From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
RAPID COMMUNICATION
Cytoplasmic Localization of a Functionally Active Fanconi Anemia Group
A – Green Fluorescent Protein Chimera in Human 293 Cells
By Frank A.E. Kruyt, Quinten Waisfisz, Lonneke M. Dijkmans, Mario A.J.A. Hermsen, Hagop Youssoufian,
Fré Arwert, and Hans Joenje
Hypersensitivity to cross-linking agents and predisposition
to malignancy are characteristic of the genetically heterogeneous inherited bone marrow failure syndrome, Fanconi
anemia (FA). The protein encoded by the recently cloned FA
complementation group A gene, FAA, has been expected to
localize in the nucleus as based on the presence of sequences homologous to a bipartite nuclear localization signal (NLS) and a leucine repeat motif. In contrast to this
expectation, we show here that a functionally active FAAgreen fluorescent protein (GFP) hybrid resides in the cytoplasmic compartment of human kidney 293 cells. In accordance with this finding, disruption of the putative NLS by
site-directed mutagenesis failed to affect both subcellular
localization and the capacity to complement hypersensitivity to the cross-linking agent mitomycin C in FA-A
lymphoblasts. Furthermore, the N-terminal part of FAA with
the putative NLS at amino acid position 18 to 35 showed no
nuclear translocation activity when fused to GFP, while the
first 115 N-terminal amino acids appeared to be indispensable for the complementing activity in FA-A cells. Similarly,
mutagenesis studies of the putative leucine repeat showed
that, even though this region of the protein is important for
complementing activity, this activity does not depend on an
intact leucine zipper motif. Finally, fusion of the NLS motif
derived from the SV40 large T antigen to FAA could not
direct the hybrid protein into the nucleus of 293 cells, suggesting that FAA is somehow maintained in the cytoplasm
via currently unknown mechanisms. Thus, like the first identified FA protein, FAC, FAA seems to exert its function in
the cytoplasmic compartment suggesting FA proteins to be
active in a yet to be elucidated cytoplasmic pathway that
governs hematopoiesis and protects against genomic instability.
q 1997 by The American Society of Hematology.
F
pendent studies have shown that the FAC protein is localized
and functionally active in the cytoplasmic compartment only,
suggesting no direct role for FAC in DNA repair.9-11
Recently, a second FA gene FAA has been identified and
found to encode a protein of 1,455 amino acids with a molecular mass of approximately 163 kD.12,13 Although no significant homology to other proteins has been found, a putative
bipartite nuclear localization signal (NLS) as well as a leucine zipper motif could be distinguished. The presence of
these domains lead to the expectation of the FAA protein
being localized to the cell nucleus.12
Here we describe the use of chimeras of FAA and the
reporter molecule green fluorescent protein (GFP) to examine the subcellular localization of the FAA polypeptide in
human cells. GFP is a 238-amino acid protein from the jellyfish Aequorea victoria which retains its ability to fluoresce
in vivo when expressed in heterologous cell types.14-16 In
contrast to the expected nuclear localization of FAA, our
results show that an FAA-GFP protein chimera, which retains full activity with respect to the correction of MMC
hypersensitivity in FA-A lymphoblasts, is primarily localized to the cytoplasm. Consistent with this finding, disruption
of the putative bipartite NLS and leucine repeat motifs by
site-directed mutagenesis failed to impair FAA function or
alter its subcellular localization. Furthermore, experiments
designed to determine the requirement of a cytoplasmic localization for FAA to restore cross-linker resistance in FAA lymphoblasts were hampered by the inability of a heterologous NLS motif to target FAA to the nucleus.
The cytoplasmic localization of both FAC and FAA suggests the existence of a novel and yet to be elucidated molecular mechanism involved in multiple cellular functions, such
as maintenance of genomic stability and the control of programmed cell death.
ANCONI ANEMIA (FA) is an autosomal recessive disease characterized by bone marrow (BM) failure, variable congenital malformations, and cancer predisposition.1
Cells from FA patients have a characteristic hypersensitivity
to cross-linking agents such as mitomycin C (MMC), cisplatin, and diepoxybutane2,3 due to their proneness to undergo apoptosis induced by these agents.4 The disorder is
genetically heterogeneous, with at least five complementation groups having been identified in somatic cell fusion
studies.5,6 These different groups, named A to E, suggest the
existence of five distinct disease genes.7
The first FA gene to be cloned, the FA group C gene FAC
encoding a 63-kD protein, has not revealed sequence motifs
that could provide a clue to its function.8 So far, the molecular
basis of the disease remains unclear, although the increased
spontaneous and cross-linker–induced chromosomal instability
found in FA has been interpreted as being indicative of a primary
defect in DNA repair. However, conflicting evidence has been
reported on the putative DNA repair defect in FA,3 while inde-
From the Department of Human Genetics, Free University, Amsterdam, The Netherlands; and the Department of Molecular and
Human Genetics, Baylor College of Medicine, Houston, TX.
Submitted May 5, 1997; accepted August 10, 1997.
Supported by the Dutch Cancer Society. H.Y. is supported by
grants from the National Institutes of Health HL52138 and
DK49216.
F.A.E.K. and Q.W. equally contributed to this work.
Address reprint requests Frank A.E. Kruyt, PhD, Department of
Human Genetics, Free University, Van der Boechorststraat 7, NL1081 BT Amsterdam, The Netherlands.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
q 1997 by The American Society of Hematology.
0006-4971/97/9009-0053$3.00/0
3288
MATERIALS AND METHODS
Plasmid construction, mutagenesis, and GFP fusion proteins.
The cDNA encoding FAA was excised by Not I digestion from
Blood, Vol 90, No 9 (November 1), 1997: pp 3288-3295
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FAA-GFP LOCALIZES TO THE CYTOPLASM OF 293 CELLS
pREP-FAA, previously described as clone D,12 and subcloned in
pBluescript SK0 (Stratagene Cloning Systems, La Jolla, CA). Following determination of the orientation of the cDNA by restriction
enzyme analysis, pSKFAA-5.5 was obtained with the 5* end of the
cDNA positioned at the T3 promoter site. Digestion of this plasmid
with Kpn I, leading to deletion of the approximately 4-kb 3* end
of the cDNA, and subsequent religation yielded pSKFAA-BK1.5.
pSKFAA-M116 was constructed by cutting pSKFAA-BK1.5 with
Ava I, filling in recessive ends, religation, and subsequent completion
of the open reading frame (ORF) by inserting the approximately 4kb Kpn I-fragment derived from pSKFAA-5.5.
For polymerase chain reaction (PCR)-based site-directed mutagenesis,
the following oligonucleotide primers were used, in which restriction
enzyme sites are underlined and nonmatching or mutated nucleotides are
shown in lowercase letters: FAAmNLS (Ava I): (5*-taaGCCTCGGGCCAGGACCCAGGGGaCCtCCtGAG); FAA1474sp: (5*-gcgatttaggtgacactatagaAGGGGTGGGTGGAGAATGTG); FA3795S: (5*-aatacgactcactataggGATGGGCCTGCTGTCGTCACAT); FAAL3P (BamHI): (5*AACGGATCCTCCcCCGCCTGCC); FAAL3,4V (BamHI): (5*-AACGGATCCTCgTCCGCCTGCCTTCGTCTGTCgTCTGC); FAA-X
(HindIII): (5*-ggtcaagcttGAAGAGATGAGGCTCCTGGGACAGGT); FAAXH (Xba I/HindIII): (5*-GCAGAAGCTTCTAGAAGAGATGAGGCTCCTGGGACAGGT).
pSKFAA-5.5 was used as a template for PCR. The PCR product
obtained with FAA-mNLS and FAA1474sp primers was digested
with both Ava I and Kpn I, and exchanged with the corresponding
fragment in pSKFAA-BK1.5. The PCR fragments generated with
either FAAL3P or FAAL3,4V in combination with the FAAXH
primer were digested with BamHI and HindIII, and subcloned in
pSK0. Several subcloning steps were required to add the lacking
ORF sequences in these FAA mutants. The PCR product obtained
with the primers FA3795S and FAA-X, encompassing the 3* portion
of the FAA ORF in which the stop codon is absent, was digested
with Sst I and HindIII and subcloned in pSK0. The 5* end of the
ORF was added by insertion of the approximately 4-kb Sst I-fragment obtained from pSKFAA-5.5. Subsequently, the 2.5-kb Kpn IHindIII fragment was taken from this construct and fused in frame
to the S65T-GFP mutant coding region,17 which was obtained as a
BamHI-Xba I fragment derived from the peroxisome-targeted GFPcontaining plasmids pcDNA3-PTS1- and PST2-GFP,18 in which the
specific target had been deleted. After the exchange of DNA fragments derived from this construct and corresponding fragments with
earlier generated plasmid constructs, ORFs encoding either wildtype or mutant FAA-GFP protein chimeras could be generated.
The SV40 Large T antigen NLS was fused to the N-terminus of
FAA by using the oligonucleotides LTNLS-U (5*-GATCCATGCCGAAGAAAAAGAGAAAGGTGGAACTGTCCGACTCGTGGGTCCCGAACTCCGCC) and LTNLS-L (5*-CCGAGGCGGAGTTCGGGACCCACGAGTCGGACAGTTCCACCTTTCTCTTTTTCTTCGGCATG). After annealing, the resulting fragment was subcloned in BamHI/Ava I digested pSKFAA-BK1.5, and subsequently
the FAA ORF was added with or without GFP. As control FAA
was fused to mLTNLS-U and mLTNLS-L, which are identical to
LTNLS-U and -L except for the substitution of the underlined nucleotides for C or G respectively, to harbor a hybrid FAA protein with
an inactivated Large T NLS. In the same way GFP alone was fused
to either a functional or mutated Large T NLS by using a similar
stratagy to allow in frame fusion to the GFP ORF.
The Epstein-Barr virus (EBV)-based episomal expression vector
pDR2 (Clontech Laboratories Inc, Palo Alto, CA), containing the
Rous Sarcoma Virus LTR, was used for transient or stable expression
of the FAA variants in different cell lines as indicated. To generate
pDR-FAA, the 3.3-kb BamHI fragment was inserted in pDR2 yielding pDRFAA-3.3, and subsequently the ORF was completed with
the approximately 4-kb Kpn I-Xba I fragment obtained from
3289
pSKFAA-5.5. The various FAA mutants in pDR2 with or without
the GFP tag were generated by exchanging specific DNA fragments
from plasmids described above and pDR-FAA. A detailed description of the generation of the constructs used in this study is available
on request.
All the mutant FAA or FAA-GFP hybrid-containing constructs
were tested for the presence of the introduced mutation or the desired
in frame fusion by sequencing using the T7 Sequencing Kit (Pharmacia Biotech, Uppsala, Sweden). Restriction or modifying enzymes
were purchased from GIBCO-BRL (Gaithersburg, MD) and oligonucleotides from Pharmacia.
Cell culture and transfection. HSC72 (FA-A) lymphoblastoid
cells19 were cultured at 377C in RPMI 1640 medium (GIBCO-BRL)
containing 10% newborn calf serum (Hyclone, Logan, UT) under
an atmosphere of 5% CO2 in air. Human fetal kidney 293 cells20
constitutively expressing the EBNA-1 protein from EBV (293EBNA; Invitrogen Corp, San Diego, CA) were cultured in Dulbecco’s Modified Eagle’s Media containing glutamax-1 (GIBCO-BRL)
supplemented with 10% fetal bovine serum and 250 mg/mL geneticin
(G418 sulfate; GIBCO-BRL).
Determination of mitomycin C (MMC, Kyowa Hakko, Ltd)-induced growth inhibition was performed by the continuous exposure
of cells in parallel cultures, starting with 5 1 104 cell/mL, to 0 to
100 nmol/L MMC as indicated. Growth inhibition was measured by
cell counting using a Coulter counter (Coulter Immunology, Hialeah,
FL) at the time that untreated cells had undergone three cell divisions
(typically after 3 to 5 days). To assess growth inhibition the final
cell count of untreated cultures was set at 100%. Electroporation
was used to stably transfect HSC72 cells as described previously.4
293-EBNA cells were transfected using DOSPER liposomal transfection reagent (Boehringer Mannheim, Mannheim, Germany) basically according to the instructions of the manufacturer. Briefly, cells
were dispensed on 6-well plates (3.5 1 105 cells/well) and 1 day later
transfected by the addition of a 2-mg plasmid DNA/9-mg DOSPER
mixture in 100 mL 20 mmol/L HEPES, 150 mmol/L NaCl. After
incubation with the DNA/DOSPER mixture for 8 hours, the medium
was discarded and replaced by fresh medium. Forty-eight hours later,
cells were either isolated for the experiments as indicated or selected
for stable expression by culturing in medium supplemented with 150
mg/mL hygromycin (Boehringer Mannheim).
Microscopy and image capturing. Transiently or stably transfected 293-EBNA cells expressing GFP fusion proteins were grown
on sterile glass coverslips placed in 6-well plates. After 24 hours
living cells were either directly analyzed or treated with various
concentrations MMC before mounting onto microscope slides. Stably GFP hybrid-expressing HSC72 cells resuspended in culture medium were spotted on slides and coverslips were sealed.
Cells illuminated by UV light were evaluated by microscopy using
a Leica DM-RB microscope (Leica, Cambridge, UK), a fluorescein
filter and a plan-apo oil-phase lens (Leica), magnification 631. Images were captured using CytoVision software (Applied Imaging
Corp, Santa Clara, CA) and processed using SCIL-Image software
(SCIL-Image; Difa Vision, Breda, The Netherlands).
Immunoblotting and cell fractionation. Immunoblotting was
performed as described earlier.4 Briefly, cell extracts, usually representing 105 cells per sample, were run on a 10% sodium dodecyl
sulfate (SDS)-polyacrylamide gel and transferred to immobilon-P
membrane (Millipore Corp, Bredford, MA). As molecular weight
markers kaleidoscope prestained standards in the range of 200 to
6.5 kD were used (Bio-Rad Laboratories, Hercules, CA). After
blocking with 5% dry milk in TBS (10 mmol/L Tris-HCl pH 7.5,
150 mmol/L NaCl) for 1 hour at room temperature, the membrane
was incubated overnight at 47C in TBS containing 0.5% bovine
serum albumin (BSA) with a 20,000-fold dilution of a GFP monoclonal antibody (Clontech Laboratories Inc). After several washing
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3290
KRUYT ET AL
steps, incubation with biotinylated F(ab*)2 fragments of rabbit-antimouse IGgs (DAKO, Glostrups, Denmark), additional washing, and
subsequent incubation with peroxidase-conjugated streptavidin
(DAKO), the blots were developed by enhanced chemiluminescence
according to the instructions of the manufacturer (Amersham, Arlington Heights, IL).
For subcellular fractions, transfected 293 cells were washed with
ice-cold phosphate-buffered saline (PBS), resuspended in PBS, and
transferred to a tube. Pelleted cells were carefully resuspended in 5pellet volumes hypotonic buffer (10 mmol/L Tris-Hcl pH 7.5, 10
mmol/L KCl, 1.5 mmol/L MgCl2 ), immediately centrifuged for 5
minutes at 1,200 rpm and resuspended in 3-pellet volumes hypotonic
buffer. Cells were allowed to swell for 10 minutes on ice and were
homogenized by pushing the cell suspension five times through a
25-gauge needle. Accurate lysis was confirmed by microscopy and
nuclei were pelleted by centrifugation for 15 minutes at 4,000 rpm.
The supernatant was collected as the cytoplasmic fraction and nuclei
were gently washed in ice-cold PBS and subsequently resuspended
in 0.5 vol low salt buffer containing 20 mmol/L Tris-HCl pH 7.5,
25% glycerol, 20 mmol/L KCl, 1.5 mmol/L MgCl2 , 0.2 mmol/L
EDTA. After the addition of 0.5 vol high-salt buffer (20 mmol/L
Tris-HCl pH 7.5, 25% glycerol, 1.2 mol/L KCl, 1.5 mmol/L MgCl2 ,
0.2 mmol/L EDTA) nuclei were extracted by rotation for 30 minutes
at 47C, followed by centrifugation for 30 minutes at 14,000 rpm.
The supernatant was dialyzed against a buffer containing 20 mmol/
L Tris-HCl pH 7.5, 20% glycerol, 100 mmol/L KCl, 0.2 mmol/L
EDTA to obtain the nuclear extract. All buffers used were suplemented with 0.5 mmol/L dithiothreitol (DTT) and 0.1 mg/mL Pefabloc (protease inhibitor; Boehringer Mannheim). Supernatants were
taken and protein content was determined using the Bio-Rad protein
assay (Bio-Rad) according to the manufacturer’s protocol.
RESULTS
Functional FAA-GFP localizes to the cytoplasmic compartment. To determine the subcellular localization of
FAA, a protein chimera was generated in which a modified
GFP gene, GFPS65T,17 was fused to the C-terminus of fulllength FAA. As shown in a schematic representation of
FAA-GFP (Fig 1A), the cloning strategy lead to the insertion
of an additional stretch of 13 amino acids (aa), KLDIEFLQPGGST, between the last residue in the FAA ORF and the
start of the GFP coding region.
First, we tested the efficacy of FAA-GFP to complement
cross-linker sensitivity in the FA-A lymphoblastoid cell line,
HSC72. The hybrid ORF encoding an approximately 190kD fusion protein was subcloned in the episomal EBV-based
expression vector pDR2 and transfected into HSC72 cells
followed by the determination of MMC-dependent growth
inhibition. Figure 1B shows that FAA-GFP is as efficient as
FAA in complementing MMC hypersensitivity, indicating
that this hybrid protein is functional. Based on this finding
the possibility that the GFP tag caused mislocalization of
the hybrid protein was considered unlikely.
Next, the subcellular localization of FAA-GFP was examined by fluorescence microscopy in human kidney 293 cells,
which were selected for their favorable transfection properties and use in previous studies of the FA phenotype.21 To
facilitate efficient expression from EBV-based expression
vectors in 293 cells, a variant cell line was used that constitutively expresses the EBV-derived protein, EBNA1 (see Materials and Methods). Both transiently and stably transfected
293-EBNA cells were evaluated for GFP-based fluorescence.
Fig 1. The FAA-GFP chimera complements MMC-hypersensitivity
in FA-A lymphoblasts. (A) Schematic representation of FAA-GFP. Indicated are the relative positions of both the putative bipartite nuclear
localization domain (NLS) and leucine repeat motif (L-zip.). The cloning strategy used resulted in the insertion of 13 amino acids (aa),
KLDIEFLQPGGST, leading to a hybrid protein encompassing 1,706 aa
with a molecular weight of approximately 190 kD. (B) MMC-dependent growth inhibition in stably transfected HSC72 (FA-A) cells. The
expression vector pDR2 alone or containing the GFP, FAA, or FAAGFP coding regions were stably transfected in HSC72 cells and MMCcomplementing activity of the constructs was determined.
Interestingly, FAA-GFP appeared to be primarily localized
to the cytoplasmic compartment (Fig 2a through c). In the
large majority of cells FAA-GFP appeared to be evenly distributed throughout the cytoplasm. However, in some cases,
a more granular or vesicular distribution pattern was observed (not shown), a phenomenon that is currently being
investigated. In addition, treatment with various concentrations of MMC failed to affect the subcellular distribution
pattern (not shown). Transfection with the parental vector
expressing GFP alone resulted in a diffuse fluorescence
throughout the cytosol and nuclear compartments (Fig 2d),
which is in agreement with earlier reports on the intracellular
distribution of GFP.22 This latter finding was as expected,
because relatively small proteins with a molecular weight
below 40 to 45 kD are known to diffuse freely between
cytoplasm and nucleus, whereas larger proteins require an
active transport mechanism to be translocated into the nucleus.23,24
To examine the possibility that shorter protein variants
derived from the hybrid coding region caused the observed
cytoplasmic staining, due to the lack of potential nuclear
targeting domains, expression of FAA-GFP was monitored
by immunoblotting analysis using a mouse monoclonal antibody directed against GFP. As shown in Fig 3A, in total
cell extracts derived from 293-EBNA cells transfected with
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FAA-GFP LOCALIZES TO THE CYTOPLASM OF 293 CELLS
3291
Fig 2. Fluorescence microscopy of 293-EBNA cells
stably expressing FAA-GFP or GFP. (a through c) The
images obtained with FAA-GFP. The distribution of
GFP is depicted in (d). (b and d) A twofold magnification of the originally recorded image.
pDRFAA-GFP predominantly a GFP-specific band of approximately 190 kD was detected, representing the expected
molecular weight of the complete FAA-GFP fusion protein.
In pDR-GFP transfected cells a band of approximately 30
kD was detected, in agreement with the size of GFP (Fig
3A). The subcellular distribution of FAA was also assessed
by cell fractionation studies in which nuclear and cytoplasmic cell fractions of 293-EBNA cells expressing FAAGFP were analyzed by immunoblotting. As shown in Fig
3B, FAA-GFP was detected in the cytoplasmic fraction only,
whereas GFP alone was found in both subcellular fractions.
Functional analysis of the putative NLS and leucine repeat. The unexpected finding of FAA-GFP being localized
Fig 3. Immunoblotting analysis on total cell extracts (A) or subcellular fractions (B) derived from 293-EBNA cells stably transfected
with FAA-GFP or GFP. The GFP specific bands are indicated by arrowheads; cytoplasmic and nuclear cell fractions are indicated with C
and N, respectively.
to the cytoplasm suggested no function for the putative bipartite NLS and, in addition, made a role for the potential leucine repeat questionable. To examine this notion in more
detail several FAA mutants were generated in which these
putative domains were either deleted or modified by sitedirected mutagenesis. These mutants, which are described
below, were generated both with and without the GFP tag
and tested for their ability to complement the MMC hypersensitivity of HSC72 cells. In addition, the subcellular localization of the GFP tag-containing mutants was examined in
293-EBNA cells. Predicted protein sizes of the various GFP
chimeras were confirmed by immunoblotting, as shown for
several FAA mutants in Fig 4. The results obtained with
these mutants are summarized in Table 1.
First, the relevance of the putative bipartite NLS domain
for FAA function was explored. Active transport of proteins
through nuclear pores has been shown to depend on the
presence of short stretches of basic, positively charged residues in the target protein.23-25 Aside from the well-characterized SV40 Large T nuclear targeting sequence consisting of
seven amino acids, a more complex NLS such as that present
in nucleoplasmin can consist of two clusters of basic amino
acids which are necessary for nuclear import.26 From the
latter one, as well as other bipartite nuclear targeting signals,
a consensus sequence has been derived consisting of two
basic amino acids, a spacer region of any 10 amino acids
and a cluster in which three out of five amino acids must be
basic.27 As shown in Fig 5, in FAA the amino acids present
between 18-35 are in agreement with this consensus. We
deleted this putative domain by making use of the Ava I site
present in the FAA ORF at base pair position 30, relative to
the adenine in the first ATG referred to as base pair position
1. After the digestion with Ava I, filling in the recessive ends
and religation, a frame shift was introduced leading to the
occurrence of a stop codon, TAA at position 105. In this
way an ORF was created which encodes a N-terminal truncated FAA protein starting at methionine 116, named FAAM116. In vitro translation of this modified FAA ORF and
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3292
KRUYT ET AL
Fig 4. Immunoblotting analysis of 293-EBNA cells transfected
with deletion or site-directed mutants of FAA-GFP. The positions of
the GFP fusion protein specific bands are indicated by arrowheads.
See text for a description of the various mutants.
subsequent electrophoresis under denaturating conditions
confirmed the translation of a truncated protein of the expected size (not shown). When stably expressed in HSC72
cells, FAA-M116 with or without the GFP tag failed to
complement hypersensitivity to MMC, indicating that the
115 N-terminal amino acids of FAA are essential for this
function of FAA (see Table 1). Nevertheless, FAA-M116GFP was found to have a similar subcellular distribution
pattern as FAA-GFP. To further scrutinize the relevance of
the putative bipartite NLS, an FAA mutant was generated
in which the arginines at position 18 and 19 were substituted
for neutral leucines in combination with the substitution of
glycine 17 for the acidic residue aspartic acid (see Fig 5).
Disruption of this first basic cluster in the bipartite NLS has
Table 1. Complementing Activity and Subcellular Localization of
Wild-Type FAA and Constructed Mutants
Construct*
pDRFAA
pDRFAA-M116
pDRmNLSFAA
pDRN271-FAA
pDRFAAL3P
pDRFAAL3, 4V
Complementation†
/
0
/
0
0
/
(41.3
(5.9
(41.9
(5.6
(6.1
(54.1
{
{
{
{
{
{
5.2)
1.1)
4.3)
2.1)
2.4)
5.9)
Subcellular Localization
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
Cytoplasm
* Constructs were generated both with and without GFP tag.
† The ability of the constructs to complement MMC-hypersensitivity
in HSC72 cells is indicated with / and lack of complementation by 0.
Numbers are IC50 values in nmol/L MMC including standard deviations
obtained from at least three independent experiments. Results of mutants with and without GFP tag were similar and taken together for
the calculation of averages. Control-transfected HSC72 cells using
pDR2 alone had an average IC50 of 6.2 { 2.2.
Fig 5. Amino acid sequence of the putative bipartite nuclear localization signal (NLS) and leucine repeat found in FAA, and their mutated derivatives. Amino acids that are in agreement with the consensus sequences are indicated with capital letters. In case of the
bipartite NLS, basic residues that fit the consensus best are underlined. Depicted are the amino acid substitutions introduced by sitespecific mutagenesis.
been previously shown to impair nuclear translocation.25,28
When transfected into HSC72 cells, this FAA variant with
a mutated putative NLS, designated mNLS-FAA, was functional in restoring MMC resistance (Table 1). Furthermore,
fluorescence microscopy of this mutant fused to GFP showed
a similar cytoplasmic distribution as found for FAA-GFP
(not shown). Finally, the potential of the bipartite NLS to
translocate a heterologous protein to the nucleus was tested,
a feature that is characteristic for domains that function as
NLS.23 Therefore, the first 271 amino acids of FAA were
fused to GFP, yielding a hybrid protein with a predicted
mass of approximately 60 kD (N271-FAA-GFP), and the
subcellular distribution of the chimera was examined. No
nuclear GFP-based fluorescence could be detected in 293EBNA cells transfected with this construct, thus confirming
that the sequence in FAA resembling a bipartite NLS has
no nuclear targeting activity.
Second, the relevance of the putative leucine repeat motif
was investigated. As depicted in Fig 5, this motif encompasses amino acids 1069-1090 and exists of four leucine
residues spaced by six amino acids, which matches the wellcharacterized leucine repeat consensus present in many transcription factors and known to function as a dimerization
interface.29,30 However, in FAA the presence of a proline at
position 1086, between the third and fourth leucine in the
repeat, casts doubt on its potential function because this
residue is known to distort the putative a helical structure
in the leucine repeat.31,32 To obtain experimental proof for a
putative function of this repeat in FAA, the motif was mutated by substituting the third leucine for a proline and by
replacing the third and fourth for valine residues (Fig 5).
Both mutations have previously been shown to disrupt the
structure and/or function of the repeat.32,33 After transfection
of these mutants into HSC72 cells, named FAA-L3P and
FAA-L3,4V, their ability to complement MMC sensitivity
was determined. As summarized in Table 1, FAA-L3,4V
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FAA-GFP LOCALIZES TO THE CYTOPLASM OF 293 CELLS
3293
However, examination of their subcellular localization in
293 cells showed a similar cytoplasmic distribution pattern
as found with FAA-GFP (Fig 2). In addition, inspection
of the transfected HSC72 cells also failed to show nuclear
accumulation of heterologous NLS-containing FAA-GFP
(not shown). This in contrast to Large T NLS-tagged GFP
alone, which showed the expected enhanced nuclear staining
in 293 cells (compare Fig 2d and Fig 6B), despite its constant
leaking into the cytoplasm because of its relatively small
size. These results indicate that Large T NLS mediated nuclear translocation of FAA in these cells is somehow prevented by yet unknown means. For this reason these experiments provide no further insight on whether the cross-linker
complementation function of FAA is predominantly dependent on its location in the cytoplasmic compartment.
DISCUSSION
Fig 6. MMC complementation and subcellular localization of FAAGFP tagged with the SV40 Large T NLS. (A) MMC survival curve
of FA-A lymphoblasts stably transfected with FAA-GFP tagged with
either a functional (NLS/FAA-GFP) or inactive (mNLS/FAA-GFP)
Large T NLS. As control, FA-A cells transfected with the Large T NLS
fused to GFP (NLS/GFP) were used. (B) Fluorescence microscopy of
293-EBNA cells transfected with NLS/FAA-GFP or NLS/GFP.
had wild-type FAA activity while FAA-L3P was not able to
complement HSC72 cells. The results obtained with FAAL3,4V show that the motif present in FAA is apparently not
functioning as a leucine repeat. However, the finding that
substitution of leucine 1083 for proline impairs the crosslinker complementation function indicates that this domain
somehow contributes to the proper functioning of FAA.
FAA tagging with SV40 Large T NLS fails to induce translocation into the nucleus. To address the question whether
the cytoplasmic localization of FAA is essential for its crosslinker complementation function a similar approach was
used as previously employed to show that FAC exerts this
function in the cytoplasmic compartment only.11 The NLS
motif derived from the SV40 Large T antigen (NLS, MPLLLRLV-EL) was fused to the N-terminus of FAA and the
hybrid ORF either with or without GFP tag was subcloned
in pDR2 . As a control the same construct was made with an
inactivated Large T NLS by substituting lysine at position
128 in the originally described motif for threonine (mNLS,
MP-LTLRLV-EL), known to completely disrupt its nuclear
targetting function.34 Interestingly, stable transfection of
these constructs in HSC72 cells and subsequent testing of
their MMC resistance-conferring potential showed that the
foreign NLS-containing FAA hybrids remained fully functional as shown for the GFP tagged constructs in Fig 6A.
In this study using GFP-tagged FAA protein we have
shown FAA to be primary localized to the cytoplasm
of human 293 cells. Because FAA-GFP was fully functional in complementing MMC-hypersensitivity in FA-A
lymphoblasts, it is unlikely that the GFP tag has caused
mislocalization of the hybrid protein. The possibility that
the level of FAA-GFP expression may have affected the
subcellular localization was not substantiated by the finding
of cytoplasmic staining in both intensly and weakly fluorescent 293-EBNA cells (see also Fig 2). In addition, HSC72
cells that have less intense GFP-based fluorescence as compared with 293 cells due to a relatively weak Rous Sarcoma
Virus (RSV) promoter activity in lymphoblastoid cells
(F.A.E.K., unpublished results, 1996) also showed FAAGFP to reside in the cytoplasmic compartment. Furthermore,
by using a functional FAC-GFP chimera we have confirmed
the cytoplasmic localisation of FAC in living cells (Q.W.,
F.A.E.K., unpublished results, 1996), which was previously
reported in immunofluoresence microscopy studies with rabbit polyclonal antisera against FAC.9,10 This result further
indicates that the GFP tag seems not to affect both the function and subcellular routing of the known FA proteins.
It should be stressed that the subcellular localization experiments described were performed in the absence of exogenously added cross-linking agents. However, experiments
in which various concentrations of MMC were applied for
different periods of time to FAA-GFP expressing cells failed
to alter the subcellular distribution pattern (data not shown).
Although more detailed studies are in progress to examine
possible changes in FAA distribution upon treatment with
various DNA damaging agents and agents that primarily
affect cell-cycle progression, to date we have no evidence
for possible nuclear translocation of FAA upon exposure to
cross-linkers in 293 cells.
The immunoblotting experiments performed in this study
indicate that apparently FAA is not extensively modified or
processed via posttranslational mechanisms. The predicted
molecular weight of the FAA-GFP hybrid in 293 cells
matches well the estimated size of approximately 190 kD
found on immunoblots (Figs 3 and 4). More evidence for
this notion comes from immunoprecipitation experiments on
metabolically labeled COS cells, using a polyclonal antibody
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
3294
raised against the N-terminal part of bacterially expressed
FAA, showing predominantly one specific band representing
nontagged FAA with an estimated size of 165 kD (H.Y.,
manuscript in preparation).
The mutational analysis of FAA performed in this study
showed no function for the putative bipartite NLS and leucine repeat motif, although the portions of FAA that comprise these sequences appeared to contribute to its proper
function. The precise role of these domains remains elusive
until more is known about the molecular function of FAA.
However, the finding that substitition of the third leucine
in the zipper motif for proline inactivated FAA, whereas
substitution of the last two leucines for valine residues had
no effect, may indicate that a helical structures in this part
of FAA are indispensible for its function. In fact, prediction
of the secondary structure confirmed the presence of an a
helical structure between residues 1064 to 1083 that was
unaffected in the L3,4V mutant (not shown). In contrast,
substituting leucine-1083 for proline reduced the length of
the predicted a helix to end at amino acid position 1079 and
enforced the formation of a b sheet, thus pointing to the
importance of protein secondary structure in this region.
For FAC it has been shown that forced translocation into
the nucleus by fusion to the Large T SV40 NLS abolishes
its complementing activity, thus indicating that cytoplasmic
localization is essential for the activity of FAC.11 In this
study a similar approach failed to provide insight on the
subcellular positional requirement for FAA’s complementation function since FAA-GFP could not be forced into the
nucleus by the Large T NLS in the cell lines used (Fig 6). The
mechanism underlying the inability of FAA to be targeted to
the nucleus of these cells remains elusive. Several explanations could account for this phenomenon such as a possible
masking of the NLS due to the structural conformation of
FAA, binding of other factors to FAA that might prevent
entrance into the nucleus, the presence of yet unknown more
powerfull other subcellular routing signals in FAA (eg, nuclear export sequences), or a combination of these possibilities.
The cytoplasmic localization of FAA indicates that both
FA proteins identified so far are localized in the same subcellular compartment. Although direct evidence is currently
lacking, a potential physical interaction between FAC and
FAA seems to be unlikely because FAC has been shown to
interact in vitro predominantly with three cytosolic proteins
with molecular masses of 65, 50, and 35 kD,35 neither of
which equals the molecular weight of the relatively large
FAA protein. Furthermore, the cytoplasmic localization of
the two FA proteins adds up to the notion that FA genes
may not be directly involved in the repair of cross-linked
DNA and suggests the existence of a novel pathway that
confers resistance to cross-linking agents. The recently found
predisposition to apoptosis in FA-C cells induced by crosslinker treatment,4,36 the FAC-mediated suppression of
apoptosis induced by interleukin-3 withdrawal in hematopoietic factor–dependent cell lines,37 as well as the observed
hypersensitivity to g-interferon in murine progenitor cells
obtained from ‘fac knock-out’ mice,38 indicate that the function of FA proteins may relate to apoptosis regulatory mech-
KRUYT ET AL
anisms involving cytokine-dependent signal transduction
pathways. In addition, and based on recent findings,39 these
signaling pathways may be linked to mechanisms that regulate the activity of the cyclinB/cdc2 kinase complex that
controls G2/M cell cycle progression, thereby providing an
explanation for the spontaneous and low-dose cross-linkerinduced G2 delay/arrest observed in FA cells. In these contexts, the cytoplasmic localization of FA proteins identified
so far appears to be consistent with their anti-apoptotic activities. More systematic studies designed to elucidate the molecular function of FA proteins are now required to obtain
more insight on the process(es) affected by mutated FA
genes.
ACKNOWLEDGMENT
We thank Dr Stephen J. Gould for kindly providing the construct
pPTS1- and PST2-GFP, Mark Strunk for performing in vitro translation assays, and Jeroen Beliën for helping with the image processing.
REFERENCES
1. Buchwald M, Joenje H, Auerbach AD: Fanconi anemia, in
Vogelstein B, Kinzler KW (eds): Metabolic and Molecular Basis of
Inherited Disease. New York, NY, McGraw-Hill, 1997
2. Strathdee CA, Buchwald M: Molecular and cell biology of
Fanconi anemia. Am J Ped Hematol Oncol 14:177, 1992
3. Liu JM, Buchwald M, Walsh CE, Young NS: Fanconi anemia
and novel strategies for therapy. Blood 84:3995, 1994
4. Kruyt FAE, Dijkmans L, van den Berg TK, Joenje H: Fanconi
anemia genes act to suppress a p53-independent apoptosis pathway
in lymphoblastoid cell lines. Blood 87:938, 1996
5. Strathdee CA, Duncan AMV, Buchwald M: Evidence for at
least four Fanconi anaemia genes including FACC on chromosome
9. Nature Genet 1:196, 1992
6. Joenje H, Lo Ten Foe JR, Oostra AB, van Berkel CGM, Rooimans MA, Schroeder-Kurth T, Wegner R-D, Gille JJP, Buchwald
M, Arwert F: Classification of Fanconi anemia patients by complementation analysis: Evidence for a fifth genetic subtype. Blood
86:2156, 1995
7. Buchwald M: Complementation groups: One or more per gene?
Nature Genet 11:228, 1995
8. Strathdee CA, Gavish H, Shannon WR, Buchwald M: Cloning
of cDNAs for Fanconi’s anaemia by functional complementation.
Nature 356:763, 1992 (correction, 358:434, 1992)
9. Yamashita T, Barber DL, Zhu Y, Wu N, D’Andrea AD: The
Fanconi anemia polypeptide, FACC, is localized to the cytoplasm.
Proc Natl Acad Sci USA 91:6712, 1994
10. Youssoufian H: Localization of Fanconi anemia C protein to
the cytoplasm of mammalian cells. Proc Natl Acad Sci USA
91:7975, 1994
11. Youssoufian H: Cytoplasmic localization of FAC is essential
for the correction of prerepair defect in Fanconi Anemia group C
cells. J Clin Invest 97:2003, 1996
12. Lo Ten Foe JR, Rooimans MA, Bosnoyan-Collins L, Alon
N, Wijker M, Parker L, Lightfoot J, Carreau M, Callen DF, Savoia
A, Cheng NC, van Berkel CGM, Strunk HP, Gille JJP, Pals G,
Kruyt FAE, Pronk JC, Arwert F, Buchwald M, Joenje H: Expression
cloning of a cDNA for the major Fanconi anemia gene, FAA. Nature
Genet 14:320, 1996
13. The Fanconi anaemia/Breast cancer consortium: Positional
cloning of the Fanconi anaemia group A gene. Nature Genet 14:324,
1996
14. Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC:
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FAA-GFP LOCALIZES TO THE CYTOPLASM OF 293 CELLS
Green fluorescent protein as a marker for gene expression. Science
263:802, 1994
15. Cubitt AB, Heim R, Adams SR, Boydm AE, Gross LA, Tsien
RY: Understanding, improving and using green fluorescent proteins.
Trends Biochem Sci 20:448, 1995
16. Prasher DC: Using GFP to see the light. Trends Genet 11:320,
1995
17. Heim R, Cubitt AB, Tsien RY: Improved green fluorescence.
Nature 373:663, 1995
18. Kalish JE, Keller GA, Morrell JC, Mihalik SJ, Smith B, Cregg
JM, Gould SJ: Characterization of a novel component of the peroxisomal protein import apparatus using fluorescent peroxisomal proteins. EMBO J 15:3275, 1996
19. Duckworth-Rysiecki G, Cornish K, Clarke CA, Buchwald M:
Identification of two complementation groups in Fanconi anemia.
Somat Cell Mol Genet 11:35, 1985
20. Graham FL, Smiley J, Russell WC, Nairn R: Characteristics
of a human cell line transformed by DNA from human adenovirus
type 5. J Gen Virol 36:59, 1977
21. Youssoufian H, Li Y, Martin ME, Buchwald M: Induction of
Fanconi anemia cellular phenotype in human 293 cells by overexpression of a mutant FAC allele. J Clin Invest 97:957, 1996
22. Carey KL, Richards SA, Lounsbury KM, Macara IG: Evidence using a green fluorescent protein-glucocorticoid receptor chimera that the RAN/TC4 GTPase mediates an essential function independent of nuclear protein import. J Cell Biol 133:985, 1996
23. Silver PA: How proteins enter the nucleus. Cell 64:489, 1991
24. Jans DA: Nuclear signalling pathways for polypeptide ligands
and their membrane receptors? FASEB J 8:841, 1994
25. Sweet DJ, Gerace L: Taking from the cytoplasm and giving
to the pore: Soluble transport factors in nuclear protein import.
Trends Cell Biol 5:444, 1995
26. Kleinschmidt JA, Seiter A: Identification of domains involved
in nuclear uptake and histone binding of protein N1 of Xenopus
laevis. EMBO J 7:1605, 1988
27. Dingwall C, Laskey RA: Nuclear targeting sequences—A
consensus? Trends Biochem Sci 16:478, 1991
28. Dingwall C, Robbins J, Dilworth SM, Roberts B, Richardson
3295
WD: The nucleoplasmin nuclear localization sequence is larger and
more complex than that of SV-40 Large T antigen. J Cell Biol
107:841, 1988
29. Landschulz WH, Johnson PF, McKnight SL: The leucine zipper: A hypothetical structure common to a new class of DNA binding
proteins. Science 240:1759, 1988
30. Vinson CR, Sigler PB, McKnight SL: Scissors-grip model
for DNA recognition by a family of leucine zipper proteins. Science
246:911, 1989
31. Chou PY, Fasman GD: Structure and functional role of leucine residues in proteins. J Mol Biol 74:263, 1973
32. Turner R, Tjian R: Leucine repeats and an adjacent DNA
binding domain mediate the formation of functional cFos-cJun
heterodimers. Science 243:1689, 1989
33. Landschulz WH, Johnson PF, McKnight SL: The DNA binding domain of the rat liver nuclear protein C/EBP is bipartite. Science
243:1681, 1989
34. Kalderon D, Richardson WD, Markham AT, Smith AE: Sequence requirements for nuclear location of simian virus 40 Large
T antigen. Nature 311:33, 1984
35. Youssoufian H, Auerbach AD, Verlander PC, Steimle V,
Mach B: Identification of cytosolic proteins that bind to the Fanconi
anemia complementation group C polypeptide in vitro. J Biol Chem
270:9876, 1995
36. Marathi UK, Howell SR, Ashmun RA, Brent TP: The Fanconi
anemia complementation group C protein corrects DNA interstrand
cross-link-specific apoptosis in HSC536N cells. Blood 88:2298,
1996
37. Cumming RC, Liu JM, Youssoufian H, Buchwald M: Suppression of apoptosis in hematopoietic factor-dependent progenitor
cell lines by expression of the FAC gene. Blood 88:4558, 1996
38. Whitney MA, Royle G, Low MJ, Kelly MA, Axthelm MK,
Reifsteck C, Olson S, Braun RE, Heinrich MC, Rathbun K, Bagby
GC, Grompe M: Germ cell defects and hematopoitic hypersensitivity
to gamma-interferon in mice with a targeted disruption of the Fanconi anemia C gene. Blood 88:49, 1996
39. Kruyt FAE, Dijkmans LM, Arwert F, Joenje H: Involvement
of the Fanconi anemia protein FAC in a pathway that signals to the
cyclin B/cdc2 kinase. Cancer Res 57:2244, 1997
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1997 90: 3288-3295
Cytoplasmic Localization of a Functionally Active Fanconi Anemia Group A
−Green Fluorescent Protein Chimera in Human 293 Cells
Frank A.E. Kruyt, Quinten Waisfisz, Lonneke M. Dijkmans, Mario A.J.A. Hermsen, Hagop Youssoufian,
Fré Arwert and Hans Joenje
Updated information and services can be found at:
http://www.bloodjournal.org/content/90/9/3288.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.