This information is current as
of June 16, 2017.
Carcinoembryonic Antigen-Related Cell
Adhesion Molecule 1 Expression and
Signaling in Human, Mouse, and Rat
Leukocytes: Evidence for Replacement of the
Short Cytoplasmic Domain Isoform by
Glycosylphosphatidylinositol-Linked Proteins
in Human Leukocytes
J Immunol 2002; 168:5139-5146; ;
doi: 10.4049/jimmunol.168.10.5139
http://www.jimmunol.org/content/168/10/5139
References
Subscription
Permissions
Email Alerts
This article cites 31 articles, 14 of which you can access for free at:
http://www.jimmunol.org/content/168/10/5139.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2002 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Bernhard B. Singer, Inka Scheffrahn, Robert Heymann,
Kristmundur Sigmundsson, Robert Kammerer and Björn
Öbrink
The Journal of Immunology
Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1
Expression and Signaling in Human, Mouse, and Rat
Leukocytes: Evidence for Replacement of the Short
Cytoplasmic Domain Isoform by
Glycosylphosphatidylinositol-Linked Proteins in
Human Leukocytes1
Bernhard B. Singer,* Inka Scheffrahn,* Robert Heymann,* Kristmundur Sigmundsson,*
Robert Kammerer,†‡ and Björn Öbrink2*
T
he functional activities of leukocytes are governed by a
diversity of cell surface receptors, that in turn are regulated by costimulatory and coinhibitory receptors (1, 2). A
large number of both costimulatory and coinhibitory receptors exist, many of which belong to the Ig superfamily (IgSF).3 One IgSF
*Department of Cell and Molecular Biology, Medical Nobel Institute, Karolinska
Institutet, Stockholm, Sweden; †Tumor Immunology Laboratory, Department of Urology, Klinikum Grosshadern, Ludwig-Maximilians-University, Munich, Germany;
and ‡Institute for Molecular Immunology, GSF National Research Center for the
Environment and Health, Munich, Germany
Received for publication December 14, 2001. Accepted for publication March
5, 2002.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by grants from the Swedish Medical Research Council
(Project 05200), the Swedish Research Council (Project 05200), the Swedish Cancer
Foundation (Project 3957), and Polysackaridforskning AB. B.B.S. and I.S. were supported by fellowships from the Wenner-Gren Foundations.
2
Address correspondence and reprint requests to Dr. Björn Öbrink, Department of
Cell and Molecular Biology, Box 285, Karolinska Institutet, SE-17177 Stockholm,
Sweden. E-mail address: [email protected]
3
Abbreviations used in this paper: IgSF, Ig superfamily; CEA, carcinoembryonic Ag;
CEACAM, CEA-related cell adhesion molecule; PMN, polymorphonuclear neutrophil; Erk, extracellular signal-regulated kinase; MAP, mitogen-activated protein kinase; NEB, New England Biolabs; FP, forward primer; BP, backward primer.
Copyright © 2002 by The American Association of Immunologists
member that is abundantly expressed in leukocytes, as well as in
epithelial and endothelial cells, is the carcinoembryonic Ag
(CEA)-related cell adhesion molecule CEACAM1 (3, 4).
CEACAM1 is a transmembrane signal-regulating glycoprotein
that is the primordial and most well conserved member of the CEA
family. In rats, CEACAM1 is the only cell surface-associated
member of the CEA family, whereas mice in addition have a related gene that codes for CEACAM2, which in comparison with
CEACAM1 makes up a minor component in a limited number of
tissues (5, 6). CEACAM2 is not expressed in leukocytes, and the
CEACAM2 gene does not exist in the human genome (5, 6). In addition to CEACAM1, the human genome contains six CEA-related
genes coding for transmembrane (CEACAM3, CEACAM4) or GPIlinked (CEACAM5, CEACAM6, CEACAM7, CEACAM8) cell surface proteins (3). No GPI-linked proteins belonging to the CEA family occur in rodents (3, 4), a fact that has contributed to the difficulties
in revealing the functions of the GPI-linked CEA family members.
CEACAM1, also known as CD66a, is an important multipotent
signaling molecule (4) that regulates a variety of cellular activities
such as cell proliferation (7), tumor growth (8, 9), apoptosis (10),
angiogenesis (11), T cell cytotoxicity (12), dendritic cell function (13), granulocyte activation (14), and epithelial cell polarization (10). It has been demonstrated that CEACAM1 can act
0022-1767/02/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Carcinoembryonic Ag-related cell adhesion molecule 1 (CEACAM1), the primordial carcinoembryonic Ag gene family member,
is a transmembrane cell adhesion molecule expressed in leukocytes, epithelia, and blood vessel endothelia in humans and rodents.
As a result of differential splicing, CEACAM1 occurs as several isoforms, the two major ones being CEACAM1-L and
CEACAM1-S, that have long (L) or short (S) cytoplasmic domains, respectively. The L:S expression ratios vary in different cells
and tissues. In addition to CEACAM1, human but not rodent cells express GPI-linked CEACAM members (CEACAM5–
CEACAM8). We compared the expression patterns of CEACAM1-L, CEACAM1-S, CEACAM6, and CEACAM8 in purified
populations of neutrophilic granulocytes, B lymphocytes, and T lymphocytes from rats, mice, and humans. Human granulocytes
expressed CEACAM1, CEACAM6, and CEACAM8, whereas human B lymphocytes and T lymphocytes expressed only
CEACAM1 and CEACAM6. Whereas granulocytes, B cells, and T cells from mice and rats expressed both CEACAM1-L and
CEACAM1-S in ratios of 2.2–2.9:1, CEACAM1-S expression was totally lacking in human granulocytes, B cells, and T cells.
Human leukocytes only expressed the L isoforms of CEACAM1. This suggests that the GPI-linked CEACAM members have
functionally replaced CEACAM1-S in human leukocytes. Support for the replacement hypothesis was obtained from experiments
in which the extracellular signal-regulated kinases (Erk)1/2 were activated by anti-CEACAM Abs. Thus, Abs against CEACAM1
activated Erk1/2 in rat granulocytes, but not in human granulocytes. Erk1/2 in human granulocytes could, however, be activated
by Abs against CEACAM8. We demonstrated that CEACAM1 and CEACAM8 are physically associated in human granulocytes.
The CEACAM1/CEACAM8 complex in human cells might accordingly play a similar role as CEACAM1-L/CEACAM1-S dimers
known to occur in rat cells. The Journal of Immunology, 2002, 168: 5139 –5146.
5140
LEUKOCYTE EXPRESSION OF CEACAM1
mAbs (Sixth Leukocyte Typing Workshop, Osaka, Japan) were obtained
from the laboratory of Dr. F. Grunert (University of Freiburg, Freiburg,
Germany): 4/3/17 (specific for CEACAM1/CEA); 12/140/4 (specific for
CEACAM1/CEA); 9A6 (specific for CEACAM6); 47 (specific for
CEACAM8); BEAR1 (specific for CD11b); and MEM48 (specific for CD18).
The CEACAM8-specific mAb 80H3 was from Coulter International (Miami, FL). Human leukocytes do not express CEA (CEACAM5); therefore
the Abs 4/3/17 and 12/140/4 will specifically detect CEACAM1 when
leukocytes are analyzed. Abs were purified from hybridoma supernatants
by affinity chromatography on fast flow protein G-Sepharose (Amersham
Pharmacia Biotech, Uppsala, Sweden). A fraction of the purified Abs was
coupled to biotin using a biotinylation kit according to the manufacturer’s
protocol (Sigma-Aldrich, St. Louis, MO). FITC-labeled mouse anti-human
CD3, rat anti-mouse CD3, hamster anti-rat CD3, mouse anti-human CD19,
rat anti-mouse CD45R/B220, and hamster anti-rat CD45R/B220 Abs were
obtained from BD PharMingen (San Diego, CA). Streptavidin-PE was obtained from DAKO (Copenhagen, Denmark). Abs against phosphorylated,
activated Erk1/2 were obtained from New England Biolabs (NEB).
[␣-32P]dCTP was from Amersham. As cDNA templates for control PCR,
we used pBlueScript plasmids (Stratagene, La Jolla, CA) containing the
complete coding sequences for rat CEACAM1-L (22), rat CEACAM1-S
(22), mouse CEACAM1-L (23), mouse CEACAM1-S (23), and pcDNA/
Neo plasmids (Invitrogen, San Diego, CA) containing the complete coding
sequences for human CEACAM1– 4L (24), human CEACAM1–3L (24),
human CEACAM1– 4S (24), and human CEACAM1–3S (24). The mouse
and human CEACAM1 plasmids were kindly provided by Dr. N. Beauchemin (McGill University, Montreal, Canada) and by Dr. T. Barnett (Bayer
Pharmaceutical Division, Berkeley, CA), respectively.
Materials and Methods
Total RNA was isolated from granulocytes, sorted CD3⫹ T cells, and human CD19⫹ and rodent CD45R/B220⫹ B cells by guanidinium thiocyanate
extraction, using the Qiagen RNAeasy minikit (Qiagen, Valencia, CA).
Samples of RNA in a final volume of 20 ␮l were reverse transcribed by
Moloney murine leukemia virus reverse transcriptase (MBI Fermentas,
Hanover, MD) according to the manufacturer’s recommendation, using the
following oligonucleotide primers that specifically hybridize to the 3⬘ regions of the various CEACAMs: rat CEACAM1, 5⬘-GGCATTGAAGT
TCAG-3⬘; mouse CEACAM1, 5⬘-ACAGTGTATGCGACG-3⬘; human
CEACAM1, 5⬘-GTTGTTTCTGTCCC-3⬘; CEACAM6, 5⬘-CCAGTGGC
TGAGTT-3⬘; CEACAM8, CCAGTGGCTGAGTT-3⬘. The PCR were performed in a total volume of 30 ␮l containing 5 ␮l of first-strand cDNA
Abs and reagents
A hybridoma secreting the rat anti-mouse CEACAM1 mAb AgB10 was
obtained from Drs. N. I. Kuprina and T. D. Rudinskaya (Cancer Research
Center, Moscow, Russia), and the mouse anti-mouse CEACAM1 mAb
CC1 was kindly provided by Dr. K. Holmes (University of Colorado, Denver, CO). The hybridoma secreting the mouse anti-rat CEACAM1 mAb 5.4
was generously provided by Dr. D. Hixson (Rhode Island Hospital, Brown
University, Providence, RI). The mouse mAb 5F4 against human
CEACAM1 was a gift from Dr. R. S. Blumberg (Brigham and Women’s
Hospital, Harvard Medical School, Boston, MA). The following mouse
Isolation of leukocytes from peripheral blood
Leukocytes were prepared from heparinized (5 U heparin/ml) peripheral
blood from healthy donors, from BALB/c mice, and from Lewis rats (obtained from Charles River, Uppsala, Sweden) by sedimentation through
Plasmasteril (Fresenius, Bad Homburg, Germany). PBMC and neutrophilic
granulocytes (polymorphonuclear neutrophils (PMN)) were separated by
centrifugation in Ficoll-Paque (Amersham Pharmacia Biotech). The erythrocytes in the pellet were lysed by repeated suspension in cold 0.2% NaCl
for 20 s followed by washing with PBS. More than 95% of the remaining
cells were PMN as judged from morphological criteria, with a viability of
⬎97% as measured by trypan blue exclusion. The PBMC recovered from
the top of the Ficoll-Paque cushion were separated into lymphocyte subpopulations by single-cell sorting in a FACSCalibur flow cytometer (BD
Biosciences, San Jose, CA). The cells were labeled with anti-CD3-FITC
for T cell sorting and either anti-CD19-FITC (human) or anti-CD45R/
B220-FITC (rat and mouse) for B cell sorting. The purity of the isolated
lymphocyte T and B subpopulations were 87–96% as determined with the
FACSCalibur instrument using CellQuest software (BD Biosciences).
Detection of CEACAM1 by flow cytometry
To analyze the surface expression of CEACAM1 in the different leukocyte
subpopulations, freshly isolated cells were stained with biotinylated antiCEACAM1 Abs (50 ␮g/ml) in PBS containing 3% FCS for 1 h on ice,
followed by washing with ice-cold PBS and incubation with streptavidin-PE at a dilution of 1/40. Background fluorescence was determined
using isotype-matched immunoglobulins instead of specific primary Abs.
Purified granulocytes were measured directly, whereas a two-color flow
cytometric staining of the lymphocytes in the unfractionated PBMCs was
performed. After the CEACAM1 staining, the PBMC were incubated with
anti-CD3-FITC or anti-CD19-FITC or anti-CD45R/B220-FITC according
to the recommendations of the manufacturer. The samples were measured
in a FACSCalibur instrument, and the data were analyzed using CellQuest
software. Dead cells were identified by propidium iodide staining (SigmaAldrich) and were excluded from the determinations.
RT-PCR for different CEACAM molecules
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
as a homophilic cell-cell adhesion molecule, binding to itself (4).
The homophilic interaction represents the only species-independent physiological binding activity of the extracellular domain that
has been unambiguously demonstrated thus far. However,
CEACAM1 also functions as a microbial receptor. Thus, in human
tissues CEACAM1 together with CEACAM3, CEA (CEACAM5),
and CEACAM6 serves as the receptor for Opa protein-expressing
gonococci and meningococci (15), and murine CEACAM1 is the
receptor for mouse hepatitis virus (16). None of these ligands, or
any monoclonal or polyclonal Abs analyzed thus far, cross-reacts
with CEACAM1 from other species. In both rodents and humans,
CEACAM1 is subject to differential splicing. The two major splice
isoforms have four extracellular Ig domains but differ in their
cytoplasmic domain and are denoted CEACAM1-L and
CEACAM1-S, respectively, in which L denotes long and S denotes short (3, 4). The L cytoplasmic domain, which consists of
71- to 73-aa residues, have 2 phosphorylatable tyrosine residues
that can recruit and activate SH2 domain-containing tyrosine kinases (17) and tyrosine phosphatases (18). The interactions with
the tyrosine kinases and tyrosine phosphatases are believed to be
important for the signaling activities of CEACAM1. The S cytoplasmic domain is 10 –12 aa long and lacks phosphorylatable tyrosine residues. Soluble isoforms of CEACAM1 have also been
found. Thus, PC12 cells express and secrete a fully glycosylated
4-Ig domain CEACAM1 lacking the transmembrane portion, due
to an outsplicing of exons 6 and 7 (19).
In many CEACAM1-expressing cell types, which have been
analyzed in depth, it has been found that CEACAM1-L and
CEACAM1-S are coexpressed, although at varying ratios (7, 20).
It has also been demonstrated that both the L and the S isoform can
form dimers (21), which is believed to play an important role in the
signal-regulating activities of CEACAM1 (4, 19). However, it is
not known whether all CEACAM1-expressing cells express both
the L and the S isoforms simultaneously, and under all functional
states. With this in mind and because of the lack of expression of
GPI-linked CEA family proteins in rats and mice, we initiated a
comparative investigation of the expression of the L and S isoforms of CEACAM1 in leukocytes isolated from peripheral blood
of rats, mice, and humans. Here we present data that show significant and striking differences in the CEACAM1 expression patterns in rodent and human leukocytes. Whereas rodent leukocytes
express both the L and the S isoforms of CEACAM1, human leukocytes express only CEACAM1– 4L and CEACAM1–3L, i.e., the
long cytoplasmic domain isoforms having four or three extracellular Ig domains, respectively. The human leukocytes also express
GPI-linked CEACAM8 and/or CEACAM6, which suggests that
the GPI-linked CEA-related molecules may have functionally replaced the short cytoplasmic domains, CEACAM1-S, in these
cells. Furthermore, we demonstrate that CEACAM1 and
CEACAM8 are physically associated in human granulocytes and
that CEACAM1 and CEACAM8 regulate the activation of extracellular signal-regulated kinases (Erk) in rodent and human granulocytes, respectively.
The Journal of Immunology
5141
Immunoblot analysis for CEACAM and activated MAP kinase
Human granulocytes and IL-2-stimulated lymphocytes were solubilized,
immunoprecipitated with mAb 4/3/17, and analyzed for CEACAM1 expression by Western blotting as described in Ref. 25. For immunoblot
analysis of CEACAM1 in rat and mouse cells, 2 ⫻ 106 freshly isolated
granulocytes or lymphocytes were solubilized in 100 ␮l of lysis buffer
containing 1% Triton X-100, 0.1% SDS, 50 mM Tris-HCl (pH 7.5), 5 mM
sodium pyrophosphate, 1 mM EDTA, 1 mM EGTA, 50 mM sodium fluoride, 1 mM PMSF, 10 ␮g/ml leupeptin, 10 ␮g/ml chymostatin, 10 ␮g/ml
pepstatin A, and 1000 kIU/ml Trasylol (aprotinin). After centrifugation for
30 min at 15 000 ⫻ g, the supernatants were incubated overnight at 4°C
with 10 ␮g/ml CEACAM1-specific mAbs (mAb 5.4, mAb CC1). BSAsaturated protein G-Sepharose was then used to collect the immune complexes. After thorough washing, the protein G-Sepharose beads were
boiled for 5 min in 2⫻ SDS sample buffer (250 mM Tris-HCl (pH 6.8), 2%
SDS, 10% glycerol, 0.01% bromphenol blue, 50 mM DL-DTT). The samples were electrophoresed on 8% SDS-polyacrylamide gels and transferred
to polyvinylidene difluoride membrane (Millipore, Bedford, MA). After
blocking of nonspecific binding with 1% skim milk powder in TBS, the
membranes were incubated with primary anti-CEACAM1 Abs (10 ␮g/ml)
and washed twice with TBS containing 0.1% Tween 20 (Merck, Rahway,
NJ). HRP-coupled secondary Abs (DAKO) were added, and the filters
were developed by ECL and documented using the Fuji gel documentation
system.
For determination of activated Erk1/2 kinases, 107 rat or human granulocytes in 100 ␮l were incubated with mAbs (50 ␮g/ml in PBS) against
CEACAM1 (mAb 5.4 for rat CEACAM1 and mAb 4/3/17 or mAb 5F4 for
human CEACAM1), CEACAM6 (mAb 9A6), and CEACAM8 (mAb
80H3), respectively, for 5 min at room temperature. Isotype-matched Igs
and PBS were used as controls. After centrifugation, the cell pellets were
lysed in 50 ␮l of ice-cold 2⫻ SDS sample buffer (see above), sonicated for
10 s, and boiled for 5 min. Twenty microliters of each sample were electrophoresed on 10% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Millipore). After blocking with 5% skim
milk powder in TBS overnight at 4°C, the membranes were incubated with
Abs specific for the phosphorylated form of activated Erk1/2 according to
the manufacturer’s protocol (NEB). After two washings with TBS containing 0.05% Tween 20, the membranes were incubated with HRP-coupled goat anti-rabbit Abs (NEB), developed by ECL, and documented by
the Fuji gel documentation system. Equal loading of samples in the electrophoresis step was checked by Amido Black staining of the membranes.
Sandwich ELISA
Microtiter plates (Nunc, Wiesbaden, Germany) were coated overnight at
4°C with 100 ␮l of solutions of various mAbs (10 ␮g/ml in PBS) of defined
specificities. After being washed and blocked with 300 ␮l of 2% BSA in
PBS, lysates of human granulocytes or HeLa-Neo cells (HeLa cells transfected with the neomycin resistance gene, kindly provided by Dr. F.
Grunert, Department of Immunology, Freiburg University, Freiburg, Germany) were added, and the plates were incubated for 4 h at 4°C and washed
thoroughly. The plates were then incubated with a second set of peroxidase- or biotin-conjugated Abs of defined specificities and were washed
again. For detection of biotinylated Abs, the wells were then incubated
with streptavidin-peroxidase (Pierce, Rockford, IL) and washed. Finally,
peroxidase activity was analyzed using tetramethylbenzidine (Fluka,
Buchs, Switzerland) as substrate. The reaction was stopped with 1 M
H2SO4, and the OD was measured in an ELISA reader (SLT-Spectra,
Salzburg, Austria) at 450 nm.
Results
Leukocyte expression of CEACAM1
Pure populations of PMN and PBMC were isolated from healthy
human donors, rats, and mice. Analysis by flow cytometry showed
that granulocytes, CD3⫹ T cells, human CD19⫹ B cells, and rodent CD45R/B220⫹ B cells expressed significant amounts of
Table I. PCR primers for different CEACAMs
Transcript
Primer
Sequence (5⬘–3⬘)
Position from
ATG
Fragment
Length
(bp)
Ref.
Rat CEACAM1
Rat CEACAM1-L
Rat CEACAM1-S
FP45
BP43
BP42
CTTTGAGCCAGTGACTCAGCCCT
CTGGAGGTTGAGGGTTTGTGCTC
TCAGAAGGACCCAGATCCGCC
1018–1040
1451–1473
1479–1499
456
424
31
31
31
Mouse CEACAM1
Mouse CEACAM1-L
Mouse CEACAM1-S
FP46
BP43
BP44
GCCATGCAGCCTCTAACCCACC
CTGGAGGTTGAGGGTTTGTGCTC
TCAGAAGGAGCCAGACCCGCC
885–906
1490–1512
1460–1480
626
594
23
23
23
Human
Human
Human
Human
Human
FP49
BP60
GCAACAGGACCACAGTCAAGACGA
GTGGTTGGAGACTGAGGGTTTG
BP59
TGGAGTGGTCCTGAGCTGCCG
995–1018
1479–1500
1180–1201
1443–1463
1502–1522
506
207
466
167
24
24
24
24
24
FPCC6
BPCC6
GTTCTTCTACTCGCCCACAAC
CGTTCCTTTTGACGCTGAGTAG
244–264
697–718
474
33
33
FPCC8
BPCC8
ATCTCAGCCCCTTCCTGCAG
CAGTTGTAGCCACGAGGGTC
42–61
213–232
190
32
32
CEACAM1
CEACAM1–4L
CEACAM1-3L
CEACAM1-4S
CEACAM1-3S
Human CEACAM6
Human CEACAM8
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
solution (or plasmid cDNA for human, mouse, or rat CEACAM1-L or
CEACAM1-S), 0.2 mM dNTPs, 3 U of Taq DNA polymerase (Amersham
Pharmacia Biotech), 3 ␮l of 10 ⫻ PCR buffer, and 0.6 ␮M concentrations
of each of the PCR primers. The reactions were initiated by heating the
samples to 94°C for 60 s, followed by 30 cycles at 94°C for 45 s, 64°C for
45 s, and 72°C for 60 s and an extension at 72°C for 10 min. The products
were analyzed on 2.7% agarose gels in Tris-borate-EDTA buffer and visualized by ethidium bromide staining. The relative amounts of the PCR
products were analyzed by scanning the gels and determining the intensities in the ethidium bromide-stained bands with Scan analyses software
(Biosoft, Milltown, NJ). The PCRs were performed with the primer combinations shown in Table I. For CEACAM6 and CEACAM8 amplifications, a single primer set was used for each CEACAM, respectively. For
CEACAM1 amplifications, a common sense primer that recognized both
CEACAM1 splice variants equally well and two antisense primers that
were specific for the two spliced isoforms were used (Table I and Fig. 4A).
The antisense primers for the L isoforms recognized the alternatively
spliced exon 7 present only in CEACAM1-L; the antisense primer for the
S isoform was constructed to anneal across the splice junction between
exon 6 and exon 8. CEACAM1 PCRs were performed both in a conventional way with one sense and one antisense primer and as a triple-primer
PCR in which one sense primer was used together with both antisense
primers selectively recognizing the L and the S isoforms, respectively. To
test the ability of the triple-primer PCR to return correct values of the input
ratios, some PCR were run with cDNA plasmids for rat CEACAM1-L and
CEACAM1-S as templates, and with the addition of [␣-32P]dCTP in the
deoxynucleotide mixture. The PCR products were quantified by cutting out
the ethidium bromide-stained bands and counting in a ␤-scintillation
counter or by analysis of the gels in a PhosphoImager (Molecular Dynamics, Sunnyvale, CA).
5142
LEUKOCYTE EXPRESSION OF CEACAM1
CEACAM1 on their surfaces (Fig. 1). The CEACAM1 expression
in rat, mouse, and human leukocytes was confirmed by Western
blotting, which showed that granulocytes and lymphocytes of both
mouse and rat origin expressed CEACAM1 molecules with identical size, corresponding to an apparent molecular mass of 140 kDa
(Fig. 2). In contrast, human granulocytes and lymphocytes expressed CEACAM1 with different apparent molecular masses, 160
and 140 kDa, respectively, due to differences in glycosylation
(Fig. 2).
Discrimination between L and S isoform expression
FIGURE 1. Cell surface expression of CEACAM1 in granulocytes and
lymphocytes. Neutrophilic granulocytes, B lymphocytes, and T lymphocytes from human, rat, and mouse blood were analyzed for CEACAM1 by
flow cytometry as described in Materials and Methods. Thick lines show
the fluorescence intensity obtained with species-specific anti-CEACAM1
Abs (human, mAb 4/3/17; rat, mAb 5.4; mouse, mAb AgB10). Thin lines
show the background fluorescence obtained with isotype-matched, nonspecific Igs.
FIGURE 2. CEACAM1 expression in rat, mouse, and human granulocytes and lymphocytes. Granulocytes and unfractionated lymphocytes (rats
and mice) or IL-2-stimulated peripheral blood lymphocytes (human) were
solubilized and analyzed for CEACAM1 by Western blotting as described
in Materials and Methods, using mAb 4/3/17, mAb 5.4, and mAb CC1 for
human, rat, and mouse CEACAM1, respectively. Molecular masses in
kilodaltons are shown to the left.
more, determining the ratio of the products by quantifying the
fluorescence signals of the ethidium bromide-stained electrophoresis bands gave values almost identical with the ones determined
from the radioactivity of the separated bands. By applying the
triple-primer PCR assay to reverse transcribed RNA preparations,
we found that granulocytes, B cells, and T cells of rats and mice
expressed both the L and the S isoforms of CEACAM1 (Fig. 4C).
In all of these cell types the L isoform was expressed to a higher
extent than the S isoform, with a L:S ratio of 2.2–2.9. In striking
contrast, however, granulocytes, B lymphocytes, and T lymphocytes from human peripheral blood did not express any trace of the
S isoforms as analyzed by RT-triple primer-PCR (Fig. 5A). This
was confirmed when the PCR was repeated with specific primers
for either the L or the S isoforms (Fig. 5B). Thus, human leukocytes only express the L isoforms (CEACAM1–3L and
CEACAM1– 4L) of CEACAM1.
FIGURE 3. Primer specificity. The ability of the antisense primers specified in Table I to selectively recognize and amplify the L and the S isoforms of CEACAM1 was tested in PCR using cDNAs for the various
isoforms as templates. A, PCR with human CEACAM1 cDNAs used as
templates. The sense primer was FP49. The antisense primers, L and S,
were BP60 and BP59, respectively. B, PCR with mouse CEACAM1 cDNAs
used as templates. The sense primer was FP46. The antisense primers, L and
S, were BP43 and BP44, respectively. C, PCR with rat CEACAM1 cDNAs
used as templates. The sense primer was FP45. The antisense primers, L and
S, were BP43 and BP42, respectively. The size (in base pairs) of oligonucleotide markers is shown on the left.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
The expression ratios of the two isoforms, CEACAM1-L and
CEACAM1-S, were determined by RT-PCR using primers that
could discriminate between the splice variants giving rise to the
long and short cytoplasmic domains, respectively. The specificity
of the primers was tested using full length cDNA for the L and S
isoforms of CEACAM1 from the respective species (Fig. 3). Complete specificity was shown under the conditions used for the PCR,
yielding products of the expected nucleotide lengths. Because human cells express splice variants of CEACAM1 that have either
three or four Ig domains, the PCR primers amplified L and S splice
isoforms of both the three Ig domain isoforms (CEACAM1–3L
and CEACAM1–3S), and the four Ig domain isoforms
(CEACAM1– 4L and CEACAM1– 4S) (Fig. 3A). Mice and rats do
not express the three Ig domain splice variants that lack Ig-domain
4, and therefore only one band for the L isoform and S isoform,
respectively, was amplified by the PCR primers that were used
(Fig. 3, B and C).
A triple-primer PCR procedure was used to produce quantitative
information on the expression ratios of the L and S splice isoforms.
In this procedure, the sense (forward (FP)) primer is common for
the two isoforms, whereas the antisense (backward (BP)) primers
are selective for the L or the S isoform, respectively (Fig. 4A). The
cDNAs of the two isoforms accordingly compete for the sense
primer, which results in a ratio of the products that corresponds to
the input ratios of the templates. By using specified ratios of
CEACAM1-L and CEACAM1-S cDNA as templates and radioactive nucleotide precursors, we could demonstrate that the procedure worked and indeed gave the same ratio of the products as
the ratio of the templates in the input mixture (Fig. 4B). Further-
The Journal of Immunology
5143
Expression of GPI-linked CEACAMs
FIGURE 4. RT-triple primer PCR determination of L and S isoform
ratios of mouse and rat CEACAM1. A, Location of primers used in the
RT-PCR procedures. The RT primers (RT primer-CEACAM1) recognize
sequences present in both the L and the S isoforms, and were used to prime
reverse transcription of both L and S isoforms of CEACAM1. The sense
primers (FP-CEACAM1) used in the PCR recognize both the L and the S
isoforms. The antisense primer, BP-CEACAM1-L, recognizes sequences
in exon 7 and is therefore specific for the L isoforms. The antisense primers, BP-CEACAM1-S, recognize sequences on both sides of the splice
junction between exons 6 and 8 and should therefore be specific for the S
isoforms under appropriate stringency conditions. B, Test of the performance of the triple-primer PCR procedure. Mixtures of defined amounts of
the plasmid cDNAs for rat CEACAM1-L (75 ng) and CEACAM1-S (75
and 100 ng) were used as templates. The oligonucleotides FP45, BP43, and
BP42 (see Table I) were used as primers. Radioactive [␣-32P]dCTP was
added to the deoxynucleotide mixture, and the radioactivity of the PCR
products were determined by PhosphoImager analysis. The data shown in
the figure demonstrate that there was an excellent agreement between the
ratios of the templates in the input mixture and of the formed PCR products. C, RNA isolated from mouse and rat granulocytes, B cells, and T cells
was analyzed by RT-triple-primer PCR using FP46, BP43, BP44, and
FP45, BP43, BP42 as primers, respectively, in the triple-PCR assays. The
ratios between the L and S products were determined by quantitative scanning of the bands in the gels.
It is well documented that human granulocytes express two GPIlinked CEACAM molecules, CEACAM6 and CEACAM8 (14),
but the expression of GPI-linked CEACAM molecules has not
been reported in normal lymphocytes. We therefore analyzed purified populations of human granulocytes, B lymphocytes, and T
lymphocytes for expression of CEACAM6 and CEACAM8 by
RT-PCR. We could confirm the expression of CEACAM6 and
CEACAM8 in granulocytes (Fig. 6). In addition, we found that
both B lymphocytes and T lymphocytes expressed CEACAM6,
whereas no signals were found for CEACAM8 expression in these
cells (Fig. 6).
FIGURE 6. RT-PCR detection of human CEACAM6/CEACAM8.
RNA isolated from human granulocytes, B cells, and T cells was subjected
to RT-PCR to detect expression of CEACAM6 (primer combination
FPCC6/BPCC6) and CEACAM8 (primer combination FPCC8/BPCC8).
Granulocytes expressed both CEACAM6 and CEACAM8, whereas B cells
and T cells only expressed CEACAM6.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 5. RT-PCR detection of human CEACAM1. The size (in base
pairs) of oligonucleotide markers is shown on the left. A, RT-triple-primer
PCR of RNA isolated from human granulocytes, B cells, and T cells. The
oligonucleotides FP49, BP60, and BP59 were used as primers in the PCR.
No products corresponding to CEACAM1– 4S or CEACAM1–3S were detected in any of the different cell types. Only bands corresponding to
CEACAM1– 4L (506 bp) and CEACAM1–3L (207 bp) were amplified.
The weak band of ⬃400 bp is supercoiled CEACAM1– 4L that on reamplification with the same primer set gave a band of 506 bp. B, Regular
RT-PCR of RNA isolated from human granulocytes. The cDNA was amplified by PCR with either FP49 and BP60 (L) or FP49 and BP59 (S) as
primers. The latter primer combination was also used with CEACAM1– 4S
as template, which demonstrated that this primer combination indeed could
amplify a product of 466 bp. Only products corresponding to the L isoforms, but no products corresponding to the S isoforms, were amplified
from the granulocyte RNA.
5144
LEUKOCYTE EXPRESSION OF CEACAM1
CEACAM1 and CEACAM8 are physically associated in human
granulocytes
Discussion
Signaling activities of CEACAM1 in human and rat
granulocytes
CEACAM1 is a signal-regulating cell surface molecule. One of the
pathways that are regulated by CEACAM1 in epithelial cells is
the Erk/MAP kinase pathway (I. Scheffrahn, B. B. Singer, and B.
Öbrink, unpublished observations). We therefore wanted to know
whether the Erk pathway could be influenced by CEACAM molecules also in leukocytes. To that end, we investigated whether
Erk1 and Erk2 could be activated by CEACAM Abs added to
human and rat granulocytes, respectively. The mAb 5.4 against rat
CEACAM1 had a strong activation effect on Erk1/2 in rat granulocytes (Fig. 7), whereas neither mAb 4/3/17 (Fig. 7) nor mAb 5F4
(data not shown) against human CEACAM1 activated Erk1/2 in
human granulocytes. Erk1/2 in human granulocytes could, however, be significantly activated by the mAb 80H3 against
CEACAM8 (Fig. 7). The mAb 9A6 against CEACAM6, in contrast, did not affect Erk1/2 activation differently than the Abs
against CEACAM1 (Fig. 7).
We have analyzed peripheral blood leukocytes of human, mouse,
and rat origins for the expression pattern of CEACAM1 with particular emphasis on the two cytoplasmic domain isoforms,
CEACAM1-L and CEACAM1-S. Granulocytes, B lymphocytes,
and T lymphocytes from all three species expressed significant
amounts of the signaling, long cytoplasmic domain isoforms
CEACAM1-L. The most striking result of the present investigation
was, however, that human granulocytes, B lymphocytes, and T
lymphocytes did not express any detectable amounts of the short
cytoplasmic domain isoforms, CEACAM1-S, whereas this isoform
was significantly expressed in all three cell types both in mice and
rats. This is in contrast to the finding of both the L and the S
isoforms in human T cells of intestinal epithelial origin (26). Thus,
different subpopulations of human T cells may exhibit different
expression patterns with regard to the cytoplasmic domain isoforms of CEACAM1. Another interesting finding was that the expression ratio of the cytoplasmic domain isoforms, CEACAM1L:CEACAM1-S, was 2.2–2.9 in all the rodent leukocytes, which is
Table II. Sandwich ELISA demonstrating complex formation between CEACAM1 and CEACAM8a
OD
Granulocyte lysate
Single Ag or Ag Heterocomplex to
Be Detected
CEACAM1
CEACAM8
CEACAM1/CEACAM8
CD11b/CD18
CD11b/CEACAM8
HeLa-Neo lysate
Dilution
1/20
Dilution
1/10
Dilution
1/10
Ab Combinations
(capturing–detecting)
0.099
0.164
0.137
0.168
0.025
0.253
0.287
0.290
0.258
0.034
0.065
0.024
0.030
0.021
0.016
12/140/4-4/3/17
47-80H3
12/140/4-80H3
BEAR1-MEM48
BEAR1-80H3
a
The sandwich ELISA is described in detail in Materials and Methods. Microtiter plates were coated with capturing Abs. Cell lysates were added, the dishes were washed,
and captured Ags or Ag complexes were quantified by conjugated detecting Abs that were monitored by determination of the OD for the appropriate conjugate reaction. The
tabulated values are means of duplicate determinations. The mAbs that were used had the following specificities: 12/140/4, CEACAM1 and CEA; 4/3/17, CEACAM1 and CEA;
47, CEACAM8; 80H3, CEACAM8; BEAR1, CD11b; MEM48, CD18. CEA is not expressed in granulocytes.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 7. Activation of Erk1/2 in granulocytes. Rat granulocytes
were incubated with Abs against rat CEACAM1 (mAb 5.4), and human
granulocytes were incubated with Abs against human CEACAM1 (mAb
4/3/17), CEACAM6 (mAb 9A6), and CEACAM8 (mAb 80H3), respectively. Control incubations were done with isotype-matched Igs (IgG1) and
PBS. Cell lysates were analyzed by immunoblotting with Abs specifically
recognizing phosphorylated, activated Erk1/2. Equal loading of samples in
the different lanes was confirmed by staining the filters with Amido Black
(not shown).
The finding that Ab perturbation of the GPI-linked CEACAM8
caused activation of Erk1/2 prompted us to investigate whether
CEACAM8 might be associated with CEACAM1, because this
would offer an explanation for the signaling activity of
CEACAM8. To that end, we designed a sandwich ELISA that
could detect bimolecular complexes of membrane-bound proteins.
In this method, a capturing Ab was used to bind one molecular
species to a microtiter plate. A second Ab with a different specificity was then used to detect molecules that were physically associated with the captured protein. Using Abs against different
epitopes in the same molecule, we showed that this sandwich
ELISA could capture and detect both CEACAM1 and CEACAM8
(Table II). Its ability to detect bimolecular complexes was demonstrated for the ␤2 integrin CD11b/CD18, where anti-CD11b was
used as capturing Ab, and anti-CD18 was used as detecting Ab
(Table II). The specificity in detecting bimolecular complexes was
demonstrated using anti-CD11b as capturing Ab and antiCEACAM8 as detecting Ab, which did not give any signal either
in granulocytes or in HeLa-Neo cells. We could then unambiguously demonstrate that CEACAM8 solubilized from human granulocytes was physically associated with CEACAM1, using antiCEACAM1 as capturing Ab and anti-CEACAM8 as detecting Ab
(Table II).
The Journal of Immunology
both rodent and human granulocytes. However, it seems unlikely
that anti-CEACAM Abs are the physiological triggering substances of such signaling. Several different CEACAM molecules
can act as homophilic cell adhesion molecules (4), and therefore it
is possible that CEACAM-mediated signaling activities under
physiological and pathological conditions are triggered by leukocyte adhesive events. This might either be adhesion between different cells or CEACAM-mediated binding of microbes to the cell
surface. However, unactivated leukocytes are nonadhesive cells
that require some kind of activation to become adhesive. This has
clearly been demonstrated for cell surface-exposed integrins that
are inactive in unactivated leukocytes and platelets but become
adhesive when the cells are exposed to various activating agents
(30). A similar situation seems to prevail for the CEACAM proteins. It is a challenge for future work to unravel the mechanisms
of CEACAM activation and the molecular events that trigger
CEACAM-mediated cell signaling.
Acknowledgments
We thank Drs. N. I. Kuprina, T. D. Rudinskaya, D. Hixson, K. Holmes,
F. Grunert, and R. S. Blumberg for their generous gifts of mAbs and Drs.
N. Beauchemin and T. Barnett for CEACAM1 plasmids. We thank MarieLouise Alun, Karin Blomgren, and Ulla Sundberg for their excellent technical assistance in obtaining blood samples from mice, rats, and humans.
References
1. Tsubata, T. 1999. Co-receptors on B lymphocytes. Curr. Opin. Immunol. 11:249.
2. Dustin, M. L., and A. C. Chan. 2000. Signaling takes shape in the immune
system. Cell 103:283.
3. Beauchemin, N., P. Draber, G. Dveksler, P. Gold, S. Gray-Owen, F. Grunert, S.
Hammarström, K. V. Holmes, A. Karlsson, M. Kuroki, et al. 1999. Redefined
nomenclature for members of the carcinoembryonic antigen family. Exp. Cell
Res. 252:243.
4. Öbrink, B. 1997. CEA adhesion molecules: multifunctional proteins with signalregulatory properties. Curr. Opin. Cell Biol. 9:616.
5. Robitaille, J., L. Izzi, E. Daniels, B. Zelus, K. V. Holmes, and N. Beauchemin.
1999. Comparison of expression patterns and cell adhesion properties of the
mouse biliary glycoprotein Bgp1 and Bgp2. Eur. J. Biochem. 264:534.
6. Han, E., D. Phan, P. Lo, M. N. Poy, R. Behringer, S. M. Najjar, and S-H. Lin.
2001. Differences in tissue-specific and embryonic expression of mouse Ceacam1
and Ceacam2 genes. Biochem. J. 355:417.
7. Singer, B. B., I. Scheffran, and B. Öbrink. 2000. The tumor growth- inhibiting
cell adhesion molecule CEACAM1 (C-CAM) is differently expressed in proliferating and quiescent epithelial cells and regulates cell proliferation. Cancer Res.
60:1236.
8. Hsieh, J. T., W. Luo, W. Song, Y. Wang, D. I. Kleinerman, N. T. Van, and S.-H.
Lin. 1995. Tumor suppressive role of an androgen-regulated epithelial cell adhesion molecule (C-CAM) in prostate carcinoma cell revealed by sense and antisense approaches. Cancer Res. 55:190.
9. Kunath, T., C. Ordonez-Garcia, C. Turbide, and N. Beauchemin. 1995. Inhibition
of colonic tumor cell growth by biliary glycoprotein. Oncogene 11:2375.
10. Huang, J., J. D. Hardy, Y. Sun, and J. E. Shively. 1999. Essential role of biliary
glycoprotein (CD66a) in morphogenesis of the human mammary epithelial cell
line MCF10F. J. Cell Sci. 112:4193.
11. Ergün, S., N. Kilik, G. Ziegler, A. Hansen, P. Nollau, J. Götze, J. H. Wurmbach,
A. Horst, J. Weil, M. Fernando, and C. Wagener. 2000. CEA-related cell adhesion molecule 1: a potent angiogenic factor and a major effector of vascular
endothelial growth factor. Mol. Cell 5:311.
12. Morales, V. M., A. Christ, S. M. Watt, H. S. Kim, K. W. Johnson, N. Utku,
A. M. Texieira, A. Mizoguchi, E. Mizoguchi, G. J. Russell, et al. 1999. Regulation of human intestinal intraepithelial lymphocyte cytolytic function by biliary
glycoprotein (CD66a). J. Immunol. 163:1363.
13. Kammerer, R., D. Stober, B. B. Singer, B. Öbrink, and J. Reimann. 2001. Carcinoembryonic antigen-related cell adhesion molecule 1 on murine dendritic cells
is a potent regulator of T cell stimulation. J. Immunol. 166:6537.
14. Skubitz, K. M., K. D. Campbell, and A. P. Skubitz. 1996. CD66a, CD66b,
CD66c, and CD66d each independently stimulate neutrophils. J. Leukocyte Biol.
60:106.
15. Muenzner, P., M. Naumann, T. F. Meyer, and S. D. Gray-Owen. 2001. Pathogenic Neisseria trigger expression of their carcinoembryonic antigen-related cellular adhesion molecule 1 (CEACAM1; previously CD66a) receptor on primary
endothelial cells by activating the immediate early response transcription factor,
nuclear factor-␬B. J. Biol. Chem. 276:24331.
16. Blau, D. M., C. Turbide, M. Tremblay, M. Olson, S. Letourneau, E. Michaliszyn,
S. Jothy, K. V. Holmes, and N. Beauchemin. 2001. Targeted disruption of the
Ceacam1 (MHVR) gene leads to reduced susceptibility of mice to mouse hepatitis virus infection. J. Virol. 75:8173.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
contrasting to the expression ratios in epithelial cells where the
expression of the S isoform always dominates over the L isoform.
The dominant expression of the S isoforms is also seen in human
epithelial cells. Although it is well described that human granulocytes express the two GPI-linked molecules CEACAM6 and
CEACAM8 (14), only one report has described the expression of
GPI-linked CEA-family members in human lymphocytes, but only
in lymphocytes of leukemic origin (27). Our finding is therefore
the first report describing expression of CEACAM6 in normal human adult B and T cells.
CEACAM1-L has signaling or signal-regulating abilities due to
the presence of phosphorylatable tyrosine residues in immunoreceptor tyrosine-based inhibitory motif sequences (4) and immunoreceptor tyrosine-based inhibitory motif-related switch sequences
(28), which can recruit and activate src family kinases or SH2
domain-containing protein tyrosine phosphatases. CEACAM1-S
lacks these tyrosine-containing sequences, but it can regulate the
signaling activities of CEACAM1-L, probably via dimer formation
with the L isoform (4, 19). This raises the question whether
CEACAM1-mediated signaling or signal regulation is different in
human vs rodent leukocytes. In this context, it is interesting that
human cells, in contrast to rodent cells, express several CEACAM
proteins that are associated with the cell surfaces via GPI anchors.
No satisfactory explanation to the functions of these GPI-linked
CEACAM molecular species have been given so far. However, it
has been reported that both CEACAM6 and CEACAM8 can form
complexes with CEACAM1 in human granulocytes (29), and we
demonstrated unambiguously that CEACAM8 is physically associated with CEACAM1 in these cells. Thus, it seems plausible that
these GPI-linked CEACAM proteins have functionally replaced
the short cytoplasmic domain isoform CEACAM1-S in human
leukocytes.
The replacement hypothesis is supported by our demonstration
that the activation of the Erk/MAP kinase pathway could be regulated by CEACAM proteins in granulocytes. In rat granulocytes,
Erk1/2 was strongly activated by an Ab directed against the Nterminal Ig-domain of CEACAM1, which confirmed the signalregulating activity of CEACAM1 in this cell type. However, neither of two different mAbs against the N-terminal Ig-domain of
human CEACAM1 activated Erk1/2 in human granulocytes. This
discrepancy might be due to recognition of different epitopes in
human and rat CEACAM1 by these Abs but could also be due to
participation of CEACAM1-L in different types of complexes in
rat and human granulocytes. The latter possibility is supported by
our finding that Abs against CEACAM8 strongly activated Erk1/2
in human granulocytes. GPI-linked cell surface proteins do not
have any cytoplasmic domains and can therefore trigger transmembrane signals only by complexing with other signaling proteins. Our finding that CEACAM8 occurs in a complex with
CEACAM1 suggests that the signal triggered by perturbation of
CEACAM8 is mediated by CEACAM1-L. Complexes between
CEACAM1-L and CEACAM8 may therefore play a similar role in
transmembrane signaling in human granulocytes as complexes between CEACAM1-L and CEACAM1-S in rat or mouse granulocytes. Interestingly, Abs against CEACAM6 did not cause any
significant activation of Erk1/2, although both CEACAM6 and
CEACAM8 can complex with CEACAM1 in human granulocytes
(28). CEACAM1/CEACAM6 and CEACAM1/CEACAM8 complexes in human granulocytes therefore seem to have different
functions. This suggests that human granulocytes have a more varied repertoire in terms of signal regulation than rodent granulocytes, which lack the GPI-linked CEACAM-molecules.
The activation of Erk1/2 by CEACAM Abs clearly shows that
these cell surface molecules can regulate signaling activities in
5145
5146
26.
27.
28.
29.
30.
31.
32.
33.
family, on human lymphocytes: structure, expression and involvement in T cell
activation. Eur. J. Immunol. 28:3664.
Donda, A., L. Mori, A. Shamshiev, I. Carena, C. Mottet, M. H. Heim,
C. Beglinger, F. Grunert, C. Rochlitz, L. Terracciano, P. Jantscheff, and
G. De Libero. 2000. Locally inducible CD66a (CEACAM1) as an amplifier of the
human intestinal T cell response. Eur. J. Immunol. 30:2593.
Hanenberg, H., M. Baumann, I. Quentin, G. Nagel, H. Grosse-Wilde,
S. von Kleist, U. Göbel, S. Burdach, and F. Grunert. 1994. Expression of the CEA
gene family members NCA-50/90 and NCA-160 (CD66) in childhood acute lymphoblastic leukemias (ALLs) and in cell lines of B-cell origin. Leukemia 8:2127.
Shlapatska, L. M., S. V. Mikhalap, A. G. Berdova, O. M. Zelensky, T. J. Yun,
K. E. Nichols, E. A. Clark, and S. P. Siderenko. 2001. CD150 association with
either the SH2-containing inositol phosphatase or the SH2-containing protein
tyrosine phosphatase is regulated by the adaptor protein SH2D1A. J. Immunol.
166:5480.
Singer, B. B. 1996. Molekulare Organisation von CD66-Molekülen auf neutrophilen Granulozyten. Doctoral dissertation. Albert-Ludwigs-Universität Freiburg,
Freiburg, Germany.
Phillips, D. R., K. S. S. Prasad, J. Manganello, M. Bao, and L. Nannizzi-Alaimo.
2001. Integrin tyrosine phosphorylation in platelet signaling. Curr. Opin. Cell
Biol. 13:546.
Lin, S-H., and G. Guidotti. 1989. Cloning and expression of a cDNA coding for
a rat liver plasma membrane ecto-ATPase. J. Biol. Chem. 264:14408.
Berling, B., F. Kolbinger, F. Grunert, J. A. Thompson, F. Brombacher,
F. Buchegger, S. von Kleist, and W. Zimmermann. 1990. Cloning of a carcinoembryonic antigen gene family member expressed in leukocytes of chronic myeloid leukemia patients and bone marrow. Cancer Res. 50:6534.
Barnett, T., S. J. Goebel, M. A. Nothdurft, and J. J. Elting. 1988. Carcinoembryonic antigen family: characterization of cDNAs coding for NCA and CEA and
suggestion of nonrandom sequence variation in their conserved loop-domains.
Genomics 3:59.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
17. Brümmer, J., M. Neumaier, C. Göpfert, and C. Wagener. 1995. Association of
pp60c-src with biliary glycoprotein (CD66a), an adhesion molecule of the carcinoembryonic antigen family downregulated in colorectal carcinomas. Oncogene
11:1649.
18. Huber, M., L. Izzi, P. Grondin, C. Houde, T. Kunath, A. Veillette, and
N. Beauchemin. 1999. The carboxyl-terminal region of biliary glycoprotein controls its tyrosine phosphorylation and association with protein-tyrosine phosphatases SHP-1 and SHP-2 in epithelial cells. J. Biol. Chem. 274:335.
19. Öbrink, B., H. Sawa, I. Scheffrahn, B. B. Singer, K. Sigmundsson, U. Sundberg,
R. Heymann, N. Beauchemin, G. Weng, P. Ram, and R. Iyengar. 2002. Computational analysis of isoform-specific signal regulation by CEACAM1, a cell adhesion molecule expressed in PC12 cells. Ann. NY Acad. Sci. In press.
20. Baum, O., S. Troll, and D. C. Hixson. 1996. The long and the short isoform of
cell-CAM 105 show variant-specific modifications in adult rat organs. Biochem.
Biophys. Res. Commun. 227:775.
21. Hunter, I., H. Sawa, M. Edlund, and B. Öbrink. 1996. Evidence for regulated
dimerization of cell-cell adhesion molecule (C-CAM) in epithelial cells. Biochem. J. 320:847.
22. Olsson, H., K. Wikström, G. Kjellström, and B. Öbrink. 1995. Cell adhesion
activity of the short cytoplasmic domain isoform of C-CAM (C-CAM2) in CHO
cells. FEBS Lett. 365:51.
23. McCuaig, K., M. Rosenberg, P. Nédellec, C. Turbide, and N. Beauchemin. 1993.
Expression of the Bgp gene and characterization of mouse colon biliary glycoprotein isoforms. Gene 127:173.
24. Barnett, T. R., A. Kretschmer, D. A. Austen, S. J. Goebel, J. T. Hart, J. J. Elting,
and M. E. Kamarck. 1989. Carcinoembryonic antigens: alternative splicing accounts for the multiple mRNAs that code for novel members of the carcinoembryonic antigen family. J. Cell Biol. 108:267.
25. Kammerer, R., S. Hahn, B. B. Singer, J. S. Luo, and S. von Kleist. 1998. Biliary
glycoprotein (CD66a), a cell adhesion molecule of the immunoglobulin super-
LEUKOCYTE EXPRESSION OF CEACAM1