Biological Journal of the Linnean Society (2001), 73: 131-138. With 2 figures
doi: l0.1006/bij1.2001.0530, available online a t httpd/www.idealibrary.com on
@
I DE b!
+.
Patterns of genetic variation in Pacific island land
snails: the distribution of cytochrome b lineages
among Society Island Purtula
@
SARA L. GOODACRE' and CHRISTOPHER M. WADE'
Institute of Genetics, University of Nottingham, Queens Medical Centre, Clifton Boulevard,
Nottingham N G 7 2UH
Received 30 October 2000; accepted for publication 14 February 2001
~
~
~
The radiation of Partula land snails has produced a large array of distinct morphological, ecological and behavioural
types occupying many tropical volcanic islands in the Pacific Ocean. Within the Society Islands of French Polynesia,
the mode of evolution is thought to have involved a single colonization event on each island, with later speciation
occurring largely in situ. The present study examines genetic variation in the mitochondrial cytochrome b gene
among taxa within the Society Island archipelago. Levels of intraspecific variation are found to be high, but variation
among species is sometimes small. Mitochondria1 variants do not always cluster according to island and some
species are found to be polyphyletic in the cytochrome b tree, despite other morphological and molecular evidence
that strongly supports their monophyly. A possible explanation for the polyphyly of species is that different variants
are derived from ancestral mitochondrial polymorphisms that have been retained despite speciation events. Although
it is possible that there has been some gene flow among islands, the distribution of mitochondrial lineages across
islands strongly indicates that their origins predate the colonization of the islands in the study, and that they are
very unlikely to have evolved entirely in situ.
0 2001 The Linnean Society of London
ADDITIONAL KEYWORDS: intraspecific variation - Partula - cytochrome b phylogeny - ancestral polymorphisms.
INTRODUCTION
Partula land snails from the islands of the Pacific have
been the subjects of study by evolutionary biologists
for more than one hundred years, and have refined our
understanding of adaptation and speciation (Garrett,
1884; Crampton, 1916, 1925, 1932; Clarke & Murray,
1969; Johnson, Murray & Clarke, 1993). The snails
are widespread on the high islands of the Pacific from
Belau in the west to the Austral Islands in the southeast. Some of the best-studied species come from the
Society Island archipelago in French Polynesia (Johnson et al., 1993). The Society Islands were formed
successively by volcanic activity, as the Pacific plate
moved over a hot spot in the earth's mantle (Duncan
& McDougall, 1976). Partula species are endemic to
' Corresponding author. Present address: Institute of Molecular
Medicine, University of Oxford OX3 9DS.
E-mail: [email protected]
Present address: Department of Zoology, The Natural History
Museum, Cromwell Road, London SW7 4BD.
0024-4066/01/050131+08 $35.00/0
single islands within the archipelago and the species on
each island are thought to be the result of independent
radiations, rather than multiple colonizations (Johnson, Murray & Clarke, 1986). Allozyme and morphological data suggest that the islands were colonized
in chronological order, although recent re-analysis of
the allozyme data suggests that there may have been
some subsequent migration between Tahiti and the
southern part of Moorea (Clarke, Johnson & Murray,
1996).
There is much variation in shell shape, colour and
banding pattern within the Society Islands. High levels
of variation exist even within species, yet populations
of different species can share similar characteristics.
Partula turgidu and some populations of l? taeniata
exhibit a suite of correlated characters; thin shells,
colourful variations in the mantle pigmentation that
shows through the shell, long tentacles and sticky
mucus. Partula otaheitana, F! nodosa and some populations of F! suturalis have shells that are very similar
to each other in shape, colour and banding pattern.
The fact that similar characteristics can be shared by
131
0 2001 The Linnean Society of London
132
S. L. GOODACRE and C. M. WADE
MATERIAL AND METHODS
'
Tupai
Tahaa
0
2.9 Huahine
Bora Bora Q
3.2
Maupiti
9"'4
Raiatea
Tetiaroa
2.4
tJ
Moorea
Tahiti
SAMPLE COLLECTION
Specimens and their localities are listed in Table 1.
Many partulids are now thought to be extinct in the
wild (Cowie, 1992), and the only available specimens
had been stored a t -20°C for up to 18 years before
use. Several of the more recent samples had been
stored in ethanol.
W
Maiao
Figure 1. Map showing the Society Islands of French
Polynesia in the South Pacific Ocean. The centre of the
map is at approximately 17" latitude, 150" longitude.
Numbers indicate the approximate ages of islands in
millions of years (taken from Duncan & McDougall, 1976).
otherwise distinct taxa on adjacent islands suggests
either that they have evolved in parallel or that there
has been movement of snails between islands. Recent
studies demonstrate that parallel evolution of different
shell-thickness types has occurred between partulid
genera (Johnson, Murray & Clarke, 2000; Goodacre &
Wade, 2001).
In addition to the observation that particular phenotypic characteristics are shared among islands, a previous study found that two mitochondrial RFLP
haplotypes were present in both Tahitian and Moorean
taxa (Murray, Stine &Johnson, 1991).The distribution
of these shared variants among species on each of
the islands suggested that either loss of ancestral
mitochondrial polymorphisms is slower than the rate of
speciation, or that the haplotypes represent selectively
favoured states, with individual restriction sites departing from and returning to the norm.
The present study continues from that based upon
the mitochondrial RFLP data (Murray et al., 1991). It
uses mitochondrial DNA sequences to examine further
the levels of genetic variation that exist within Partula
species, and to investigate the manner of their radiation within the Society Islands, by reconstructing
evolutionary relationships between different mitochondrial variants. Twenty-nine sequences from 19
different taxa are included in the analysis, encompassing species from the islands of Raiatea, Huahine,
Moorea and Tahiti (Fig. 1). Species from Guam, Saipan,
Aguijan and the New Hebrides, far to the west of the
Society Islands, are also included in the analysis for
comparison, and for use as a possible outgroup.
DNA EXTRACTION, PCR AND SEQUENCING
To overcome problems of PCR inhibition caused by the
presence of mucopolysaccharides contaminating the
DNA, extraction was performed using CTAB (hexadecyltrimethylammonium bromide). For each sample
a small piece of foot tissue (approximately 25mm3)
was sliced finely, placed in 300 p1 of 100 mM TrisHC1, 1.4M NaC12, 20mM EDTA, 2% CTAB, 0.2% pmercaptoethanol, with 0.01 mg Proteinase K, and incubated a t 60°C for 2-3 hours, shaking vigorously every
hour. Proteins were removed using 300 p1 chloroform,
centrifuging a t 13000 rpm for 15min and then taking
the aqueous layer for two further extractions with
3 0 0 ~ 11:l liquid phenovchloroform mix, and a final
extraction using 300p1 chloroform. DNA was precipitated using two volumes of 100% ice cold ethanol,
left on ice for 10min and pelleted by spinning a t
13000 rpm for 15min. The pellet was then washed in
70% ethanol, dried, resuspended in 50 p1 distilled water
and stored a t -20°C. l p 1 was used as a template for
PCR reactions.
A single pair of primers was used to amplify 686
nucleotides, comprising 635 base pairs (bp) of the
cytochrome b coding sequence and 51 bp of non-coding
sequence a t the 3' end of the gene. Primers were
designed from sequences of cloned Partula mitochondrial DNA (Goodacre, unpublished data). The
primer sequences (5'-3') were as follows: CYTB1:TAGGACAACAAGTCAAATATG, CYTB2:GGTCUATATCTTITTGAGG.
All PCR reactions were carried out in a total volume
of 50p1 containing 1 unit of Taq DNA polymerase
(Boehringer Mannheim), 2.5 mM MgC12, 0.5 mM of
each dNTP, 400nM of each primer, in a buffer of
10 mM Tris-HC1,500mM KCl pH 8.3 (20°C). An initial
denaturation a t 94°C for l m i n was followed by 35
cycles of denaturation a t 94°C for 30s, annealing a t
55 or 50°C for 20 s, and extension a t 72°C for 30 s. The
lower annealing temperature was used where PCR
amplification did not produce enough product a t the
higher temperature. PCR products were prepared for
sequencing with QIAGEN columns. Approximately
50 ng in 10 pl distilled water was used for automated
sequencing reactions, which were carried out using
Perkin Elmer dRhodamine sequencing mix.
GENETIC VARIATION IN PARTULA
133
a b l e 1. Specimens and their localities. Species authorities are given in brackets. Where more
than one specimen from a species is included in the analysis, an identifying number is given
after the species name. All Tahitian, Huahine and Moorean snails were collected by Professor
B. C. Clarke, Professor J.J. Murray and Dr M. S. Johnson. €? tristis and €? hebe from Raiatea
were collected by Mr D. Clarke. Partula l a d o r d i , €? radiolata and €? gibba were provided by
Miss S. Wells. l? turneri was collected by Professor W. Sutherland
Species
WESTERN
PACIFIC
l? gibba (Ferussac)
l? radiolata (Pfeiffer)
I! langforcli (Kondo)
I! turneri (Pfeiffer)
F!
l?
l?
l?
l?
Saipan (Navy Hill)
Guam (Tumon Bay)
Aguijan, Mariana Islands
Tanna Island, New Hebrides
tristis (Crampton and Cooke)
turgida (Pease)
hebe (Pfeiffer)
msea (Broderip)
uaria (Broderip)(1)
(2)
l? mirabilis (Crampton)
l? mooreana (Hartman) (1)
(2)
l? suturalis (Pfeiffer) (1)
(2)
(3)
(4)
l? taeniata (Morch) (1)
(2)
(3)
E! tohiueana (Crampton)
l? clara (Pease)
E! affinis (Pease) (1)
(2)
l? filosa (Pfeiffer) (1)
(2)
E! nodosa (Pfeiffer)
P otaheitana (Bruguiere) (1)
(2)
PHYLOGENETIC ANALYSIS
Sequences were aligned manually within the GDE
data analysis package (Smith et al., 1994). DNA-based
phylogenetic analyses were performed using version
4d65 of PAUP* (Swofford, 1999) and were based on
682 unambiguously aligned nucleotide sites. Positions
1-634 were in the cytochrome b gene itself and positions 635-682 were in the 3’ flanking region. Phylogenies were reconstructed using maximum likelihood
(Felsenstein, 198l), neighbour-joining (Saitou & Nei,
1987), and maximum parsimony Pitch, 1971). For
maximum likelihood and neighbour-joining methods
correction for multiple hits was performed using the
general time reversible (GTR) model incorporating
rate variation between sites. The rate matrix, base
SOCIETY
ISLANDS
Raiatea (Tevaitoa valley)
(Tevaitoa valley)
(Hotopuu valley)
Huahine (Mahuti valley)
(Mouatapu valley)
(Mouatapu valley)
Moorea (Fareaito valley)
(Atimaha valley)
(Maatea valley)
(l? s. vexillurn, Aareo valley)
(l? s. strigosa, Mount Ahutau)
(l? s. vexillurn, Faatoai valley)
(l? s. uexillurn, Fareaito valley)
(l? t. nucleola, Aareo valley)
(l? t. ekmgata, Mount Ahutau)
(l? t. simulans, Hotutea valley)
(Fareaito valley)
Tahiti (Tereehia valley)
(Mahaena valley)
(Tiarei valley)
(Pirae valley)
(Plrae valley)
(Papehue valley)
(Vaihiria valley)
(Papenoo valley)
frequencies, proportion of invariant sites and shape
parameter (alpha value) for the gamma distribution,
based on 16 rate categories, were estimated by likelihood using iteration from an initial neighbour-joining
tree. Parameters estimated from the initial tree were
then used to make a new neighbour-joining tree. The
parameters were then re-estimated, and the process
repeated until no further improvement in likelihood
was observed. In addition to applying a gamma distribution to all sites, rate variation a t specific codons
was also examined by estimating separate rates for
first, second and third codon positions, and for noncoding sites. Tree searching for maximum likelihood
and maximum parsimony used a heuristic procedure
with tree-bisection-reconnection branch swapping.
134
S. L. GOODACRE and C. M. WADE
The translation of cytochrome b sequences into
amino acids was done using the genetic code of the
land snail C. nemoralis (Terrett, Miles & Thomas,
1994). This differs from the universal code in that
ATA specifies methionine rather than isoleucine, TGA
specifies tryptophan rather than termination and the
rare codons AGA and AGG are thought t o specify serine
rather than termination. The program CLUSTAL-WP
was used t o calculate maximum likelihood trees from
the amino acid sequence data, based on a Dayhoff
matrix of amino acid substitution, and entering several
values between 0.1 and 2 to describe the shape parameter for rate variation.
No suitable outgroup cytochrome b sequence is currently available for Partula. The phylogeny is therefore
presented unrooted. Bootstrap resampling (1000 replicates, Felsenstein, 1985) was used t o assign support
to particular branches within the tree. Alternative
phylogenetichypotheses were evaluated using the likelihood-ratio test of Kishino & Hasegawa (1989) in
PAUP*.Alternative trees were generated under a given
topological constraint, but allowing for the optimization of the tree by rearrangement of the unconstrained taxa. The likelihood of the optimal tree
generated under a specific constraint was then compared t o that of the actual (unconstrained) tree obtained from maximum likelihood analyses.
NUCLEOTIDE SEQUENCE ACCESSION NUMBERS
Nucleotide sequences reported in this study have been
assigned the GenBank accession numbers AF350882
to AF350910.
RESULTS
VARIATION IN CYTOCHROME b SEQUENCES
Sequences were obtained from 29 individuals of 19
species of Partula: 265 out of 682 unambiguously
aligned sites were found to be variable, of which 255
were in the cytochrome b protein-coding region. The
overall mean GC content for the sequences was 29%
(range 27%/6-30%) and at first and second codon positions was 35% (range 23%38%). The mean transiti0n:transversion ratio was 2.7 (range 1.8-8.0). Each
sequence encodes 211 amino acids, 57 of which were
observed t o be variable. Termination is by the codon
TAG in all specimens apart from rl tristis and I?
turgida, where TAA is used. Twenty-four amino acid
replacements in the Partula alignment involve the
hydrophobic residues leucine, isoleucine and valine
and 16 involve other amino acid replacements of equal
charge. Seventeen involve replacements of unequal
charge. Variable sections of the alignment are interspersed with highly conserved areas. This agrees
with previous studies on mammalian cytochrome b
genes, which show that variable regions containing
hydrophobic residues (thought to be located in membranes) are interspersed by parts of the protein that
are more constrained (Irwin, Kocher & Wilson, 1991;
Howell, 1989).
Maximum likelihood estimates of the gamma shape
parameter (a)and the proportion of invariant sites
(pinvar) were 1.8 and 0.55 respectively. The values
indicate that approximately half the sites are conserved, and that the rate of change of the remaining
sites can be approximated by a normal distribution
with a small standard deviation. Partitioning the data
into separate rate categories for different codon positions, and estimating rates using maximum likelihood, gave values for codon positions 1, 2, 3 and
non-coding positions of 0.437, 0.098, 2.640 and 0.199
respectively. Values of 2<1<<3 are expected because of
the pattern of degeneracy in the genetic code. Estimates of genetic distance, calculated using the 6parameter, general time reversible model reveal a large
degree of variability overall (up to 37%), with a mean
value of 24%. These values are consistent with the
levels of mitochondria1 variation found in other land
snails such as Cepaea nemoralis (Thomaz, Guiller &
Clarke, 1996), and at other mitochondrial loci in Partula (Goodacre, 2001). Genetic distances between mitochondrial sequences from the same species may be
greater than between those from different species. The
levels of diversity within species ranges from 0% to
31%. Between species, levels of diversityrange between
18%and 37%.
CYTOCHROME b PHYLOGENETIC ANALYSIS
A maximum likelihood phylogeny incorporating 28
sequences from 18 Partula species is presented in
Figure 2. The tree shows a number of groups that are
supported by high bootstrap values and which are
consistently resolved by all methods of constructing
trees (Fig. 2, boxed, shaded areas). These groups are
also resolved in analyses of the amino acid sequences
(data not shown). The first group includes the Tahitian
species, rl filosa and l? otaheitana, and is supported
in 70% of bootstrap replicates. Group 2, supported in
95% of bootstrap replicates, contains sequences of the
Moorean species F! mirabilis, l? suturalis and F!
taeniata, and the Tahitian species l? affinis and l?
otaheitana. F! nodosa from Tahiti also shows an association with this group, but with only 53% bootstrap
support. The third group contains two Moorean specimens of l? suturalis and is supported in 100% of
replicates. Group 4, also supported in 100%of bootstrap
replicates, includes the Moorean taxa F! mooreana, rl
taeniata, and 19 tohiueana as well as l? Clara from
Tahiti. l? suturalis 2 and F! taeniata 3 (Fig. 2, underlined) come from the south of Moorea, where populations are thought, (based largely on allozyme data),
GENETIC VARIATION IN PARTULA
l? tristis
135
W T E A
P nffinic 1
MOORFA
) TAHITI
LI
I
l? nodosn
TAHITI
200
1)
I? suturdis 3
K*utudi84
M001WA
SOCIETY ISLANDS
.MOOREA
-
r
I
10
-I?
I! tolriueam
clam
l? rosea
I
l? hebe
TAHITI
I
HUAHINE
.____..........P. turgida
C'
l? langfordi AGUIJAN
l? radiolata
GUAM
Pgibba
SAIPAN
l? turneri
-
)
RAIATEA
NEW HEBRIDES
WESTERN PACIFIC
10% divergence
Figure 2. Evolutionary tree of mitochondrial cytochrome b sequences. The tree was constructed using maximum
likelihood (682 sites, ci = 1.8, pinvar = 0.55). Values on the tree indicate the support (9'0) for individual branches in 1000
bootstrap replicates based on a neighbour-joining tree (only values above 70% are shown). Figures in bold show the
bootstrap values for groups (shaded areas) that are consistently supported in all types of analysis. The dashed line
shows the position of l? turgida based on 599 sites in the cytochrome b gene (data are missing from 83 base pairs in
the middle of the gene). The overall structure of the tree based on these 599 sites is similar to that for the entire
region. The tree is not rooted because there is no suitable outgroup. l? suturalis and l? taeniata from the south of
Moorea, where some back-migration from Tahiti is thought to have occurred, are underlined.
to have hybridized with recent invaders from Tahiti.
These two individuals cluster separately in groups 2
and 4. The final group contains two l? varia sequences
from Huahine (100%bootstrap support) and shows a n
association with l? msea, also from Huahine. Elsewhere, evolutionary relationships are less well resolved; however the western species of Partula appear
to be distinct from the Society Island taxa.
Several species (l? affinis, l? otaheitana, l? suturalis
and P taeniata) are polyphyletic, with conspecific sequences falling into different terminal groups (Fig.
2). Moreover, mitochondria1 sequences from the same
island cluster separately from one another, the
Moorean and Tahitian sequences each falling into three
distinct terminal groups. Raiatean sequences appear
also to occupy two positions in the tree (though bootstrap support for their placement is weak). The Kishino-Hasegawa test was used to test alternative tree
topologies that assume species are not polyphyletic, or
that require sequences from the same island to group
together. The most likely trees produced under these
individual constraints were found to be less likely than
the unconstrained tree (P<O.Ol in each case).
The Partula studied in the analysis include representatives of both the 'thin-shelled' and 'thickshelled' suites of characters. The thin-shelled specimens l? taeniata 2 from Moorea and €? tulgida from
Raiatea group separately in the tree (Fig. 2, bold). The
former groups with the thick-shelled taxa l? suturalis
and I? otaheitana. The latter groups most closely with
the thick-shelled l? hebe, also from Raiatea, based on
a partial alignment of 599 sites (data are missing from
a n 83 base-pair section in the middle of this sequence).
I? suturalis and l? otaheitam closely resemble each
other in shell-shape and colour but again, their sequences do not all cluster together in the tree.
136
S. L. GOODACRE and C. M. WADE
DISCUSSION
Snails of the genus Partula are found on islands
throughout the Pacific. There is a high level of endemism, and individual islands often have many species (Pilsbry, 1909-1910). Little is known about how
land snails colonize remote islands, but possible mechanisms include trans-oceanic dispersal assisted by typhoons, on rafts of vegetation or on the feet of birds.
Since land snails have a low mobility and poor tolerance
t o salt water, natural colonization events are likely
to be relatively rare, with distance from the source
determining their likelihood. Within archipelagos, colonizations are likely to have been in the order of
island age, with founder individuals coming from older
islands in the group. In the Society Islands, data on
Partula shell-colours,banding patterns and allozymes
are consistent with this model (reviewed in Johnson
et al., 1993).
The present analysis of the cytochrome b gene demonstrates that there is a high degree of genetic variation in the mitochondrial DNA of Partula, even within
a species. Data on nuclear DNA, allozymes, morphology, behaviour and ecology all support the existing
classification of species (Johnson et al., 1993; Goodacre
& Wade, 2001). Nevertheless, sequences from several
individual Tahitian and Moorean Partula species do
not cluster together in the mitochondrial cytochrome
b gene tree, and these species thus appear to be polyphyletic. Moreover, mitochondrial sequences do not
always cluster together according to island, with some
variants clustering with those from other islands.
Given that there is good evidence to support current
species definitions, the apparent polyphyly of individual species and the clustering together of sequences from different islands can be explained in one
of two ways. The first explanation is that different
mitochondrial variants are derived from polymorphisms in an ancestor predating both the origins
of individual species and the colonization events themselves. The second explanation is that inter-specific
and inter-island gene flow either recently or in the
past has obscured true historical relationships between
species. Both these hypotheses are considered below.
The Society Island archipelago is young in evolutionary terms (less than 5 million years old), with
Tahiti and Moorea, the two youngest islands, dated
at 1 and 1.5 million years respectively (Duncan &
McDougall, 1976). As speciation is thought t o have
occurred largely in situ, island age suggests that Tahitian and Moorean Partula species are likely to have
originated relatively recently, with little time for divergence between the two sets of taxa. Retention of
ancestral polymorphisms between Tahitian and
Moorean species is an attractive hypothesis to explain
lineage sharing in such a recently diverged group of
species, and is consistent with a previous study, which
found at least one mitochondrial lineage to be distributed over both Tahiti and Moorea (Murray et al.,
1991). Mitochondria1 variants found in Tahitian and
Moorean Partula could have evolved on older islands
in the archipelago such as Raiatea or Huahine, or they
might even predate colonization of the archipelago as
a whole. Although not supported by a high bootstrap
value, the association between Raiatean I? tristis and
a single Tahitian l? affirzis variant is consistent with
variants not having evolved on either Tahiti or Moorea.
Retention of polymorphisms may also account for the
extremely high level of genetic diversity observed in
the mitochondrial cytochrome b gene, since if alleles
predate species divisions, they have had much longer
to diverge than the age of the species (as inferred from
the age of the island on which they are found) suggests.
A similar argument has been proposed t o explain the
high levels of genetic diversity observed in the mitochondrial genes of other land snails, such as Cepaea
nemoralis in Britain (Thomaz et al., 1996).
The alternative explanation for the distribution of
mitochondrial lineages in Partula is that there has
been genetic exchange between taxa. Although there
is clear evidence from morphological, behavioural and
molecular studies to support current species definitions
(Johnson et al., 1993),gene flow (‘molecularleakage’) is
thought to occur between some closely-relatedMoorean
Partula (Clarke & Murray, 1969 Clarke et al., 1996)
and may also be possible between Tahitian taxa
(Murray & Clarke, 1980). However, in order for gene
flow to explain the entire pattern of genetic diversity
observed in the cytochrome b gene, inter-island genetic
exchanges need t o be relatively common because mitochondrial types from one island cluster with those
from another. Even assuming that hybridization occurs
readily between species found on separate islands,
there is no evidence that transit between islands is
common. Even in a specific instance (Clarke et al.,
1996), where other data suggest that genetic exchange
has occurred between Tahiti and southern Moorea, the
distribution of cytochrome b variants does not appear
to reflect this. The overall distribution of different
mitochondrial variants suggests that whilst there may
have been some gene flow between islands, this cannot
entirely account for the pattern of mitochondrial variation observed. In the absence of evidence for extensive
gene flow between islands, retention of ancestral polymorphisms remains the more likely explanation for
the levels of variation within and between species, and
for the distribution of different mitochondrial lineages.
There are a number of evolutionary mechanisms
that might account for the retention of ancestral mitochondrial polymorphisms in Partula. The first is
selection for different mitochondrial types. Balancing
selection is thought t o explain the sharing of Mhc
GENETIC VARIATION IN PARTULA
class I1 alleles between both closely-relatedcichlid fish
species and between species of rat (Ono et al., 1993;
Seddon & Baverstock, 2000). In each case, different
Mhc lineages are thought to have diverged many millions of years ago and subsequently passed through
numerous speciation events. Similarly, the diversity
of alleles at self-incompatibilty loci that are shared
between different plant species of the Solanaceae (Ioerger, Clark & Kao, 1990) and between different sordariacean fungi m u , Saupe & Glass, 1998)are thought
to be maintained by selection. Selection is not the only
means by which polymorphisms may persist however.
Neutral alleles can be maintained if effective population size is sufficiently large for them to resist elimination by drift and they are randomly sorted at
subsequent speciation events. It is proposed that alleles at putative neutral non-coding loci found to be
distributed amongst different cichlid fish species have
been maintained in this way (Nag1 et aE.,1998).
Either selection or random sorting of neutral alleles
could account for retention of polymorphisms in Partula, but there is little evidence favouring either. Since
colonization events are assumed t o be relatively rare
and founder populations are not thought t o have been
large, many alleles are likely to have been eliminated
through drift. Maintenance of alleles through balancing selection has yet t o be demonstrated however
and the reason for the persistence of different lineages
in Partula therefore remains uncertain.
Retention of ancestral polymorphisms (or gene flow
between taxa) will of course obscure the true evolutionary relationships among species. The mitochondrial cytochrome b gene tree therefore shows the
relationships between mitochondria rather than between organisms and the level at which mitochondria1
genes can be informative about the phylogenetic relationships among partulid snails remains unclear.
Additional genes will be required t o investigate historical relationships among taxa with similar morphological characteristics such as shell thickness,
shape, and colour, in order t o distinguish between the
two opposing hypotheses of convergent evolution and
identity by descent. Future studies may also further
our understanding of why polymorphisms persist during the colonization and speciation of land snails on
Pacific islands.
ACKNOWLEDGEMENTS
We thank Professor Bryan Clarke for his assistance
throughout this project and for critically reading the
manuscript. We also thank Professor Jim Murray, Drs
Mike Johnson, Peter Mordan and Angus Davison for
helpful comments and Mrs. Vivien Frame and the
University of Nottingham for technical assistance. We
are grateful to Professor Murray, Dr Johnson, Professor
137
Clarke and the other sample collectors given in the
legend to Table 1. This work was supported by a
BBSRC studentship t o SLG and a NERC grant t o
Professor Clarke and Dr Mordan.
REFERENCES
Clarke B, Johnson MS, Murray J. 1996. Clines in the
genetic distance between two species of island land snails
- how molecular leakage can mislead us about speciation.
Philosophical Transactions of the Royal Society of London
B 351: 773-784.
Clarke B, Murray J. 1969. Ecological genetics and speciation in land snails of the genus Partula. Biological
Journal of the Linnean Society 1: 3142.
Cowie F W . 1992. Evolution and extinction of Partulidae,
endemic Pacific island land snails. Philosophical Transactions of the Royal Society of London B 335 167-191.
Crampton HE. 1916. Studies on the variation, distribution,
and evolution of the genus Partula. The species inhabiting
Tahiti. Carnegie Institute of Washington Publication 228:
1-311.
Crampton HE. 1925. Studies on the variation, distribution
and evolution of the genus Partula. The species of the
Mariana Islands, Guam and Saipan. Carnegie Institute of
Washington Publication 228A 1-116.
Crampton HE. 1932. Studies on the variation, distribution,
and evolution of the genus Partula. The species inhabiting
Moorea. Carnegie Institute of Washington Publication 410
1-335.
Duncan RA, McDougall I. 1976. Linear volcanism in
French Polynesia. Journal of Volcanic Geotherm Research
I: 197-227.
Felsenstein J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution 17: 368-376.
Felsenstein J. 1985 Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 3 9 783-791.
Fitch WM. 1971. Toward defining the course of evolution:
minimum change for a specified tree topology. Systematic
Zoology 2 0 406416.
Garrett A. 1884. The terrestrial mollusca inhabiting the
Society Islands. Journal of the Academy of Natural Sciences
Philadelphia (Series 2) 9 17-114.
Goodacre SL. 2001. Genetic variation in a Pacific Island
land snail: population history versus current drift and
selection. Proceedings of the Royal Society of London series
B 26& 121-126.
Goodacre SL, Wade CM. 2001. Molecular evolutionary
relationships between partulid land snails of the Pacific.
Proceedings of the Royal Society of London series B 268:
14.
Howell N. 1989. Evolutionary conservation of protein regions
in the proton-motive cytochrome b and their possible roles
in redox catalysis. Journal of Molecular Evolution 29:
157-169.
Ioerger TR, Clark AG, Kao T. 1990. Polymorphism at the
138 S. L. GOODACRE and C. M. WADE
self-incompatibility locus in Solanaceae predates speciation. Proceedings of the National Academy of Sciences
U S A 87: 9732-9735.
Irwin DM, Kocher TD, Wilson AC. 1991. Evolution of
the cytochrome b gene of mammals. Journal of Molecular
Evolution 32: 128-144.
Johnson MS, Murray J, Clarke B. 1986. An electrophoretic
analysis of phylogeny and evolutionary rates in the genus
Partula from the Society Islands. Proceedings of the Royal
Society of London series B 227: 161-177.
Johnson MS, Murray J, Clarke B. 1993. The ecological
genetics and adaptive radiation of Partula on Moorea.
Oxford Surveys in Evolutionary Biology 9 167-238.
Kishino H, Hasegawa M. 1989. Evaluation of the maximum
likelihood estimate of the evolutionary tree topologies from
DNA sequence data, and the branching order in Hominoidea. Journal of Molecular Evolution 29. 170-179.
Johnson MS, Murray J, Clarke, B. 2000. Parallel evolution
in Marquesan partulid land snails. Biological Journal of
the Linnean Society 69: 577-598.
Murray J, Clarke B. 1980. The genus Partula on Moorea:
speciation in progress. Proceedings of the Royal Society of
London series B 211: 83-117.
Murray J, Stine OC, Johnson M S. 1991. The evolution
of mitochondrial DNA in Partula. Heredity 66: 93-104.
Nag1 S, Tichy H, Mayer WE, Takahata N, Klein J. 1998.
Persistence of neutral polymorphisms in Lake Victoria
cichlid fish. Proceedings of the National Academy of Sciences
USA 95: 14238-14243.
Ono H, O’Huigin C, Tichy H, Klein J. 1993. Major-histocompatibility-complex variation in two species of cichlid
fishes from Lake Malawi. Molecular Biology and Evolution
1 0 1060-1072.
Pilsbry HA. 1909-1910. Family Partulidae. In: Manual of
Conchology, vol. 20, 19-114.
Saitou N, Nei M. 1987. The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Molecular
Biology and Evolution 4 406425.
Seddon JM, Baverstock PR. 2000. Evolutionary Lineages
of RT1.Ba in t h e Australian Rattus. Molecular Biology and
Evolution 17: 768-772.
Smith SW, Overbeek R, Woese CR, Gilbert W, Gillevet
PM. 1994. The genetic data environment: An expandable
GUI for multiple sequence analysis. Computational Applied
Bioscience 1 0 671-675.
Swofford DL. 1999. PAUP*. Phylogenetic Analysis Using
Parsimony (*and Other Methods). Version 4. Sunderland,
Massachusetts: Sinauer Associates.
Terrett J, Miles S, Thomas RH.1994. The mitochondrial
genome of Cepaea nemoralis (Gastropoda, Stylommatophora) - Gene order, base composition, and heteroplasmy.
Nautilus 108: 79-84.
Thomaz D, Guiller A, Clarke B. 1996. Extreme divergence
of mitochondrial DNA within species of Pulmonate land
snails. Proceedings of the Royal Society of London series B
263 363-368.
W u J, Saupe SJ, Glass NL. 1998. Evidence for balancing
selection operating at the het-c heterokaryon incompatibility locus in a group of filamentous fungi. Pmceedings of the National Academy of Sciences USA 95:
12398-12403.