J Antimicrob Chemother 2015; 70: 2203 – 2208
doi:10.1093/jac/dkv096 Advance Access publication 17 April 2015
Prevalence of pilus genes in pneumococci isolated from healthy
preschool children in Iceland: association with vaccine
serotypes and antibiotic resistance
Martha Á. Hjálmarsdóttir1,2*, Brynhildur Pétursdóttir1,2, Helga Erlendsdóttir1,2,
Gunnsteinn Haraldsson1,2 and Karl G. Kristinsson1,2
1
Department of Clinical Microbiology, Landspitali University Hospital, Reykjavik, Iceland; 2Faculty of Medicine,
University of Iceland, Reykjavik, Iceland
*Corresponding author. Tel: +354-5254898; Fax: +354-5254898; E-mail: [email protected]
Received 31 October 2014; returned 5 January 2015; revised 23 February 2015; accepted 20 March 2015
Objectives: The objective of this study was to investigate the prevalence of pilus islets [pilus islet 1 (PI-1) and pilus
islet 2 (PI-2)] in pneumococcal isolates from healthy Icelandic preschool children attending day care centres,
prior to the introduction of conjugated pneumococcal vaccine, and the association of the pilus islets with vaccine
serotypes and antibiotic resistance.
Methods: Nasopharyngeal swabs were collected from 516 healthy children attending day care centres in
Reykjavik in March and April 2009. Infant vaccination was started in 2011, thus the great majority of the children
were unvaccinated. Pneumococci were cultured selectively, tested for antimicrobial susceptibility and serotyped.
The presence of PI-1 and PI-2 was detected using PCR.
Results: A total of 398 viable isolates were obtained of which 134 (33.7%) showed the presence of PI-1.
PI-1-positive isolates were most often seen in serotype 19F [30/31 (96.8%)] and were of clade I, and in 6B
[48/58 (82.8%)] of clade II. PI-2-positive isolates were most common in serotype 19F [27/31 (87.1%)]; all of
them were also PI-1 positive. Of the PI-1-positive and PI-2-positive isolates, 118 (88.1%) and 31 (81.6%), respectively, were of vaccine serotypes. Both PI-1 and PI-2 were more often present in penicillin-non-susceptible
pneumococci (PNSP) than in penicillin-susceptible pneumococci [PI-1 in 41/58 (70.7%) and 93/340 (27.4%),
respectively, and PI-2 in 28/58 (48.3%) and 10/340 (2.9%), respectively].
Conclusions: Genes for PI-1 and/or PI-2 in pneumococci isolated from healthy Icelandic children are mainly
found in isolates of vaccine serotypes and in PNSP isolates belonging to multiresistant international clones
that have been endemic in the country.
Keywords: pili, PI-1, PI-2, PNSP
Introduction
Streptococcus pneumoniae is a frequent colonizer of the human
upper respiratory tract but also a major human pathogen that
causes diverse infections ranging from acute otitis media to lifethreatening invasive disease. The current conjugate vaccines are
limited to few serotypes (10-valent: 1,4,5,6B,7F,9V,18C,19F,23F;
and 13-valent: also 3,6A,19A). Capsular switching1 and increasing
replacement of non-vaccine serotypes2 makes development of a
serotype-independent vaccine made from pneumococcal proteins more important. A number of proteins have been considered
in this context, among them the recently found pili.3,4
Pneumococcal pili affect their ability to adhere to human
respiratory epithelial cells.5 – 8 Furthermore, murine models suggest
that pili promote invasiveness of pneumococci by enhancing
phagocytosis and prolonging the survival of pneumococci after
phagocytosis.9
The two major types of pili are encoded by two genetic islets,
pilus islet 1 (PI-1)8 and pilus islet 2 (PI-2).6 PI-1 is 14 kb and consists
of seven genes: a transcription regulator gene rlrA; three genes coding for pili subunits, rrgA, rrgB and rrgC; and three genes coding for
sortases, srtB, srtC and srtD.10 Its genetic variability can be determined from variable regions within the rrgB gene and is presented
by three clade types.11 Reported prevalence of PI-1 in invasive disease, carriers, otitis media and global collections ranges from 10%
to 35%.6,12 – 20
PI-2 is just over 6.5 kb and includes five genes: pitA coding for
pili subunits; pitB coding for the backbone protein; srtG1 and srtG2
# The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: [email protected]
2203
Hjálmarsdóttir et al.
Table 1. Nucleotide sequences of the primers used in this study
Sequence (5′ 3′ )
Primer
Purpose
Reference
srtD for
srtD rev
CATGTCTTTTTCCGCCATTT
CGTAGTAAACGTGCTAGCTTCC
presence of PI-1
this study
PFL for
PFL rev
CTCATTGACTACACAAGTATCACCTC
AGCATACTCCAACTCATAAATATGTG
confirm absence of PI-1
modified from Aguiar et al.13
P06 for
P06 rev
CGTGGGTATCAGGTGTCCTATGATAA
GCCTCGTCTTCTAATKACTGTTAC
presence of PI-2
Bagnoli et al.6
1008 for
1009 rev
GCTGGATCGAGTTTGAAACCAGAA
TAAGGATCACCAAAGTCCAAGGCA
confirm absence of PI-2
Bagnoli et al.6
Clade I for
Clade I rev
AACAGATGGGGATATGGATAAAATTG
AATGGTAATTCAATTTCAATTGGA
clade I
Moschioni et al.11
Clade II for
Clade II rev
AATCCATAAGTTACTGCTCTCAGA
ATCCATAGCTACATTATTCAAAGT
clade II
Moschioni et al.11
Clade III for
Clade III rev
GACAGATCAAGAGCTTGACGCTTG
CTGGATCTACGAAACCTGCTGCAG
clade III
Moschioni et al.11
coding for sortases; and sipA coding for signal-peptidase-related
product.6 Reported prevalence of PI-2 ranges from 0% to 21%
in invasive disease, carriers, otitis media and global collections.6,12,15 – 17
Knowledge about the prevalence of piliated pneumococci in
the nasopharynx of healthy children and in disease enhances
the understanding of pneumococcal pathogenicity and is essential for evaluation of the feasibility of pili as a candidate for future
vaccines. The aim of this study was to investigate the prevalence
of PI-1 and PI-2 in pneumococcal isolates from healthy Icelandic
preschool children attending day care centres, prior to implementation of conjugated pneumococcal vaccine, and to investigate
the association of the pilus islets with vaccine serotypes and antibiotic resistance.
of PI-1 was confirmed using the primers PFL for and PFL rev. The presence
of PI-2 was detected using the primers P06 for and P06 rev. The absence of
PI-2 was confirmed using the primers 1008 for and 1009 rev. All PI-1 were
further classified to clades using specific primers for clades I –III.11 Primers
used are listed in Table 1.
Statistical analysis
Pearson’s x2 and Fisher’s exact test were used for statistical analysis and a
P value,0.05 was considered significant.
Results
Nasopharyngeal swabs were collected from 516 healthy children attending
15 representative day care centres in the metropolitan area of Reykjavik. The
children were considered healthy if they attended on the day of sampling.
The samples were collected in March and April 2009 after obtaining
informed consent from a parent/guardian contacted through the day
care centres. Pneumococci were isolated from the swabs using conventional methods and their identification confirmed with PCR using primers
for lytA and cps.21,22 Susceptibility testing was performed by disc diffusion
according to the CLSI standard and criteria,23 and penicillin susceptibility of
oxacillin-resistant strains was determined using Etest (AB-Biodisk).24 The
isolates were serotyped using latex agglutination25 and PCR methods.21
MLST26,27 was performed on representative phenotypes of serotypes
6B and 19F. Pneumococcal conjugated vaccines were first introduced
into the infant vaccination programme in Iceland in 2011; therefore, the
great majority of the children had not received pneumococcal vaccines.
The children participating in the study were 1.2 – 6.3 years old;
mean age¼4.1 years. Pneumococci were found in 372 of the samples (carriage rate, 72.1%). In some of the samples different colony
appearances were noted. Each was sub-cultured and serotyped,
revealing 32 samples with strains of two different serotypes.
Thus, a total of 404 isolates were stored at 2808C for the investigation. Of these, six were not available for pilus analyses, thus the final
number of isolates tested for presence of pilus islet genes was 398.
The most common serotype was 6B [58 (14.6%)], followed by 6A
[48 (12%)], 23F [47 (11.8%)], 19A [43 (10.8%)] and 19F [31
(7.8%)]. There were 340 (85.4%) penicillin-susceptible pneumococci
(PSP; MIC , 0.1 mg/L) and 58 (14.6%) penicillin-non-susceptible
pneumococci (PNSP; MIC ≥0.1 mg/L). No isolates were fully resistant to penicillin (MIC ≥2 mg/L).
The prevalence of pneumococcal serotypes differed between
the 15 day care centres, thus the majority of PNSP isolates of serotype 19F carrying PI-1 and PI-2 genes originated from children
attending three of the day care centres, while they were very
rarely detected in nine and not detected in one of the day care
centres.
PI-1 and PI-2 detection
PI-1
Methods
Bacterial isolates and serotyping
11,28
6
The presence or absence of PI-1
and PI-2 was determined using a
modification of previously published PCR methods. In short, the presence
of PI-1 was detected using the primers srtD for and srtD rev. The absence
2204
Of the 398 viable isolates, 134 isolates (33.7%) showed the presence of PI-1, 261 isolates (65.6%) were negative and no result was
obtained for three isolates (0.8%), as the absence of PI-1 could
JAC
70
70
60
60
50
PI-1 negative
40
PI-1 positive
30
Unknown
20
10
PI-2 negative
PI-2 positive
Unknown
40
30
20
10
19F
11
6B
6A
23F
19A
NT
14
15
3
18C
23A
9V
33
9N
Other
Figure 1. Presence of PI-1 according to serogroups/serotypes. Unknown
are isolates where the absence of PI-1 could not be confirmed by
positive reaction with the PFL primers. NT, non-typeable.
Number of isolates
50
0
6B
19F
6A
15
9V
14
NT
4
23F
19A
6C
11
3
18C
23A
33
9N
Other
0
Number of isolates
Number of isolates
Piliated pneumococci in carriers
50
45
40
35
30
25
20
15
10
5
0
Clade III
Clade II
Clade I
6B 19F 6A
15
9V
14
NT 23F
4
Figure 3. Presence of PI-2 according to serogroups/serotypes. Unknown
are isolates where the absence of PI-2 could not be confirmed by
positive reaction with the 1008 for and 1009 rev primers.
be confirmed by a positive PCR with the 1008 for and 1009 rev primers. Distribution according to serotypes varied. The highest number and prevalence of PI-2-positive isolates were seen in serotype
19F, where 87.1% (27/31) carried the genes. The presence of PI-2
was also detected in serogroup 11 where 41.2% (7/17) were positive, in serotype 6B 5.2% (3/58) and in 6A 2.1% (1/48). The presence
of PI-2 was not detected in other serotypes. All of the isolates of
serotype 19F that were PI-2 positive were also PI-1 positive.
Isolates of serogroup 11 were only positive for PI-2, not PI-1, but
one of the isolates of serotype 6B was positive for both islets
(Figure 3).
19A
Association of the pilus islets with vaccine serotypes
Figure 2. Clade classification of PI-1-positive isolates according to
serogroups/serotypes.
not be confirmed by a positive PCR with the PFL primers.
Distribution according to serotypes varied. Of the five most commonly carried serotypes, the proportional rates for PI-1 genes
were highest in serotype 19F, where the vast majority, 96.8%
(30/31), were PI-1 positive. However, the highest number of
PI-1-positive isolates within a serotype was found in serotype
6B, but at lower rates, 82.8% (48/58). The PI-1 prevalence for
serotype 9V was 90.0% (9/10), for serogroup 15 it was 68.4%
(13/19) and for 6A it was 45.8% (22/48). Other serotypes carrying
PI-1 genes were less commonly seen, including serotype 4, where
two isolates were detected; both carried PI-1 genes (Figure 1).
All of the PI-1-positive isolates were further analysed to determine their class of clade and results were obtained for 131 of the
134 PI-1-positive isolates (97.8%). Of those 73 (55.7%) were of
clade I, 41 (31.3%) of clade II and 17 (13.0%) of clade III.
Distribution of clades varied according to serotypes, thus all the
PI-1-positive isolates of serotype 19F belonged to clade I, 40/48
(83.3%) isolates of PI-1 serotype 6B to clade II and 19/22
(86.4%) of 6A to clade I (Figure 2).
PI-2
The number of isolates that showed the presence of PI-2 genes was
38 (9.5%); 355 isolates (89.2%) were negative and no result was
obtained for five isolates (1.3%), as the absence of PI-2 could not
Of the 134 isolates positive for PI-1, 95 (70.9%) were of serotypes
included in the 10-valent vaccine and a further 23 (88.1%) were of
serotypes included in the 13-valent vaccine, thereof 22 of serotype
6A. Of the 16 PI-1-positive isolates that did not belong to vaccine
types, 13 isolates were of serogroup 15. Of the 38 PI-2-positive isolates, 30 (78.9%) were of serotypes of the 10-valent vaccine, and
additionally 1 (81.6%) of the 13-valent serotypes. There were
7 (18.4%) isolates of non-vaccine serotypes carrying PI-2 genes,
all of serogroup 11. Isolates carrying pilus islet genes were more
likely to belong to vaccine serotypes than not (P,0.001).
Association of the pilus islets with antibiotic resistance
PI-1 was more often present in PNSP, than in PSP, or in 70.7% (41/58)
and 27.4% (93/340), respectively (P,0.001). The majority, or 28 isolates, of PI-1-positive PNSP were of serotype 19F, 5 were of serotype
6B, and 5 were of serotype 14. The majority, or 43 isolates, of
PI-1-positive PSP were of serotype 6B, 21 were of serotype 6A, 13
were of serotype 15, and 9 were of serotype 9V. The same held
true for carriage of PI-2 genes in PNSP and PSP. Thus, 48.3%
(28/58) of the PNSP isolates were PI-2 positive, and 2.9%
(10/340) of the PSP (P, 0.001). Of the PI-2-positive PNSP, 26
isolates belonged to serotype 19F and 7 of the PSP belonged to
serogroup 11 (Table 2). The isolates of serotype 19F carrying
PI-1 genes of clade I and PI-2 genes were multiresistant, of several STs belonging to the clonal complex 236, and single-locus or
double-locus variants of the international clone Taiwan19F-14. The
PNSP of serotype 6B carrying PI-1 genes of clade II were of ST90,
belonging to the international clone Spain6B-2.
2205
Hjálmarsdóttir et al.
Table 2. Serotype distribution according to susceptibility to penicillin of isolates carrying PI-1 and PI-2 genes in serotypes
PNSP positive for pilus islet, n (%)
Serotype
PSP positive for pilus islet, n (%)
PNSP total
PI-1
PI-2
PSP total
PI-1
PI-2
19F
6B
6A
15
9V
11
14
NT
4
19A
23F
6C
Other
28
7
1
0
0
0
6
13
0
1
1
0
1
28 (100)
5 (71.4)
1 (100)
0
0
0
5 (83.3)
2 (15.4)
0
0
0
0
0
26 (92.9)
1 (14.3)
1 (100)
0
0
0
0
0
0
0
0
0
0
3
51
47
19
10
17
0
0
2
42
46
3
100
2 (66.7)
43 (84.3)
21 (44.7)
13 (68.4)
9 (90.0)
0
0
0
2 (100)
1 (2.4)
1 (2.2)
1 (33.3)
0
1 (33.3)
2 (3.9)
0
0
0
7 (14.2)
0
0
0
0
0
0
0
Total
58
41
28
340
93
10
NT, non-typeable.
Discussion
In this study we found genes of the islets encoding for pili of type 1
in one-third, and genes for pili of type 2 in every tenth isolate of
pneumococci from healthy preschool children before pneumococcal vaccination was implemented in the infant vaccination
programme.
The prevalence rate of 33.7% for PI-1 is in concordance with
previously reported rates of 15% – 35% in nasopharyngeal samples from healthy children.14,18,20 The rate is also comparable to
reported rates of 20% – 30% in acute otitis media12,15 and of
10% – 33% in invasive disease.11,14,16,19 Furthermore, the prevalence rate of 9.4% for PI-2 is in concordance with previous studies
on mixed, invasive and middle-ear collections reporting rates from
0% to 21%.6,12,15,16
The vast majority of isolates carrying PI-1 genes belonged to
serotypes included in the protein-conjugated vaccines. The majority of isolates of non-vaccine serotypes carrying PI-1 genes were
of serogroup 15, but PI-1 genes were also detected in one isolate
of serotype 6C and two non-typeable isolates. More than threequarters of the PI-2-positive isolates belonged to the vaccine
serotypes, the vast majority were of serotype 19F, but a few
were of serotype 6B and one of serotype 6A. PI-2 presence in nonvaccine serotypes was only detected in serogroup 11. Thus, a
vaccine including pili subunits would only provide additional
protection to a limited number of serotypes, compared with the
current protein-conjugated vaccines.
Vaccination has reduced rates of piliated pneumococci in invasive pneumococcal disease.18,29 However, re-emergence of both
PI-118 and PI-229 is also reported to have occurred after a few
years of vaccination due to piliated strains of non-vaccine types.
Thus, we can expect that piliated pneumococci will become rare if
the vaccination eradicates the vaccine types in healthy children.
However, piliated strains of serogroups 11 and 15 could be of
2206
concern in Iceland in the future, as possible emerging clones of
piliated non-vaccine serotypes in pneumococcal disease.
Since 2004 the most prevalent PNSP isolates in Iceland have
been of serotype 19F, belonging to STs that are single-locus and
double-locus variants of the international clone Taiwan19F-14
and belong to the clonal complex 236.30 The isolates of this clonal complex carry PI-1 genes of clade I and PI-2 genes, and are
thus the main cause of the significantly higher rates of both PI-1
and PI-2 in PNSP isolates than in PSP. Before 2004 the most
prevalent PNSP clone was of serotype 6B, ST90, belonging to
the international clone Spain6B-2.31 This clone is still present in
Iceland, although at much lower rates, and carries PI-1 genes
of clade II.
It is possible that piliated pneumococci select against other
piliated pneumococcal strains.32 When a clone of a specific
clade/class is prevalent for a period of time, it may also be possible
that it induces herd immunity to that clade/class and thus selects
against piliated pneumococci belonging to the same clade/class.
If that is true, a successful new piliated clone would be likely to be
of another clade/class. The fact that the piliated 19F clonal complex of clade class I replaced the piliated 6B clone of clade II as the
most prominent PNSP clone in the country supports this theory.30
Possible pili vaccines would need to address that.
It might be considered a weakness in this study that we only
tested for one of the genes, srtD, as a marker for the presence
of PI-1. However, we tested a subset of 31 isolates carrying sortase D genes for the presence of genes for sortases B and C,28
and found all tested isolates positive for all sortases. The fact
that we had designed new primers for srtD that worked very
well influenced the choice of that primer for our study. The presence of genes for all sortases is, however, not an indicator for the
complete pilus operon, as previously demonstrated.17 Similarly,
the presence of PI-2 was only tested with one primer pair after
having tested a subset with more and found all to be positive.
Piliated pneumococci in carriers
We consider it a strength in this study that the absence of both
pilus islets was confirmed with a positive PCR. The primers used
flank the pilus islets and PCR can therefore only give a positive
reaction when pilus islet genes are not present. However, in
spite of repeated tests, we could not confirm the absence of
PI-1 in three isolates and the absence of PI-2 in five isolates. In
all instances, when no results were obtained for PI-1, the PCR
worked well testing PI-2 and vice versa.
In conclusion, prior to pneumococcal vaccination, genes for
PI-1 and/or PI-2 in pneumococci isolated from healthy Icelandic
children were mainly found in isolates of vaccine serotypes and
PNSP isolates belonging to multiresistant international clones
that have been widely distributed in the country. A new prevailing
clone replacing another in the same geographical area is likely to
have pili of different clade class than the previous one and after
implementation of vaccinations to be of a non-vaccine serotype.
Acknowledgements
We thank the staff and students at the Department of Clinical Microbiology
at Landspitali University Hospital for their work and support. We thank our
Czech co-workers in the IceCzech project for their input.
Funding
This study was supported by EEA/Norway Grants, the IceCzech project
(project A/CZ0046/2/0007) and Landspitali University Hospital Research
Fund grant.
Transparency declarations
None to declare.
Some of the authors have received a research grant from GSK, to study
the effectiveness of pneumococcal vaccination in Iceland. The study is an
investigator-initiated study, and we do not envisage conflicts of interests
due to this study.
References
1 Wyres KL, Lambertsen LM, Croucher NJ et al. Pneumococcal capsular
switching: a historical perspective. J Infect Dis 2013; 207: 439– 49.
2 Weinberger DM, Malley R, Lipsitch M. Serotype replacement in disease
after pneumococcal vaccination. Lancet 2011; 378: 1962– 73.
3 Barocchi MA, Censini S, Rappuoli R. Vaccines in the era of genomics: the
pneumococcal challenge. Vaccine 2007; 25: 2963– 73.
4 Moschioni M, De Angelis G, Harfouche C et al. Immunization with
the RrgB321 fusion protein protects mice against both high and
low pilus-expressing Streptococcus pneumoniae populations. Vaccine
2012; 30: 1349– 56.
5 Hava DL, LeMieux J, Camilli A. From nose to lung: the regulation behind
Streptococcus pneumoniae virulence factors. Mol Microbiol 2003; 50:
1103– 10.
6 Bagnoli F, Moschioni M, Donati C et al. A second pilus type in
Streptococcus pneumoniae is prevalent in emerging serotypes and mediates adhesion to host cells. J Bacteriol 2008; 190: 5480– 92.
7 Nelson AL, Ries J, Bagnoli F et al. RrgA is a pilus-associated adhesin in
Streptococcus pneumoniae. Mol Microbiol 2007; 66: 329– 40.
JAC
8 Barocchi MA, Ries J, Zogaj X et al. A pneumococcal pilus influences virulence and host inflammatory responses. Proc Natl Acad Sci USA 2006; 103:
2857– 62.
9 Orrskog S, Rounioja S, Spadafina T et al. Pilus adhesin RrgA interacts with
complement receptor 3, thereby affecting macrophage function and systemic pneumococcal disease. MBio 2012; 4: 00535 –12.
10 Rosch JW, Mann B, Thornton J et al. Convergence of regulatory networks on the pilus locus of Streptococcus pneumoniae. Infect Immun
2008; 76: 3187– 96.
11 Moschioni M, Donati C, Muzzi A et al. Streptococcus pneumoniae contains 3 rlrA pilus variants that are clonally related. J Infect Dis 2008; 197:
888–96.
12 Moschioni M, De Angelis G, Melchiorre S et al. Prevalence of
pilus-encoding islets among acute otitis media Streptococcus pneumoniae
isolates from Israel. Clin Microbiol Infect 2010; 16: 1501 –4.
13 Aguiar SI, Serrano I, Pinto FR et al. The presence of the pilus locus is a
clonal property among pneumococcal invasive isolates. BMC Microbiol
2008; 8: 41.
14 Basset A, Trzcinski K, Hermos C et al. Association of the pneumococcal
pilus with certain capsular serotypes but not with increased virulence.
J Clin Microbiol 2007; 45: 1684– 9.
15 Vainio A, Kaijalainen T, Hakanen AJ et al. Prevalence of pilus-encoding
islets and clonality of pneumococcal isolates from children with acute
otitis media. Eur J Clin Microbiol Infect Dis 2011; 30: 515–9.
16 Zahner D, Gudlavalleti A, Stephens DS. Increase in pilus islet 2-encoded
pili among Streptococcus pneumoniae isolates, Atlanta, Georgia, USA.
Emerg Infect Dis 2010; 16: 955–62.
17 Kulohoma BW, Gray K, Kamng’ona A et al. Piliation of invasive
Streptococcus pneumoniae isolates in the era before pneumococcal conjugate vaccine introduction in Malawi. Clin Vaccine Immunol 2013; 20:
1729– 35.
18 Regev-Yochay G, Hanage WP, Trzcinski K et al. Re-emergence of the type
1 pilus among Streptococcus pneumoniae isolates in Massachusetts, USA.
Vaccine 2010; 28: 4842–6.
19 Selva L, Ciruela P, Blanchette K et al. Prevalence and clonal distribution
of pcpA, psrP and pilus-1 among pediatric isolates of Streptococcus pneumoniae. PLoS One 2012; 7: e41587.
20 Turner P, Melchiorre S, Moschioni M et al. Assessment of Streptococcus
pneumoniae pilus islet-1 prevalence in carried and transmitted isolates
from mother-infant pairs on the Thailand – Burma border. Clin Microbiol
Infect 2012; 18: 970– 5.
21 Pai R, Gertz RE, Beall B. Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates. J Clin
Microbiol 2006; 44: 124–31.
22 Sourav S, Patricia A, Sharma S et al. Detection of pneumolysin and
autolysin genes among antibiotic resistant Streptococcus pneumoniae in
invasive infections. Indian J Med Microbiol 2010; 28: 34– 9.
23 Clinical and Laboratory Standards Institute. Performance Standards for
Antimicrobial Disk Susceptibility Tests—Tenth Edition: Approved Standard
M02-A10. CLSI, Wayne, PA, USA, 2009.
24 AB-Biodisk. Susceptibility Testing of Pneumococci, Vol. Etest Technical
Guide 5C. Solna, Sweden: AB-Biodisk, 1998.
25 Slotved HC, Kaltoft M, Skovsted IC et al. Simple, rapid latex agglutination test for serotyping of pneumococci (Pneumotest-Latex). J Clin
Microbiol 2004; 42: 2518– 22.
26 Enright MC, McKenzie H. Moraxella (Branhamella) catarrhalis—clinical
and molecular aspects of a rediscovered pathogen. J Med Microbiol
1997; 46: 360–71.
2207
Hjálmarsdóttir et al.
27 Aanensen DM, Spratt BG. The multilocus sequence typing network:
mlst.net. Nucl Acids Res 2005; 33: W728– 33.
28 Paterson GK, Mitchell TJ. The role of Streptococcus pneumoniae sortase
A in colonisation and pathogenesis. Microbes Infect 2006; 8: 145–53.
29 Aguiar SI, Melo-Cristino J, Ramirez M. Use of the 13-valent conjugate
vaccine has the potential to eliminate pilus carrying isolates as causes of
invasive pneumococcal disease. Vaccine 2012; 30: 5487– 90.
2208
30 Hjálmarsdóttir MA, Kristinsson KG. Epidemiology of penicillin nonsusceptible pneumococci in Iceland, 1995–2010. J Antimicrob Chemother
2014; 69: 940–6.
31 Kristinsson KG. Epidemiology of penicillin resistant pneumococci in
Iceland. Microb Drug Resist 1995; 1: 121–5.
32 Henriques-Normark B, Blomberg C, Dagerhamn J et al. The rise and fall of
bacterial clones: Streptococcus pneumoniae. Nat Rev Microbiol 2008; 6: 827–37.