmbH (Bürstadt, Germany). Restriction enzymes, molecular weight standards
for SDS-PAGE, Isis proofreading DNA polymerase and SuperSignalTM West Fermento
maximum sensitivity western blot substrate were obtained from Thermo Scientific GmbH
(Schwerte, Germany). Endo-β-N-acetyl-glucosaminidase (endo H) was acquired from Roche
Diagnostics (Mannheim, Germany). All other reagents are of superior analytic grade.
Immunochemical reagents
The anti-SI monoclonal antibodies (mAb) produced from the hybridoma cell lines
HBB 1/691, HBB 2/614, HBB 2/219, HBB 3/705 and hSI2 were provided by Dr. Hans-Peter
Hauri (Biocenter, Basel, Switzerland) and Dr. Erwin Sterchi (University of Bern, Bern
Switzerland). A combination of these antibodies was used to detect different conformations
and glycoforms of sucrase-isomaltase wild type and mutant forms. Horseradish peroxidaseconjugated anti-mouse IgG was acquired from Thermo Fisher Scientific (Bonn, Germany).
Site-directed mutagenesis
Expression plasmids encoding sucrase-isomaltase with amino acid substitutions of
aspartic acid (Asp 604, Asp 505, Asp 1394 or Asp 1500) in its catalytic site motifs were
generated by site-directed mutagenesis. The PCR reaction was performed using Isis
proofreading polymerase and different complementary mutagenic primers (Table 3.1) using
pSG8-SI as template (Ouwendijk et al., 1996). PCR products were treated with DpnI
restriction enzyme to remove the methylated template, transformed into E.coli DH5α cells and
screened for the correct amino acid exchanges by DNA sequencing after plasmid preparation.
Cell culture and transient transfection
COS-1 cells were cultured in DMEM medium containing 1000 mg/L glucose
supplemented with 10% (v/v) FCS, 100 U/mL penicillin and 0.1 mg/mL streptomycin. The
cells were maintained at 37°C in humidified incubators with 5% CO2. Transfection with SI
constructs was performed by the DEAE-dextran method as described before (Naim et al.,
1991a). All experiments were performed 2 days after transfection.
62
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Cell lysis, immunoprecipitation, deglycosylation and tryptic structural analysis
Transfected COS-1 cells were solubilized in 25 mM Tris-HCl pH 8.0 containing 50 mM
NaCl, 0.5% Triton X-100 (v/v), 0.5% sodium deoxycholate and a protease inhibitor mixture
for 1 hour at 4°C. After removing the cell debris with cool centrifugation, lysates were
subjected to protein A sepharose beads pre-conjugated with a combination of monoclonal
anti-SI-antibodies and rocked for 1 hour at 4°C. The immunoprecipitants are washed
successively with wash buffer I (0.5% Triton X-100 and 0.05% deoxycholate in PBS) and
wash buffer II (125 mM Tris, 10 mM EDTA, 500 mM NaCl, 0.5% Triton X-100, pH 8.0)
each two times. Immunoprecipitants were treated with endo H for deglycosylation
experiments as described previously (Naim et al., 1987) or subjected to partial proteolysis
with 500 BAEE units of trypsin for 1 hour at 37°C to analyze the SI structure.
SDS-polyacrylamide gel electrophoresis and western blotting
Immunoprecipitated SI was cooked in Laemmli buffer containing 20-50 µM DTT for
5 min at 95°C, proteins were resolved on 6% polyacrylamide gels and transferred to a PVDF
membrane at 240 mA for 100 min. After blocking in 5% milk-PBS the membranes were used
for immunoblotting with primary antibodies either HBB2/705/60 detecting the isomaltase
subunit of SI or HBB/614/88 recognizing the sucrase subunit followed by incubation with
anti-mouse IgG antibody conjugated with horseradish peroxidase. Proteins were visualized
via enhanced chemiluminescent peroxidase substrate and documented with a ChemiDoc XRS
System (Bio-Rad, Munich, Germany). The band intensities were quantified by Quantity One
software.
Measurement of enzymatic activities
Immunoprecipitated SI was washed three times with PBS, pH 6.2 and incubated with
maltose (100 mM), sucrose (75 mM) or palatinose (100 mM) substrates for 1 hour at 37°C.
Activities were calculated based on liberated glucose determined by a glucose oxidaseperoxidase mono-reagent method with calorimetric measurement at 492 nm. Activities were
correlated to the SI protein amount of each sample, detected by western blotting. Relative
specific activities are reported in comparison to the wild type.
63
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
To study the effect of glucose on the kinetic parameters of SI, brush border preparation of the
human intestine was used as enzyme source. Michaelis-Menten kinetics were determined as
described before (Amiri and Naim, 2012) .
Statistical analysis
Statistical tests were performed using Microsoft Excel software. SI kinetic parameters
were calculated by the GraphPad Prism software based on the Michaelis-Menten method. The
data were analyzed by paired Student's t-test and presented as means ± SEM of values from at
least three independent experiments. NS, not significant; * p˂0.05, ** p˂0.01, *** p˂0.001.
RESULTS AND DISCUSSION
Generated active site mutants of SI are transport competent
The nucleophilic catalytic residue of human SI is located in the DGLWIDMNE
sequence, which is conserved in all members of the GH31 family of enzymes (Ernst et al.,
2006; Frandsen and Svensson, 1998; Quaroni and Semenza, 1976). By resolving the crystal
structure of the isomaltase subunit of SI, the Asp 604 residue in the HWLGDN sequence was
predicted to function as the proton donor for the acid-base catalysis (Sim et al., 2010). To
experimentally validate the contribution of this residue to the sugar hydrolysis, we
specifically exchanged it with amino acid residues that have similar or different
physicochemical characteristics as presented in Figure 3.1. The corresponding residue to this
position in the sucrase subunit, i.e. Asp 1500, was also determined based on sequence
similarities and subjected to similar amino acid exchanges. In parallel, an aspartic acid to
glutamic acid substitution for the two nucleophilic residues was also generated to serve as
controls for the active site manipulations.
The SI mutants were transiently expressed in COS-1 cells and analyzed with
immunoblotting. As shown in Figure 3.2, properly processed wild type SI appears mainly as a
complex N- and O- glycosylated (SIc) form at ~ 245 kDa. This form represents the mature and
functionally active SI which is found at Golgi to cell surface compartments. The minor band
of SI with a size of ~210 kDa is the immature mannose-rich from of SI (SIh) after processing
in the ER. All of the generated mutations illustrated a similar level and pattern of expression
to the wild type in immunoblots with a comparable ratio of SIc to SIh (Figure 3.2). These
results indicate a normal expression and trafficking rate for the mutants.
64
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Tryptic structural analysis is a known tool to investigate the folding of the SI protein
(Jacob et al., 2002b; Keiser et al., 2006). A single cleavage site for trypsin in properly folded
SI specifically splits the protein in between the sucrase and isomaltase subunit. Using
different antibodies against isomaltase (α-IM) or sucrase (α-SUC) subunits, we could
distinguish the subunits response to trypsin in immunoblots (Figure 3.3). The majority of the
mutants showed appropriate pattern of cleavage, suggesting proper folding of the polypeptide
despite the amino acid exchange. However, the folding of the isomaltase subunit in D505E,
D604N, D604S and D604Y variants as well as sucrase in D604N seems to be influenced by
the mutation, making them in part or totally susceptible to degradation by trypsin (Figure 3.3).
Meanwhile, as illustrated before for the maturation rate, the misfolding at this level has no or
very minor effects on the transport competence of the SI protein.
Active site mutants of SI reveal the catalytic specifications of each functional
subunit
After expression of mutants or wild type in COS-1 cells, the proteins were
immunoprecipitated and used for enzyme activity analyses. Here sucrose, maltose and
palatinose substrates were utilized to determine α-1,2, α-1,4 and α-1,6 hydrolytic activities
respectively. Figure 3.4 shows that in comparison to the wild type SI, all of the variations at
the potential proton donor residue for sucrase or isomaltase subunits result in a total loss of
enzyme activities for the target subunit. So that the mutations targeting the Asp 604 residue of
the isomaltase subunit result in an almost complete loss of α-1,6- and an reduction in the α1,4-glycosidic activities of the protein, but do not influence the sucrase activity negatively.
Similarly the mutations of the Asp 1500 residue in the sucrase subunit eliminate the sucrase
activity and decrease the maltase activity with no loss of palatinase activity (Figure 3.4). The
alterations in the enzymatic function by mutations of Asp 604 or Asp 1500 residues is
following the same pattern as the control mutations of Asp 505 or Asp 1394 respectively. This
evidence can confirm the role of the predicted proton donor residues in the enzyme catalysis.
As a common substrate for both subunits, the residual level of maltase activity in the mutants
is reflecting the specificity and rate of catalysis of the functionally active subunit for maltose.
Based on this measure, the sucrase subunit with about 80% of relative maltase activity has a
higher contribution to the total maltose digestion of SI in comparison to the isomaltase
subunit with around 50% relative activity. Interestingly, the sum of the maltase activity from
65
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
an average sucrase active and an average isomaltase active mutant will be higher than that of
the intact SI protein in the similar conditions. Also the hydrolysis of sucrose or isomaltose
substrate by their corresponding subunit seems to have a tendency to increase in the absence
of activity from the other subunit. To explain this phenomenon, we analyzed the possibility of
product inhibition in SI.
Glucose is the common product of all SI substrates. We used human intestinal brush
border membrane preparations to check for the possible alterations in the SI kinetic
parameters in the presence of glucose. For this purpose Michaelis-Menten kinetics were
determined using sucrose or isomaltose substrates from samples treated with glucose and
compared to the control. As presented in Figure 3.5, both sucrase and isomaltase activities are
subjected to a functional inhibition in the presence of 700 pM of glucose. Reduction in the
Vmax value combined with an increased KM value indicates a mixed type of inhibition of the
SI activity in the presence of glucose (i.e. a combination of competitive and uncompetitive
inhibitions). Competitive inhibition shows affinity of glucose to the active sites of SI, likely to
occur at high concentrations, and the uncompetitive inhibition renders an allosteric inhibition
of the enzyme-substrate complex by glucose in such a way that reduces the catalytic
efficiency. These inhibitory characteristics mimic the function of an iminosugar analog of
glucose named N-butyl deoxynojirimycin on the intestinal SI. Our group has previously
reported that this iminosugar can inhibit intestinal α-glucosidases including SI in a mixed
inhibitory manner (Amiri and Naim, 2012; Amiri and Naim, 2014). It can be postulated that
N-butyl deoxynojirimycin shares the same allosteric binding site on SI with glucose.
In the physiological context, product inhibition or negative feedback is a known
regulatory mechanism for many metabolic enzymes (Eggert et al., 2011; Liu et al., 1999). It is
likely that the inhibitory function of glucose on the SI activity is a regulatory mechanism in
the body to control excess release of glucose in the intestine and later in the blood.
CONCLUSION
We generated transport competent SI variants with single functional active site
properties by an exchange of predicted catalytic aspartic acid residues in the SI catalytic sites.
These variants allowed for the first time to study single catalytic site properties in a functional
SI in vitro. Including the control mutations of the nucleophilic catalysts (Asp 505 and Asp
1394), mutations of Asp 604 and Asp 1500 residues validated the predicted role for these
66
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
residues as catalytic proton donor in sugar hydrolysis in isomaltase and sucrase subunits
respectively. Moreover, our data demonstrated a higher rate of maltase activity in the singleactive-subunits of SI versus the intact protein, which was determined to result from product
inhibition. This so far undescribed product inhibition of SI with glucose presumably functions
as a control mechanism to regulated glucose release from carbohydrate digestion in the
intestine and balance the glycemic levels in the blood.
67
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
References
Alfalah, M., M. Keiser, T. Leeb, K.P. Zimmer, and H.Y. Naim. 2009. Compound heterozygous
mutations affect protein folding and function in patients with congenital sucrase-isomaltase
deficiency. Gastroenterology. 136:883-892.
Amiri, M., and H.Y. Naim. 2012. Miglustat-induced intestinal carbohydrate malabsorption is due to
the inhibition of alpha-glucosidases, but not beta-galactosidases. J Inherit Metab Dis. 35:949954.
Amiri, M., and H.Y. Naim. 2014. Long term differential consequences of miglustat therapy on
intestinal disaccharidases. J Inherit Metab Dis. 37:929-937.
Amit-Romach, E., R. Reifen, and Z. Uni. 2006. Mucosal function in rat jejunum and ileum is altered by
induction of colitis. International journal of molecular medicine. 18:721-727.
Cohen, S.A. 2016. The clinical consequences of sucrase-isomaltase deficiency. Molecular and cellular
pediatrics. 3:5.
Eggert, M.W., M.E. Byrne, and R.P. Chambers. 2011. Impact of high pyruvate concentration on
kinetics of rabbit muscle lactate dehydrogenase. Applied biochemistry and biotechnology.
165:676-686.
Ernst, H.A., L. Lo Leggio, M. Willemoes, G. Leonard, P. Blum, and S. Larsen. 2006. Structure of the
Sulfolobus solfataricus alpha-glucosidase: implications for domain conservation and
substrate recognition in GH31. Journal of molecular biology. 358:1106-1124.
Frandsen, T.P., and B. Svensson. 1998. Plant alpha-glucosidases of the glycoside hydrolase family 31.
Molecular properties, substrate specificity, reaction mechanism, and comparison with family
members of different origin. Plant molecular biology. 37:1-13.
Gray, G.M., B.C. Lally, and K.A. Conklin. 1979. Action of intestinal sucrase-isomaltase and its free
monomers on an alpha-limit dextrin. The Journal of biological chemistry. 254:6038-6043.
Hermans, M.M., M.A. Kroos, J. van Beeumen, B.A. Oostra, and A.J. Reuser. 1991. Human lysosomal
alpha-glucosidase. Characterization of the catalytic site. The Journal of biological chemistry.
266:13507-13512.
Hunziker, W., M. Spiess, G. Semenza, and H.F. Lodish. 1986. The sucrase-isomaltase complex: primary
structure, membrane-orientation, and evolution of a stalked, intrinsic brush border protein.
Cell. 46:227-234.
Iwanami, S., H. Matsui, A. Kimura, H. Ito, H. Mori, M. Honma, and S. Chiba. 1995. Chemical
modification and amino acid sequence of active site in sugar beet alpha-glucosidase.
Bioscience, biotechnology, and biochemistry. 59:459-463.
Jacob, R., B. Purschel, and H.Y. Naim. 2002. Sucrase is an intramolecular chaperone located at the Cterminal end of the sucrase-isomaltase enzyme complex. The Journal of biological chemistry.
277:32141-32148.
Keiser, M., M. Alfalah, M.J. Propsting, D. Castelletti, and H.Y. Naim. 2006. Altered folding, turnover,
and polarized sorting act in concert to define a novel pathomechanism of congenital sucraseisomaltase deficiency. The Journal of biological chemistry. 281:14393-14399.
Lee, S.S., S. He, and S.G. Withers. 2001. Identification of the catalytic nucleophile of the Family 31
alpha-glucosidase from Aspergillus niger via trapping of a 5-fluoroglycosyl-enzyme
intermediate. The Biochemical journal. 359:381-386.
Liu, X., C.S. Kim, F.T. Kurbanov, R.B. Honzatko, and H.J. Fromm. 1999. Dual mechanisms for glucose 6phosphate inhibition of human brain hexokinase. The Journal of biological chemistry.
274:31155-31159.
Lovering, A.L., S.S. Lee, Y.W. Kim, S.G. Withers, and N.C. Strynadka. 2005. Mechanistic and structural
analysis of a family 31 alpha-glycosidase and its glycosyl-enzyme intermediate. The Journal of
biological chemistry. 280:2105-2115.
68
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Naim, H.Y., M. Heine, and K.P. Zimmer. 2012. Congenital sucrase-isomaltase deficiency:
heterogeneity of inheritance, trafficking, and function of an intestinal enzyme complex.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S13-20.
Naim, H.Y., S.W. Lacey, J.F. Sambrook, and M.J. Gething. 1991. Expression of a full-length cDNA
coding for human intestinal lactase-phlorizin hydrolase reveals an uncleaved, enzymatically
active, and transport-competent protein. The Journal of biological chemistry. 266:1231312320.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1987. Biosynthesis and maturation of lactase-phlorizin
hydrolase in the human small intestinal epithelial cells. Biochem. J.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988. Biosynthesis of the human sucrase-isomaltase
complex. Differential O-glycosylation of the sucrase subunit correlates with its position
within the enzyme complex. The Journal of biological chemistry. 263:7242-7253.
Nichols, B.L., S. Avery, P. Sen, D.M. Swallow, D. Hahn, and E. Sterchi. 2003. The maltase-glucoamylase
gene: common ancestry to sucrase-isomaltase with complementary starch digestion
activities. Proceedings of the National Academy of Sciences of the United States of America.
100:1432-1437.
Okuyama, M. 2011. Function and structure studies of GH family 31 and 97 alpha-glycosidases.
Bioscience, biotechnology, and biochemistry. 75:2269-2277.
Okuyama, M., A. Okuno, N. Shimizu, H. Mori, A. Kimura, and S. Chiba. 2001. Carboxyl group of
residue Asp647 as possible proton donor in catalytic reaction of alpha-glucosidase from
Schizosaccharomyces pombe. European journal of biochemistry / FEBS. 268:2270-2280.
Ouwendijk, J., C.E. Moolenaar, W.J. Peters, C.P. Hollenberg, L.A. Ginsel, J.A. Fransen, and H.Y. Naim.
1996. Congenital sucrase-isomaltase deficiency. Identification of a glutamine to proline
substitution that leads to a transport block of sucrase-isomaltase in a pre-Golgi
compartment. Journal of Clinical Investigation. 97:633641.
Quaroni, A., and G. Semenza. 1976. Partial amino acid sequences around the essential carboxylate in
the active sites of the intestinal sucrase-isomaltase complex. The Journal of biological
chemistry. 251:3250-3253.
Quezada-Calvillo, R., C.C. Robayo-Torres, Z. Ao, B.R. Hamaker, A. Quaroni, G.D. Brayer, E.E. Sterchi,
S.S. Baker, and B.L. Nichols. 2007. Luminal substrate "brake" on mucosal maltaseglucoamylase activity regulates total rate of starch digestion to glucose. Journal of pediatric
gastroenterology and nutrition. 45:32-43.
Quezada-Calvillo, R., L. Sim, Z. Ao, B.R. Hamaker, A. Quaroni, G.D. Brayer, E.E. Sterchi, C.C. RobayoTorres, D.R. Rose, and B.L. Nichols. 2008. Luminal starch substrate "brake" on maltaseglucoamylase activity is located within the glucoamylase subunit. The Journal of nutrition.
138:685-692.
Sander, P., M. Alfalah, M. Keiser, I. Korponay-Szabo, J.B. Kovacs, T. Leeb, and H.Y. Naim. 2006. Novel
mutations in the human sucrase-isomaltase gene (SI) that cause congenital carbohydrate
malabsorption. Human mutation. 27:119.
Sim, L., C. Willemsma, S. Mohan, H.Y. Naim, B.M. Pinto, and D.R. Rose. 2010. Structural basis for
substrate selectivity in human maltase-glucoamylase and sucrase-isomaltase N-terminal
domains. The Journal of biological chemistry. 285:17763-17770.
Song, K.M., M. Okuyama, M. Nishimura, T. Tagami, H. Mori, and A. Kimura. 2013. Aromatic residue
on beta-->alpha loop 1 in the catalytic domain is important to the transglycosylation
specificity of glycoside hydrolase family 31 alpha-glucosidase. Bioscience, biotechnology, and
biochemistry. 77:1759-1765.
Treem, W.R. 1995. Congenital sucrase-isomaltase deficiency. Journal of pediatric gastroenterology
and nutrition. 21:1-14.
Trombetta, E.S., K.G. Fleming, and A. Helenius. 2001. Quaternary and domain structure of
glycoprotein processing glucosidase II. Biochemistry. 40:10717-10722.
69
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Trombetta, E.S., J.F. Simons, and A. Helenius. 1996. Endoplasmic reticulum glucosidase II is composed
of a catalytic subunit, conserved from yeast to mammals, and a tightly bound noncatalytic
HDEL-containing subunit. The Journal of biological chemistry. 271:27509-27516.
Uhrich, S., Z. Wu, J.Y. Huang, and C.R. Scott. 2012. Four mutations in the SI gene are responsible for
the majority of clinical symptoms of CSID. Journal of pediatric gastroenterology and nutrition.
55 Suppl 2:S34-35.
Valentina, R., A. Marwan, Z. Klaus-peter, S. Jacques, J. Ralf, and Y.N. Hassan. 2003. Congenital
sucrase-isomaltase deficiency because of an accumulation of the mutant enzyme in the
endoplasmic reticulum. Gastroenterology. 125:16781685.
William, R.T. 2012. Clinical aspects and treatment of congenital sucrase-isomaltase deficiency.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:13.
70
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Table 3.1 Oligonucleotide primers used in site-directed mutagenesis for generation of
aspartic acid SI variants. The mutagenic codons are underlined and the changed base(s) are
in bold.
Primer
DNA sequence of mutagenic primer (5´-3´)
D505E for
GACTTTGGATTGAGATGAATGAAGTCTCGAGCTTTATTCAAGGTTC
D505E rev
CTTGAATAAAGCTCGAGACTTCATTCATCTCAATCCAAAGTCCATC
D604E for
GGTTAGGAGAAAATACTGCTAGCTGGGAACAAATGG
D604E rev
ATTTGTTCCCAGCTAGCAGTATTTTCTCCTAACCAATGAG
D604N for
CTCATTGGTTAGGAAACAATACTGCTAGCTGGGAACAAATGGAATG
D604N rev
ATTTGTTCCCAGCTAGCAGTATTGTTTCCTAACCAATGAGCAG
D604S for
TTGGTTAGGAAGCAATACTGCTAGCTGGGAACAAATGG
D604S rev
ATTTGTTCCCAGCTAGCAGTATTGCTTCCTAACCAATGAG
D604Y for
GGTTAGGATACAATACTGCTAGCTGGGAACAAATGG
D604Y rev
ATTTGTTCCCAGCTAGCAGTATTGTATCCTAACCAATGAG
D1394E for
GTGGATTGAAATGAATGAGCCCTCGAGTTTTGTAAATGG
D1394E rev
TTACAAAACTCGAGGGCTCATTCATTTCAATCCACAAACC
D1500E for
GGCTTGGAGAGAACTATGCACGATG
D1500E rev
GCATAGTTCTCTCCAAGCCAGTGTCC
D1500N for
TGGCTTGGAAACAACTATGCACGATG
D1500N rev
GCATAGTTGTTTCCAAGCCAGTGTCCTC
D1500S for
CTGGCTTGGATCCAACTATGCACGATG
D1500S rev
TGCATAGTTGGATCCAAGCCAGTGTCC
D1500Y for
CTGGCTTGGATACAACTATGCACGATGG
D1500Y rev
GCATAGTTGTATCCAAGCCAGTGTCCTCC
71
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
A.
B.
Figure 3.1 Localization of analyzed aspartic acid residues within SI and overview of
generated mutants. (A) Schematic presentation of the SI protein. Positions of aspartic acid catalytic
residues are depicted by arrows and exchanged amino acid residues are listed. (B) Consistency
(Consist.) of sucrase and isomaltase sequences in the vicinity of their catalytic residues. Sequence
alignment of the SI subunits was performed by Profile ALIgNEment (PRALINE).
72
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
A.
B.
Figure 3.2 Trafficking of the SI catalytic site mutants compared to that of wild type SI.
(A) COS-1 cells transiently expressing either wild type or mutants of SI were lysed, SI was
immunoprecipitated and detected by immunoblotting after treatment with endoglycosidase H. (B) The
relative amount of SIc and SIh in the mutants as well as the wild type SI were calculated and graphically
presented. SIc: complex N- and O-glycosylated mature SI, SIh: mannose-rich immature form of SI.
73
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Figure 3.3 Tryptic structural analysis to determine the folding of SI catalytic site
variants. Immunoprecipitants of SI mutants or wild type prepared from transiently expressing COS-1
cells were subjected to trypsin, and detected by western blotting in comparison to the untreated
controls. Immunoblotting was either performed with the HBB3/705/60 antibody to detect the
isomaltase subunit (α-IM) or the HBB2/614/88 antibody to detect the sucrase subunit (α-SUC).
74
Chapter 3: Modulation of sucrase-isomaltase activities by catalytic aspartic acid residues
Figure 3.4 Sucrase, maltase and palatinase activities of SI mutants compared to the wild
type. The SI variants were immunoprecipitated from cell lysates of transiently expressing COS-1 cells
and assayed for their function in hydrolyzing sucrose, maltose or palatinose. Specific activities were
calculated based on the SI protein content in each sample detected by western blotting. The relative
specific activities of SI are presented versus the wild type as means ± SEM of at least four independent
experiments.
Figure 3.5 Glucose can inhibit the enzyme activity of the SI protein. Michealis-Menten
kinetics of the SI protein from brush border membrane preparations of the human small intestine were
determined using different concentrations of sucrose or isomaltose as substrate. Here the presence of
700 pM of glucose in the reaction was determined to partly inhibit the SI function.
75
Chapter 4
General Discussion
Chapter 4: Discussion
Dietary carbohydrates are main energy sources for the human body and most
importantly for the human brain (Benton et al., 2003). However, the use of dietary
carbohydrates as energy sources depends on their availability as basic building blocks, thus
requiring their cleavage into monosaccharides by specific enzymes. Sucrase-isomaltase (SI) is
one such enzyme found in the small intestinal brush border membrane that essentially
contributes to the final digestion of carbohydrates. The two catalytic subunits of SI are active
against linear α-1,4-linked starch digestion products such as maltooligosaccharides and
maltose (Quezada-Calvillo et al., 2008). The isomaltase subunit additionally hydrolyzes α-1,6
branching linkages of isomaltose and the sucrase subunit has a unique small intestinal activity
against α-1,2-linkages of sucrose (Gray et al., 1979). Although SI substantially contributes to
the cleavage of food carbohydrates and the release of monosaccharides, the mechanisms
behind this process are not completely resolved.
Defects of SI are associated with carbohydrate malabsorption and clinical symptoms
like diarrhea and abdominal pain (Cohen, 2016). This study focuses on the human
carbohydrate malabsorption disorder congenital sucrase-isomaltase deficiency (CSID), which
can be caused by SI gene mutations. The disease is clinically characterized by reduced to
absent activities of SI in the human small intestine (William, 2012). Different SI gene
mutations identified in CSID patients are implicated in the heterogeneous effects on the SI
protein function (Ouwendijk et al., 1996; Propsting et al., 2003; Sander et al., 2006). A
detailed understanding of the physiology and pathophysiology of carbohydrate digestion
processes with focus on SI and genetic SI deficiency may improve diagnostic and therapeutic
approaches for CSID. The current study aimed to expand the knowledge on carbohydrate
digestion by SI and on the cellular and molecular basis of CSID.
The specific aims of this thesis were to:
1.
Reveal potential molecular defects of the SI protein by novel naturally occurring SI
gene mutations.
2.
Categorize the novel naturally occurring SI mutations according to molecular
pathogenicity and disease-causing potential.
3.
Resolve the catalytic site specificities of SI and the mechanism of substrate catalysis
under physiological conditions.
77
Chapter 4: Discussion
4.1 Congenital sucrase-isomaltase deficiency and challenges in diagnosis
and therapy
Congenital sucrase-isomaltase deficiency (CSID) is an autosomal recessively inherited
disorder of the human intestine. The disease is associated with carbohydrate malabsorption
due to carbohydrate maldigestion. CSID is clinically characterized by an osmotic fermentative
diarrhea, cramps and abdominal pain upon ingestion of carbohydrates.
CSID belongs to a diverse group of intestinal enteropathies called congenital diarrheal
disorders (CDD), all of which share similar clinical symptoms, making a differential
diagnosis challenging (Terrin et al., 2012). These diseases are mostly rare, generally
autosomal recessively inherited and manifest early in life as chronic diarrhea and the
malabsorption of nutrients (Kuokkanen et al., 2006; Overeem et al., 2016; Vallaeys et al.,
2013). In addition to this group of inherited diseases, secondary disorders, for example those
caused by infections or food intolerances, can also be associated with diarrhea (Hering et al.,
2016; Samasca et al., 2011). A distinct diagnosis of congenital diarrheal intestinal disorders
mostly requires an invasive biopsy sampling of patients.
Despite common symptoms, the underlying pathological mechanism and defects of
congenital diarrheal disorders differ, and require targeted and adapted therapeutic strategies
for proper treatment. In most CDDs, the disease-causing gene is known and molecular and
cellular analysis of the resulting protein variants may contribute to a univocal diagnosis and
reveal new treatment options. Examples of CDDs are microvillus inclusion disease instigated
by defects of the MYO5B gene (Ruemmele et al., 2010; Schneeberger et al., 2015), cystic
fibrosis caused by mutations in the CFTR gene (Sheppard et al., 1993), glucose-galactose
malabsorption due to defects of the SLGT1 transporter (Lam et al., 1999) and defects of the
genes encoding intestinal disaccharidases like sucrase-isomaltase (SI) (Behrendt et al., 2009;
Jacob et al., 2000b; Sander et al., 2006).
Under physiological conditions, the α-1,2-, α-1,6- and α-1,4-glycosidic activities of the
SI protein extensively contribute to the final cleavage step of α-glycosidically linked
disaccharides and derivatives of starch during carbohydrate digestion in the intestinal lumen.
Genetic alterations of a single nucleotide in the SI gene, which encodes the brush border
enzyme SI, can result in a protein variant with an impaired function (Keiser et al., 2006;
Spodsberg et al., 2001). The symptoms of CSID are consequences of reduced or absent
activities of SI at the intestinal brush border membrane.
78
Chapter 4: Discussion
A number of mutations in the SI gene, that result in the translation of variant SI
proteins, have been reported in previous studies and were classified as disease-causing with
the use of biopsies and molecular analyses (Hauri et al., 1985a; Jacob et al., 2000b; Sander et
al., 2006; Valentina et al., 2003). Some of the identified variants so far were analyzed
biochemically at the molecular and cellular level and investigation of these SI variants
revealed defects in protein biosynthesis of the affected SI protein and diverse phenotype
classes I-VII (Naim et al., 2012). Some other mutations like, T231A and I1532M, have been
described to have no effect on the SI protein function and are assumed to be natural
polymorphism without a pathological effect (Ritz et al., 2003; Sander et al., 2006). With the
improvement of gene sequencing in the recent years, various novel mutations have been
identified. However, the pathogenic potential of these novel mutations based on their
influence on the SI protein function is not known or has not been analyzed so far on a
molecular basis.
CSID was initially considered as a rare orphan disease elicited by a single mutation
inherited from each parental allele. This led to the assumption that CSID is exclusively found
in families from consanguineous marriages (Jansen et al., 1965). This view was refuted by the
identification of the heterozygous or compound heterozygous trait of inheritance in CSID,
supporting the postulation that CSID is more common than initially thought (Alfalah et al.,
2009; Naim et al., 2012; Sander et al., 2006).
CSID is typically associated with a normal intestinal histology, reduced or absent
activities of sucrase and/or isomaltase and normal activities of the other brush border
membrane disaccharidases. A specific diagnosis of CSID mostly requires duodenal biopsy
sampling of the patient with analysis of disaccharidase activities and assessment of the
intestinal morphology (Robayo-Torres et al., 2009). The diagnosis of CSID could likely be
delayed or may be missed because the symptoms are falsely recognized as being related to
other before mentioned gastrointestinal disorders. When diagnosed, the current therapeutic
strategies to mitigate or resolve CSID symptoms are enzyme replacement therapy or a
sucrose- and/or starch-free diet (Puntis and Zamvar, 2015).
Genome sequencing techniques have improved in the recent years and have become
helpful in the identification of disease-causing mutations. Possibly in the near future, gene
sequencing will allow a rapid and early diagnosis, thus providing an alternative to repetitive
invasive biopsy sampling of patients with suspected CSID or with other intestinal disorders.
79
Chapter 4: Discussion
After identification of a mutation, basic research, including the molecular analysis and
functional studies of the resulting protein variants in a model system, allows us to define the
molecular pathogenicity of a mutation and clarify disease-causing mechanisms. The
classification of a number of mutants may help to define genotype-phenotype correlation and
open new targeted therapeutic options.
The current study identified the molecular pathogenesis of 15 novel naturally
occurring SI mutations in CSID patients including the exchange of an arginine to a chain
termination codon at position 1124, which is described as one of the four most common SI
variants in European descendants with CSID (Uhrich et al., 2012).
The 15 mutations, analyzed in this study, both on the cellular and the molecular level,
were identified among 56 abnormal SI alleles found in 31 probands with confirmed biopsy
diagnosis of CSID (Uhrich et al., 2012). The patients with normal histology of biopsy samples
and normal lactase, but deficient or reduced sucrase and/or isomaltase activities were
recruited by different attempts, including a letter to gastroenterologists or package inserts in
sucraid boxes (Uhrich et al., 2012). The patient’s DNA was isolated from saliva or blood
samples and genetic alterations were identified by Sanger sequencing of the whole SI coding
region (Uhrich et al., 2012).
Based on biochemical, molecular and cellular analysis within this study the novel SI
variants were classified into three biosynthetic phenotypes depending on the influence of the
genetic alteration on the SI function in an in vitro mammalian cellular model system. Mutants
classified into the first biosynthetic phenotype have only mild effects on the in vitro SI
function. Mutations classified into the second biosynthetic phenotype cause more severe
functional limitations of the SI protein. Finally, the third biosynthetic phenotype is associated
with a complete loss of SI function, and includes mutations with the most severe effect on the
SI protein. A summary of the data is discussed in the following chapter.
4.2 Biochemical analysis and phenotypic classification of novel SI variants
in a mammalian cell model
During CSID pathogenesis, the protein function of SI can be potentially affected by
impairment of different biosynthetic processing steps including (i) glycosylation/trafficking,
(ii) folding, (iii) lipid rafts association and (iv) enzymatic activity. All of these processes
primarily rely on information that is encoded in the amino acid sequence of the protein and
80
Chapter 4: Discussion
can be affected by genetic alterations eliciting single amino acid exchanges, such as in the
identified SI mutations.
The biosynthetic pathway for the 15 novel SI variants found in CSID was analyzed by
expression of the protein variants in a mammalian in vitro COS-1 cell system. COS-1 cells are
shown to be a good model system for ER to Golgi trafficking by previous studies and do not
endogenously express SI (Dahm et al., 2001; Keiser et al., 2006; Marc et al., 2009). The
analysis of the maturation of SI from a mannose-rich ER located precursor protein to a mature
complex glycosylated protein by biosynthetic labeling up to 8 hours, revealed three
trafficking relevant classes of SI mutants (Figure 4.1).
Figure 4.1 Classification model of the 15 novel SI variants into three in vitro biosynthetic
phenotypes, according to intracellular trafficking. For fulfillment of its function in cleaving
dietary carbohydrates in the intestinal lumen, SI needs to reach the cell surface. However, before its
delivery to the cell surface it has to undergo various cellular processes, including complex N- and Oglycosylation in the ER and Golgi apparatus, folding into its native conformation and the association
with lipid rafts as sorting platforms to the apical membrane. Impairment of these processes can
interfere with a normal trafficking and activity of the SI protein. SI variants grouped into biosynthetic
phenotype III were shown to be blocked in the ER, indicating that these variants do not have the ability
to carry out their physiological functions at the cell surface. Mutants of phenotypes I and II mature to
the complex glycosylated Golgi and cell surface SI but in a different rate. Maturation of mutations
from phenotype II is heavily retarded as indicated by the dashed arrow. BBM, brush border membrane;
ER, endoplasmatic reticulum.
81
Chapter 4: Discussion
Five out of the 15 analyzed SI variants (R774G, Q930R, W105C, F139Y, and D536V)
constituted a first trafficking relevant class with normal to slightly reduced maturation from
the mannose-rich to the complex protein after 8 hours of labeling. This result indicates normal
to slightly decelerated secretory trafficking from the ER to Golgi apparatus of these mutants.
Two other mutations (Q307Y and C1531Y) showed a greatly delayed maturation rate with
low amounts of the protein processed into the complex glycosylated form after the 8 hour
labeling period and were classified into a second group. A third trafficking class was
composed of eight SI variants (S549P, L741P, F875S, W931R, R1544C, T1606I, W931X and
R1124X), that showed no maturation of the mannose-rich precursor protein to the complex
glycosylated form after 8 hours of labeling, thus indicating a retention of the protein in the
ER. In the SI variants W931X and R1124X the introduction of a premature chain termination
codon lead to variants only consisting of the cytoplasmatic and transmembrane domains and a
small part of the isomaltase subunit respectively, which are likely degraded by the ER
associated degradation (ERAD) pathway. The localization of the 15 mutations within the SI
amino acid sequence is depicted in Figure 6.1.
Correct subcellular localization of proteins is crucial because it provides the
physiological context for their function. Since proteins regulate the vital cellular functions of
our body, aberrant localization of proteins such as enzymes or transporter proteins contribute
to the pathogenesis of many diseases. For example in the lysosomal storage disease,
Gaucher´s disease, the catabolic enzyme β-glucocerebrosidase is not properly targeted to the
lysosomes (Schmitz et al., 2005) or in cystic fibrosis, where the chloride channel CFTR,
which is normally apically located, is blocked intracellularly in epithelial cells (Cheng et al.,
1990). Similarly SI needs to reach the apical cell surface to access carbohydrates in the
intestinal lumen and perform its physiological function. Therefore, the ER retention of eight
of the newly analyzed SI variants is directly connected to a loss of function of these proteins.
The trafficking of the SI mutants was additionally assessed in a second approach by
detection of the cellular localization of the mutants using fluorescence microscopy and ER
staining using calnexin as a marker protein. The cellular localization of the SI mutants was
consistent with the labeling data representing three phenotypes (i) with strong Golgi-like and
cell surface localization of SI, (ii) with partial Golgi-like localization and (iii) complete
colocalization with calnexin, indicating an blockage in the ER.
As shown in other molecular studies of protein trafficking diseases, trafficking defects
82
Chapter 4: Discussion
can be caused by change in the native protein conformation leading to the intracellular
blockage, accumulation or degradation of proteins (Du and Lukacs, 2009; Perlmutter et al.,
2007; Ron and Horowitz, 2005; Schlehe et al., 2008). Structural changes can besides the
trafficking also affect the enzymatic activity of proteins. The trafficking competent SI variants
grouped together in phenotype I could potentially fulfill their function at the cell surface but
only if enzymatically active.
As mentioned earlier, a second cellular process that might be impaired in CSID is
protein folding. Therefore, the influence of the different genetic alterations within SI on the
protein folding and activity was assessed in two approaches: by tryptic digestions of the SI
mutant proteins and activity measurements of both protein subunits with isomaltose and
sucrose substrates. These experiments revealed aberrant folding patterns and reduced
enzymatic activities especially for mutants grouped in phenotypes II and III.
All mutants of the first biosynthetic phenotype showed normal tryptic cleavage and
folding patterns as well as normal to reduced, but no absent, enzymatic activities. Thus,
mutants grouped in this first biosynthetic phenotype have only a mild in vitro effect on the SI
function. Partially transported mutants, grouped in phenotype II, displayed reduced activities
and thereby exert a more severe impact on the SI functionality. As for most mutants in
phenotype III, genetic defects rendered them completely inactive, with the exception of,
T1606I and R1544C, variants that displayed high activities of isomaltase that was not
accessible at the cell surface due to trafficking defects. As shown by this data, mutations
grouped in the third biosynthetic phenotype are associated with a complete loss of function of
the SI protein. The trafficking defects of class III mutants can be explained by partial or
complete misfolding.
Furthermore, this study showed that mutations in one functional SI subunit can also
influence the activity of the other subunit. Among the analyzed variants, mutations within the
isomaltase specially affected the activity of both subunits. The mutations T1606I, R1544C
and C1531Y that target the sucrase subunit, lead to improper folding and a drastically
decreased activity of this subunit, but did not affect the isomaltase folding or activity. A
similar pattern was also shown in a previous study, including two mutations of the sucrase
subunit, C1229Y and F1745C (Alfalah et al., 2009). Both protein variants had isomaltase but
no sucrase activities. The sucrase subunit was misfolded, while the isomaltase was intact.
Thus, in the analyzed protein variants structural integrity of the isomaltase was shown to be
83
Chapter 4: Discussion
important for sucrase activity but not forcibly the other way around.
Another biochemical aspect that may contribute to SI defects is association with lipid
rafts. Previous studies have shown that SI as well as other integral membrane proteins, such
as the prostate-specific membrane antigen (PSMA) (Alfalah et al., 1999; Castelletti et al.,
2008), was transported via lipid rafts as sorting platforms to the apical cell surface. Moreover,
the lipid raft association of SI was shown to increase its enzymatic activities (Wetzel et al.,
2009). Our study showed a causative correlation between the SI activities, trafficking and
lipid raft association of SI variants, supporting these assumptions. While transport competent
and enzymatically active SI variants of the first biosynthetic phenotype showed similar lipid
raft associations to the wild type SI, the ER arrested and mostly inactive mutations of the
biosynthetic phenotype III showed only low or no enrichment in lipid rafts.
Conclusively, this study demonstrated that multiple cellular processes can be affected
by a single mutation within the SI gene, producing a mutant protein that exerts different
degrees of functionalities, depending on the type and position of the mutation. Diverse effects
of the mutations on the protein biogenesis, including the glycosylation and trafficking, the
folding, enzymatic activity and lipid rafts association of SI cause phenotypic variations. This
may, to a certain extent and after consideration of other factors, like the patient-specific
intestinal physiology, explain variations in disease severity and CSID symptoms, which are
described as ranging from mild to severe (Treem, 1996; Treem, 2012; William, 2012). The
findings of this study have resulted in a model (Figure 4.1) that elucidates the molecular basis
of SI defects in the context of CSID, and is represented by the three in vitro biosynthetic
phenotypes. This classification may provide a useful framework for understanding the
primary defect of SI on a molecular and cellular level.
84
Chapter 4: Discussion
Figure 4.2 Overview of intracellular localization, maturation and enzyme activities of the
15 novel human SI variants and their localization within the SI protein. The 15 novel SI
variants were classified according to their molecular in vitro pathogenicity defined by their effects on
intracellular SI trafficking and enzymatic activity. The biosynthetic labeling images are representative
for the maturation of the SI protein variants from the ER located mannose-rich SI protein (SIh) to the
complex glycosylated Golgi and cell surface form of the SI protein (SIc).
4.3 Modification of protein localization in human disease as therapeutic
option for CSID
Our analysis showed that the 15 novel mutations in SI cause pathological conditions
by interfering with correct cellular localization and biological activity of the enzyme. Both
processes, protein trafficking and enzyme activity, are associated with proper protein folding.
Depending on the particular mutation, the cellular processing of the mutant protein variant is
affected to a different degree and this diversity of cellular and molecular effects caused by
aberrant protein variants can be used for therapeutic targets. In the past years, considerable
efforts have been made to develop reliable methods to predict the effect of mutations on the
subcellular localization of disease-related proteins (Emanuelsson et al., 2007; Hung and Link,
85
Chapter 4: Discussion
2011; Ron and Horowitz, 2005; Zhang et al., 2005). The modification of disease-related
subcellular mislocalization of proteins has enormous potential for therapeutic interventions in
various diseases. Besides CSID, protein misfolding is linked to a large number of other
diseases like Gaucher’s disease, Fabry disease, Cystic fibrosis and also Alzheimer’s or
Parkinson’s disease (Cheung and Deber, 2008; Forloni et al., 2002; Garman and Garboczi,
2002). These protein misfolding or conformational diseases are mostly caused by mutations in
the gene encoding the disease-causing protein (Du et al., 2005; Garman and Garboczi, 2002;
Yang et al., 2015). Other causes of protein misfolding include aging and changes in the
cellular environment, such as changes in the pH, changes in the temperature or oxidative
stress, hypoxia and inflammation (Kikis et al., 2010; van der Kamp and Daggett, 2010;
Zeitouni et al., 2016). Generally protein misfolding diseases can be classified into (i) gain of
protein function or (ii) loss of protein function diseases (Herczenik and Gebbink, 2008). For
instance, the loss of protein function occurs if misfolding results in a protein that fails to
achieve its native conformation and/or in a protein that cannot reach its cellular site of action,
similar to SI variants classified into biosynthetic phenotype III. As also supported by the
recent study, many disease-causing mutations disrupt the native conformation but not the
complete biological activity of the affected polypeptide. Despite having partial biological
activity, these mutant proteins, such as the SI variants C1531Y, T1606I, R1544C or Q307Y
analyzed in this study, are not or only in a reduced rate delivered to their correct cellular
destinations.
Therapeutic strategies to regain or improve the physiological function involve the
restoration of protein folding and thereby the physiological protein location and function. In
recent years, in vitro and in vivo studies demonstrated that small molecule compounds that
stimulate a correct folding of mutant proteins or that stabilize their native conformation can
slow, arrest or revert disease progression (Alfonso et al., 2005; Burrows et al., 2000; Forloni
et al., 2002; Lin et al., 2004). In analogy to cellular chaperone proteins, the small molecule
compounds have been named pharmacological and chemical chaperones. Chaperone therapy
may be an additional treatment strategy for CSID in the future, especially for patients with
underlying genetic defects classified here into the biosynthetic phenotypes II and III. More
research is needed to find or develop suitable chemical or pharmacological chaperones as a
treatment option for CSID. Potential chaperones can be identified by quantitative highthroughput screening (qHTS) of a structurally diverse library of different compounds and
86
Chapter 4: Discussion
preclinical validation in cell culture systems (Inglese et al., 2006; Zheng et al., 2007). SI
mutants with delayed or abolished trafficking but a remaining biological activity such as
C1531Y, T1606I, R1544C and Q307Y, would be ideal candidates to test chaperone function.
Furthermore, F1745C, one of the four most common mutations in European descendants with
CSID (Uhrich et al., 2012), which was analyzed in another study, displays isomaltase activity
but is blocked in the ER (Alfalah et al., 2009) and would be another good candidate to test
chaperone therapy.
4.4 CSID is a multifactorial disease
Our data from in vitro molecular and cellular analysis, in combination with sequencing
data and SI activities measured in patients’ biopsies underline the fact that CSID is a
multifactorial disease, in which different factors can influence the etiology.
This study categorized the mutations within SI using different criteria, including the
impairment of trafficking and activity, into three biosynthetic phenotypes according to the
degree of their in vitro functional consequences. The expression of cDNAs encoding SI
variants from phenotype III in an in vitro COS-1 cell model, lead to non-functional protein
products as revealed by biochemical analysis. This indicates a high molecular pathogenicity
of these mutants.
As shown by sequence analysis of the patients’ DNA, nearly all mutations were found
in a compound heterozygous background of inheritance, underlining that not only the effect of
a single variant on the SI function but also the combination of different mutations has
implications in the onset of CSID. The comparison of molecular and cellular data to the
patients’ data showed that the highly pathogenic in vitro effect of mutations grouped into
biosynthetic phenotype III matched the in vivo SI activities from patients’ biopsies. The
compound heterozygous inheritance of one mutation, belonging to the third biosynthetic
phenotype, on each allele lead to a complete loss of enzymatic activities in the patient as
shown by biopsy sampling and enzyme measurements. This data suggests that mutations from
biosynthetic phenotype III generate null alleles, leading to the expression of a non-functional
SI gene product. The combined inheritance of mutations from biosynthetic phenotype III with
mutations from phenotype I or II lead to a reduction of SI activities to different levels
mirroring varying in vitro activity levels to certain extent. These results suggest that mutations
of biosynthetic phenotype I or II represent hypomorphic alleles that reduce but don’t
87
Chapter 4: Discussion
eliminate the SI gene function. A comparison with the patient’s symptoms severity and
analysis of a higher number of patients would be important for further conclusions in future
studies. The comparison of our molecular and genetic data to the severity of CSID patients’
symptoms would help to resolve a possible correlation of the SI molecular defect to the
clinical in vivo presentation of CSID. This study highlights that the onset of CSID not only
depends on the single mutation per se but also on the trait of inheritance and combination of
mutations.
Two of the analyzed mutations, R774G and F875S, were found in a true heterozygous
background by sequencing analysis. That CSID can be elicited by only one mutation on a
single allele was already suggested by Sander and colleagues by the study of 11 Hungarian
patients (Sander et al., 2006). However it cannot be excluded, that for instance, a large
deletion in the wild type allele was missed by sequencing. The patient with the heterozygote
F875S mutation expressed no in vitro enzymatic activities in biopsy samples. This might be
explained by different reasons including (i) alteration of the second allele, which was missed
by sequencing, (ii) haploinsufficiency of the wild type allele, (iii) the wild type allele alone
cannot compensate for the complete loss of function of the other allele or (iv) an interaction of
the wildtype and mutant protein, and thereby a retention of the wild type protein in the cell.
The mechanism behind this should be elucidated by molecular and cellular studies including
co-transfection of the wild type and SI variants and subsequent measurement of enzymatic
activities and comparison to single mutant activities, in the future.
The combination of molecular and sequencing data can help to explain the
pathogenesis of CSID and aid to find a fast diagnosis and therapy.
4.5 Modulation of sucrase-isoaltase enzymatic activities by aspartic acid
residues
As illustrated by the analysis of single amino acid exchanges within the SI enzyme of
CSID patients in this study, the function of a protein is primarily determined by its amino acid
sequence and can be disrupted by a single exchange. The amino acid residues of a protein
have different functions. For instance specific amino acids can serve as glycosylation sites,
with implications in protein folding, transport and signaling, other amino acids for example
can serve as structural determinants or have functions in substrate binding or substrate
hydrolysis in enzymes.
88
Chapter 4: Discussion
The analysis of structure-function relationships in proteins, such as SI, can be helpful
for a better understanding of the physiological protein function and of connected
pathophysiological conditions. SI consists of two homologous subunits, isomaltase and
sucrase, with one catalytic site each, and displays α-1,6-activities by the isomaltase subunit
and α-1,2-activities by the sucrase subunit. Moreover it contributes with a combined α-1,4activity of both subunits to 60-80% of maltose digestion in the intestinal lumen (QuezadaCalvillo et al., 2007). However, the contribution of each single subunit to digestion of dietary
starches is not clarified yet. With its broad substrate specificities against dietary carbohydrates
SI substantially contributes to the release of free glucose in the intestinal lumen. A better
understanding of the functional roles of catalytic residues and SI structure-function properties
may provide insights into detailed mechanistic aspects of carbohydrate digestion processes
and help to resolve the pathogenesis of diseases associated with α-glucosidase enzyme
function.
A commonly used method to study the structure of a protein is the resolution of the
crystal structure and computational homology modeling (Kitamura et al., 2005; Nakamura et
al., 2012; Sim et al., 2008). Nevertheless, these methods alone do not reflect the protein
function in a physiological or cellular background, including protein biosynthesis and
processing. Here we experimentally resolved the catalytic site properties of both SI subunits
in an in vitro cell model by specific mutational elimination of predicted catalytic residues
within SI.
Functionally important protein regions, such as the active site of enzymes, are
oftentimes highly conserved in protein families and among different species. According to the
carbohydrate-active enzyme classification system (CAZY, http://www.cazy.org), which is
based on sequence similarities, SI is classified into the glycoside hydrolase family 31 (GH31)
(Cantarel et al., 2009). This family also includes other α-glucosidases like MGAM,
endoplasmic reticulum α-glucosidase and lysosomal α-glycosidase (Ernst et al., 2006). These
enzymes have the common ability to cleave terminal carbohydrate moieties and are involved
in digestion, protein biosynthesis and protein quality control in the human body (DiazSotomayor et al., 2013; Ellgaard and Helenius, 2003). Despite different substrate specificities,
all of these enzymes are described to follow a retaining catalytic mechanism, in contrast to the
inverting mechanism of other hydrolases (Ernst et al., 2006; Song et al., 2013). The retaining
catalytic mechanism relies on two amino acid residues, functioning as catalytic nucleophile or
89
Chapter 4: Discussion
acid/base catalyst respectively (Frandsen and Svensson, 1998; Hermans et al., 1991; Lovering
et al., 2005). From active site specific inhibition or labeling studies aspartic acid (D) within
the [GFY]-[LIVMF]-W-x-D-M-[NSA]-E GH31 typical consensus amino acid motif is
predicted to function as the catalytic nucleophile (Lee et al., 2001; Okuyama et al., 2001; Sim
et al., 2008). The specific consensus amino acid sequence for all GH31 α-glucosidases is
WIDMNE surrounding the nucleophilic aspartic acid residue (Lovering et al., 2005).
Asp 505 within the GH31 catalytic site consensus motif WIDMNE in the isomaltase
subunit and Asp 1394 in the sucrase subunit are described to act as catalytic nucleophiles
during the SI substrate catalysis (Sim et al., 2010). Based on the crystal structure of the
isomaltase subunit another aspartic acid residue, Asp 604, in a WLGDN consensus motif is
suggested to act as proton donor during the substrate catalysis. Moreover, sequence
similarities suggest that Asp 1500 within the WLGDN sequence motif acts as proton donor in
the sucrase subunit.
The predicted proton donor aspartic acid residues were selectively exchanged by other
amino acids with different physiological characteristics, including glutamic acid, asparagine,
serine and tyrosine. As a control, the aspartic acid catalytic nucleophiles at position Asp 505
and Asp 1394 were exchanged to glutamic acid and the catalytic properties were analyzed in
an in vitro COS-1 cell system.
The specific exchange of aspartic acid, separately in sucrase and isomaltase catalytic
sites, caused a complete loss of activity of the targeted subunit, whereby activities of the other
subunits were not affected negatively. This result experimentally confirmed the proton donor
functions of Asp 604 and Asp 1500 and highlights their essential role in the SI functionality.
Despite the loss of activity of one subunit by exchange of the catalytic aspartic acid residue,
the SI proteins revealed a normal intracellular maturation and trafficking rendering them to a
good model system for studying single catalytic site properties of sucrase-isomaltase under in
vitro conditions. Moreover, the folding of most of the generated catalytic site variants of SI
showed no gross structural changes. A few partial folding defects in some mutants had no or
minor effects on the trafficking of the respective mutant.
Measurements of maltase activity of the single-active subunit SI proteins revealed that
sucrase displays a higher single subunit activity against maltose. The maltose hydrolysis of
the sucrase subunit accounted for 80% that of the isomaltase subunit for 50% of the wild
types overall maltose digestive capacity. Interestingly the average combined maltase activity
90
Chapter 4: Discussion
of both single active-site SI variants was increased compared to that of the bifunctional SI
protein with two active subunits. Furthermore, the sucrase and isomaltase activities of the
single active site variants were detected to have a tendency to increase in the absence of
activity from the other subunit.
The analysis of SI enzyme kinetics in intestinal human brush border membrane
preparations under addition of extra glucose revealed that the above described phenomenon
can be explained by product inhibition of SI. Activities of both subunits against sucrose or
isomaltose substrates respectively, were shown to be reduced by the presence of 700 pM
glucose, which is a common product of all SI substrates. Furthermore, the reduction in the
maximal velocity (Vmax), representing the maximal rate of reaction, combined with an
increase in the Michaelis constant (Km), describing the binding affinity, indicated a mixed
type of inhibition. This mechanism is similar to that described for miglustat in a previous
study (Amiri and Naim, 2012). Miglustat (N-butyl deoxynojirimycin, NB-DNJ) is an
imunosugar analogue of glucose used for the therapy in the lysosomal storage disease, type I
Gaucher disease, or Niemann Pick disease type C (Patterson et al., 2007; Venier and Igdoura,
2012). Miglustat is used as pharmacological chaperone for substrate reduction therapy by
inhibition of glycolipid biosynthesis. However, this therapy is connected to gastrointestinal
site effects like diarrhea (Machaczka et al., 2012). These site effects were explained by a
mixed type inhibition of α-glycosidic disaccharidases by miglustat (Amiri and Naim, 2012;
Amiri and Naim, 2014). This means, miglustat is competing with the SI substrate for the
active sites (competetive inhibition) and after binding of the substrate to the active site
miglustat can diminish the substrate cleavage through allosteric inhibition (Amiri and Naim,
2012). The current study indicates that glucose as product of terminal carbohydrate cleavage
can similarly inhibit the SI function. This so far undescribed mechanism of product inhibition
of SI by glucose may serve as control mechanism to regulate glucose release from
carbohydrate digestion in the intestine and balance glycemic levels in the blood.
Taken together, the catalytic site properties of both SI subunits were described
separately by our in vitro studies, confirming Asp 604 and Asp 1500 to be essential catalytic
residues with proton donor functions in the catalytic sites of SI. A mutational exchange of
these residues was directly connected to a loss of function of the targeted SI subunit.
Furthermore, our data provide an impression on SI in vitro functionality, if one subunit
is inactivated by mutations, as present in some patients of CSID. Terminal starch digestion
91
Chapter 4: Discussion
products mainly α-1,4-linked maltooligosaccharides are finally cleaved by the overlapping
activities of SI and MGAM to absorbable glucose. Defects of SI can lead to an excess of nondigested carbohydrates in the small intestine, leading to osmotic-fermentative diarrhea in
CSID patients. In patients with heterozygous inherited SI variants, that comprise a functional
sucrase subunit and an inactive isomaltase subunit, the capability of maltose digestion is most
likely reduced, as supported by our in vitro study. Previous studies showed that high amounts
of simple disaccharides, such as sucrose may additional limit the digestion of higher
carbohydrates, like starch hence maltose and sucrose compete for the same active site in αglucosidases (Heymann et al., 1995; Lee et al., 2012). It is conceivable that especially for
these patients with partially active SI, the ingestion of high sucrose amounts can additionally
reduce the capability of starch digestion in the small intestine and contributes to a worsening
of gastrointestinal symptoms.
92
Chapter 4: Discussion
References
Aebi, M., R. Bernasconi, S. Clerc, and M. Molinari. 2010. N-glycan structures: recognition and
processing in the ER. Trends in biochemical sciences. 35:74-82.
Ahmed, S.N., D.A. Brown, and E. London. 1997. On the origin of sphingolipid/cholesterol-rich
detergent-insoluble cell membranes: physiological concentrations of cholesterol and
sphingolipid induce formation of a detergent-insoluble, liquid-ordered lipid phase in model
membranes. Biochemistry. 36:10944-10953.
Alfalah, M., R. Jacob, U. Preuss, K.P. Zimmer, H. Naim, and H.Y. Naim. 1999. O-linked glycans mediate
apical sorting of human intestinal sucrase-isomaltase through association with lipid rafts.
Current biology : CB. 9:593-596.
Alfalah, M., M. Keiser, T. Leeb, K.P. Zimmer, and H.Y. Naim. 2009. Compound heterozygous
mutations affect protein folding and function in patients with congenital sucrase-isomaltase
deficiency. Gastroenterology. 136:883-892.
Alfalah, M., G. Wetzel, I. Fischer, R. Busche, E.E. Sterchi, K.P. Zimmer, H.P. Sallmann, and H.Y. Naim.
2005. A novel type of detergent-resistant membranes may contribute to an early protein
sorting event in epithelial cells. The Journal of biological chemistry. 280:42636-42643.
Alfonso, P., S. Pampin, J. Estrada, J.C. Rodriguez-Rey, P. Giraldo, J. Sancho, and M. Pocovi. 2005.
Miglustat (NB-DNJ) works as a chaperone for mutated acid beta-glucosidase in cells
transfected with several Gaucher disease mutations. Blood cells, molecules & diseases.
35:268-276.
Ament, M.E., D.R. Perera, and L.J. Esther. 1973. Sucrase-isomaltase deficiency-a frequently
misdiagnosed disease. J Pediatr. 83:721-727.
Amiri, M., and H.Y. Naim. 2012. Miglustat-induced intestinal carbohydrate malabsorption is due to
the inhibition of alpha-glucosidases, but not beta-galactosidases. J Inherit Metab Dis. 35:949954.
Amiri, M., and H.Y. Naim. 2014. Long term differential consequences of miglustat therapy on
intestinal disaccharidases. J Inherit Metab Dis. 37:929-937.
Amit-Romach, E., R. Reifen, and Z. Uni. 2006. Mucosal function in rat jejunum and ileum is altered by
induction of colitis. International journal of molecular medicine. 18:721-727.
Antonowicz, I., J.D. Lloyd-Still, K.T. Khaw, and H. Shwachman. 1972. Congenital sucrase-isomaltase
deficiency. Observations over a period of 6 years. Pediatrics. 49:847-853.
Apweiler, R., H. Hermjakob, and N. Sharon. 1999. On the frequency of protein glycosylation, as
deduced from analysis of the SWISS-PROT database. Biochimica et biophysica acta. 1473:4-8.
Beaulieu, J.F., B. Nichols, and A. Quaroni. 1989. Posttranslational regulation of sucrase-isomaltase
expression in intestinal crypt and villus cells. The Journal of biological chemistry. 264:2000020011.
Behrendt, M., M. Keiser, M. Hoch, and H.Y. Naim. 2009. Impaired trafficking and subcellular
localization of a mutant lactase associated with congenital lactase deficiency.
Gastroenterology. 136:2295-2303.
Belmont, J.W., B. Reid, W. Taylor, S.S. Baker, W.H. Moore, M.C. Morriss, S.M. Podrebarac, N. Glass,
and I.D. Schwartz. 2002. Congenital sucrase-isomaltase deficiency presenting with failure to
thrive, hypercalcemia, and nephrocalcinosis. BMC pediatrics. 2:4.
Benting, J.H., A.G. Rietveld, and K. Simons. 1999. N-Glycans mediate the apical sorting of a GPIanchored, raft-associated protein in Madin-Darby canine kidney cells. J Cell Biol. 146:313320.
Benton, D., M.P. Ruffin, T. Lassel, S. Nabb, M. Messaoudi, S. Vinoy, D. Desor, and V. Lang. 2003. The
delivery rate of dietary carbohydrates affects cognitive performance in both rats and
humans. Psychopharmacology. 166:86-90.
93
Chapter 4: Discussion
Berni Canani, R., V. Pezzella, A. Amoroso, T. Cozzolino, C. Di Scala, and A. Passariello. 2016.
Diagnosing and Treating Intolerance to Carbohydrates in Children. Nutrients. 8:157.
Brown, D.A., and E. London. 2000. Structure and function of sphingolipid- and cholesterol-rich
membrane rafts. The Journal of biological chemistry. 275:17221-17224.
Burrows, J.A., L.K. Willis, and D.H. Perlmutter. 2000. Chemical chaperones mediate increased
secretion of mutant alpha 1-antitrypsin (alpha 1-AT) Z: A potential pharmacological strategy
for prevention of liver injury and emphysema in alpha 1-AT deficiency. Proceedings of the
National Academy of Sciences of the United States of America. 97:1796-1801.
Cantarel, B.L., P.M. Coutinho, C. Rancurel, T. Bernard, V. Lombard, and B. Henrissat. 2009. The
Carbohydrate-Active EnZymes database (CAZy): an expert resource for Glycogenomics.
Nucleic acids research. 37:D233-238.
Caplan, M.J. 1997. Membrane polarity in epithelial cells: protein sorting and establishment of
polarized domains. The American journal of physiology. 272:F425-429.
Caspary, W.F. 1992. Physiology and pathophysiology of intestinal absorption. The American journal of
clinical nutrition. 55:299s-308s.
Castelletti, D., M. Alfalah, M. Heine, Z. Hein, R. Schmitte, G. Fracasso, M. Colombatti, and H.Y. Naim.
2008. Different glycoforms of prostate-specific membrane antigen are intracellularly
transported through their association with distinct detergent-resistant membranes. The
Biochemical journal. 409:149-157.
Castro-Rodriguez, J.A., E. Salazar-Lindo, and R. Leon-Barua. 1997. Differentiation of osmotic and
secretory diarrhoea by stool carbohydrate and osmolar gap measurements. Archives of
disease in childhood. 77:201-205.
Chantret, I., M. Lacasa, G. Chevalier, J. Ruf, I. Islam, N. Mantei, Y. Edwards, D. Swallow, and M.
Rousset. 1992. Sequence of the complete cDNA and the 5' structure of the human sucraseisomaltase gene. Possible homology with a yeast glucoamylase. The Biochemical journal. 285
( Pt 3):915-923.
Cheng, S.H., R.J. Gregory, J. Marshall, S. Paul, D.W. Souza, G.A. White, C.R. O'Riordan, and A.E. Smith.
1990. Defective intracellular transport and processing of CFTR is the molecular basis of most
cystic fibrosis. Cell. 63:827-834.
Cheung, J.C., and C.M. Deber. 2008. Misfolding of the cystic fibrosis transmembrane conductance
regulator and disease. Biochemistry. 47:1465-1473.
Cohen, S.A. 2016. The clinical consequences of sucrase-isomaltase deficiency. Molecular and cellular
pediatrics. 3:5.
Colombo, V., H. Lorenz-Meyer, and G. Semenza. 1973. Small intestinal phlorizin hydrolase: the "betaglycosidase complex". Biochimica et biophysica acta. 327:412-424.
Cornell, H.J., R.S. Auricchio, G. De Ritis, M. De Vincenzi, L. Maiuri, V. Raia, and V. Silano. 1988.
Intestinal mucosa of celiacs in remission is unable to abolish toxicity of gliadin peptides on in
vitro developing fetal rat intestine and cultured atrophic celiac mucosa. Pediatr Res. 24:233237.
Crosnier, C., D. Stamataki, and J. Lewis. 2006. Organizing cell renewal in the intestine: stem cells,
signals and combinatorial control. Nature reviews. Genetics. 7:349-359.
D'Inca, R., G.C. Sturniolo, D. Martines, V. Di Leo, A. Cecchetto, C. Venturi, and R. Naccarato. 1995.
Functional and morphological changes in small bowel of Crohn's disease patients. Influence
of site of disease. Dig Dis Sci. 40:1388-1393.
Dahlqvist, A. 1984. Assay of intestinal disaccharidases. Scandinavian journal of clinical and laboratory
investigation. 44:169-172.
Dahm, T., J. White, S. Grill, J. Fullekrug, and E.H. Stelzer. 2001. Quantitative ER <--> Golgi transport
kinetics and protein separation upon Golgi exit revealed by vesicular integral membrane
protein 36 dynamics in live cells. Mol Biol Cell. 12:1481-1498.
94
Chapter 4: Discussion
Daniels, C.W., and M. Belosevic. 1995. Disaccharidase activity in male and female C57BL/6 mice
infected with Giardia muris. Parasitology research. 81:143-147.
De Boeck, K., A. Zolin, H. Cuppens, H.V. Olesen, and L. Viviani. 2014. The relative frequency of CFTR
mutation classes in European patients with cystic fibrosis. Journal of cystic fibrosis : official
journal of the European Cystic Fibrosis Society. 13:403-409.
Delaunay, J.L., M. Breton, G. Trugnan, and M. Maurice. 2008. Differential solubilization of inner
plasma membrane leaflet components by Lubrol WX and Triton X-100. Biochimica et
biophysica acta. 1778:105-112.
Derichs, N. 2013. Targeting a genetic defect: cystic fibrosis transmembrane conductance regulator
modulators in cystic fibrosis. European respiratory review : an official journal of the European
Respiratory Society. 22:58-65.
Diaz-Sotomayor, M., R. Quezada-Calvillo, S.E. Avery, S.K. Chacko, L.K. Yan, A.H. Lin, Z.H. Ao, B.R.
Hamaker, and B.L. Nichols. 2013. Maltase-glucoamylase modulates gluconeogenesis and
sucrase-isomaltase dominates starch digestion glucogenesis. Journal of pediatric
gastroenterology and nutrition. 57:704-712.
Diekmann, L., K. Pfeiffer, and H.Y. Naim. 2015. Congenital lactose intolerance is triggered by severe
mutations on both alleles of the lactase gene. BMC gastroenterology. 15:36.
Drozdowski, L.A., and A.B. Thomson. 2006. Intestinal sugar transport. World J Gastroenterol.
12:1657-1670.
Du, K., and G.L. Lukacs. 2009. Cooperative assembly and misfolding of CFTR domains in vivo. Mol Biol
Cell. 20:1903-1915.
Du, K., M. Sharma, and G.L. Lukacs. 2005. The DeltaF508 cystic fibrosis mutation impairs domaindomain interactions and arrests post-translational folding of CFTR. Nature structural &
molecular biology. 12:17-25.
Dunbar, K., and M. Canto. 2008. Confocal endomicroscopy. Current opinion in gastroenterology.
24:631-637.
Ebert, K., and H. Witt. 2016. Fructose malabsorption. Molecular and cellular pediatrics. 3:10.
Eggeling, C., C. Ringemann, R. Medda, G. Schwarzmann, K. Sandhoff, S. Polyakova, V.N. Belov, B.
Hein, C. von Middendorff, A. Schonle, and S.W. Hell. 2009. Direct observation of the
nanoscale dynamics of membrane lipids in a living cell. Nature. 457:1159-1162.
Eggert, M.W., M.E. Byrne, and R.P. Chambers. 2011. Impact of high pyruvate concentration on
kinetics of rabbit muscle lactate dehydrogenase. Applied biochemistry and biotechnology.
165:676-686.
Ellgaard, L., and A. Helenius. 2003. Quality control in the endoplasmic reticulum. Nature reviews.
Molecular cell biology. 4:181-191.
Emanuelsson, O., S. Brunak, G. von Heijne, and H. Nielsen. 2007. Locating proteins in the cell using
TargetP, SignalP and related tools. Nature protocols. 2:953-971.
Ernst, H.A., L. Lo Leggio, M. Willemoes, G. Leonard, P. Blum, and S. Larsen. 2006. Structure of the
Sulfolobus solfataricus alpha-glucosidase: implications for domain conservation and
substrate recognition in GH31. Journal of molecular biology. 358:1106-1124.
Farquhar, M.G., and G.E. Palade. 1963. Junctional complexes in various epithelia. J Cell Biol. 17:375412.
Ferris, S.P., V.K. Kodali, and R.J. Kaufman. 2014. Glycoprotein folding and quality-control mechanisms
in protein-folding diseases. Disease models & mechanisms. 7:331-341.
Fic, E., S. Kedracka-Krok, U. Jankowska, A. Pirog, and M. Dziedzicka-Wasylewska. 2010. Comparison of
protein precipitation methods for various rat brain structures prior to proteomic analysis.
Electrophoresis. 31:3573-3579.
Forloni, G., L. Terreni, I. Bertani, S. Fogliarino, R. Invernizzi, A. Assini, G. Ribizzi, A. Negro, E. Calabrese,
M.A. Volonte, C. Mariani, M. Franceschi, M. Tabaton, and A. Bertoli. 2002. Protein misfolding
95
Chapter 4: Discussion
in Alzheimer's and Parkinson's disease: genetics and molecular mechanisms. Neurobiology of
aging. 23:957-976.
Frandsen, T.P., and B. Svensson. 1998. Plant alpha-glucosidases of the glycoside hydrolase family 31.
Molecular properties, substrate specificity, reaction mechanism, and comparison with family
members of different origin. Plant molecular biology. 37:1-13.
Fransen, J.A., H.P. Hauri, L.A. Ginsel, and H.Y. Naim. 1991. Naturally occurring mutations in intestinal
sucrase-isomaltase provide evidence for the existence of an intracellular sorting signal in the
isomaltase subunit. J Cell Biol. 115:45-57.
Garman, S.C., and D.N. Garboczi. 2002. Structural basis of Fabry disease. Molecular genetics and
metabolism. 77:3-11.
Gebbers, J.O., and J.A. Laissue. 1989. Immunologic structures and functions of the gut. Schweizer
Archiv fur Tierheilkunde. 131:221-238.
Gericke, B., M. Amiri, and H.Y. Naim. 2016. The multiple roles of sucrase-isomaltase in the intestinal
physiology. Molecular and cellular pediatrics. 3:2.
Glabe, C. 2001. Intracellular mechanisms of amyloid accumulation and pathogenesis in Alzheimer's
disease. Journal of molecular neuroscience : MN. 17:137-145.
Goder, V., and M. Spiess. 2001. Topogenesis of membrane proteins: determinants and dynamics.
FEBS Lett. 504:87-93.
Gray, G.M., B.C. Lally, and K.A. Conklin. 1979. Action of intestinal sucrase-isomaltase and its free
monomers on an alpha-limit dextrin. The Journal of biological chemistry. 254:6038-6043.
Griffiths, G., and K. Simons. 1986. The trans Golgi network: sorting at the exit site of the Golgi
complex. Science (New York, N.Y.). 234:438-443.
Groschwitz, K.R., and S.P. Hogan. 2009. Intestinal barrier function: molecular regulation and disease
pathogenesis. The Journal of allergy and clinical immunology. 124:3-20; quiz 21-22.
Gudmand-Hoyer, E., H.J. Fenger, P. Kern-Hansen, and P.R. Madsen. 1987. Sucrase deficiency in
Greenland. Incidence and genetic aspects. Scand J Gastroenterol. 22:24-28.
Gupta, S.K., S.K. Chong, and J.F. Fitzgerald. 1999. Disaccharidase activities in children: normal values
and comparison based on symptoms and histologic changes. Journal of pediatric
gastroenterology and nutrition. 28:246-251.
Hall, P.A., P.J. Coates, B. Ansari, and D. Hopwood. 1994. Regulation of cell number in the mammalian
gastrointestinal tract: the importance of apoptosis. J Cell Sci. 107 ( Pt 12):3569-3577.
Hamaker, B.R., B.H. Lee, and R. Quezada-Calvillo. 2012. Starch digestion and patients with congenital
sucrase-isomaltase deficiency. Journal of pediatric gastroenterology and nutrition. 55 Suppl
2:S24-28.
Hansen, G.H., L.L. Niels-Christiansen, E. Thorsen, L. Immerdal, and E.M. Danielsen. 2000. Cholesterol
depletion of enterocytes. Effect on the Golgi complex and apical membrane trafficking. The
Journal of biological chemistry. 275:5136-5142.
Hanzal-Bayer, M.F., and J.F. Hancock. 2007. Lipid rafts and membrane traffic. FEBS Lett. 581:20982104.
Hauri, H.P., J. Roth, E.E. Sterchi, and M.J. Lentze. 1985a. Transport to cell surface of intestinal
sucrase-isomaltase is blocked in the Golgi apparatus in a patient with congenital sucraseisomaltase deficiency. Proceedings of the National Academy of Sciences. 82:4423-4427.
Hauri, H.P., E.E. Sterchi, D. Bienz, J.A. Fransen, and A. Marxer. 1985b. Expression and intracellular
transport of microvillus membrane hydrolases in human intestinal epithelial cells. The
Journal of Cell Biology. 101:838-851.
Helenius, A., and M. Aebi. 2001. Intracellular functions of N-linked glycans. Science (New York, N.Y.).
291:2364-2369.
Herczenik, E., and M.F. Gebbink. 2008. Molecular and cellular aspects of protein misfolding and
disease. FASEB journal : official publication of the Federation of American Societies for
Experimental Biology. 22:2115-2133.
96
Chapter 4: Discussion
Hering, N.A., A. Fromm, J. Kikhney, I.F. Lee, A. Moter, J.D. Schulzke, and R. Bucker. 2016. Yersinia
enterocolitica Affects Intestinal Barrier Function in the Colon. The Journal of infectious
diseases. 213:1157-1162.
Hermans, M.M., M.A. Kroos, J. van Beeumen, B.A. Oostra, and A.J. Reuser. 1991. Human lysosomal
alpha-glucosidase. Characterization of the catalytic site. The Journal of biological chemistry.
266:13507-13512.
Heyman, M.B. 2006. Lactose intolerance in infants, children, and adolescents. Pediatrics. 118:12791286.
Heymann, H., D. Breitmeier, and S. Gunther. 1995. Human small intestinal sucrase-isomaltase:
different binding patterns for malto- and isomaltooligosaccharides. Biological chemistry
Hoppe-Seyler. 376:249-253.
High, S. 1995. Protein translocation at the membrane of the endoplasmic reticulum. Progress in
biophysics and molecular biology. 63:233-250.
Hung, M.C., and W. Link. 2011. Protein localization in disease and therapy. J Cell Sci. 124:3381-3392.
Hunziker, W., and C. Fumey. 1994. A di-leucine motif mediates endocytosis and basolateral sorting of
macrophage IgG Fc receptors in MDCK cells. The EMBO journal. 13:2963-2969.
Hunziker, W., M. Spiess, G. Semenza, and H.F. Lodish. 1986. The sucrase-isomaltase complex: primary
structure, membrane-orientation, and evolution of a stalked, intrinsic brush border protein.
Cell. 46:227-234.
Inglese, J., D.S. Auld, A. Jadhav, R.L. Johnson, A. Simeonov, A. Yasgar, W. Zheng, and C.P. Austin.
2006. Quantitative high-throughput screening: a titration-based approach that efficiently
identifies biological activities in large chemical libraries. Proceedings of the National Academy
of Sciences of the United States of America. 103:11473-11478.
Iwanami, S., H. Matsui, A. Kimura, H. Ito, H. Mori, M. Honma, and S. Chiba. 1995. Chemical
modification and amino acid sequence of active site in sugar beet alpha-glucosidase.
Bioscience, biotechnology, and biochemistry. 59:459-463.
Jacob, R., and H.Y. Naim. 2001. Apical membrane proteins are transported in distinct vesicular
carriers. Current biology : CB. 11:1444-1450.
Jacob, R., K. Peters, and H.Y. Naim. 2002a. The prosequence of human lactase-phlorizin hydrolase
modulates the folding of the mature enzyme. The Journal of biological chemistry. 277:82178225.
Jacob, R., B. Purschel, and H.Y. Naim. 2002b. Sucrase is an intramolecular chaperone located at the Cterminal end of the sucrase-isomaltase enzyme complex. The Journal of biological chemistry.
277:32141-32148.
Jacob, R., J.R. Weiner, S. Stadge, and H.Y. Naim. 2000a. Additional N-glycosylation and its impact on
the folding of intestinal lactase-phlorizin hydrolase. The Journal of biological chemistry.
275:10630-10637.
Jacob, R., K.P. Zimmer, J. Schmitz, and H.Y. Naim. 2000b. Congenital sucrase-isomaltase deficiency
arising from cleavage and secretion of a mutant form of the enzyme. The Journal of clinical
investigation. 106:281-287.
Jandhyala, S.M., R. Talukdar, C. Subramanyam, H. Vuyyuru, M. Sasikala, and D. Nageshwar Reddy.
2015. Role of the normal gut microbiota. World J Gastroenterol. 21:8787-8803.
Jansen, W., G.S. Que, and W. Veeger. 1965. Primary combined saccharase and isomaltase deficiency.
Report of two adult siblings of consanguineous parentage. Archives of internal medicine.
116:879-885.
Jones, K., R. Eskandari, H.Y. Naim, B.M. Pinto, and D.R. Rose. 2012. Investigations of the structures
and inhibitory properties of intestinal maltase glucoamylase and sucrase isomaltase. Journal
of pediatric gastroenterology and nutrition. 55 Suppl 2:S20-24.
Jourdan, N., J.P. Brunet, C. Sapin, A. Blais, J. Cotte-Laffitte, F. Forestier, A.M. Quero, G. Trugnan, and
A.L. Servin. 1998. Rotavirus infection reduces sucrase-isomaltase expression in human
97
Chapter 4: Discussion
intestinal epithelial cells by perturbing protein targeting and organization of microvillar
cytoskeleton. Journal of virology. 72:7228-7236.
Keiser, M., M. Alfalah, M.J. Propsting, D. Castelletti, and H.Y. Naim. 2006. Altered folding, turnover,
and polarized sorting act in concert to define a novel pathomechanism of congenital sucraseisomaltase deficiency. The Journal of biological chemistry. 281:14393-14399.
Keller, J., and P. Layer. 2014. The Pathophysiology of Malabsorption. Viszeralmedizin. 30:150-154.
Keller, P., and K. Simons. 1997. Post-Golgi biosynthetic trafficking. J Cell Sci. 110 ( Pt 24):3001-3009.
Keller, P., D. Toomre, E. Diaz, J. White, and K. Simons. 2001. Multicolour imaging of post-Golgi sorting
and trafficking in live cells. Nat Cell Biol. 3:140-149.
Kerry, K.R., and R.R.W. Townley. 1965. GENETIC ASPECTS OF INTESTINAL SUCRASE-ISOMALTASE
DEFICIENCY. Journal of Paediatrics and Child Health. 1:223-235.
Kikis, E.A., T. Gidalevitz, and R.I. Morimoto. 2010. Protein homeostasis in models of aging and agerelated conformational disease. Advances in experimental medicine and biology. 694:138159.
Kitamura, M., T. Ose, M. Okuyama, H. Watanabe, M. Yao, H. Mori, A. Kimura, and I. Tanaka. 2005.
Crystallization and preliminary X-ray analysis of alpha-xylosidase from Escherichia coli. Acta
crystallographica. Section F, Structural biology and crystallization communications. 61:178179.
Kohan, A.B., S.M. Yoder, and P. Tso. 2011. Using the lymphatics to study nutrient absorption and the
secretion of gastrointestinal hormones. Physiology & behavior. 105:82-88.
Kornfeld, R., and S. Kornfeld. 1985. Assembly of asparagine-linked oligosaccharides. Annual review of
biochemistry. 54:631-664.
Kuokkanen, M., J. Kokkonen, N.S. Enattah, T. Ylisaukko-Oja, H. Komu, T. Varilo, L. Peltonen, E.
Savilahti, and I. Jarvela. 2006. Mutations in the translated region of the lactase gene (LCT)
underlie congenital lactase deficiency. Am J Hum Genet. 78:339-344.
Lam, J.T., M.G. Martin, E. Turk, B.A. Hirayama, N.U. Bosshard, B. Steinmann, and E.M. Wright. 1999.
Missense mutations in SGLT1 cause glucose-galactose malabsorption by trafficking defects.
Biochimica et biophysica acta. 1453:297-303.
Layer, P., A.R. Zinsmeister, and E.P. DiMagno. 1986. Effects of decreasing intraluminal amylase
activity on starch digestion and postprandial gastrointestinal function in humans.
Gastroenterology. 91:41-48.
Lebenthal, E., U. Khin Maung, B.Y. Zheng, R.B. Lu, and A. Lerner. 1994. Small intestinal glucoamylase
deficiency and starch malabsorption: a newly recognized alpha-glucosidase deficiency in
children. J Pediatr. 124:541-546.
Lee, B.H., R. Quezada-Calvillo, B.L. Nichols, Jr., D.R. Rose, and B.R. Hamaker. 2012. Inhibition of
maltase-glucoamylase activity to hydrolyze alpha-1,4 linkages by the presence of undigested
sucrose. Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S45-47.
Lee, S.S., S. He, and S.G. Withers. 2001. Identification of the catalytic nucleophile of the Family 31
alpha-glucosidase from Aspergillus niger via trapping of a 5-fluoroglycosyl-enzyme
intermediate. The Biochemical journal. 359:381-386.
Lenne, P.F., L. Wawrezinieck, F. Conchonaud, O. Wurtz, A. Boned, X.J. Guo, H. Rigneault, H.T. He, and
D. Marguet. 2006. Dynamic molecular confinement in the plasma membrane by
microdomains and the cytoskeleton meshwork. The EMBO journal. 25:3245-3256.
Levitt, M.D., and R.M. Donaldson. 1970. Use of respiratory hydrogen (H2) excretion to detect
carbohydrate malabsorption. The Journal of laboratory and clinical medicine. 75:937-945.
Lin, A.H., B.R. Hamaker, and B.L. Nichols, Jr. 2012. Direct starch digestion by sucrase-isomaltase and
maltase-glucoamylase. Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S4345.
Lin, H., Y. Sugimoto, Y. Ohsaki, H. Ninomiya, A. Oka, M. Taniguchi, H. Ida, Y. Eto, S. Ogawa, Y.
Matsuzaki, M. Sawa, T. Inoue, K. Higaki, E. Nanba, K. Ohno, and Y. Suzuki. 2004. N-octyl-beta-
98
Chapter 4: Discussion
valienamine up-regulates activity of F213I mutant beta-glucosidase in cultured cells: a
potential chemical chaperone therapy for Gaucher disease. Biochimica et biophysica acta.
1689:219-228.
Lingwood, D., and K. Simons. 2010. Lipid rafts as a membrane-organizing principle. Science (New
York, N.Y.). 327:46-50.
Lipardi, C., L. Nitsch, and C. Zurzolo. 2000. Detergent-insoluble GPI-anchored proteins are apically
sorted in fischer rat thyroid cells, but interference with cholesterol or sphingolipids
differentially affects detergent insolubility and apical sorting. Mol Biol Cell. 11:531-542.
Liu, X., C.S. Kim, F.T. Kurbanov, R.B. Honzatko, and H.J. Fromm. 1999. Dual mechanisms for glucose 6phosphate inhibition of human brain hexokinase. The Journal of biological chemistry.
274:31155-31159.
Lomas, D.A., D.L. Evans, J.T. Finch, and R.W. Carrell. 1992. The mechanism of Z alpha 1-antitrypsin
accumulation in the liver. Nature. 357:605-607.
Lovering, A.L., S.S. Lee, Y.W. Kim, S.G. Withers, and N.C. Strynadka. 2005. Mechanistic and structural
analysis of a family 31 alpha-glycosidase and its glycosyl-enzyme intermediate. The Journal of
biological chemistry. 280:2105-2115.
Lucke, T., M. Keiser, S. Illsinger, M.J. Lentze, H.Y. Naim, and A.M. Das. 2009. Congenital and putatively
acquired forms of sucrase-isomaltase deficiency in infancy: effects of sacrosidase therapy.
Journal of pediatric gastroenterology and nutrition. 49:485-487.
Machaczka, M., R. Hast, I. Dahlman, R. Lerner, M. Klimkowska, M. Engvall, and H. Hagglund. 2012.
Substrate reduction therapy with miglustat for type 1 Gaucher disease: a retrospective
analysis from a single institution. Upsala journal of medical sciences. 117:28-34.
Marc, B., K. Markus, H. Melanie, and Y.N. Hassan. 2009. Impaired trafficking and subcellular
localization of a mutant lactase associated with congenital lactase deficiency.
Gastroenterology. 136:2295-2303.
Martoglio, B., and B. Dobberstein. 1998. Signal sequences: more than just greasy peptides. Trends in
cell biology. 8:410-415.
Matter, K., W. Hunziker, and I. Mellman. 1992. Basolateral sorting of LDL receptor in MDCK cells: the
cytoplasmic domain contains two tyrosine-dependent targeting determinants. Cell. 71:741753.
McNair, A., E. Gudmand-Hoyer, S. Jarnum, and L. Orrild. 1972. Sucrose malabsorption in Greenland.
British medical journal. 2:19-21.
Mellman, I., and W.J. Nelson. 2008. Coordinated protein sorting, targeting and distribution in
polarized cells. Nature reviews. Molecular cell biology. 9:833-845.
Mikko, K., B. Ralf, R. Heli, M. Krzysztof, N. Mef, M. Susanne, L. Jan, and J. Irma. 2005. Lactase
persistence and ovarian carcinoma risk in Finland, Poland and Sweden. International Journal
of Cancer. 117:90-94.
Mostov, K., T. Su, and M. ter Beest. 2003. Polarized epithelial membrane traffic: conservation and
plasticity. Nat Cell Biol. 5:287-293.
Mothes, W., B. Jungnickel, J. Brunner, and T.A. Rapoport. 1998. Signal sequence recognition in
cotranslational translocation by protein components of the endoplasmic reticulum
membrane. J Cell Biol. 142:355-364.
Naim, H.Y., M. Heine, and K.P. Zimmer. 2012. Congenital sucrase-isomaltase deficiency:
heterogeneity of inheritance, trafficking, and function of an intestinal enzyme complex.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S13-20.
Naim, H.Y., S.W. Lacey, J.F. Sambrook, and M.J. Gething. 1991a. Expression of a full-length cDNA
coding for human intestinal lactase-phlorizin hydrolase reveals an uncleaved, enzymatically
active, and transport-competent protein. The Journal of biological chemistry. 266:1231312320.
99
Chapter 4: Discussion
Naim, H.Y., S.W. Lacey, J.F. Sambrook, and M.J. Gething. 1991b. Expression of a full-length cDNA
coding for human intestinal lactase-phlorizin hydrolase reveals an uncleaved, enzymatically
active, and transport-competent protein. The Journal of biological chemistry. 266:1231312320.
Naim, H.Y., J. Roth, E.E. Sterchi, M. Lentze, P. Milla, J. Schmitz, and H.P. Hauri. 1988a. Sucraseisomaltase deficiency in humans. Different mutations disrupt intracellular transport,
processing, and function of an intestinal brush border enzyme. The Journal of clinical
investigation. 82:667-679.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1987. Biosynthesis and maturation of lactase-phlorizin
hydrolase in the human small intestinal epithelial cells. Biochem. J.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988b. Biosynthesis of the human sucrase-isomaltase
complex. Differential O-glycosylation of the sucrase subunit correlates with its position
within the enzyme complex. Journal of Biological Chemistry.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988c. Biosynthesis of the human sucrase-isomaltase
complex. Differential O-glycosylation of the sucrase subunit correlates with its position
within the enzyme complex. The Journal of biological chemistry. 263:7242-7253.
Naim, H.Y., E.E. Sterchi, and M.J. Lentze. 1988d. Structure, biosynthesis, and glycosylation of human
small intestinal maltase-glucoamylase. The Journal of biological chemistry. 263:19709-19717.
Nakamura, S., K. Takahira, G. Tanabe, O. Muraoka, and I. Nakanishi. 2012. Homology Modeling of
Human Alpha-Glucosidase Catalytic Domains and SAR Study of Salacinol Derivatives. Open
Journal of Medicinal Chemistry. Vol.02No.03:11.
Neurath, M.F. 2014. Cytokines in inflammatory bowel disease. Nature reviews. Immunology. 14:329342.
Newton, T., M.S. Murphy, and I.W. Booth. 1996. Glucose polymer as a cause of protracted diarrhea in
infants with unsuspected congenital sucrase-isomaltase deficiency. J Pediatr. 128:753-756.
Nichols, B.L., S. Avery, P. Sen, D.M. Swallow, D. Hahn, and E. Sterchi. 2003. The maltase-glucoamylase
gene: common ancestry to sucrase-isomaltase with complementary starch digestion
activities. Proceedings of the National Academy of Sciences of the United States of America.
100:1432-1437.
Nichols, B.L., S.E. Avery, W. Karnsakul, F. Jahoor, P. Sen, D.M. Swallow, U. Luginbuehl, D. Hahn, and
E.E. Sterchi. 2002. Congenital maltase-glucoamylase deficiency associated with lactase and
sucrase deficiencies. Journal of pediatric gastroenterology and nutrition. 35:573-579.
O'Neill, R.A. 1996. Enzymatic release of oligosaccharides from glycoproteins for chromatographic and
electrophoretic analysis. Journal of chromatography. A. 720:201-215.
Ohtsubo, K., and J.D. Marth. 2006. Glycosylation in cellular mechanisms of health and disease. Cell.
126:855-867.
Okuyama, M. 2011. Function and structure studies of GH family 31 and 97 alpha-glycosidases.
Bioscience, biotechnology, and biochemistry. 75:2269-2277.
Okuyama, M., A. Okuno, N. Shimizu, H. Mori, A. Kimura, and S. Chiba. 2001. Carboxyl group of
residue Asp647 as possible proton donor in catalytic reaction of alpha-glucosidase from
Schizosaccharomyces pombe. European journal of biochemistry / FEBS. 268:2270-2280.
Ouwendijk, J., C.E. Moolenaar, W.J. Peters, C.P. Hollenberg, L.A. Ginsel, J.A. Fransen, and H.Y. Naim.
1996. Congenital sucrase-isomaltase deficiency. Identification of a glutamine to proline
substitution that leads to a transport block of sucrase-isomaltase in a pre-Golgi
compartment. Journal of Clinical Investigation. 97:633641.
Overeem, A.W., C. Posovszky, E.H. Rings, B.N. Giepmans, and I.S.C. van. 2016. The role of enterocyte
defects in the pathogenesis of congenital diarrheal disorders. Disease models & mechanisms.
9:1-12.
Paladino, S., T. Pocard, M.A. Catino, and C. Zurzolo. 2006. GPI-anchored proteins are directly targeted
to the apical surface in fully polarized MDCK cells. J Cell Biol. 172:1023-1034.
100
Chapter 4: Discussion
Patterson, M.C., D. Vecchio, H. Prady, L. Abel, and J.E. Wraith. 2007. Miglustat for treatment of
Niemann-Pick C disease: a randomised controlled study. The Lancet. Neurology. 6:765-772.
Perlmutter, D.H., J.L. Brodsky, W.F. Balistreri, and B.C. Trapnell. 2007. Molecular pathogenesis of
alpha-1-antitrypsin deficiency-associated liver disease: a meeting review. Hepatology
(Baltimore, Md.). 45:1313-1323.
Peterson, L.W., and D. Artis. 2014. Intestinal epithelial cells: regulators of barrier function and
immune homeostasis. Nature reviews. Immunology. 14:141-153.
Peterson, M.L., and R. Herber. 1967. Intestinal sucrase deficiency. Transactions of the Association of
American Physicians. 80:275-283.
Piepoli, A., E. Schirru, A. Mastrorilli, A. Gentile, R. Cotugno, M. Quitadamo, A. Merla, M. Congia, P.
Usai Satta, and F. Perri. 2007. Genotyping of the lactase-phlorizin hydrolase c/t-13910
polymorphism by means of a new rapid denaturing high-performance liquid
chromatography-based assay in healthy subjects and colorectal cancer patients. J Biomol
Screen. 12:733-739.
Pralle, A., P. Keller, E.L. Florin, K. Simons, and J.K. Horber. 2000. Sphingolipid-cholesterol rafts diffuse
as small entities in the plasma membrane of mammalian cells. J Cell Biol. 148:997-1008.
Prior, I.A., R.G. Parton, and J.F. Hancock. 2003. Observing cell surface signaling domains using
electron microscopy. Science's STKE : signal transduction knowledge environment. 2003:Pl9.
Propsting, M.J., R. Jacob, and H.Y. Naim. 2003. A glutamine to proline exchange at amino acid residue
1098 in sucrase causes a temperature-sensitive arrest of sucrase-isomaltase in the
endoplasmic reticulum and cis-Golgi. The Journal of biological chemistry. 278:16310-16314.
Puntis, J.W., and V. Zamvar. 2015. Congenital sucrase-isomaltase deficiency: diagnostic challenges
and response to enzyme replacement therapy. Archives of disease in childhood. 100:869-871.
Qu, B.H., E.H. Strickland, and P.J. Thomas. 1997. Localization and suppression of a kinetic defect in
cystic fibrosis transmembrane conductance regulator folding. The Journal of biological
chemistry. 272:15739-15744.
Quaroni, A., E. Gershon, and G. Semenza. 1974. Affinity labeling of the active sites in the sucraseisomaltase complex from small intestine. The Journal of biological chemistry. 249:6424-6433.
Quaroni, A., and G. Semenza. 1976. Partial amino acid sequences around the essential carboxylate in
the active sites of the intestinal sucrase-isomaltase complex. The Journal of biological
chemistry. 251:3250-3253.
Quezada-Calvillo, R., C.C. Robayo-Torres, Z. Ao, B.R. Hamaker, A. Quaroni, G.D. Brayer, E.E. Sterchi,
S.S. Baker, and B.L. Nichols. 2007. Luminal substrate "brake" on mucosal maltaseglucoamylase activity regulates total rate of starch digestion to glucose. Journal of pediatric
gastroenterology and nutrition. 45:32-43.
Quezada-Calvillo, R., L. Sim, Z. Ao, B.R. Hamaker, A. Quaroni, G.D. Brayer, E.E. Sterchi, C.C. RobayoTorres, D.R. Rose, and B.L. Nichols. 2008. Luminal starch substrate "brake" on maltaseglucoamylase activity is located within the glucoamylase subunit. The Journal of nutrition.
138:685-692.
Rana, S.V., D.K. Bhasin, R. Katyal, and K. Singh. 2001. Comparison of duodenal and jejunal
disaccharidase levels in patients with non ulcer dyspepsia. Tropical gastroenterology : official
journal of the Digestive Diseases Foundation. 22:135-136.
Ritz, V., M. Alfalah, K.P. Zimmer, J. Schmitz, R. Jacob, and H.Y. Naim. 2003. Congenital sucraseisomaltase deficiency because of an accumulation of the mutant enzyme in the endoplasmic
reticulum. Gastroenterology. 125:1678-1685.
Robayo-Torres, C.C., A.R. Opekun, R. Quezada-Calvillo, X. Villa, E.O. Smith, M. Navarrete, S.S. Baker,
and B.L. Nichols. 2009. 13C-breath tests for sucrose digestion in congenital sucrase
isomaltase-deficient and sacrosidase-supplemented patients. Journal of pediatric
gastroenterology and nutrition. 48:412-418.
101
Chapter 4: Discussion
Robayo-Torres, C.C., R. Quezada-Calvillo, and B.L. Nichols. 2006. Disaccharide digestion: clinical and
molecular aspects. Clinical gastroenterology and hepatology : the official clinical practice
journal of the American Gastroenterological Association. 4:276-287.
Ron, I., and M. Horowitz. 2005. ER retention and degradation as the molecular basis underlying
Gaucher disease heterogeneity. Human molecular genetics. 14:2387-2398.
Roth, Z., G. Yehezkel, and I. Khalaila. 2012. Identification and Quantification of Protein Glycosylation.
International Journal of Carbohydrate Chemistry. 2012:10.
Ruemmele, F.M., T. Muller, N. Schiefermeier, H.L. Ebner, S. Lechner, K. Pfaller, C.E. Thoni, O. Goulet,
F. Lacaille, J. Schmitz, V. Colomb, F. Sauvat, Y. Revillon, D. Canioni, N. Brousse, G. de SaintBasile, J. Lefebvre, P. Heinz-Erian, A. Enninger, G. Utermann, M.W. Hess, A.R. Janecke, and
L.A. Huber. 2010. Loss-of-function of MYO5B is the main cause of microvillus inclusion
disease: 15 novel mutations and a CaCo-2 RNAi cell model. Human mutation. 31:544-551.
Ruggiano, A., O. Foresti, and P. Carvalho. 2014. Quality control: ER-associated degradation: protein
quality control and beyond. J Cell Biol. 204:869-879.
Salim, S.Y., and J.D. Soderholm. 2011. Importance of disrupted intestinal barrier in inflammatory
bowel diseases. Inflammatory bowel diseases. 17:362-381.
Samasca, G., M. Bruchental, A. Butnariu, A. Pirvan, M. Andreica, V. Cristea, and D. Dejica. 2011.
Difficulties in Celiac Disease Diagnosis in Children - A case report. Maedica. 6:32-35.
Sander, P., M. Alfalah, M. Keiser, I. Korponay-Szabo, J.B. Kovacs, T. Leeb, and H.Y. Naim. 2006. Novel
mutations in the human sucrase-isomaltase gene (SI) that cause congenital carbohydrate
malabsorption. Human mutation. 27:119.
Sanz, Y., and G. De Palma. 2009. Gut microbiota and probiotics in modulation of epithelium and gutassociated lymphoid tissue function. International reviews of immunology. 28:397-413.
Sartor, R.B. 2008. Microbial influences in inflammatory bowel diseases. Gastroenterology. 134:577594.
Sasaki, Y., Y. Oshima, R. Koyama, R. Maruyama, H. Akashi, H. Mita, M. Toyota, Y. Shinomura, K. Imai,
and T. Tokino. 2008. Identification of flotillin-2, a major protein on lipid rafts, as a novel
target of p53 family members. Molecular cancer research : MCR. 6:395-406.
Schlehe, J.S., A.K. Lutz, A. Pilsl, K. Lammermann, K. Grgur, I.H. Henn, J. Tatzelt, and K.F. Winklhofer.
2008. Aberrant folding of pathogenic Parkin mutants: aggregation versus degradation. The
Journal of biological chemistry. 283:13771-13779.
Schmidt, S., G. Fracasso, M. Colombatti, and H.Y. Naim. 2013. Cloning and characterization of canine
prostate-specific membrane antigen. Prostate. 73:642-650.
Schmitz, M., M. Alfalah, J.M. Aerts, H.Y. Naim, and K.P. Zimmer. 2005. Impaired trafficking of mutants
of lysosomal glucocerebrosidase in Gaucher's disease. Int J Biochem Cell Biol. 37:2310-2320.
Schneeberger, K., G.F. Vogel, H. Teunissen, D.D. van Ommen, H. Begthel, L. El Bouazzaoui, A.H. van
Vugt, J.M. Beekman, J. Klumperman, T. Muller, A. Janecke, P. Gerner, L.A. Huber, M.W. Hess,
H. Clevers, J.H. van Es, E.E. Nieuwenhuis, and S. Middendorp. 2015. An inducible mouse
model for microvillus inclusion disease reveals a role for myosin Vb in apical and basolateral
trafficking. Proceedings of the National Academy of Sciences of the United States of America.
112:12408-12413.
Schuck, S., M. Honsho, K. Ekroos, A. Shevchenko, and K. Simons. 2003. Resistance of cell membranes
to different detergents. Proceedings of the National Academy of Sciences of the United States
of America. 100:5795-5800.
Schutz, G.J., G. Kada, V.P. Pastushenko, and H. Schindler. 2000. Properties of lipid microdomains in a
muscle cell membrane visualized by single molecule microscopy. The EMBO journal. 19:892901.
Scott, K.G., L.C. Yu, and A.G. Buret. 2004. Role of CD8+ and CD4+ T lymphocytes in jejunal mucosal
injury during murine giardiasis. Infection and immunity. 72:3536-3542.
102
Chapter 4: Discussion
Semenza, G., and S. Auricchio. 1989. The metabolic basis of inherited disease (II). Hill Inc., New York.
2975-2997.
Semenza, G., S. Auricchio, and A. Rubino. 1965. MULTIPLICITY OF HUMAN INTESTINAL
DISACCHARIDASES. I. CHROMATOGRAPHIC SEPARATION OF MALTASES AND OF TWO
LACTASES. Biochimica et biophysica acta. 96:487-497.
Sheppard, D.N., D.P. Rich, L.S. Ostedgaard, R.J. Gregory, A.E. Smith, and M.J. Welsh. 1993. Mutations
in CFTR associated with mild-disease-form Cl- channels with altered pore properties. Nature.
362:160-164.
Sim, L., R. Quezada-Calvillo, E.E. Sterchi, B.L. Nichols, and D.R. Rose. 2008. Human intestinal maltaseglucoamylase: crystal structure of the N-terminal catalytic subunit and basis of inhibition and
substrate specificity. Journal of molecular biology. 375:782-792.
Sim, L., C. Willemsma, S. Mohan, H.Y. Naim, B.M. Pinto, and D.R. Rose. 2010. Structural basis for
substrate selectivity in human maltase-glucoamylase and sucrase-isomaltase N-terminal
domains. The Journal of biological chemistry. 285:17763-17770.
Simons, K., and E. Ikonen. 1997. Functional rafts in cell membranes. Nature. 387:569-572.
Simossis, V.A., and J. Heringa. 2005. PRALINE: a multiple sequence alignment toolbox that integrates
homology-extended and secondary structure information. Nucleic acids research. 33:W289294.
Skovbjerg, H. 1981. Immunoelectrophoretic studies on human small intestinal brush border proteins-the longitudinal distribution of peptidases and disaccharidases. Clinica chimica acta;
international journal of clinical chemistry. 112:205-212.
Skovbjerg, H., H. Sjostrom, and O. Noren. 1981. Purification and characterisation of amphiphilic
lactase/phlorizin hydrolase from human small intestine. European journal of biochemistry /
FEBS. 114:653-661.
Slatko, B.E., J. Kieleczawa, J. Ju, A.F. Gardner, C.L. Hendrickson, and F.M. Ausubel. 2011. "First
generation" automated DNA sequencing technology. Current protocols in molecular biology /
edited by Frederick M. Ausubel ... [et al.]. Chapter 7:Unit7.2.
Song, K.M., M. Okuyama, M. Nishimura, T. Tagami, H. Mori, and A. Kimura. 2013. Aromatic residue
on beta-->alpha loop 1 in the catalytic domain is important to the transglycosylation
specificity of glycoside hydrolase family 31 alpha-glucosidase. Bioscience, biotechnology, and
biochemistry. 77:1759-1765.
Spodsberg, N., R. Jacob, M. Alfalah, K.P. Zimmer, and H.Y. Naim. 2001. Molecular basis of aberrant
apical protein transport in an intestinal enzyme disorder. The Journal of biological chemistry.
276:23506-23510.
Surma, M.A., C. Klose, and K. Simons. 2012. Lipid-dependent protein sorting at the trans-Golgi
network. Biochimica et biophysica acta. 1821:1059-1067.
Szul, T., and E. Sztul. 2011. COPII and COPI traffic at the ER-Golgi interface. Physiology (Bethesda,
Md.). 26:348-364.
Tan, S., H.T. Tan, and M.C. Chung. 2008. Membrane proteins and membrane proteomics. Proteomics.
8:3924-3932.
Tarentino, A.L., and T.H. Plummer, Jr. 1994. Enzymatic deglycosylation of asparagine-linked glycans:
purification, properties, and specificity of oligosaccharide-cleaving enzymes from
Flavobacterium meningosepticum. Methods in enzymology. 230:44-57.
Terrin, G., R. Tomaiuolo, A. Passariello, A. Elce, F. Amato, M. Di Costanzo, G. Castaldo, and R.B.
Canani. 2012. Congenital diarrheal disorders: an updated diagnostic approach. International
journal of molecular sciences. 13:4168-4185.
Treem, W.R. 1995. Congenital sucrase-isomaltase deficiency. Journal of pediatric gastroenterology
and nutrition. 21:1-14.
Treem, W.R. 1996. Clinical heterogeneity in congenital sucrase-isomaltase deficiency. J Pediatr.
128:727-729.
103
Chapter 4: Discussion
Treem, W.R. 2012. Clinical aspects and treatment of congenital sucrase-isomaltase deficiency.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:S7-13.
Trombetta, E.S., K.G. Fleming, and A. Helenius. 2001. Quaternary and domain structure of
glycoprotein processing glucosidase II. Biochemistry. 40:10717-10722.
Trombetta, E.S., J.F. Simons, and A. Helenius. 1996. Endoplasmic reticulum glucosidase II is composed
of a catalytic subunit, conserved from yeast to mammals, and a tightly bound noncatalytic
HDEL-containing subunit. The Journal of biological chemistry. 271:27509-27516.
Tsukita, S., M. Furuse, and M. Itoh. 2001. Multifunctional strands in tight junctions. Nature reviews.
Molecular cell biology. 2:285-293.
Uhrich, S., Z. Wu, J.Y. Huang, and C.R. Scott. 2012. Four mutations in the SI gene are responsible for
the majority of clinical symptoms of CSID. Journal of pediatric gastroenterology and nutrition.
55 Suppl 2:S34-35.
Vagin, O., J.A. Kraut, and G. Sachs. 2009. Role of N-glycosylation in trafficking of apical membrane
proteins in epithelia. American journal of physiology. Renal physiology. 296:F459-469.
Valentina, R., A. Marwan, Z. Klaus-peter, S. Jacques, J. Ralf, and Y.N. Hassan. 2003. Congenital
sucrase-isomaltase deficiency because of an accumulation of the mutant enzyme in the
endoplasmic reticulum. Gastroenterology. 125:16781685.
Vallaeys, L., S. Van Biervliet, G. De Bruyn, B. Loeys, A.S. Moring, E. Van Deynse, and L. Cornette. 2013.
Congenital glucose-galactose malabsorption: a novel deletion within the SLC5A1 gene.
European journal of pediatrics. 172:409-411.
Van den Steen, P., P.M. Rudd, R.A. Dwek, and G. Opdenakker. 1998. Concepts and principles of Olinked glycosylation. Critical reviews in biochemistry and molecular biology. 33:151-208.
van der Flier, L.G., and H. Clevers. 2009. Stem cells, self-renewal, and differentiation in the intestinal
epithelium. Annual review of physiology. 71:241-260.
van der Kamp, M.W., and V. Daggett. 2010. Influence of pH on the human prion protein: insights into
the early steps of misfolding. Biophysical journal. 99:2289-2298.
Venier, R.E., and S.A. Igdoura. 2012. Miglustat as a therapeutic agent: prospects and caveats. Journal
of medical genetics. 49:591-597.
Vereecke, L., R. Beyaert, and G. van Loo. 2011. Enterocyte death and intestinal barrier maintenance
in homeostasis and disease. Trends in molecular medicine. 17:584-593.
Vriezinga, S.L., J.J. Schweizer, F. Koning, and M.L. Mearin. 2015. Coeliac disease and gluten-related
disorders in childhood. Nature reviews. Gastroenterology & hepatology. 12:527-536.
Wahab, P.J., J.W. Meijer, and C.J. Mulder. 2002. Histologic follow-up of people with celiac disease on
a gluten-free diet: slow and incomplete recovery. American journal of clinical pathology.
118:459-463.
Weijers, H.A., K.J. va de, D.A. Mossel, and W.K. Dicke. 1960. Diarrhoea caused by deficiency of sugarsplitting enzymes. Lancet (London, England). 2:296-297.
Welsh, J.D., J.R. Poley, M. Bhatia, and D.E. Stevenson. 1978. Intestinal disaccharidase activities in
relation to age, race, and mucosal damage. Gastroenterology. 75:847-855.
Welsh, M.J., and A.E. Smith. 1993. Molecular mechanisms of CFTR chloride channel dysfunction in
cystic fibrosis. Cell. 73:1251-1254.
Werner, N.S., R. Windoffer, P. Strnad, C. Grund, R.E. Leube, and T.M. Magin. 2004. Epidermolysis
bullosa simplex-type mutations alter the dynamics of the keratin cytoskeleton and reveal a
contribution of actin to the transport of keratin subunits. Mol Biol Cell. 15:990-1002.
West, L.F., M.B. Davis, F.R. Green, R.H. Lindenbaum, and D.M. Swallow. 1988. Regional assignment of
the gene coding for human sucrase-isomaltase (SI) to chromosome 3q25-26. Annals of
human genetics. 52:57-61.
Wetzel, G., M. Heine, A. Rohwedder, and H.Y. Naim. 2009. Impact of glycosylation and detergentresistant membranes on the function of intestinal sucrase-isomaltase. Biol Chem. 390:545549.
104
Chapter 4: Discussion
William, R.T. 2012. Clinical aspects and treatment of congenital sucrase-isomaltase deficiency.
Journal of pediatric gastroenterology and nutrition. 55 Suppl 2:13.
Williams, D.B. 2006. Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic
reticulum. J Cell Sci. 119:615-623.
Wujek, P., E. Kida, M. Walus, K.E. Wisniewski, and A.A. Golabek. 2004. N-glycosylation is crucial for
folding, trafficking, and stability of human tripeptidyl-peptidase I. The Journal of biological
chemistry. 279:12827-12839.
Yan, A., and W.J. Lennarz. 2005. Unraveling the mechanism of protein N-glycosylation. The Journal of
biological chemistry. 280:3121-3124.
Yang, C., H. Wang, D. Zhu, C.S. Hong, P. Dmitriev, C. Zhang, Y. Li, B. Ikejiri, R.O. Brady, and Z. Zhuang.
2015. Mutant glucocerebrosidase in Gaucher disease recruits Hsp27 to the Hsp90 chaperone
complex for proteasomal degradation. Proceedings of the National Academy of Sciences of
the United States of America. 112:1137-1142.
Yeaman, C., A.H. Le Gall, A.N. Baldwin, L. Monlauzeur, A. Le Bivic, and E. Rodriguez-Boulan. 1997. The
O-glycosylated stalk domain is required for apical sorting of neurotrophin receptors in
polarized MDCK cells. J Cell Biol. 139:929-940.
Zauner, G., R.P. Kozak, R.A. Gardner, D.L. Fernandes, A.M. Deelder, and M. Wuhrer. 2012. Protein Oglycosylation analysis. Biol Chem. 393:687-708.
Zeitouni, N.E., S. Chotikatum, M. von Kockritz-Blickwede, and H.Y. Naim. 2016. The impact of hypoxia
on intestinal epithelial cell functions: consequences for invasion by bacterial pathogens.
Molecular and cellular pediatrics. 3:14.
Zhang, L., M. Shimoji, B. Thomas, D.J. Moore, S.W. Yu, N.I. Marupudi, R. Torp, I.A. Torgner, O.P.
Ottersen, T.M. Dawson, and V.L. Dawson. 2005. Mitochondrial localization of the Parkinson's
disease related protein DJ-1: implications for pathogenesis. Human molecular genetics.
14:2063-2073.
Zheng, W., J. Padia, D.J. Urban, A. Jadhav, O. Goker-Alpan, A. Simeonov, E. Goldin, D. Auld, M.E.
LaMarca, J. Inglese, C.P. Austin, and E. Sidransky. 2007. Three classes of glucocerebrosidase
inhibitors identified by quantitative high-throughput screening are chaperone leads for
Gaucher disease. Proceedings of the National Academy of Sciences of the United States of
America. 104:13192-13197.
Zhu, Z., and H. Desaire. 2015. Carbohydrates on Proteins: Site-Specific Glycosylation Analysis by Mass
Spectrometry. Annual review of analytical chemistry (Palo Alto, Calif.). 8:463-483.
105
Chapter 5
Conclusion
Chapter 5: Conclusion
In our current age of food sensitivities and intolerances, it is has become more and
more apparent that we need a better understanding of the molecular and cellular processes that
drive the digestion of specific foods, and the mechanisms by which these processes may be
disturbed in digestive diseases. This study focused on and elucidated several aspects of the
carbohydrate malabsorption disease, CSID, and provided a link between deficient enzymatic
function and the biochemical cause behind it. Novel mutations within the human SI gene
coding region of patients with clinically confirmed CSID were classified into three distinct
biosynthetic phenotypes with a different molecular pathogenicity on the human SI function.
The phenotypes were defined depending on the effect of a mutation on trafficking, folding,
enzyme activity and lipid rafts association during the biosynthesis of SI in mammalian cells.
The significance of this report is that it expands the current knowledge on the cellular
and molecular basis of congenital sucrase-isomaltase deficiency as well as of similar
malabsorption or protein trafficking disorders. The general trend is moving away from
invasive and costly procedures for diagnosing CSID, such as biopsies, and moving towards
faster and more accurate screenings based on the highly evolving genomic sequencing field in
combination with molecular methods. A detailed analysis of the mutations and their resulting
biosynthetic phenotypes would contribute to the establishment of more efficient diagnostic
methods.
Ultimately, these findings can be used to create treatments tailored to the specific
biochemical dysfunction. For example, SI variants from phenotypes II and III with a
biological activity but with no or delayed cell surface transport could be potential targets for a
customized therapy using chemical or pharmacological chaperones. This could help improve
the quality of life of patients suffering from CSID or other malabsorption disorders.
So far, the structure-function properties of SI are not completely resolved. A resolution
of these properties may give better insights into the physiological function of SI and its
association in pathological conditions like CSID. The single active site properties of SI are
characterized by specific mutational inactivation of aspartic acid in catalytic sites of the SI
protein with normal transport and folding. This study experimentally demonstrated that the
substrate catalysis by SI is regulated by four aspartic acid residues in the two catalytic sites of
sucrase-isomaltase. Mutations of these amino acids are directly connected to a loss of SI
activities.
Over the course of this study, several findings came to light that not only apply to
107
Chapter 5: Conclusion
CSID, but possibly to other diseases as well. In fact, my results led to the suggestion of a
novel mechanism for sucrase-isomaltase, called product inhibition, that may also be involved
in the regulation of blood glucose levels.
Altogether, the results of this study provide better insights into the sucrase-isomaltase
catalytic properties during digestion of dietary carbohydrates in humans, and into the
molecular basis of impaired SI function during the pathogenesis of congenital sucraseisomaltase deficiency. This may aid in the diagnosis of CSID as well as that of related
diseases, and may help find new targets for improved therapy.
108
Chapter 6
Appendix
Chapter 6: Appendix
6.1 Supplementary figure
Figure S 6.1 Amino acid sequence and internal homology of human SI. Comparison of the
amino acid sequence of isomaltase and sucrase subunits by a sequence alignment. Identical
amino acids are highlighted in grey. The catalytic consensus motifs of SI are framed in black.
The amino acid residues targeted by the studied novel mutations that were found in CSID
patients are highlighted by a red box. CYT: cytosotlic tail, TM: transmembrane sequence, ISO:
isomaltase, SUC: sucrase.
110
Chapter 6: Appendix
6.2 Affidavit
I herewith declare that I autonomously carried out the PhD-thesis entitled "Molecular basis of
the heterogeneity in congenital sucrase-isomaltase deficiency".
No third party assistance has been used.
I did not receive any assistance in return for payment by consulting agencies or any other
person. No one received any kind of payment for direct or indirect assistance in correlation to
the content of the submitted thesis.
I conducted the project at the following institution: Department of Physiological
Biochemistry, University of Veterinary Medicine Hannover, Germany.
The thesis had not been submitted elsewhere for an exam, as thesis or for evaluation in a
similar context.
I hereby affirm the above statements to be complete and true to the best of my knowledge.
date, signature
111
Chapter 6: Appendix
6.3 Acknowledgement
First of all, I want to express my special appreciation to Prof. Hassan Y. Naim for offering me
the environment to perform my research within the Department of Physiological Chemistry
and for supervision of my PhD study. I am very grateful for many constructive discussions,
good advice and for the great chance to participate in several national and international
conferences.
I want to extend my gratitude to Prof. Pablo Steinberg and Prof. Klaus-Peter Zimmer for their
valuable contributions as member of my advisory committee, for their helpful suggestions and
comments as well as for the fruitful discussions.
I am very grateful to Dr. Mahdi Amiri for the cooperation in different projects, for his advice
and for sharing his experience with me.
My sincerest thanks also go to Prof. Maren von Köckritz-Blickwede for her kind and valuable
support at different points during my PhD studies.
I am very grateful to all former and present members of the Department of Physiological
Chemistry who helped me in one or the other way and for the good working climate. It was a
pleasure to meet and work with all of you. In particular, I want to thank Eva, Lena D.,
Melissa, Nat and Sue for always supporting me and making work and life easier.
I would like to thank the Hannover Graduate School for Veterinary Pathology,
Neuroinfectiology, and Translational Medicine (HGNI) for financial support and the HGNI
management and coordination team for helping me out in several questions.
Finally, I would like to thank my family and Flo for continuous support and love.
112